Vol. 59, No. 10

Isolation, Characterization, and Molecular Cloning of a SpecificMycobacterium tuberculosis Antigen Gene: Identification of a

Species-Specific SequenceCARLOS A. PARRA,* LIDA P. LONDONO, PATRICIA DEL PORTILLO, AND MANUEL E. PATARROYO

Instituto de Inmunologia, Hospital San Juan de Dios, Universidad Nacional de Colombia,Carrera 10 Calle 1, Bogota, Colombia

Received 7 December 1990/Accepted 5 July 1991

A rabbit polyclonal antiserum exhibiting a specific recognition pattern for Mycobacterium tuberculosisproteins was used to screen an M. tuberculosis genomic library constructed in the expression vector lambdagtll. One clone, denominated C1:10, expressed M. tuberculosis-specific determinants as part of a large fusionprotein with ,I-galactosidase. The gene for this protein has been sequenced, and it encodes a protein of 134amino acids (13.8 kDa) which did not display significant homology with any of the previously reported proteinsin the data bases. Hybridization studies with restriction fragments of the cloned sequence revealed that it wasnot present in the genomes of related mycobacteria, namely, M. bovis, M. bovis BCG, M. flavescens, M.fortuitum, M. phlei, and M. vaccae. These findings suggest that we have detected a gene, or a fragmenttherefrom, unique for M. tuberculosis whose nucleotide and amino acid sequences could be useful tools in thedesign of an improved vaccine or a diagnostic method of greater accuracy for tuberculosis.

Tuberculosis is a major public health problem in develop-ing countries, where most of the people afflicted by thisdisease are concentrated (40). Efforts to control the diseasehave been mounted from several angles, including vaccina-tion, drug therapy, and early diagnosis. However, tubercu-losis continues to be a major health problem in thesecountries, mainly because of the nonefficacy of the existingvaccine and the increased prevalence of the disease in AIDSpatients.Although Mycobacterium bovis BCG has been widely

used as a vaccine, its protective value in some vaccinationtrials has been disputed (37). The available forms of therapyare satisfactory in controlled situations, but in practice arather high proportion of patients do not comply with therecommended regimens. Furthermore, a number of antibiot-ic-resistant strains are emerging, while alternative medica-tions are not available (27). Finally, a fast, accurate, andinexpensive method to unambiguously diagnose tuberculosisinfections has not yet been developed.Knowledge about the individual bacillary components is a

prerequisite in the search for molecules of potential immu-noprophylactic or immunodiagnostic value. In this context,it is important to find proteins or nucleotide sequencesexclusive to the M. tuberculosis bacilli. Despite the numer-ous approaches to achieve this goal, the primary structure ofmost of the proteins already identified reveals that theycorrespond to heat shock proteins, which are found not onlyin other mycobacteria but also in other prokaryotic andeukaryotic cells (11, 18, 30, 43). In previous publications, wehave reported the identification and isolation of several M.tuberculosis antigenic proteins which were well recognizedby sera from tuberculosis patients (25). The complete aminoacid sequences of some of these antigens have already beendetermined (13, 41).To identify proteins which could be involved in the

particular pathogenic behavior of M. tuberculosis, we have

* Corresponding author.

focused our studies on those proteins exclusively present inM. tuberculosis and not in M. bovis BCG. Here, we describethe results obtained when TB40 serum, a rabbit serum raisedagainst one of these M. tuberculosis-specific proteins, wasused to screen a lambda gtll genomic library.

MATERIALS AND METHODS

Bacterial strains and vectors. The following mycobacterialstrains were obtained from the Trudeau Mycobacterial Col-lection (TMC): M. tuberculosis (TMC 102, strain H37Rv),M. bovis (TMC 410), M. bovis BCG (TMC 1011, substrainPasteur), M. phlei (ATCC 11758), M. vaccae (TMC 1526),M. flavescens (ATCC 14474), and M. fortuitum (TMC 1529).Bacteriophage lambda gtll and Escherichia coli Y1088,Y1089, and Y1090 were provided by Amersham (Amersham,United Kingdom). E. coli DH5a, E. coli XL1-Blue, andphagemid vector Bluescript were purchased from Stratagene(La Jolla, Calif.). M13mpl8 was from Pharmacia (Uppsala,Sweden).

Sonic extracts. Mycobacteria were grown on Sauton'smedium, harvested, and sonicated as described by Janicki etal. (16) with minor modifications. Briefly, the bacilli weresonicated by subjecting them to 15-min pulses in a Bransonsonicator at 0°C, followed by a 5-min rest period betweenpulses, and the process was repeated four times. The soni-cate was then centrifuged at 150,000 x g for 1 h at 4°C. Thesupernatant was removed, and the protein content wasdetermined by the method of Lowry et al. (20). This materialwas stored in aliquots at -70°C until needed.Antiserum and immunological analysis. Polyclonal antisera

raised against purified M. tuberculosis proteins have beenproduced by us and described elsewhere (25). Briefly, 150 ,ugof the MTP40 protein, which had been isolated from poly-acrylamide gels under nonreducing conditions, was mixedvolume for volume with incomplete Freund adjuvant andinjected subcutaneously into rabbits on days 0, 20, and 45.The rabbits were bled on days 30, 45, and 60. The antiserumobtained after this immunization schedule was named TB40

3411

INFECTION AND IMMUNITY, OCt. 1991, p. 3411-34170019-9567/91/103411-07$02.00/0Copyright © 1991, American Society for Microbiology

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

3412 PARRA ET AL.

and tested by immunoelectrophoresis (IE) and crossed im-munoelectrophoresis (CIE) as described by Weeke (38). Todetermine the proteins recognized by the antiserum, thedenatured M. tuberculosis sonic extract was electro-phoresed on a sodium dodecyl sulfate (SDS)-polyacrylamidegel and blotted onto a nitrocellulose membrane (Amersham)as described by Towbin et al. (36). The membrane stripswere incubated with either the preimmune or the hyperim-mune rabbit sera, followed by application of the appropriatesecond antibody and substrate.

Isolation of mycobacterial DNA. DNA was isolated fromboth fast- and slow-growing mycobacteria which were cul-tured in Sauton's medium. After complete growth, thebacteria were harvested and washed three times with 1OxTE (lx TE is 10 mM Tris HCI-1 mM EDTA [pH 8.0]).Washed bacilli were then incubated at 37°C with vigorousagitation for 1.5 h in the presence of lysozyme (2 mg/ml).Bacterial membranes were disrupted by increasing the tem-perature to 65°C and by adding SDS and proteinase K to afinal concentration of 1% and 250 ,ug/ml, respectively.Ninety minutes later, the suspension was adjusted to 0.7 MNaCl; 1/10 volume of a mixture of Cetab (Sigma, St. Louis,Mo.) and NaCl (10% Cetab, 0.7 M NaCI) was then added.Finally, the suspension was incubated once more at 65°C for20 min, and the DNA was extracted from the suspensionwith chloroform-isoamyl alcohol (24:1) and precipitated withisopropanol. The pellet was washed with 70% ethanol andfinally resuspended in TE buffer. The concentration andpurity of the DNA were assessed by standard spectrophoto-metric methods.

Libraries and screening. To obtain the M. tuberculosisgenomic library, 1 ,ug of DNA was digested with EcoRI(Amersham), and the sizes of the released fragments wereestimated by agarose gel electrophoresis by using molecularsize markers. Once the DNA reached an average insert sizeof between 1 and 5 kbp, the enzyme was inactivated. Thedigested DNA was then extracted twice with chloroform-phenol (1:1) and once with chloroform-isoamyl alcohol (24:1). Subsequently, the DNA was precipitated with 2.5 vol-umes of ethanol and the pellet was resuspended in water.Finally, 0.2 ,ug of the digested DNA was ligated to 0.8 ,ugof dephosphorylated EcoRI-digested lambda gtll arms(Promega, Madison, Wis.). The library was packaged inGigapack Gold extracts (Stratagene) and amplified in E. coliY1088.Antibody screening with the polyclonal antiserum was

performed as described previously (15, 42), except thatlambda gtll-infected E. coli Y1090 (5,000 PFU per 150-mm-diameter plate) was seeded on LB plates and incubated at42°C for 7 h. To induce expression of the fusion protein, theplates were overlaid with isopropyl-i-D-thiogalactopyrano-side (IPTG)-saturated filters (Hybond C extra; Amersham)and incubated for 12 h at 37°C. The polyclonal rabbitantiserum TB40 used for the screening was preabsorbed withan E. coli lysate (15) and used at a final dilution of 1:50. Forcolor development, an immunodetection kit from Promegawas used.To obtain the complete mtp4O gene, an enriched library of

M. tuberculosis was constructed by electroeluting BamHI-digested fragments in the range of 3 kbp and subcloning theminto the plasmid Bluescript. E. coli DH5a-competent cellswere transformed with this plasmid. Colony screening wascarried out with a random priming labeled probe as de-scribed by Bululela et al. (3).

Preparation of recombinant lambda gtll lysogens. Coloniesof E. coli Y1089 were lysogenized with the appropriate C1:10

recombinant lambda gtll clone as described by Huynh et al.(15). The fusion protein was analyzed by Western blot(immunoblot).

Probes and hybridization studies. Several restriction endo-nuclease fragments were used as probes in the differenthybridization assays. The fragments were labeled by therandom priming method (10) by use of the Oligolabelling Kitfrom Pharmacia. Southern blots of M. tuberculosis DNAwere performed with genomic mycobacterial DNAs digestedwith different restriction enzymes. A 10-tLg amount of eachdigested DNA was electrophoresed on 1% agarose gels. Theresulting gels were blotted onto Hybond N membranes(Amersham) as recommended by the manufacturer. Thefilters were hybridized with 10 nmol of the random priminglabeled probe per ml (specific activity, 108 cpm/,g of DNAused). Hybridizations were carried out at 65°C for 16 h in amixture composed of 3x SSC, 0.2% bovine serum albumin,0.2% Ficoll, 0.2% polyvinylpyrrolidone, and 0.02 jig oftRNA per ml (lx SSC is 150 mM NaCl plus 15 mM sodiumcitrate [pH 7.0]). The filters were washed at 65°C in asolution containing O.1x SSC. SDS at 0.5% was present inboth hybridization mixtures and washing solutions.DNA sequence and computer analysis. DNA was purified

from recombinant phages as previously described (22).C1:10 clone inserts contained in the EcoRI sites of thelambda gtll vector were sequenced directly (21) by using thepurified C1:10 DNA as a template and the lambda gtllprimers (Boehringer Mannheim). These inserts were alsoreleased and subcloned into the polylinker of the M13mpl8vector which was amplified in E. coli XL1-Blue. DNAsequencing was carried out by the dideoxynucleotide chaintermination method (26) by using modified T7 DNA poly-merase (34) as described in the U.S. Biochemicals sequenc-ing manual on a Sequenase DNA sequencing kit. To obtainthe sequence of the gene, restriction fragments of a 3-kbpBamHI fragment released from the digested M. tuberculosisgenome were subcloned into the polylinker of the plasmidBluescript. In this case, the double-stranded sequencingmethod was used and the plasmid DNA was initially dena-tured by alkali (4). Sequencing reactions were carried outwith a-35S-dATP, and the reaction products were subjectedto electrophoresis in 8% polyacrylamide gels.The DNA sequence data were analyzed by using the

computer programs of Staden (31-33). Computer-aided anal-ysis of the nucleic acid and deduced amino acid sequenceswas performed with the programs of the Genetics ComputerGroup (University of Wisconsin Biotechnology Center,Madison) (8) and GENEPRO.

Nucleotide sequence accession number. The mtp4O genenucleotide sequence has been submitted to GenBank, LosAlamos National Laboratory, under the accession numberM57952.

RESULTS

Specificity of the TB40 antiserum. The specificity of theTB40 antiserum was initially evaluated by IE and CIEagainst protein extracts from M. tuberculosis and M. bovisBCG. The antiserum precipitated antigens only from M.tuberculosis sonic extracts and did not cross-react with anyBCG antigen (Fig. 1A). A single precipitation band wasevidenced when the serum was used in CIE with M. tuber-culosis sonic extracts, as shown in Fig. 1B. Four proteins ofM. tuberculosis sonic extracts with molecular masses of 14,28, 40, and 76 kDa were detected by Western blots with theantiserum (Fig. 1C).

INFECT. IMMUN.

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN 3413

A. A a

X ~t _ f*.

9 :S

431t0iW

SAWJO is

0oAv

.,

c:,

FIG. 1. (A) IE of TB40 antiserum with M. tuberculosis (upperwell) and M. bovis BCG (lower well) sonic extracts. Sonic extract(100 Fg) from each mycobacterium was loaded per well. Undilutedserum (100 ,ul) was used on the central lane. (B) CIE of TB40antiserum against M. tuberculosis. A total of 100 ,ug of mycobacte-rial sonic extract was initially electrophoresed in a 1.0% agarose geland subsequently in a similar gel containing TB40 serum at a 1:50dilution. (C) Reactivity of TB40 serum with M. tuberculosis in aWestern blot assay. Sonic extracts from M. tuberculosis (100 ,ug perlane) were mixed with Laemmli buffer containing 2.5% P-mercap-toethanol, kept at 100°C for 3 min, and loaded on an SDS-10%polyacrylamide gel. The gel was blotted onto a nitrocellulosemembrane, and strips were incubated with a 1:50 dilution of eitherrabbit preimmune serum (lane 1) or hyperimmune serum (lane 2).Goat anti-rabbit alkaline phosphatase conjugate was used as a

second antibody. Molecular weight markers are indicated.

Genomic library and screening. Approximately 200 ,ug ofDNA was recovered from the different mycobacteria used(5). The M. tuberculosis genomic library contained 105PFU/Ig of DNA used. The library was amplified in E. coliY1088 to a final titer of 1011 PFU/ml. The amplified libraryconsisted of 90% recombinants whose DNA insert sizesaveraged between 0.5 and 5 kbp.Four filters, representing a total of 20,000 plaques, were

probed with the polyclonal rabbit TB40 serum. In the firstround of screening, two possible candidates were detected,but, after three consecutive purification rounds, only thestrongest one remained positive. This clone was denomi-nated C1: 10. EcoRI endonuclease restriction analysis of thisclone demonstrated the presence of two inserts, 266 and 350bp long. The total insert size was 610 bp according to adouble digestion with KpnI and SstI (data not shown).Nucleotide sequencing showed a 5' through 3' arrangementof the 266 and 350 inserts in the vector. An EcoRI restrictionsite was found at nucleotide 261.

E. coli Y1089 was lysogenized with the lambda gtll C1:10clone and lysed after induction of the lacZ operon with 10mM IPTG. The resultant protein extract was analyzed byWestern blot. Figure 2 shows that a 130-kDa fusion protein,which contains a foreign polypeptide of approximately 13kDa, was generated. This hybrid protein was visualized bythe binding of either the polyclonal rabbit serum antibodies

I

FIG. 2. Immunobloting analyses from 10% polyacrylamide gelsof lysates from E. coli Y1089 lysogenized with C1:10 clone (lanes 2and 3) or with lambda gtll with no insert (lanes 1 and 4). (A)Incubation with a murine anti-,-galactosidase monoclonal antibody(Promega); (B) incubation with TB40 serum. Molecular weightmarkers are indicated.

or a monoclonal anti-p-galactosidase. The fusion protein wasproduced only after induction of the lacZ operon with IPTG(data not shown).To confirm the actual organization of the 266- and 350-bp

EcoRI fragments in the M. tuberculosis genome, the hybrid-ization pattern of each of these two fragments within thetotal DNA was analyzed. EcoRI and three other differentrestriction enzymes (KpnI, SstI, and BamHI), none of whichhad recognition sites within these two inserts, were used todigest the M. tuberculosis DNA. Southern blots of thedigested DNAs were carried out separately and probed witheach of the two EcoRI fragments in phage clone C1:10. Theprobes hybridized with bands of the same size in the EcoRIdigestion, but very different restriction bands were recog-nized by each probe in the lanes where DNA digested withthe other enzymes had been loaded (data not shown). Theseresults, and the way in which the library was constructed,indicated that these two different segments of the genomehad come together during the cloning process.

Isolation of the gene. Taking into account the fact that an

open reading frame (ORF) was found following the EcoRIsite in the 266-bp insert downstream from the P-galactosi-dase and that no ORF was seen running through the 350-bpinsert, we chose the 266-bp fragment as the probe with whichto screen another enriched M. tuberculosis library in orderto isolate the complete gene. A 3-kbp BamHI fragment ofM.tuberculosis DNA was found to contain the 266-bp insert(Fig. 3 and 4A). An enriched library of this fragment wasconstructed in phagemid Bluescript. A total of 1,000 recom-

I

VOL. 59, 1991

I .. .....

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

3414 PARRA ET AL.

S E SSmE Sa I *-*-a ai -- /OO bp

a HSm

P Sp

a

-IPROBE 206 bpS SI-1 PROBE 266 bp*E 'E

NH StII I I

PROBE 1.! Kbp E E PfOBE 1.5 Kbp

FIG. 3. Restriction map of the 3-kbp region of the M. tuberculosis genome containing the mtp4O gene. Noted segment represents the gene.The upper diagram indicates direction and length of the gene sequence determined. Restriction enzymes: B, BamHI; E, EcoRI; H, HincII;N, NcoI; Nt, NotI; P, PstI; S, SacIl; Sm, SmaI; Sp, SphI; St, StuI. This 3-kbp fragment held no sites for BglII, ClaI, HindIII, KpnI, or

TthlllI enzymes.

binant colonies were screened with the 266-bp probe; theplasmid DNA of several positive colonies was isolated, andthe 3-kbp BamHI insert was cut with different restrictionenzymes. Figure 3 shows the final alignment of the endonu-clease restriction fragments on this 3-kbp BamHI sequence.

Sequence analysis. The sequence of the 266-bp fragment ofclone C1:10, as well as the sequences of its flanking regionsin the chromosome, are shown in Fig. 4. The ORF beginswith an ATG codon at position +1, goes through the ORFpreviously identified in clone C1:10, and finishes 402 nucle-otides downstream, with a TGA codon. The overall G+Cbase composition of the sequence is 62.4%, and there is asignificant preference for the use of C or G in the thirdposition of the codons. Upstream of the coding sequence,

ATTGGTGCGGGCGATTTGCTCGCGCACATGCAAGCAAATCGAACGCCGGGAGATTACCGG 60

GAAATTTCAGCTGCACAGCCCGCT6GAGTCCCGcGGACsGGTGTGGTTTCCTGAGTTG6C 1-0-35

SD G A P S V V P NATCACTGCGGATAGGGCACCCGATAGGGAATGCTCGGcAAC3CGCCGTCGGTGGTTCCCA 160

-10 150

T T L G M H C 6 S F G S A P S N G W L KACACCACGTTAGGGATGCACTGCGGCAGCTTCGGCAGCGCTCCCAGCAACGGGTGGCTCA -40

L 6 L V E F G G V A K L N A E V MS P TAGTTGGGTCTGGTCGAATTCGGTGGAGTCGCAAAGTTGAAcGCTGAGGTCATGTCGCCAA 300

EcoRI

T P S R Q A V IM L G T G T P N R A R I NCCACGCCGTCGCGCCAGGCGGTCATGTTGGGAACCGGCACGCCGAACCGGGCGCSAATCA 360

F N C E V W S N V S E T I S G P R L Y GACTTCAATTGCGAGGTGTGGTCGAACGTGTCGGAGAC,ATCAGCGGGCCGCGGOTGTACG 4:0

E M T M 0 6 T R K P R P S G P R M P P DGCGAAATGACAATGCAGGGAACGCGAAAACCCAGACCGAGCGGACCACGAATGCrACCGG 4Ev

P 6 T A S M L G Tl V T N S P G V P A V PACCCGGGTACTGCGTCGATGTTGGGCACCGTGACGAATTCGCCGGGTGTCCCGpCGETGC 540

EcoRI

W G ACGTGGGGGGCGTGACGTGGTCGAAGAAGCCSCCGTTCTCGTCATAGCTGACGATAAGTGC 600

554

GGTCTTTTCCCACACCGCGGGATTGGACAGCAAGATCCGCAGCSCGTTCACCATGGACAC_G 66:

FIG. 4. Nucleotide sequence and deduced amino acid sequenceof the M. tuberculosis genomic region containing the mtp4O gene.The presumed initiation codon is located at position 150. Theprobable -35 and -10 promoter sequences are underlined, and theputative Shine-Dalgarno (SD) motif is overlined. Stop codon ismarked (*). EcoRI cloning sites are indicated. The repeated aminoacid motif is boxed.

there exist consensus sequences that resemble known bac-terial promoters. At position -35, there is a typical E. colipromoter sequence, TTGGCA. At position -11, there existsa CCGATAG sequence that is similar in six nucleotides to a

well-known B. subtilis promoter. The most probable Shine-Dalgarno sequence is located immediately adjacent to theinitiation codon (-7).The encoded amino acid sequence contains 134 residues.

The predicted molecular mass of the protein is 13 kDa. Thereare two cysteine residues at positions 18 and 74. There is anamino acid motif (MLGX, where X is either T or N),beginning at amino acid residue 1, which is repeated threetimes in the sequence at 54-amino-acid residue intervals(Fig. 4).

Hybridization studies. To establish whether the epitopespecificity of the MTP40 protein observed with the TB40antiserum could also be found at the DNA level, the 266-bpEcoRI fragment was used as a probe in hybridization stud-ies. As is shown in Fig. 5A, the probe hybridized to the M.tuberculosis genome but did not react with another sixmycobacterial genomes, namely, M. bovis, M. bovis BCG,M. phlei, M. vaccae, M. flavescens, and M. fortuitum.Probes constructed with another two restriction fragmentsfrom the cloned 3-kbp genomic fragment (1.1-kbp BamHI-EcoRI fragment and 1.5-kbp EcoRI-BamHI fragment), as

shown in Fig. 3, presented the same hybridization behavior(Fig. 5B and C). Southern blots used for autoradiographs(Fig. 5) were hybridized under low stringency conditions,indicating the exclusive presence of this 266-bp sequence inthe M. tuberculosis genome, which involves its flankingregions as well.The copy number of this 3-kbp DNA fragment within the

M. tuberculosis genome was also studied in similar experi-ments. The M. tuberculosis DNA was digested to comple-tion by restriction enzymes EcoRI, BamHI, PstI, BstEII,and SaclI in independent reactions. Autoradiographs of thehybridizations between the DNA and four different probesfrom the 3-kbp BamHI fragment are shown in Fig. 6. Thehybridization patterns are conserved for all four DNAprobes, even when the sample was treated with restrictionenzymes which have a high cutting frequency in the M.tuberculosis genome (e.g., BstEII and SacIl), suggestingthat there is a single copy of this 3-kbp BamHI fragmentwithin the entire genome.

a

a

INFECT. IMMUN.

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN 3415

.1 4 5 6 SS 9 1E U 2 13 4 -R12 3 4 5 67 #9K 12S3 14 2- 4 S1 7r 9 t it 12 014-

A;C,~,',.iE,&X i:'-E!r 0-

_. :

.. ... ,:A..A.

FIG. 5. Analysis of different mycobacterial genomes for the presence of the mtp4O gene and its flanking regions. DNA from M.tuberculosis (lanes 1 and 2), M. fortuitum (lanes 3 and 4), M. flavescens (lanes 5 and 6), M. vaccae (lanes 7 and 8), M. phlei (lanes 9 and 10),M. bovis (lanes 11 and 12), and M. bovis BCG (lanes 13 and 14) were digested with EcoRI (lanes 1, 3, 5, 7, 9, 11, and 13) or BamHI (lanes2, 4, 6, 8, 10, and 14) restriction enzymes. The digested DNAs were separated by electrophoresis on 1% agarose gels and blotted onto nylonmembranes. Each panel was hybridized under low stringency conditions with the following different random priming labeled probes derivedfrom the 3-kbp cloned fragment: the 266-bp EcoRI fragment (A), the 1.1-kbp EcoRl fragment (B), and the 1.5-kbp EcoRI-BamHI fragment(C).

DISCUSSION

In this article, we describe a rabbit antiserum whichshowed selective recognition of certain M. tuberculosisproteins. When the serum was tested by us in a number ofdifferent immunological assays, including immunodifusion,IE, and Western blot, it failed to recognize, in proteinextracts from atypical mycobacteria, those antigenic deter-minants that it recognized in M. tuberculosis sonic extracts(data not shown). The precipitation band evidenced by CIEwith M. tuberculosis sonic extracts was not detected in M.bovis BCG sonic extracts when the serum was tested with awell-known BCG reference system (7, 24). Considering thiscapacity of TB40 antibodies to recognize epitopes specificfor M. tuberculosis antigens, we chose this serum to probe agenomic library of M. tuberculosis.The screening of 20,000 PFU with the TB40 serum led us

to identify an M. tuberculosis gene, or a fragment therefrom,which is 402 bp long. Its total G+C content and the tendencyto use G or C in the third position of the codons are twofeatures that agree with the results observed in genes ofother mycobacterial antigens (23, 29, 35). Sequence analysisallowed us to identify a putative transcription promoterregion 35 nucleotides upstream from the ATG startingcodon. This sequence resembles an E. coli promoter (14),since it comprises the hexanucleotide TTGGCA with ahomology of 5 of 6 nucleotides to TTGACA. We were unableto identify, at position -10, a sequence similar to a TATAbox, but a 7-nucleotide-long sequence that resembles areported Pribnow box of Bacillus subtilis genes (19) wasfound. These two -10 consensus sequences differ only in thelast nucleotide of the string. There is a T in the B. subtilisgenes while there is a C in the mycobacterial gene. Althoughthe Shine-Dalgarno sequence (28) matches in only threepositions with the traditional Shine-Dalgarno sequencefound in most of the known mycobacterial genes, it is almostidentical to that reported for the 32-kDa protein gene of M.tuberculosis (AGGGAAG, homology of 6 nucleotides toAGGGAAT) (2).The putative methionine initiation codon is located 35

nucleotides downstream from the consensus promoter se-

FIG. 6. Copy number of the mtp4O gene and flanking regions inthe M. tuberculosis genome. The hybridization patterns of differentrestriction fragments from the cloned 3-kbp BamHI fragment are

shown. M. tuberculosis DNA (10 ,ug) was digested with EcoRI (lane1), BamHI (lane 2), PstI (lane 3), SacII (lane 4), and BstEII (lane 5)restriction enzymes and electrophoresed on 1% agarose gels. Gelswere blotted onto nylon membranes and hybridized with fourdifferent probes: 206-bp SacII fragment (A), 266-bp EcoRI fragment(B), 1.1-kbp BamHI-EcoRI fragment (C), and 1.5-kbp EcoRI-BamHI fragment (D).

A 82 3 4 3 4

_ ~~~~~40KbP

-1 23412345wwt;-.s

l:2*'F,8 b ° 3

160

C0D

C 0~~~0.

1 2 3 4 1a 53 4 a

VOL. 59, 1991

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

3416 PARRA ET AL.

quence, and the protein consists of 134 amino acid residues.A motif of four amino acids (MLGX, where X is a T or a P)was found repeated three times within the sequence.A search in the EMBL3 data bank did not show any

significant homology between the gene and other sequencespreviously reported, either at the nucleotide or amino acidlevel. The 266-bp EcoRI fragment was expressed as a fusionprotein in the pGEMEX-1 vector, and the TB40 antiserumrecognized this product. This result confirms that this 266-bpfragment, but not the 350-bp fragment in clone C1:10, isencoding the epitopes recognized by. the TB40 serum in theoriginal screening. Monoclonal antibodies IT-1, IT-7, IT-10,IT-13, IT-15, IT-23, and IT-27 (8a, 8b), raised against otherM. tuberculosis proteins, did not react with this fusionprotein (data not shown), thus confirming the results of thesearch in the data banks.

Considering the TGA codon at position 554 as the stopcodon, the estimated molecular mass of the encoded proteinis 13 kDa. This result does not agree with our expectationssince the serum was initially raised against an M. tubercu-losis protein whose molecular mass was in the range of 40kDa, but it reacted not only against a 14-kDa protein but alsoagainst two other antigens of 28 and 76 kDa. The discrep-ancy observed above could be explained in several ways. Itis possible that we have only sequenced a part of the gene.However, all the available sequence evidence indicates thata complete gene is present in this 600-bp fragment: furtherdownstream of the mentioned TGA stop codon there exist a

TGA codon at position 589 and a TAA codon at position 595which could function as alternative stop codons. Moreover,there are two stop codons located upstream from the initia-tion site, ruling out the possibility of promoters differentfrom the ones we have found. It is also possible that theapparent molecular weight of the native protein, inoculatedunder nondenaturing conditions, differed from that definedby the antiserum in immunoblots of reduced, denaturedsonicate (Fig. 1C). Alternatively, the detected protein mayshare immunogenic determinants with the initially inocu-lated product. Studies are presently being conducted in our

laboratory to explain this result.Hybridization studies suggest that the mtp4O gene is

unique to the M. tuberculosis genome. The fact that underlow-stringency conditions the probes derived from its flank-ing segments did not hybridize with other mycobacterialgenomes rules out the presence of homologous regions to thecloned 3-kbp gerlomic region in the tested samples. Re-cently, the synthesis of two oligonucleotide probes repre-senting the 5' and 3' ends of the gene has allowed us toconfirm the exclusive presence of this gene in the M.tuberculosis genome. The gene could be amplified by poly-merase chain reaction only from M. tuberculosis strains(H37Rv and H37Ra) and not from M. leprae, M. smegmatis,or M. bovis BCG Pasteur (7a).The use of nucleic acid probes for the diagnosis of

infectious diseases has increased during the last severalyears. Such probes must be very specific for a particularpathogenic species, thereby allowing its use to differentiaterapidly between pathogenic and nonpathogenic species orbetween virulent and avirulent strains, as exemplified bystudies in Leishmania species (39). The search for suchspecific sequences in mycobacteria has recently been suc-cessful in the case of M. leprae (1, 6, 12). One of thesesequences has been found to be repeated at least 18 times inthe bacillus genome. Recently, Shinnick et al. (30) discussedthe potential use of specific rDNA sequences in the diagnosisof tuberculosis. However, to our knowledge, the sequence

described here is unique and is the first exclusive codingsequence reported for M. tuberculosis.The strong humoral and cellular responses to synthetic

peptides derived from this protein in both tuberculosispatients and household contacts (9) suggest the presence ofimportant T- and B-cell epitopes within this antigen. Fromthe data presented here, we conclude that we have cloned agene, or a fragment of a larger gene, denominated mtp4O,which could be a promising tool for use in the design of animproved tuberculosis vaccine.

ACKNOWLEDGMENTS

We thank George Widera, Al Remtulla, Nina Agadian, and JohnZabriskie for helpful discussion of the manuscript, Juan Rodriguez,Marcela Rodriguez, and Clemencia Pinilla for providing assistance,and William R. Jacobs, Jr., for kindly providing the M. tuberculosis,M. bovis BCG, M. smegmatis, and M. leprae DNAs.

This research was supported by the Presidency of the Republic ofColombia, the Colombian Ministry of Public Health, and the Ger-man Leprosy Relief Association.

REFERENCES1. Booth, R. J., D. P. Harris, J. M. Love, and J. D. Watson. 1988.

Antigenic proteins of Mycobacterium leprae: complete se-quence of the gene for the 18-kDa protein. J. Immunol. 140:597-601.

2. Borremans, M., L. De Wit, G. Volckaert, J. Ooms, J. De Bruyn,K. Huygen, J.-P. Van Vooren, M. Stelandre, R. Verhofstadt, andJ. Content. 1989. Cloning, sequence determination, and expres-sion of a 32-kilodalton-protein gene of Mycobacterium tubercu-losis. Infect. Immun. 57:3123-3130.

3. Bululela, L., A. Foster, T. Bochm, and T. H. Rabbitts. 1989. Arapid procedure for colony screening using nylon filters. NucleicAcids Res. 17:452.

4. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: a

fast, simple method for sequencing plasmid DNA. DNA 4:165-170.

5. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A species-specific repetitive sequence in M. leprae DNA. J. Infect. Dis.159:7-15.

6. Clark-Curtiss, J. E., W. R. Jacobs, M. A. Docherty, L. R.Ritchie, and R. Curtiss. 1985. Molecular analysis of DNA andconstruction of genomic libraries of Mycobacterium leprae. J.Bacteriol. 161:1093-1102.

7. Closs, O., M. Harboe, N. H. Axelsen-Chistensen, and M. Mag-nussen. 1980. The antigens of Mycobacterium bovis, strainBCG, studied by crossed-immunoelectrophoresis: a referencesystem. Scand. J. Immunol. 12:249-264.

7a.Del Portillo, P., L. A. Murillo, and M. E. Patarroyo. 1991.Amplification of a species-specific DNA fragment of Mycobac-terium tuberculosis and its possible use in diagnosis. J. Clin.Microbiol. 29:2163-2168.

8. Devereux, J. R., P. Haeberli, and 0. Smithies. 1984. A compre-hensive set of sequence analysis programs for the VAX. NucleicAcids Res. 12:387-395.

8a.Engers, H. D., et al. 1985. Letter. Infect. Immun. 48:603-605.8b.Engers, H. D., et al. 1986. Letter. Infect. Immun. 51:718-720.9. Falla, J. C., C. A. Parra, M. Mendoza, L. C. Franco, F.

Guzman, J. Forero, 0. Orozco, and M. E. Patarroyo. 1991.Identification of B- and T-cell epitopes within the MTP40protein of Mycobacterium tuberculosis and their correlationwith the disease course. Infect. Immun. 59:2265-2273.

10. Feinberg, A. P., and R. Vogelstein. 1983. A technique forradiolabelling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 132:6-13.

11. Garsia, R. J., L. Hellqvist, R. J. Booth, A. J. Radford, W. J.Britton, L. Astbury, R. J. Trent, and A. Basten. 1989. Homologyof the 70-kilodalton antigens from Mycobacterium leprae andMycobacterium bovis with the Mycobacterium tuberculosis71-kilodalton antigen and with the conserved heat shock protein70 of eukaryotes. Infect. Immun. 57:204-212.

INFECT. IMMUN.

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

CLONING OF A SPECIFIC M. TUBERCULOSIS ANTIGEN 3417

12. Grosskinsky, C. M., W. R. Jacobs, J. E. Clark-Curtiss, and B. R.Bloom. 1989. Genetic relationships among Mycobacterium lep-rae, Mycobacterium tuberculosis, and candidate leprosy vac-cine strains determined by DNA hybridization: identification ofan M. leprae-specific repetitive sequence. Infect. Immun. 57:1535-1541.

13. Harboe, M., S. Nagai, M. E. Patarroyo, M. L. Torres, C.Ramirez, and N. Cruz. 1986. Properties of proteins MPB64,MPB70, and MPB80 of Mycobacterium bovis BCG. Infect.Immun. 52:293-302.

14. Hawley, D. K., and W. R. McClure. 1983. Compilation andanalysis of E. coli promoter DNA sequences. Nucleic AcidsRes. 11:2237-2255.

15. Huynh, T. V., R. A. Young, and R. W. Davis. 1985. Constructingand screening libraries in lambda gtlO and lambda gtll, p. 49. InD. M. Glover (ed.), DNA cloning: a practical approach, vol. 1.IRL Press, Oxford.

16. Janicki, B. W., G. L. Wright, R. C. Good, and S. D. Chaparas.1976. Comparison of antigens in sonic and pressure cell extractsof Mycobacterium tuberculosis. Infect. Immun. 13:425-437.

17. Kohne, D., J. Hogan, V. Jones, E. Dean, and T. H. Adams. 1986.Novel approach for rapid and sensitive detection of microorgan-isms: DNA probes to rRNA, p. 110-112. In L. Lieve (ed.),Microbiology-1986. American Society for Microbiology,Washington, D.C.

18. Lathigra, R. B., D. B. Young, D. Sweetser, and R. A. Young.1988. A gene from Mycobacterium tuberculosis which is homol-ogous to the DnaJ heat shock protein of E. coli. Nucleic AcidsRes. 16:1636.

19. Losick, R., and J. Pero. 1981. Cascades of sigma factors. Cell25:582-584.

20. Lowry, 0. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall.1951. Protein measurement with the Folin phenol reagent. J.Biol. Chem. 193:265-275.

21. Manfioletti, G., and C. Schneider. 1988. A new and fast methodfor preparing high quality lambda DNA suitable for sequencing.Nucleic Acids Res. 16:2873-2885.

22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

23. Matsuo, K., R. Yamaguchi, A. Yamazaki, H. Tasaka, and T.Yamada. 1988. Cloning and expression of the Mycobacteriumbovis BCG gene for extracellular alpha-antigen. J. Bacteriol.170:3847-3854.

24. Patarroyo, M. E., C. Parra, C. Pinilla, P. del Portillo, D. Lozada,M. Oramas, M. Torres, P. Clavoo, C. Ramirez, N. Fajardo, N.Cruz, and C. Jimenez. 1986. Immunogenic synthetic peptidesagainst Mycobacterium tuberculosis, p. 219. In F. Brown et al.(ed.), Vaccines 86: new approaches to immunization. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

25. Patarroyo, M. E., C. A. Parra, C. Pinilla, P. del Portillo, M. L.Torres, P. Clavijo, L. M. Salazar, and C. Jimenez. 1986.Immunogenic synthetic peptides against mycobacteria of poten-tial immunodiagnostic and immunoprophylactic value. Lepr.Rev. 57(Suppl. 2):163-168.

26. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.

USA 74:5463-5467.27. Sensi, P. 1989. Approaches to the development of new antitu-

berculosis drugs. Rev. Infect. Dis. 11(Suppl. 2):S467.28. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence of

Escherichia coli 16S ribosomal RNA: complementary to non-sense triplets and ribosome binding sites. Proc. Natl. Acad. Sci.USA 71:1342-1346.

29. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacte-rium tuberculosis. J. Bacteriol. 169:1080-1088.

30. Shinnick, T. M., M. H. Vodkin, and J. C. Williams. 1988. TheMycobacterium tuberculosis 65-kilodalton antigen is a heatshock protein which corresponds to common antigen and to theEscherichia coli GroEL protein. Infect. Immun. 56:446-451.

31. Staden, R. 1982. Automation of the computer handling of the gelreading data produced by the shotgun method ofDNA sequenc-ing. Nucleic Acids Res. 10:4731-4751.

32. Staden, R. 1984. Graphic methods to determine the function ofnucleic acid sequences. Nucleic Acids Res. 12:521-538.

33. Staden, R. 1982. An interactive graphics program for comparingand aligning nucleic acid and amino acid sequences. NucleicAcids Res. 10:2951-2961.

34. Tabor, S., and C. C. Richardson. 1987. DNA sequence analysiswith a modified bacteriophage T7 DNA polymerase. Proc. Natl.Acad. Sci. USA 84:4767-4771.

35. Thole, J. E. R., W. J. Keulen, A. H. J. Kolk, D. G. Groothuis,L. G. Berwald, R. H. Tiesjema, and J. D. A. van Embden. 1987.Characterization, sequence determination, and immunogenicityof a 64-kilodalton protein of Mycobacterium bovis BCG ex-pressed in Escherichia coli K-12. Infect. Immun. 55:1466-1475.

36. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretictransfer of proteins from polyacrylamide gels to nitrocellulosesheets: procedure and some applications. Proc. Nati. Acad. Sci.USA 76:4350-4354.

37. Tuberculosis Prevention Trial, Madras. 1979. Trial of BCGvaccines in South India for tuberculosis prevention. Indian J.Med. Res. 72:349-363.

38. Weeke, B. 1973. Rocket immunoelectrophoresis, p. 37. In N. H.Axelsen, J. Kroll, and B. Weeke (ed.), A manual of quantitativeimmunoelectrophoresis, methods and applications. Univer-sitetsforlaget, Oslo.

39. Wirth, D. F., and D. M. Pratt. 1982. Rapid identification ofLeishmania species by hybridization of kinetoplast DNA incutaneous lesions. Proc. Natl. Acad. Sci. USA 79:6999-7003.

40. World Health Organization. 1982. Tuberculosis control. Tech-nical Report Series vol. 671, p. 1.

41. Yamaguchi, R., K. Matsuo, A. Yamazaki, C. Abe, S. Nagai, K.Terasaka, and T. Yamada. 1989. Cloning and characterization ofthe gene for the immunogenic protein MPB64 ofMycobacteriumbovis BCG. Infect. Immun. 57:283-288.

42. Young, D., R. Lathigra, R. Hendrix, D. Sweetser, and R. A.Young. 1988. Stress proteins are immune targets in leprosy andtuberculosis. Proc. Natl. Acad. Sci. USA 85:4267-4270.

43. Young, R. A., B. R. Bloom, C. M. Grosskinsky, J. Ivanji, D.Thomas, and R. W. Davis. 1985. Dissection of Mycobacteriumtuberculosis antigens using recombinant DNA. Proc. Natl.Acad. Sci. USA 82:2583-2587.

VOL. 59, 1991

on June 18, 2018 by guesthttp://iai.asm

.org/D

ownloaded from