IP, the FDA, and the Startup

Vern Norviel

Partner, Wilson Sonsini Goodrich & Rosati

The way to get good ideas is to get lots of ideas and throw the bad ones away –

Linus Pauling

Agenda

• Objectives of an IP Program in a Startup Company– Financing

• Forms of IP Protection- Balancing FDA protection and patent protection

• How the idea gets into the company

• Cutting Edge IP Issues

• Changes coming up in US patent law

• Q/A

Introduction

• Started at Chevron 1985

• Partner at Townsend and Townsend 1985-1994

• Early employee and GC of Affymetrix 1994-2002

• Early employee and GC of Perlegen 2002-2003

• Partner at WSGR 2003– Leads the Patents and Innovation

Strategies Group

Objectives of an IP Program in a Startup

• The FIRST objective should be to SET objectives

• Possible priorities– Make sure others cannot patent your

ideas– Develop a portfolio as a “trading card”

when, e.g. Pfizer comes calling after you are successful

– Stop others Two levels- clinical data vs the

field– Simply ensure freedom to operate via

FTO studies

Typical Start-Up Biotech/Pharma Objectives

• GUARANTEE Freedom to operate vs the entire world

• GURANTEE to stop competitors in the entire field

• AT LEAST have patent protection sufficiently broad to protect against data certification

• OR at a minimum have data exclusivity• Maybe or maybe NOT

– Minimize cost– Develop a broad portfolio

(not necessarily covering our products) as a trading card deck

• Secure Financing

An editorial commentary: Current Startup Financing Market

• Worst IPO Market Ever? In the third quarter of 2008, venture-backed companies generated just $4.57 billion in liquidity through initial public offerings (IPOs) and mergers and acquisitions (M&As), down 66% from the $13.4 billion generated in the third quarter of 2007. (www.venturecapital.dowjones.com)

• About $551 million raised via seven IPOs as of September 2008, thus on pace to be the worst year on record in terms of both number of IPOs and liquidity generated via IPO.

• Startup Funding Steady? A study by the Center for Venture Research at the University of New Hampshire put total angel investment in the first half of 2008 at $12.4 billion, 4.2 percent higher than the first half of 2007. (“Angel Investors Fly Steady,” Red Herring, October 10, 2008)

New Venture Capital Financing by Sector*

*Source: Venturedeal.com

So financing is still possible, and a key is to protect the inventions…

Forms of Protection Used

• Most companies use ALL forms of protection, to some greater or lesser degree

• The types are:– Patents– Copyrights– Trade Secrets– Trademark– FDA exclusivity

• Patents are arguably the most important form of IP for a biotech/pharmaceutical company

What is a Patent?

• A patent conveys the right to exclude others from making, using or selling the claimed invention for the term of the patent

• Does not mean your are free of the patents of others

• Term: 20 years (roughly)

• Patents are issued by individual countries Enforcement is limited to within country’s borders

• A competitor can be stopped, even if they come up with the idea later, but independently

In other words, we (the government) will make a “DEAL”

• In exchange for telling the world about your idea (rather than keeping it a secret), we (the government) will let you keep other people from using your idea it for a “brief” period of time

What can you Patent?

• ANYTHING! (well, almost...)Devices, compositions, methods, kits, software,

business models

Requirements for Patentability

• New

• Useful

• “Nonobvious” Obviousness is a function of time Early filing reduces the amount of prior art

• You must describe to the world how to make/use the invention

• You must tell the world the BEST way to make/use your invention

Obviousness

• General standard: To be obvious the references must have every element of an invention, plus some reasoned basis for combining the references

• SO– If one paper teaches glass bulbs– And another paper teaches inert gas– And another teaches wires– BUT there is no reasoned basis to combine

them, you can patent the light bulb

Preserving Patent Rights

• “Absolute” novelty required outside the U.S. You cannot publicly talk about something prior to patent filing-

this ends up being the actual rule

• But, even if you have, you have 1 year in the US

• Get applications on file before public disclosures, publications, offers for sale

Patents can be filed in a manner that will not hold you up

Don’t forget that investors will not sign an NDA

Elements of a Patent

• Background

• Summary of the Invention

• Specification: Enablement and Best Mode– Basically a decent scientific paper

• Drawings

• CLAIMS

• Abstract

Another form of protection- FDA exclusivity

• IF the molecule has never been approved before, others cannot use your clinical data- they must run a new clinical trial, e.g for a new indication

• But, – The protection is only 5 yrs (10 years in EP)– Someone can use the SAME molecule absent a

patent, but they must just run their own trial

• Note: IT’S FREE (compared to a patent)!

One important thing to note about this complex process

• Lots of lawyers are involved.

• THEREFORE, it is expensive!!!!

Why do people spend the $$$$ on IP?Because it can be worth it.

Interaction of the FDA and the patent process

• Major fact: It normally costs huge huge sums of money to perform a clinical trial SO DEPENDING ON THE BUSINESS MODEL, there are three levels of protection for drugs/devices

– FDA exclusivity for the molecule MAY be enough, i.e. the market allows for competitors that also have to run clinical trials

Consequence: Narrower patents are acceptable, and “safer”

– But even in these cases, a patent may have longer life, so they are often desirable

– If the business model requires you must own the space- You must have a BROAD patent, eg. All regulation of a gene

Possible Company types

• A “new” molecule that was known for a hundred years, but never was approved as a drug. No patents, 5 yrs of data exclusivity

– Perhaps with a method patent to at least prevent approval for the SAME indication

• A “new” molecule that has both patent and data exclusivity– Patent could be broad, and cover the whole class of

molecules, or a silver bullet

• A new target/indication that uses an old molecule and has a patent on the METHOD

– Drug partners do not like this– If the molecule is not otherwise sold at generic prices it

may in fact be ok however,

Where did the IP come from?

• Be very careful of founders with former employers--- i.e. all founders need to be aware of their prior contracts

• Obviously many companies start from a university license– Most “big” universities are “easy” to deal with

Standard terms Quick turnaround Realistic about the world

– Other academics can be tougher, largely by inexperience

• Don’t try to avoid these issues. It is harder to solve prior employer issues later when you have a valuable business that when you have nothing

– It is very uncomfortable to resolve this as part of a financing– Virtually all VCs and underwriters will probe this issue

Company Process Issues

• During fund raising– File before you talk to VC’s; they will rarely sign an NDA– File provisionals before you talk with the VCs– Get consulting agreements, employment agreements with those involved

• After fund raising, and early on– No employee or consultant without an agreement– Make invention disclosure process routine– Patent committee at an early date– NDAs with collaborators/suppliers........– Review process for technical papers– Lab notebooks and process around them

Freedom to Operate (FTO)

• A study to determine if you infringe the patents of others

• Tech– Usually just a check of direct competitor patents before the fund

raising or as part of diligence

• Biotech– You really must KNOW if there are issues– If you don’t do it, the investors will– Usually a very expensive process– Involves looking at every patent in your area. As well as

“background” technologies. Often thousands of patents to review

The Venture Capital Process

• As part of a financing from Angels, diligence may be minimal

– But, it is better to be prepared, and appear to know your field

• As part of a larger Series A– The VC will often hire a diligence firm

– They will look at Whether you can get good patents

Documentation issues

Whether you have freedom to operate– Often better to know where you stand before they

are involved

– Sometimes this results in buying good patents

“Burning” Issues

• At their heart, all of the burning issues are asking the question

– “Is society better off by giving a broad patent and allowing one

company to control an area (but likely leaving it well funded), or

better off allowing a lot of people in the area and allowing more (but perhaps not well funded) research”

• EG. Assume you invented aspirin and it was the first pain reliever. Should you be entitled to a patent on a) aspirin, or b) ALL pain relievers

Some “Burning” Issues

• Genes- Utility– GATCTACCATGAAAGACTTGTGAATGCTGGTGCC

CAGAGTGGGATTTCGGGATT

• Should someone be entitled to a patent on this string of letters after running a DNA sequencer???

• Answer: No, UNLESS– You have discovered a credible, significant utility for

this string of letters.– Let’s say, you discovered this is the gene that

causes macular degeneration

Let say you DO know what the function of this string of letters

• A little about the drug development process– Often people find a gene’s function, make mouse models

of the gene, etc.– THEN, they do things like make antibodies to it, develop

DNA tests, and SCREEN FOR SMALL MOLECULES– This is pretty darn hard

• What can you get a patent on?– In the US and EP, probably the dna, the diagnostics, the

protein, antibody therapeutics, methods of conducting assays with the gene….

– But what about small molecules that interact with this gene?????- Probably NOT

But what about those methods of conducting assays?

• Lets say you get a claim like: “A small molecule drug discovered by the process of conducting assays on the above gene”

• That would probably be a really valuable thing.

• BUT, the courts are saying you can’t get that patent now, because you didn’t describe WHAT THOSE SMALL MOLECULES WERE

– (University of Rochester v. Searle)

Clinical Trial Exemption

• General law- You can use a patented compound in preparing data for a clinical trial

– But, how far back does this go?– Merck v Integra- pretty far back! ANYTHING used in

development of data for a clinical trial, eg small molecule libraries

In this case, a patented molecule was being used with others to explore new molecules that might work in cancer (RGD peptides)

But NOT research tools- at least for now This could have a huge impact on “tools” companies if a

future decision goes the other way

Changes in the US? - Big changes coming?

• The outcome is VERY uncertain, but we may see the first major changes in the patent system since 1952

• First to file/first to invent– Now: whoever INVENTS first gets the patent (in theory). In

Europe, whoever FILES first gets the patent– The US has been off base on this with respect to other countries– The law may be changed to provide for the first filing, much like

Europe– May avoid long and expensive miniature lawsuits called an

“interference”

Changes? (cont)

• Oppositions?– In Europe, after a patent is allowed it can be “opposed”

based on art the examiner did not find– The theory is that it prevents bad patents from coming

along– The US may develop a similar procedure

May help overcome the recent tide of “bad” patents that have played heavily in the press

But, remember all that money that was saved because interferences may not happen?

Changes? (cont)

• Other dramatic suggestions/changes– The possibility of obtaining an injunction has been

reduced--such that actual harm must be shown and the public interest must be considered

– Limiting the number of continuations?– Elimination of best mode requirement?– A new obviousness standard

A career in IP Law?

• You work with the cutting edge science in a number of technologies

– Sometimes people find this stressful

• For those with high-demand PhD’s firms like WS will PAY FOR LAW SCHOOL

– But.... It is hard work

WSGR PRACTICE

So, A Typical Scenario: A Day In Our Life

• A clever scientist at [Yale/JHU] comes up with a great new drug, diagnostic, or research tool

• A few people see the vision, and come to WSGR to start a company

• What do we do:– License in the IP from [Yale/JHU]– Help pitch them to our VC friends– Identify and license in technology from other universities that may be

needed– Help in company formation– Defend in the due diligence of the VCs– Push their patents through the Patent office– Engage in reducing/eliminating IP that may be detrimental– Get the company GREAT patents throughout the world– Help partner the technology to move it rapidly to the market

Life Science Experience

• More than 350 life sciences clients

• Assisted life sciences clients in raising nearly $1 billion in more than 70 rounds of venture financings in 2007

• Assisted life sciences clients in more than 80 public offering transactions raising more than $8 billion since 1998

• Assisted life sciences clients in more than 100 mergers and acquisitions valued over $10 billion since 1998

• Dedicated Drug & Device Regulatory practice

• Largest dedicated Life Sciences Partnering Transactions practice

• Largest dedicated Life Sciences Patent Counseling and Prosecution practice

• Dedicated Life Sciences Intellectual Property Litigation practice

• More than 85 Professionals

– Dedicated attorneys, patent agents, and scientific advisors

– More than half with PhDs in biotechnology related fields

• Exclusively focused on biotech and medical device companies

• Integrated with corporate, litigation, and transactional practices

• Attorneys with a track record of IP value creation

• Responsible for the development of the IP portfolios covering inventions such as IL-2, the DNA chip, cancer therapies, nanotechnology, stem cell technologies, and PCR

PCR (Nobel Prize 1993) – patent drafted by Al Halluin

GFP (Nobel Prize 2008) – patent drafted by Vern Norviel and John Storella

World-Class IP Patents & Innovations Practice

Select Life Sciences Clients

Life Sciences Practice

Note: clients may have recently merged or been acquired

Select Venture Capital Firm Clients

• Abingworth Management

• Alloy Ventures

• Alta Partners

• Apax Partners

• ARCH Venture Partners

• Atlas Venture

• Avalon Ventures

• Bay City Capital

• Burrill & Company

• Canaan Partners

• De Novo Ventures

• Delphi Ventures

• Domain Associates

• Draper Fisher Jurvetson

Represent more than half of the top 100 most active venture capital firms with investments in the life sciences industry*, including:

• New Enterprise Associates

• Novartis Venture Fund• Novo• Prospect Venture Partners• Rho Capital Partners• Sanderling Ventures• Skyline Ventures• Sofinnova Partners• SR One• SV Life Sciences• Three Arch Partners• Venrock• Versant Ventures• Warburg Pincus

*Source: VentureOne. Based on search of VC firms investing in companies from the following industry segments: Biopharmaceuticals, Healthcare Services, Medical Devices/Equipment, Medical Software & IS, Other Healthcare; investments made no earlier than 9/26/06

• Essex Woodlands Health Ventures

• Flagship Ventures• Frazier Healthcare Ventures• Hambrecht & Quist Capital

Management• Highland Capital Partners

• InterWest Partners• Kleiner Perkins Caufield & Byers• Mayfield• Mohr Davidow• Morgenthaler• MPM Capital

Our Partnering Practice

• Unequalled Scale

– More than 50 attorneys fully dedicated to technology transactions including the following deal types:

• Strategic Alliances; Corporate Partnering Agreements• Joint Ventures• Collaborations and Co-Development Agreements• Manufacturing, Supply and Distribution Agreements • Strategic Technology Acquisitions; License Agreements• Academic Collaborations• Service Agreements (CRO, testing, other)• Outsourcing Transactions

– A collaborative cross-industry practice comprised of attorneys who are industry specialists

• Unequalled Experience

– Well over 200 major life sciences collaborations

– Multiples more in other industries

Select Partnering Transactions

Penwest Pharmaceuticals

Research, Development,

Commercialization and

License Agreement

July 2007

Celgene

Strategic Global R&D

Collaboration

September 2007

Merck & Co

RCT Technology

Access Agreement

August 2007

Human Genome Sciences

Collaboration Agreement

Involving XmAb

Technologies

February 2008

Medtronic

Global Licensing Agreement

January 2008

Tornier

Worldwide Collaboration

Involving Synthetic Growth

Factor Technology

February 2008

Bristol-Myers SquibbAgreement for the Global

Development and Commercialization of KAI-9803

May 2008

Kyowa Hakko Kogyo Co Ltd

Exclusive Licensing Agreement

of KW-0761

May 2008

Kinetic Concepts

Worldwide License

Agreement

NeutroPhase Technology

June 2007

GlaxoSmithKline

XP13512 Compound

Development &

Commercialization February

2007

Amgen

Strategic Collaboration

January 2007

Galderma

License Agreement January

2007

Life Sciences Expertise

Gilead Sciences

Purchase Agreement for

Cicletanine Assets

May 2008

Santen

Licensing Agreement

June 2008

Ortho-McNeil-Janssen

Pharmaceuticals, Inc.

Licensing Agreement

July 2008