Embed Size (px)
Citation preview
High selenium induces endothelial
dysfunction via endoplasmic
reticulum stress
By
Matshediso Zachariah
A thesis submitted in accordance with the requirements of the
University of Surrey for the degree of Doctor of Philosophy
Faculty of Health and Medical Sciences
University of Surrey
© Matshediso Zachariah, 2017
Page 2 of 167
Declaration of Originality
I hereby declare that this submission is my own work and that to my best of my
knowledge it contains no material previously published or written by any other
person. The design, experimental and written work was performed by me and any
concept and research contribution made in the research by my colleagues during my
candidature is fully acknowledged. This thesis has not been submitted to any other
academic or profession institute. The University of Surrey has the right to submit my
work electronically for plagiarism. In addition, the University has the right to request
an electronic copy for assessment.
Signature: …… ……………………….
Date: ……………26 May 2017……………………
Page 3 of 167
Abstract
Selenium (Se) is associated with insulin resistance and may affect endothelial
function thereby increasing the risk of type 2 diabetes and associated cardiovascular
disease (CVD). However, the molecular mechanisms involved are not clear. The
endoplasmic-reticulum (ER) stress response is a mechanism involved in apoptosis
induced by high Se in some cancer cells and, also in the pathogenesis of insulin
resistance and endothelial dysfunction (ED). Thus, we hypothesised that high Se
status causes ED through ER stress response. Endothelial cells (HUVECs) and
EA.hy926 cell lines were treated with selenite (0.5-10 µM) for 24 hours in the
presence or absence of the ER chemical chaperone, 4-phenylbutryic acid (PBA). ER
stress markers were investigated using qPCR and western-blot technique.
Endothelial function was assessed by the Griess assay, flow cytometry, Matrigel®
and colourimetric assays. Data were expressed as S.E.M (p<0.05) vs. control.
High Se concentration (5-10 µM) compared to physiological concentration
(0.5–2.0 µM) enhanced mRNA expression of ER-stress markers:- activating
transcription factor-4 (ATF4), CAAA/enhanced-binding homologous protein (CHOP)
and X-binding box-1 (XBP-1). In addition, high selenite concentration reduced nitric
oxide production and angiogenic capacity in endothelial cells. Moreover, high
selenite treatment significantly (p<0.05) increased production of reactive oxygen
species (ROS) and induced apoptosis through caspase-3/7 activity.
Interestingly, PBA completely reversed all the effects of high selenite on
endothelial function, indicating the involvement of the ER-stress response. High Se
treatment caused endothelial dysfunction through the activation of the ER-stress
response. This thesis additionally warns the public to be aware of the risks of the use
of Se supplements as a prophylactic agent against oxidative-stress disease.
Page 4 of 167
Publication and conference attendance Papers Maamoun H., Zachariah M., McVey JH., Green FR and Agouni A. 2016. Heme
oxygenase (HO)-1 induction prevents Endoplasmic Reticulum stress-mediated
endothelial cell death and impaired angiogenic capacity. Biochemical Pharmacology,
127:46-59
Peer reviewed published abstracts Zachariah M, Maamoun H, Agouni A and Rayman MP. 2015. High selenium intake
is associated with endothelial dysfunction: Critical role for Endoplasmic Reticulum
stress. Heart.101:A113.
Conferences presentations FHMS Festival of Research, July 2013, University of Surrey, UK-poster presentation
PGR conference, Feb 2014, University of Surrey, UK- poster presentation
The British Society for Cardiovascular Research Society (BSCR), September 2014,
Reading, UK- poster presentation
The 83rd Congress of the European Atherosclerosis Society (EAS 2015), March
2015, Glasgow, UK-discussed poster
PGR conference, March 2015, University of Surrey, UK-poster presentation
The British Society for Cardiovascular Research Society (BSCR), June 2015,
Manchester, UK- poster presentation
Page 5 of 167
FHMS Festivals of Research, July 2015, University of Surrey, UK-poster
presentation.
The 33rd Annual Meeting of the European Section of the ISHR, July 2015,
Bordeaux, France-poster presentation
The Nutrition Society Postgraduate Conference, September 2015, Cambridge, UK-
oral presentation
The British Society for Cardiovascular Research, September 2016, Leeds, UK-poster
presentation
The 11th International Symposium on Selenium in biology and Medicine and The 5th
International conference on Selenium in the Environment and Human Health
Page 6 of 167
Acknowledgements
I would like to express my special appreciation to my supervisors Professor Margaret
Rayman and Dr Abdelali Agouni for their support, encouragement and patience from
the start of MSc to finally PhD. I am grateful for their motivation and their immense
knowledge in my field. Prof Rayman, thank you for making me expand my English
language and writing skills.
I am highly grateful to Dr Lisiane Meira whom we met along the PhD to take
the role of being more than a supervisor but a friend (my Lisi) and a marvellous aunt.
I appreciate that her door, ears and arms were always open for both PhD related
issues and personal matters. I would have not completed this PhD in time without
her assistance, patience and eager to take on a student midway PhD.
Thank you my PhD colleagues for the support in the laboratory and allowing
me to use some of your reagents and equipment; Dr Hatem Maamoun, Larissa De
Souza, Dr Gillian Stenson, Dr Shahida Shafi and Dr Priti Chivers. I am grateful to the
friends I gained in the last 4 years who made PhD fun.
A special thank you to my mother Kitso Zachariah, my brother Tshepo
Zachariah and a sister I gained in UK Chawada Monei for constant love,
encouragement and monetary support. This PhD experience was not just for me but
for us as a family. Thato Stanley Motlogelwa, thank you for believing in me even at
times I made you angry you always had word of encouragement. May God
continuously bless you and a Pula e le nele (May your lives be blessed with showers
of rain). I am forever indebted to my sponsor University of Botswana and The
Botswana government, Dr Ishmael Kasvosve and Dr Rosemary Musonda.
Pula!!!Pula!!
Page 7 of 167
Table of Contents
Declaration of Originality ............................................................................................ 2
Abstract ......................................................................................................................... 3
Publication and conference attendance ................................................................... 4
Acknowledgements...................................................................................................... 6
List of figures and tables .......................................................................................... 10
List of Abbreviations ................................................................................................. 12
Chapter 1. General Introduction ............................................................................... 16
1. Introduction ............................................................................................................. 17
1.1 Selenium and selenium sources......................................................................................... 18 1.2 Selenium metabolism ....................................................................................................... 19
1.2.1. Selenoprotein Synthesis. ..................................................................................................... 21 1.2.2. Functions of Selenoproteins ............................................................................................... 23
1.3. Selenium in human health and disease ............................................................................. 28 1.3.1. The impact of selenium in type 2 diabetes and type 2 diabetes-associated CVD .............. 29 1.3.2. Definition of Insulin resistance, endothelial dysfunction and Type-2 diabetes and associated CVD .............................................................................................................................. 30 1.3.3. Endothelial dysfunction ...................................................................................................... 32 1.3.4. Is selenium involved in cardio-metabolic disorders? .......................................................... 36 1.3.5. The impact of Se on type-2 diabetes and CVD risks; observational studies ....................... 37 1.3.6. The impact of Se in type-2 diabetes and CVD risk; randomised controlled trials (RCTs) ... 38 1.3.7. Selenium status and lipid profiles ....................................................................................... 40
1.4. Molecular mechanisms involved in Se-induced insulin resistance ...................................... 42 1.5. Endoplasmic Reticulum (ER) Stress ................................................................................... 45
1.5.1 ER stress inhibitors; uses of chemical chaperones .............................................................. 50 1.6. The role of ER stress in endothelial dysfunction and cardiovascular disease ...................... 53 1.7. Selenium-induced ER Stress. ............................................................................................ 56 1.8. Hypothesis: ..................................................................................................................... 58 1.9. Aims and Objectives: ....................................................................................................... 58
Chapter 2. Materials and Methods ........................................................................... 60
2.1. Cells and cell culture ........................................................................................................ 61 2.2. MTT viability assay .......................................................................................................... 62 2.3. ER stress induction; time course and dose response of sodium selenite ............................. 63 2.4. RNA extraction ................................................................................................................ 63 2.5. cDNA synthesis and mRNA gene expression analyses ........................................................ 64 2.6. Conventional PCR for XBP-1 ............................................................................................. 66
Page 8 of 167
2.7. Western Blot ................................................................................................................... 67 2.7.1. Protein extraction ............................................................................................................... 67 2.7.2 Protein assay ........................................................................................................................ 68 2.7.3. Sample preparation and protein denaturation for electrophoresis. .................................. 69 2.7.4. Western blotting analysis. .................................................................................................. 70
2.8. Measurement of apoptosis using flow cytometry ............................................................. 71 2.9. Caspases 3/7 activity ....................................................................................................... 73 2.10. Measurement of reactive oxygen species ....................................................................... 74 2.11. Nitric Oxide (NO) measurement: Griess assay ................................................................. 75 2.12. In vitro tube-like structure formation assay on Matrigel® matrix ..................................... 76 2.13. Statistical Analysis ......................................................................................................... 77
Chapter 3. Results ...................................................................................................... 78
High selenium treatment activates the ER stress response in cultured
endothelial cells and hepatocytes. .......................................................................... 78
3.1 Introduction ..................................................................................................................... 79 3.2 Results ............................................................................................................................. 81
3.2.1 High Selenium treatments cause ER stress induction in hepatocytes ................................. 81 3.2.2 High selenium treatment activates the ER stress response in a time- and dose- dependent manner in endothelial cells ........................................................................................................... 86 3.2.3 High Selenium treatments cause ER stress induction in endothelial cells .......................... 88 3.2.4 High selenium activates spliced XBP-1 in endothelial cells ................................................. 89 3.2.5 Effects of high selenium on viability of endothelial cells and hepatocytes. ........................ 90
3.3 Discussion ........................................................................................................................ 93
Chapter 4 Results ..................................................................................................... 100
High selenium treatment induces molecular changes in endothelial cells ..... 100
4.1. Introduction .................................................................................................................. 101 4.2 Results ........................................................................................................................... 105
4.2.1 ER stress response induced by high selenium impairs nitric oxide (NO) bioavailability in endothelial cells. ......................................................................................................................... 105
4.2.2. High-selenium-induced ER stress response enhances oxidative stress in endothelial cells ............................................................................................................................................ 109 4.3. Discussion. .................................................................................................................... 111
Chapter 5 Results ..................................................................................................... 116
High Selenium Induced ER stress leads to impaired angiogenic capacity and
apoptosis ................................................................................................................... 116
5.1. Introduction .................................................................................................................. 117 5.2 Results ........................................................................................................................... 128
5.2.1. High selenium impairs angiogenesis mediated by ER stress in endothelial cells ............. 128 5.2.2. High selenium stimulates VEGF-A expression in endothelial cells is mediated by ER stress and time dependent ................................................................................................................... 131
Page 9 of 167
5.2.3 High selenium induces apoptosis in endothelial cells through ER stress activation. ........ 133 5.2.4. High selenium causes ER stress-mediated apoptosis through the activation of caspases 3/7 in endothelial cells. ............................................................................................................... 135
5.3 Discussion ...................................................................................................................... 136
Chapter 6. General discussion ............................................................................... 143
6. General Discussion ........................................................................................................... 144 6.1. High Se concentration induces ER stress in cells .............................................................. 144 6.2. ER stress induced by high Se leads to endothelial dysfunction ......................................... 146 6.3. Summary ....................................................................................................................... 148
Reference List ........................................................................................................... 150
Page 10 of 167
List of figures and tables
Figure 1.1. Sources of Se in the UK
Figure 1.2. Se metabolism in human and animals
Figure 1.3. Selenocycteine and selenoprotein synthesis
Figure 1.4. Serum Se in human disease
Figure 1.5 Mechanism by which endothelial cells produce nitric oxide (NO)
Figure 1.6. Potential influence of Se on the insulin cascade
Figure 1.7. The UPR pathway.
Figure 2.1 FACS analysis of the apoptotic cells
Figure 2.2 FACS gate discriminating DHE positive from DH negative cells
Figure 2.3 Image J analysis of the tube like structures in a Matrigel®
Figure 3.1 High Se treatment enhances phosphorylation of the eIF2α at Ser 51
Figure 3.2 High Se treatment activates CHOP in HuH-7 cells.
Figure 3.3 High Se treatment induces ER stress in hepatocytes
Figure 3.4 High Se treatment induced ER stress in endothelial cells
Figure 3.5 High Se treatment enhances activation of BiP and phosphorylation eIF2α
at Ser 51 of the
Figure 3.6 High Se treatment activates splicing of the XBP-1 mRNA
Figure 3.7 Effects of the high Se on viability of endothelial cells and hepatocytes
Figure 4.1 High Se-induced ER stress response impairs nitric oxide (NO) bioavailability in
endothelial cells.
Figure 4.2 Effect of high Se treatment on expression of Akt and eNOS
phosphorylation
Figure 4.3 High Se-induced ER stress response enhances oxidative stress in
endothelial cells
Page 11 of 167
Figure 5.1 High Se-induced ER stress response impairs angiogenic capacity of
endothelial cells
Figure 5.2 High Se increase VEGF-A mRNA expression in a time dependent manner
in endothelial cells
Figure 5.3 High Se concentration of Se induces apoptosis through the activation of
ER stress in endothelial cells
Figure 5.4 High Se causes ER stress mediated apoptosis through the activation of
caspase 3/7 in endothelial cells
Figure 6.1 Summary of mechanism of which high Se induces endothelial dysfunction
Table 1.1. Summary of selenoproteins and their function in humans
Table 2.1 List of human forward and reverse primers used in qPCR experiments.
Page 12 of 167
List of Abbreviations
7-AAD 7-Aminoactinomycin D
Akt/PKB Protein Kinase B
ATF Activating transcription factor
ASK1 Apoptotic signal- regulating kinases-1
ATCC American type culture collection
BAK BCL-2 homologous antagonist/killer
BCA Bicinchoninic acid assay
BCL-2 B-cell lymphoma 2
BIP/GRP78 Binding-immunoglobulin protein/Glucose regulated protein 78
BIM BCL-2 interacting mediator of cell death
BSA Bovine serum albumin
CHOP CAAA/enhanced- binding protein homologous protein
CO2 Carbon dioxide
CVD Cardiovascular disease
Diabetes Diabetes mellitus
DIO Iodothyronine deiodinase
DMEM Dulbeco‘s modified Eagle medium
DMSO Dimethyl sulfoxide
dNTP Deoxynucleotide
EA.hy926 Endothelial somatic cell hybrid
DNA Deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic acid
EFSec Specific elongation factor
eNOS Endothelial Nitric Oxide Synthase
Page 13 of 167
ER Endoplasmic reticulum
ERAD Endoplasmic reticulum-associated protein degradation
FBS Foetal bovine serum
GADD34 Growth arrest and DNA damage-inducible protein 34
GLUT Glucose transporter
GPx Glutathione peroxidase
H2O2 Hydrogen peroxide
HDL High density lipoprotein
HepG2 Human liver carcinoma cells
HuH-7 Hepato carcinoma cell lines
HUVECs Human Umbilical Vein Endothelial cells
IRE-1 Inositol requiring element 1
IRS1/2 Insulin receptor substrate 1/2
I.U International units
LSGS Low serum growth supplement
mRNA Messenger RNA
miRNA Micro RNA
MSA Methylseleninic acid
MTT (3-(4,5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide
NaCl Sodium chloride
NADPH Nicotinamide adenine dinucleotide phosphate
NEAA Non-essential amino acid
NED N-napthylethylenediamine
NEFAs Non-esterified fatty acids
NF-κB Nuclear factor kappa B
Page 14 of 167
NPC National Prevention for Cancer Trial
NO Nitric oxide
PBA 4-phenylbutyric acid
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PERK PKR-like eukaryotic initiation factor 2α kinase
Phospho-eIF2α Phosphorylated eukaryotic initiation factor 2 alpha
PRECISE Prevention of Cancer by Intervention with Selenium
PTEN Phosphatase and tensin homolog
PTP1B Protein tyrosine phosphatase 1B
PVDF Polyvinylidene fluoride
qPCR Quantitative polymerase chain reaction
RIPA Radioimmuno-precipitation assay
RIDD Regulated IRE1-dependent decay
ROS Reactive oxygen species
SBP2 SECIS binding protein 2
SDS Sodium dodecyl Sulfate
Se Selenium
SECIS Selenocysteine insertion sequence
SELECT Selenium and Vitamin E for Cancer Prevention Trial
SELENOP Selenoprotein P
SELENOR Selenoprotein R
SELENOS Selenoprotein S
Sel-Met SelenoMethionine
SEM Standard error of the mean
Page 15 of 167
T3 Triiodothyronine
T4 Thyroxine
TBS-T Tris buffered saline-Tween
TNF-α Tumour necrosis factor alpha
TRAF-2 TNF receptor-associated factor 2
Trx Thioredoxin
TrxR Thioredoxin reductase
TUDCA Tauroursodeoxycholic acid
UK United Kingdom
UPR Unfolded protein response
USA United States of America
V-PE Annexin V-PE
WHO World Health Organization
XBP-1 X-binding protein 1
Page 16 of 167
Chapter 1. General Introduction
Page 17 of 167
1. Introduction
Cardiovascular disease (CVD) is prevalent in westernised countries and
continuously increasing in the developing world making CVD a public-health
concern. Several cellular and molecular mechanisms involved in CVD, including
oxidative stress, have been investigated. Recently, the endoplasmic reticulum (ER)
stress mechanism has been linked to endothelial dysfunction and CVD (Tabas,
2010; Galán et al., 2014; Lenna, Han and Trojanowska, 2014; Wang et al., 2015).
The use of anti-oxidants has been trialled to prevent chronic diseases caused by
oxidative stress (Lippman et al., 2009; Goodman et al., 2011; Rayman, 2012).
Selenium (Se), which is required for the synthesis of the anti-oxidant selenoproteins
(Brenneisen, Steinbrenner and Sies, 2005; Lipinski, 2011), has been used to reduce
the effects of oxidative stress in various disease states including cancer,
neurodegenerative disorders, type 2 diabetes mellitus (type 2 diabetes) and CVD
(Rayman, 2012; Pillai, Uyehara-Lock and Bellinger, 2014). However, increasing
evidence from human, animal and in vitro studies suggests that both low and high Se
concentrations are associated with an increased risk of type 2 diabetes (Bleys,
Navas-Acien and Guallar, 2007; Bleys et al., 2008; Labunskyy et al., 2011; Rayman
et al., 2012; Rayman and Stranges, 2013; Rocourt and Cheng, 2013; Zhou, Huang
and Lei, 2013). Although type 2 diabetes is intimately linked with endothelial
dysfunction and vascular wall disease, more experimental work is essential to
elucidate fully the effect of Se in endothelial dysfunction and CVD risk.
Inappropriately high (>200 g/day) or low (<55 g/day) Se intake may
increase the risk of oxidative stress disease and has the potential to induce ER
stress (Stranges et al. 2010). Several studies have linked ER stress to insulin
Page 18 of 167
resistance and type 2 diabetes (Araki, Oyadomari and Mori, 2003; Ozcan et al.,
2004, 2006; Hummasti and Hotamisligil, 2010).
Although Se has been implicated as a risk factor for type 2 diabetes and CVD (
Stranges et al. 2010; Stranges et al. 2007; Steinbrenner et al. 2011; Laclaustra et al.
2010; Rayman & Stranges 2013; Rayman 2012; Bleys, Navas-Acien & Guallar
2008), few studies have linked the role of Se-induced ER stress to the aetiology or
progression of type 2 diabetes or other human diseases (Wu et al., 2005; Zu et al.,
2006; Hwang et al., 2007; Wallenberg et al., 2014). Moreover, the role of Se-induced
ER stress on endothelial dysfunction or diabetes-associated complications such as
cardiovascular disease is not known.
1.1 Selenium and selenium sources
Se exists in small amounts in foods predominantly as organic forms, [e.g. seleno-
methionine (SeMet) and seleno-cysteine (SeCys)] and very small amounts of
inorganic forms [selenate (SeO4-2), selenite (SeO3
-2)]. The highest amounts being
found in Brazil nuts, fish and offal (e.g. kidney) (Rayman, 2012; Mehdi et al., 2013).
Sodium selenite and selenate are major sources in dietary supplements. Se levels in
foods vary across countries depending on the content of Se in the soil in which foods
are grown and its bioavailability (Labunskyy, Hatfield and Gladyshev, 2014; Roman,
Jitaru and Barbante, 2014). The richest source of Se is Brazil nuts however the main
sources of Se in United Kingdom (UK) are bread and cereals, meat and poultry (see
Figure 1.1) (Rayman, 2012). The UK is considered relatively Se deficient due to the
low levels of Se in soils (Johnson, Fordyce and Rayman, 2010). Daily Se intake
varies from country to country, from Se deficient (e.g. in the Keshan area of China)
to toxic levels (Thomson, 2004). The Se concentration required for optimal
Page 19 of 167
glutathione peroxide function, specifically GPx3, in human serum or plasma, is
around 1-1.2 µM which equates to a Se intake of some 55 µg/day (Thomson, 2004).
Figure 1.1. Sources of Se in the UK. .Meat and poultry and bread and cereals are the main source of Se in the UK (Rayman, 2012)
1.2 Selenium metabolism
Inorganic forms of Se (selenite and selenate) are reduced to hydrogen selenide by
glutathione and thioredoxin reductase (TXNRD3) then converted into
selenophosphate and finally incorporated into the Seryl-tRNA[ser]sec for synthesis of
selenoproteins (Roman, Jitaru and Barbante, 2014; Burk and Hill, 2015). The organic
form of Se, SeMet, is demethylated to selenocysteine and further metabolized to
hydrogen selenide (Burk and Hill, 2015). At the same time, SeMet can replace
methionine in a non-specific manner; this means that a high intake of SeMet (e.g.
from cereal sources or supplements) can appear in blood incorporated into albumin
or haemoglobin, appearing to raise Se status. However, such Se is inert until the
proteins are catabolized and the SeMet is made free for conversion into
Page 20 of 167
selenoproteins via selenocysteine and hydrogen selenide (Burk and Hill, 2015).
Figure 1.2 summarizes the metabolism of Se forms for synthesis of selenoproteins.
As dietary intake increases from deficient to adequate, excess Se is stored in tissues
(as SeMet in body proteins) and the rest is excreted via the urine or the skin.
Excessive intake of Se can result in a pro-oxidant state; toxic levels (>1mg) cause
selenosis (Dennert et al. 2012) (Vinceti et al. 2001). All Se compounds, once
converted to hydrogen selenide can lead to increased selenoprotein synthesis (Burk
and Hill, 2015). As Se dietary intake increases from deficient to adequate, excess Se
is stored in tissues and the rest is excreted via the urine (Burk and Hill, 2015).
Figure 1.2. Selenium metabolism in human and animals. Sources of Se from diet or
supplements. Selenomethionine (SeMet) is incorporated into proteins in a non-specific
manner as well as being capable of being metabolised to selenocysteine (SeCys). SeMet,
SeCys, selenite and selenate are all broken down into hydrogen selenide (H2Se). H2Se is
metabolically active and can further be used to synthesise different selenoproteins such as
selenoprotein P (SELENOP). Excess Se is excreted via the skin, urine and breath (adapted
from Rayman, Infante and Sargent, 2008; Burk and Hill, 2015).
Page 21 of 167
1.2.1. Selenoprotein Synthesis.
Selenoproteins contain one Sec, the 21st amino acid, in their sequences (Arnér,
2010; Mehdi et al., 2013) with the exception of selenoprotein P (SELENOP).
SELENOP has up to ten Sec residues including an N-terminal Sec-containing
thioredoxin domain (Roman, Jitaru and Barbante, 2014). Selenoprotein synthesis is
reduced when Se dietary intake is deficient or restricted (Labunskyy, Hatfield and
Gladyshev, 2014). Co-translational incorporation of Sec into proteins is imposed by
an in-frame UGA codon present in active site of selenoprotein mRNAs (Burk and Hill,
2015). Sec is introduced into selenoproteins by a complex mechanism that requires
serine, seryl-tRNA synthase and trans-acting protein factors, Sec-tRNA [Ser]Sec and a
Sec-insertion-sequence (SECIS) element (Arnér, 2010; Labunskyy, Hatfield and
Gladyshev, 2014; Burk and Hill, 2015).
The SECIS element transforms the UGA codon from a stop codon to a
selenoprotein coding sequence (Arnér, 2010; Burk and Hill, 2015). Sec is coded for
by the Trsp gene in the TATA box position 34 to form tRNA[Ser]Sec which gets
aminoacylated by serine to form seryl-tRNASer]Sec (Arnér, 2010; Labunskyy, Hatfield
and Gladyshev, 2014; Burk and Hill, 2015). Hydrogen selenide from dietary
metabolism reacts with seryl-tRNASer]Sec in the presence of O-phosphoseryl-
tRNASer]Sec kinase to produce O-phosphoseryl- tRNASer]Sec which is a
selenophosphate. Selenocysteryl-tRNA Ser]Sec is synthesized by selenocysteine
synthase from O-phosphoseryl- tRNASer]Sec; the Selenocysteryl-tRNA Ser]Sec is a
transfer RNA that is incorporated into the SECIS element for coding and synthesis of
selenoproteins such as glutathione peroxidase-2 (GPx2) (Labunskyy, Hatfield and
Gladyshev, 2014; Burk and Hill, 2015).
Page 22 of 167
Figure 1.3 highlights a three-way synthesis step of selenoproteins from
hydrogen selenide in the presence of a tRNA specific for selenoprotein synthesis,
SECIS binding protein 2 (SBP2) and co-factors such as nucleolin (Arnér, 2010;
Labunskyy, Hatfield and Gladyshev, 2014). Other than dietary levels and Se intake,
it has been proposed that different SECIS-binding proteins such as nucleolin,
eIF4alpha3 and SBP2, regulate the insertion of Sec on proteins for selenoprotein
synthesis (Arnér, 2010; Labunskyy, Hatfield and Gladyshev, 2014) however, the
exact mechanism of regulation of Sec incorporation into proteins is complex and is
yet to be understood. For example, two studies showed that SBP2 is the main
SECIS binding protein regulating selenoprotein synthesis (Squires et al., 2007;
Miniard et al., 2010). Although both studies agree on the function of SBP2 in
selenoprotein synthesis, the involvement of other SECIS binding proteins such as
nucleolin, could not be confirmed. Understanding the mechanism by which Sec is
incorporated into proteins is still evolving; nonetheless it can be agreed that
regulation of selenoprotein synthesis does not only depend on Se dietary intake but
also on Sec incorporation.
Page 23 of 167
Figure 1.3. Selenocysteine and selenoprotein synthesis. The formation of selenoproteins requires the formation of an amino acid, selenocycteine, a unit of selenoproteins. Selenocycteine is co-translationally inserted in response to the UGA codon with Se insertion sequence (SECIS) to be read as a selenoprotein coding codon instead of a stop codon. The process starts with serylation of tRNA[ser]sec by seryl-tRNA synthase followed by phosphorylation of serine to phosphoseryl-tRNA[ser]sec
and lastly, phosphoseryl-tRNA is converted to selenocysteryl-tRNA by selenocycteine synthase. Selenocysteryl-tRNA[ser]sec, SECIS binding protein (SBP2), selenocycteine elongation factor (IFsec), eukaryotic intiation factor 4α (eIF4α) and nucleolin bind to the SECIS and code for the translation of selenoproteins such as glutathione peroxidase-2 (Papp et al., 2007; Arnér, 2010).
1.2.2. Functions of Selenoproteins
Human selenoproteins are encoded by 25 genes encoding 25 selenoproteins (Papp
et al., 2007; Labunskyy, Hatfield and Gladyshev, 2014; Roman, Jitaru and Barbante,
2014). With few exceptions, all functioning selenoproteins have Sec inserted on
either the N or C-terminus of the active sites and have redox-active functions (Papp
et al., 2007). However, the Sec is not only limited to redox-active functions but has
diverse biological functions as shown in Table 1.1 (Huang, Rose and Hoffmann,
2012). Among the 25 well-characterised selenoproteins, the most relevant for this
study are the glutathione peroxidases (GPXs), thioredoxin reductases (TXNRDs),
iodothyronine deiodinases (DIOs), SELENOP, selenoprotein S, selenoprotein F
(formerly known as 15kDa-selenoprotein) and selenoprotein K (Mehdi et al., 2013;
Page 24 of 167
Roman, Jitaru and Barbante, 2014). Selenoproteins have been recently named with
new abbreviations with major changes in renaming selenoproteins F,I,O,P, S and T
(Regina et al., 2016). Their functions include antioxidant defence, formation of
thyroid hormones, DNA synthesis, maturation of semen, modulation of Ca2+ influx in
immune cells (Verma et al., 2011; Rayman, 2012; Mehdi et al., 2013; Roman, Jitaru
and Barbante, 2014). Selenoproteins such as selenoprotein S, M and selenoprotein
K, have been linked to cytosolic calcium regulation, protein folding and degradation
of misfolded proteins in the ER because they reside in the ER (Reeves, Bellinger
and Berry, 2010; Roman, Jitaru and Barbante, 2014).
SELENOP is one of the important selenoproteins in human health; it is
produced in liver and used to transport Se (Roman, Jitaru and Barbante, 2014). It
has also been implicated in the pathophysiology of insulin resistance, endothelial
dysfunction and type 2 diabetes (Misu et al., 2010; Yang et al., 2011; Ishikura et al.,
2014). Elevated levels of SELENOP have been found to impair insulin signalling and
dysregulate glucose metabolism in hepatocytes. Treating hepatocytes with purified
SELENOP produced from mouse liver, induced the reduction of insulin-stimulated
phosphorylation of insulin receptor and protein kinase (Akt) (Misu et al., 2010).
Moreover, SELENOP increased phosphorylation of IRS1 at ser307, a negative
regulator of tyrosine phosphorylated IRS-1 (Misu et al., 2010). However, SELENOP
alone did not alter gluconeogenic enzymes or mRNA encoding glucose production in
the absence of insulin (Misu et al., 2010). The research showed that SELENOP
modulated insulin signalling and resulted in impaired angiogenesis due to impaired
insulin-dependent NO production (Ishikura et al., 2014).
Page 25 of 167
Glutathione peroxidase 1 (GPX1) is the most abundant selenoprotein in
mammals and its function is to reduce hydrogen peroxide and organic
hydroperoxides in the cytosol and mitochondria (Arnér, 2010; Labunskyy, Hatfield
and Gladyshev, 2014) . GPX1 has been shown to have insulin mimetic effects in
hepatocytes (Stapleton, 2000). Mice overexpressing GPX1 are obese and present
with hyperglycaemia and hyperinsulinaemia (McClung et al., 2004), which indicates
that GPX1 overexpression leads to insulin resistance. Insulin resistance was thought
to result from the reduction in insulin-stimulated phosphorylation of the hepatic and
muscle insulin substrate receptor and Akt observed in GPX1 overexpressing mice
compared to wild type (McClung et al., 2004).
Selenoprotein S (SELENOS) is an ER-resident selenoprotein which is
involved in protein folding, elimination of misfolded proteins from the ER and also in
regulating inflammation (Mehdi et al., 2013; Labunskyy, Hatfield and Gladyshev,
2014). Se deficiency results in an abnormal redox state causing several disorders
related to oxidative stress such as cancer, type 2 diabetes and CVD (Rayman 2005;
Stranges et al. 2010; Rayman 2012; Baum et al. 2013). Table 1.1 summarises the
25 human selenoproteins identified and characterised from the literature (Huang,
Rose and Hoffmann, 2012).
Page 26 of 167
Table 1.1. Summary of selenoproteins and their functions in humans (Huang, Rose and Hoffmann, 2012).
Selenoprotein Abbreviation(s) Function and significance
Cytosolic glutathione peroxidase
GPX1 GPX1 knockout is susceptible to oxidative challenge. Overexpression of GPX1 increases risk of diabetes.
Gastrointestinal glutathione peroxidase
GPX2 GPX1/GPX2 double-knockout mice develop intestinal cancer; one allele of GPX2 added back confers protection.
Plasma glutathione peroxidase GPX3 Important for cardiovascular protection, perhaps through modulation of nitric oxide levels; antioxidant in thyroid gland.
Phosholipid hydroperoxide glutathione peroxidase
GPX4 Genetic deletion is embryonic lethal; GPX4 acts as crucial antioxidant, and sensor of oxidative stress and pro-apoptotic signals; required for spermatozoa function
Olfactory glutathione peroxidase
GPX6 Importance unknown.
Thioredoxin reductase type I TXNRD1 Localized to cytoplasm and nucleus. Genetic deletion is embryonic lethal.
Thioredoxin reductase type II TXNRD2 Localized to mitochondria. Genetic deletion is embryonic lethal.
Thioredoxin reductase type III TXNRD3 Testes-specific expression.
Deiodinase type I DIO1 Important for systemic active thyroid hormone (T3) production.
Deiodinase type II DIO2 Important for local active thyroid hormone (T3) production.
Deiodinase type III DIO3 Inactivates thyroid hormone.
Selenoprotein H SELENOH Nuclear localization, involved in transcription. Essential for viability and antioxidant defence in Drosophila.
Selenoprotein I SELENOI Possibly involved in phospholipid biosynthesis.
Selenoprotein K SELENOK Transmembrane protein localized to ER and involved in calcium flux in immune cells.
Selenoprotein M, Selenoprotein 15
SELENOM Thiol-disulfide oxidoreductase localized to ER. Possibly involved in protein-folding.
Selenoprotein N SELENON Potential role in early muscle formation; involved in RyR-related calcium mobilization from ER.
Page 27 of 167
Selenoprotein Abbreviation(s) Function and significance
Selenoprotein O SELENOO Contains a Cys-X-X-Sec motif suggestive of redox function, but importance remains unknown.
Selenoprotein P SELENOP Se transport to brain and testes—SELENOP knockout leads to neurological problems and male sterility. SELENOP also functions as intracellular antioxidant in phagocytes.
Selenoprotein R Methionine-R-sulfoxide reductase 1
MsrB1 Functions as a methionine sulfoxide reductase and SELR knockouts show mild damage to oxidative insult.
Selenoprotein S SELENOS Transmembrane protein found in plasma membrane and ER. Reduces ER stress.
Selenoprotein T SELENOT ER protein involved in calcium mobilization.
Selenoprotein V SELENOV Testes-specific expression.
Selenoprotein W SELENOW Putative antioxidant role, perhaps important in muscle growth.
Selenophosphate synthetase SELENOP2 Involved in synthesis of all selenoproteins, including itself.
Page 28 of 167
Recently, high Se intake (from supplementation) and higher Se status have
been implicated as risk factors for type 2 diabetes (Bleys, Navas-Acien and Guallar,
2007; Rayman, 2012). Se has been shown to have a non-linear, partial U-shaped
association with diabetes as well as with all-cause mortality (Figure 1.4) (Bleys,
Navas-Acien and Guallar, 2007) indicating that both low and high Se status may
contribute to human disease. However, the molecular and cellular mechanisms
underlying these paradoxical effects of Se are yet to be fully investigated.
Figure 1.4. Serum Se in human disease. Figure 1.4 A shows the relationship between low and high Se status and odds ratio for developing type 2 diabetes in the USA population whereas Figure 1.4 B shows the U-shaped association between serum Se and all-cause mortality from the US National Health and Nutrition Examination Survey (Bleys, Navas-Acien and Guallar, 2007).
1.3. Selenium in human health and disease
Se exerts its anti-oxidative-stress actions through the enzymatic activity of Se in
GPXs and TrxRs, and to a lesser extent through other selenoproteins (Rayman,
2012; Labunskyy, Hatfield and Gladyshev, 2014). The addition of Se to food,
fertilisers and dietary supplements has increased in many countries around the world
particularly in western countries such as the UK and USA, because of the scientific
evidence that Se may reduce the risk of diseases linked to oxidative stress (Zhou,
Huang and Lei, 2013). Human and animal studies have shown some benefits of Se
Page 29 of 167
on cancer incidence, immune function, brain function, fertility and reproduction,
thyroid function and viral suppression (Rayman, 2012). The effect of Se status on
type 2 diabetes is controversial. A U-shaped relationship between Se status and type
2 diabetes has been observed (Labunskyy et al., 2011; Rayman and Stranges, 2013;
Xin-liang et al., 2016). Moreover, the impact of Se status on CVD is also
controversial and therefore needs further investigation.
1.3.1. The impact of selenium in type 2 diabetes and type 2 diabetes-
associated CVD
Several studies have shown that Se has contradictory effects on cardio-metabolic
disease (Bleys, Navas-Acien and Guallar, 2007; Bleys et al., 2008; Labunskyy et al.,
2011; Rayman et al., 2011; Stranges et al., 2011). The effect of Se on diabetes has
been controversial as both low and high Se status have been shown to be
associated with heightened diabetes risk in animal and human studies (Bleys,
Navas-Acien and Guallar, 2007; Mueller et al., 2009; Labunskyy et al., 2011;
Rayman, 2012). Low serum and erythrocyte Se concentrations have been observed
in type 1 and type 2 diabetes patients (Kljai and Runje, 2001). This study
demonstrated that diabetic patients had significantly lower serum Se (< 59.23±12.2
µg/L) than non-diabetics whose mean serum Se was 64.2±11.5 µg/L (Kljai and
Runje, 2001). Four years later, Rajpathak and colleagues, 2005, showed that toenail
Se concentration, a biomarker for dietary Se, was lower in diabetics with or without
cardiovascular complications than in healthy men (Rajpathak et al., 2005).
Additionally Parks and colleagues (K. Park et al., 2012) found that higher levels of
toenail Se among generally healthy American men and women were associated with
lower incidence of type 2 diabetes; however the result does not exclude the harm or
Page 30 of 167
benefits of high Se intake on type 2 diabetes. The potential mechanism(s) involved in
the increased risk Se in diabetes need to be clarified
1.3.2. Definition of Insulin resistance, endothelial dysfunction and Type-2
diabetes and associated CVD
Type 2 diabetes is intimately associated with CVD chiefly because of the complex
interplay between insulin resistance and endothelial dysfunction (Gage et al., 2013;
Rajendran et al., 2013; Wang et al., 2013). Endothelial dysfunction is the initial step
in development of macro- and micro-vascular complications (Levick, 2003;
Rajendran et al., 2013; Wang et al., 2013). Type 2 diabetes is a complex metabolic
disorder which is characterised by inability of the body to control glucose as a result
of defects in insulin secretion or insulin action (Drouin et al., 2013). Diabetes has
become a leading health problem especially in developed countries with an
estimated 360 million people diagnosed worldwide. It has been estimated that by
2025, five million people will have diabetes in the United Kingdom (UK) and currently
over three million people are diabetic, 90% of whom suffer from type 2 diabetes and
10% of whom live with type 1 diabetes (www.diabetes.org.uk). Type 2 diabetes is
characterised by hyperglycaemia and insulin resistance (Stanley, 1999). Insulin
resistance is generally considered as the hallmark of the development of type 2
diabetes (McClung et al., 2004).
Growing evidence suggests that insulin resistance promotes dyslipidaemia,
hypertension and inflammation to induce several components of the metabolic
syndrome and promote progression to CVD, including heart failure and vascular
dysfunction (McCarthy, 2010; Drouin et al., 2013). CVD is the number one cause of
death globally, representing 31% of all global deaths with 7.4 million and 6.7 million
Page 31 of 167
deaths due to coronary heart disease and stroke respectively (WHO, 2015). The
American Heart Association reported in 2015 that approximately 65% of diabetic
patients die of CVD (Mozaffarian et al., 2015). Moreover, the American Heart
association estimates that 27 in 1000 adults aged 60+ years are at risk of a fatal
coronary heart disease or heart attack (Mozaffarian et al., 2015). In the UK, the
primary cause of death and disability in diabetic patients is CVD, accounting for 52%
of deaths in diabetes (Sarwar et al., 2010; Diabetes UK, 2015). The cost of treating
CVD in the UK is £6.8 billion with CVD death rates of 33/100 000 in the National
Health Service between 2012 and 2013 (Bhatnagar et al., 2015). Insulin resistance,
a marker of type 2 diabetes, is an independent factor of CVD (Lebovitz, 2001; Cox et
al., 2014). Diabetic patients have twice the risk of developing CVD than non-diabetic
patients. In addition, 20% of hospital admission for stroke, heart failure and heart
attack are in diabetic patients (Diabetes UK, 2015).
Several factors concurrently influence the predisposition to the development
of type 2 diabetes and CVD. Among these factors are sedentary lifestyle, western-
type diet, hypertension, genetic factors and ageing (Stanley, 1999; McClung et al.,
2004; Cox et al., 2014) with obesity being the most common underlying factor (Hu,
2011; Nguyen et al., 2011). Obesity is a result of imbalance between calories
consumed and calories disbursed resulting in increased accumulation of fat around
the body (WHO 2013). Obesity accounts for 80-85% of the risk of development of
type 2 diabetes (Hu, 2011). Excess adipose tissue increases levels of pro-
inflammatory cytokines (leptin and tumour necrosis-factor alpha) and non-esterified
fatty acids (NEFAs) to impairs insulin signalling transduction (Watanabe, Nagai and
Takatsu, 2013). The released NEFAs circulate in the plasma leads to increased free
glycerol and therefore very low density lipoproteins. Elevated VLDL and NEFAs
Page 32 of 167
impair endothelial function and raise blood pressure (Watanabe, Nagai and Takatsu,
2013). The relationship between NEFA and insulin resistance has not been well
clarified; a systemic review of the effect of NEFA in insulin resistance showed that
NEFA is not necessary associated with IR (Karpe, Dickmann and Frayn, 2011).
However, Insulin resistance increases fatty acid production resulting in increased
lipid peroxidation. Increased activation of lipid oxidation induces inflammation in the
vascular walls resulting in impaired endothelial function and eventually insulin
resistance (Karpe, Dickmann and Frayn, 2011), Activation of inflammation in type 2
diabetes increases the risk of CVD via impaired function of the endothelium (Wang
et al., 2013).
1.3.3. Endothelial dysfunction
The endothelium is composed of a monolayer of endothelial cells that line the entire
innermost tunica intima of all vessels in the body. It is recognised as being an
endocrine organ able to sense mechanical and hormonal changes in the blood, but
also to secrete various mediators and hormones (Rajendran et al., 2013).
Endothelial cells regulate vascular homeostasis through the control of various
vascular functions including angiogenesis, regulating vasodilators and
vasoconstrictors, smooth muscle cell proliferation and the maintenance of blood
fluidity by balancing levels of pro-coagulants and anti-coagulants (Rajendran et al.,
2013). Nitric oxide (NO) is one of the vasodilators produced continuously by
endothelial cells. NO has physiological roles in the cardiovascular, neurologic and
immune systems and the generation of NO is directed from multiple pathways
(Levick, 2003).
Page 33 of 167
One of the important pathways of NO production is through the insulin binding
to the Insulin receptor substrate-1 (IRS-1) (Shankar et al., 2000; Wang et al., 2013).
Insulin binds to the IRS-1 activating its auotphosphorylation which later forms a
dimer with the phosphatidylinositol 3-kinase-dependent (P(I)3K). Phosporylation of
P(I)3K actvates the phosphorylation of PDK that inturn phosphorylates the protein
kinase B (Akt) (Shankar et al., 2000; Wang et al., 2013). Akt directly phosphorylates
endothelial nitric oxide synthase at serine-1177 resulting in ijncreased eNOS activity
and production of NO (Shibuya, 2011; Wang et al., 2013; Johnson and Wilgus,
2014). Impaired insulin signalling leads to reduced insulin-induced NO production
and reduced glucose uptake in the skeletal muscles resulting in endothelial
dysfunction and hyperglycaemia (Kubota et al., 2011). Increased glucose levels lead
to activation of inflammation, which is implicated in cardiac insulin resistance and
CVD (Basha et al., 2012; Mandavia et al., 2013).
In relation to the cardiovascular system, a physical stimulus such as shear
stress or bradykinin activates the generation of NO from L-arginine to L-citrulline by
stimulating the phosphorylation of endothelial NO synthase (eNOS) and releasing
NO (Levick, 2003; Cunningham and Gotlieb, 2005; Hermann, Flammer and Lscher,
2006). Additionaly, the synthesis of NO can be stimulated during hypoxia to induce
endothelial cell migration, motility and maturation and angiogenesis (Shibuya, 2011;
Carnicer et al., 2013). Hypoxia activates the hypoxia inducing factor-1 alpha (HIF-1α)
which is a transcription factor for the vascular endothelial growth factor (VEGF-A)
(Shibuya, 2011). The VEGF-A produced by the surrounding cells (pericytes), as a
result of stimuli such as hypoxia in tumourigenesis or in the process of tissue repair,
binds to the VEGF receptor-2 on the endothelial cells stimulating the
phosphoyrylation of eNOS via the P(I)3K pathway (Shibuya, 2011; Johnson and
Page 34 of 167
Wilgus, 2014). P(I)3K results in the phosphorylation of protein kinase B (Akt) which
in turn activates eNOS by donating its phosphate to produce NO in the endothelial
cells (Johnson and Wilgus, 2014). At the same time, stimulation of the
VEGFreceptor-2 (VEGF-R2) triggers the activity of phospholipase C (PLCγ) which
catalyses the breakdown of inositol trisphophate (IP3). IP3 activates the Ca2+
channels and relases the stored Ca2+ from the ER to the cytoplasm, increasing the
cytosolic Ca2+. Increased cytosolic Ca2+ stimualtes Ca2+/calmodulin kinase, inducing
phosphorylation of eNOS and resulting in NO production (Levick, 2003). Figure 1.5
summarises the synthesis of NO by endothelial cells.
Figure 1.5. Mechanism by which endothelial cells produce NO. VEGF stimulated by physiological stimuli e.g hypoxia inducing factor 1α (HIF-1α) during tumourigenesis or tissue repair, binds to the VEGF receptor 2 activating the phosphorylation of the phospholipae C (PLCγ), triggering the increase of the cytosolic Ca2+ from the ER and inducing the intercalation of the Ca2+ calmodulin (Ca2+/CaM) channel to the eNOS (Figure 1.5A). In addition, various stimuli such as shear stess, VEGF-A binding and insulin signalling trigger the activation of the phosphoinositide 3-kinase pathway (P(I)3K) resulting in the phosphoryaltion of protein kinase B (Akt) and eNOS. Also, eNOS cleaves from L-arginine to produce L-citruline and NO (Figure 1.5B). NO is a major vasodilator and important activator for angiogenesis, inhibtion of inflamatory respose and leukocyte proliferation (Levick, 2003; Shibuya, 2006).
Page 35 of 167
NO available from the endothelial cells acts on guanyl cyclase to produce
3′,5′-cyclic guanosine monophosphate to act on vascular smooth muscles cells,
resulting in vasodilation (Hermann, Flammer and Lscher, 2006; Luiking, Engelen and
Deutz, 2010; Rajendran et al., 2013). In addition, the function of NO is to prevent
platelet aggregation, exert anti-inlfammatory effects on leukocytes and promote the
formation of new vessels or capillaries from pre-exisiting vessels; this process is
known as angiogenesis (Luiking, Engelen and Deutz, 2010) and provides protection
from atherosclerosis (Dimmeler et al., 1999; Cunningham and Gotlieb, 2005;
Hermann, Flammer and Lscher, 2006).
Disturbances in glucose and lipid metabolism associated with the insulin
resistant state leads to increased production of reactive oxygen species (ROS) and
reactive nitrogen species in addition to the activation of several inflammatory
pathways within the body (Donath and Shoelson, 2011). ROS, specifically
superoxide anion (O2), can react with nitric oxide (NO), a marker and key player in
functions mediated by endothelial cells, and reduce the bioavailability NO, leading to
impaired endothelial cell function including angiogenesis (Roberts and Sindhu,
2009). Because insulin directly stimulates the production of NO in endothelial cells,
disrupted insulin signalling may disturb endothelial function by reducing NO
bioavailability (Bashan et al., 2009; Rains and Jain, 2011). Hence, insulin resistance
in the endothelium is associated with reduced insulin-stimulated NO production
contributing to micro and macro vascular complication in diabetic patients (Gage et
al., 2013). Vascular complications associated with type 2 diabetes are grouped as
microvascular and macrovascular. Microvascular complications include retinopathy,
diabetic nephropathy and neuropathy which all are resultant of impaired
angiogenesis (Fowler, 2011; Gage et al., 2013).
Page 36 of 167
Angiogenesis is an important feature in normal physiology and several
pathological processes that promotes and enhances the formation of new blood
vessels from pre-existing vessels (Carmeliet, 2005). Angiogenesis is tightly regulated
by the pro-angiogenic and anti-angiogenic factors that act on endothelial cells to
induce or inhibit endothelial growth and migration in order to initiate angiogenesis
(Adams and Alitalo, 2007). Vascular endothelial growth factor (VEGF-A), platelet
activating factor (PAF) and fibroblast growth factors are important pro-angiogenic
activators needed for stimulating endothelial cell growth and migration in order to
initiate angiogenesis (Levick, 2003; Johnson and Wilgus, 2014). VEGF-A is the most
important molecule controlling the morphogenesis of the blood vessels; it is
abundant in tissues consistently forming new vessels such as tumours, diabetic
retina, myocardium and endothelium (Adams and Alitalo, 2007; Johnson and Wilgus,
2014). Studies have shown that VEGF resistance leads to impaired angiogenesis in
type 2 diabetes resulting in development of various vascular complications
associated with type 2 diabetes (Shibuya, 2011) however the molecular mechanism
is not fully understood. Yang and colleagues showed that high glucose induced
apoptosis in endothelial cells through down regulation of VEGF mRNA expression
(Yang et al., 2008). The study showed that pre-treating cells with endogenous
VEGF-A prevented apoptosis mediated by high glucose (Yang et al., 2008).
1.3.4. Is selenium involved in cardio-metabolic disorders?
The use of anti-oxidants has been trialled to prevent chronic diseases caused by
oxidative stress (Lippman et al., 2009; Goodman et al., 2011; Rayman, 2012).
Dietary supplements such as the trace element Se, which is required for the
synthesis of the anti-oxidant selenoproteins (Brenneisen, Steinbrenner and Sies,
2005; Lipinski, 2011) have been used to reduce the effects of oxidative stress in
Page 37 of 167
various disease states including cancer, neurodegenerative disorders, type 2
diabetes and CVD (Rayman, 2012; Pillai, Uyehara-Lock and Bellinger, 2014).
However, increasing evidence from human, animal and in vitro studies suggests that
both low and high Se concentrations are associated with increased risk of type 2
diabetes and CVD (Bleys, Navas-Acien and Guallar, 2007; Bleys et al., 2008;
Labunskyy et al., 2011; Rayman et al., 2012; Rayman and Stranges, 2013; Rocourt
and Cheng, 2013; Zhou, Huang and Lei, 2013) making inappropriately high or low
Se status yet another risk factor for cardio-metabolic disorders.
1.3.5. The impact of Se on type-2 diabetes and CVD risks; observational
studies
A non-linear association between Se and type 2 diabetes has been observed. The
Selenium and Vitamin E Cancer Trial (SELECT) was designed to investigate the
effect of 200 µg/day of Se and 400 IU of vitamin E on the incidence of prostate
cancer (Lippman et al., 2009). SELECT results revealed a statistically non-
significant increase (relative risk=1.07, p=0.16) in the risk of diabetes in men taking
Se supplementation alone compared to the placebo group alone and Se combined
with vitamin E group (Lippman et al., 2009). In 2011 another meta-analysis of
SELECT study showed a beneficial effect of Se supplementation on prostate cancer
risk but type-2 diabetes and CVD risks have not yet been investigated in the updated
results (Klein et al., 2011). However, further secondary analysis of the SELECT trial
after 7 years of follow up showed a 17% increased risk of prostate cancer in men
taking vitamin E alone but showed no type 2 diabetes risk suggesting that vitamin E
may have a long term effect on prostate cancer risk only (Klein et al., 2011). An
evaluation of twenty-five observational studies showed that a 50% increase in Se
Page 38 of 167
concentration was associated with a 24% reduction in CVD risk (Flores-Mateo et al.,
2006). In observational studies, Se status was inversely associated with CVD risk
(Flores-Mateo et al., 2006; Klein et al., 2011). However, as observational studies do
not measure the effect of an intervention (Se) with an outcome (CVD risk),
randomised controlled trials are more suitable for the assessment of Se on CVD
risks.
1.3.6. The impact of Se in type-2 diabetes and CVD risk; randomised controlled
trials (RCTs)
High Se intake has been found to increase the risk of type 2 diabetes. A non-linear
association between Se and type 2 diabetes has been observed. One systemic
review observed a positive association between serum Se levels in populations with
low and high Se levels (Xin-liang et al., 2016). The study showed that there was a
significant prevalence of type 2 diabetes in a population with high blood Se
compared to populations with low blood Se levels (p<0.05, p=0.003) (Xin-liang et al.,
2016). In addition, serum Se was positively associated with type 2 diabetes in
populations with low serum Se, <97.5 µg/L (<0.5 µM) (Xin-liang et al., 2016). The
Nutritional Prevention of Cancer (NPC) trial was designed to investigate the effect of
Se supplementation on non-melanoma skin cancer among the 1312 men from low
Se areas of Eastern United States of America (USA). Despite the fact that Se
supplementation given as 200 µg/day of high-Se yeast showed a protective role
against prostate cancer, the post hoc analysis of the trial showed that long term Se
intake at 200 µg/day increased the risk of diabetes (Stranges et al., 2007). Men with
baseline serum Se more than 121.6 ng/mL given long-term supplementation with Se
had dysregulated glucose metabolism and insulin resistance (Stranges et al., 2007).
Page 39 of 167
In the UK, Se supplementation in the UK PRECISE trial had no effect on the
risk of type 2 diabetes as measured by plasma adiponectin in elderly participants
with low plasma Se (Rayman et al., 2012). Adiponectin is a hormone secreted by
adipocytes that is independently associated with decreased risk of diabetes, CVD,
hypertension and dyslipidaemia (Spranger et al., 2003; Yamamoto et al., 2014). In
participants with a mean plasma Se of 90.8 g/L treated with 100, 200 and 200
µg/day of Se-yeast, there was no effect on adiponectin levels after six months of
treatment (Rayman et al., 2012). The effect of Se on type 2 diabetes is controversial.
Randomised controlled trials show contradictory results, however animal and cell
culture experiments shows that high Se levels impair insulin signalling leading to
insulin resistance (Stranges et al., 2007; Rayman et al., 2012; Cold et al., 2015).
Considering that insulin resistance is closely linked to endothelial dysfunction and
increased risk of CVD, the role of Se in endothelial dysfunction and CVD risk has
attracted attention (Bleys et al., 2009; Laclaustra et al., 2010; S. Stranges et al.,
2010).
In humans, Se deficiency is thought to be linked to Keshan disease, an
endemic cardiomyopathy found in the Chinese region of Keshan where Se intake
was extremely low as a result of deficient Se intake (Chen et al., 2012). A meta-
analyses study shows that Se deficiency increases the risk of CVD and that long-
term Se deficiency adversely affects heart function (Thomson, 2004). Interestingly,
high Se intake and levels have been implicated in the development of CVD
(Rajpathak et al., 2005; Flores-Mateo et al., 2006; Bleys et al., 2008; Laclaustra et
al., 2010; Saverio Stranges et al., 2010; Rayman et al., 2011). The UK PRECISE
results contradict the NPC trial results because the two populations had different
Page 40 of 167
baseline plasma Se levels. The baseline Se of the NPC trial was 121.6 ng/mL
whereas the UK population baseline mean plasma Se was 90.8 µg/L. . The Se
supplementation might therefore be beneficial for the low-Se population of the UK
compared to the adequate-Se population of the USA. Also, the UK PRECISE trial
assessed adiponectin as a marker of type 2 diabetes instead of glucose levels or
insulin as compared to NPC trial which used confirmed diagnosis of type 2 diabetes.
However, it shows that Se is associated with type 2 diabetes risk.
In addition to the association of Se status and type diabetes risk, Se status is
also linked to CVD risk. Secondary analysis of the NPC trial assessing the incidence
of myocardial infarction, total cerebrovascular accidents and CVD from low-Se areas
of the eastern USA did not show an overall benefit of 200 µg/day of Se
supplementation in the prevention of CVD during 7.6 years of follow-up (Stranges et
al., 2006). A meta-analysis of the NPC and SELECT trials showed that there was no
proof that Se supplements prevent CVD therefore further trials of Se
supplementation in Se adequate population are discouraged (Rees et al., 2013).
1.3.7. Selenium status and lipid profiles
In comparison to RCTs with Se-containing supplements, studies on Se
supplementation and plasma lipids also show contradictory results based on the Se
status of the population studied (Bleys et al., 2008; Laclaustra et al., 2010; Saverio
Stranges et al., 2010; Rayman et al., 2011; Cold et al., 2015). One RCT in a
population of relatively low Se status supplemented with 100, 200 and 300 µg
Se/day concluded that Se supplementation had small beneficial effects on plasma
lipids in that population (Rayman et al., 2011). Six months Se supplementation
reduced the total cholesterol and non-HDL cholesterol levels in 100 and 200 µg/day
Page 41 of 167
group compared to the placebo (Rayman et al., 2011). Although the total cholesterol-
HDL cholesterol ratio decreased progressively with increased Se doses, there was a
moderate increase in HDL levels in the population given 300 µg/day of Se compared
to placebo (Rayman et al., 2011). Interestingly, a Danish study in which 468
subjects aged between 60 and 74 years were supplemented with 100, 200 and 300
µg/day of Se (as high-Se yeast) for up-to 5 years, found a significant increase in
plasma Se levels and a significant decrease in total cholesterol in the supplemented
groups compared to the placebo group (Cold et al., 2015). In addition there was a
small non-significant difference in the total:HDL-cholesterol ratio, non-HDL-
cholesterol and HDL-cholesterol after 6 months and 5 years of Se supplementation
(Cold et al., 2015). In comparison to the UK PRECISE study, the Danish PRECISE
study did not show any benefit of Se supplementation over placebo after 6 months or
5 years of Se supplementation.
Although the two European studies performed in low Se status countries
showed contradictory results on the benefits of Se supplementation on
serum/plasma lipids, studies conducted in USA showed a positive association of
serum Se with levels of plasma lipids (Bleys et al., 2008; Laclaustra et al., 2010).
Cross-sectional analysis of the NHANES III observational study investigating the
relationship between Se intake and the lipid profile of a representative sample of
USA adults aged between 19-64 years found a positive association between high
serum Se and serum concentrations of total cholesterol, low density cholesterol, high
density cholesterol, triacylglycerol, apolipoprotein B and apolipoprotein A-I (Bleys et
al., 2008). The results showed that participants with more than 147 µg/L of serum Se
had high levels of plasma lipids compared to those with low baseline serum Se
levels (124 µg/L). In the NHANES III, data collected between 2003 and 2004 showed
Page 42 of 167
that high serum Se levels were associated with increased concentrations of total and
LDL cholesterol (Laclaustra et al., 2010); a similar trend was observed in NHANES
III from data collected between 1988-1994 (Bleys et al., 2008).
The literature review reveals contradictory effects of Se supplementation on CVD
suggesting that experimental work is needed to clarify the effect of high Se levels on
CVD. Altogether, these findings suggest that high Se intake may be associated with
cardio-metabolic risk, particularly of insulin resistance, a hallmark of type 2 diabetes
and endothelial dysfunction; however, the underpinning molecular mechanisms are
not yet fully elucidated.
1.4. Molecular mechanisms involved in Se-induced insulin resistance
A study comparing the action of Se to that of insulin suggested that Se (500 -1000
µM, as selenate), has insulin-mimetic effects by promoting the phosphorylation of the
β-subunit of the insulin receptor substrate and insulin receptor 1 (Stapleton et al.,
1997). However, the study did not specify if the selenate supplementation was done
in Se-deficient or adequate conditions (Stapleton et al., 1997). Furthermore, as
selenoproteins are scavengers of ROS, it has long been understood that low Se
status leads to increased accumulation of ROS and reduced insulin sensitivity. On
the other hand, Wang and others found that high Se intake caused activation of
selenoproteins, including glutathione peroxidase and SELENOP, which led to an
influx of free fatty acids into rat liver and a dramatic increase in ROS production
resulting in impaired insulin signalling and hepatic insulin resistance (Wang et al.,
2014). Recently, Zeng reported that prolonged high intake of dietary Se increased
the expression of GPx1 in a dose-dependent manner and caused insulin resistance,
hyper-insulinaemia and glucose intolerance in gestating rats (Zeng et al., 2012).
Page 43 of 167
High Se intake was shown to induce glucose and insulin intolerance in rat
models by disturbing the insulin-signalling pathway and enhancing gluconeogenesis
in rat liver and hepatocytes (Wang et al., 2014). High levels of Se, as methylseleninic
acid (MSA), were able to activate several selenoproteins leading to enhanced
lipolysis in adipose tissue and to an influx of free fatty acids in rat liver (Wang et al.,
2014). This led to the accumulation of ROS as a result of an excessive supply of
electrons for mitochondrial oxidative phosphorylation (Wang et al., 2014). This study
indicates that high Se may lead to insulin resistance through the impairment of ROS
regulation. Increased ROS, particularly of hydrogen peroxide (H2O2), can activate
several Ser/Thr protein kinases such as IKKβ, PKC, JNK and p38, which can then
phosphorylate insulin receptor substrates (IRS)-1/2 on serine residues (Ser302,
Ser307 and Ser612). This can inhibit the capacity of IRS-1/2 to associate with the
insulin receptor which then suppresses the recruitment and thus activation of PI3-K
leading to the impairment of the insulin-signalling pathway (Tiganis, 2011).
The interaction of insulin with its receptor leads to a short activation of
nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, a membrane
complex responsible for superoxide production. Superoxide produced by NADPH
oxidase will be reduced to H2O2 under the action of superoxide dismutase. H2O2 can
then interact and thus inactivate two phosphatases: – protein tyrosine phosphatase
1B (PTP1B) and phosphatase and tensin homolog (PTEN). PTP1B is a negative
regulator of a substrate receptor-1 (IRS-1). IRS-1 is kept inactive by insulin-induced
H2O2 to enhance insulin signalling. The inhibition of PTEN and PTP1B by insulin-
induced H2O2 will therefore enhance the insulin response. Low levels of H2O2
activate PTEN and PTP1B. PTEN dephosphorylates PIP3 into PIP2 thus reducing the
activation of the Akt enzyme downstream of the insulin receptor signalling pathway.
Page 44 of 167
Increased amounts of selenoproteins following high Se intake will quench the insulin-
induced H2O2 and therefore leave PTP-1B and PTEN phosphatases active, leading
eventually to impairment of the insulin signalling pathway (Steinbrenner, 2013).
Figure 1.6 summarizes these mechanisms.
Figure 1.6. Potential influence of Se on the insulin cascade. Physiological levels of reactive oxygen species (H2O2) keep both PTEN and the PTP1B inactive. However, high Se levels and increased selenoproteins (SelP and GPx1) quench ROS produced thus activating PTP1B and PTEN. Active PTP1B prevents tyrosine phosphorylation of IRS-1 and active PTEN dephosphorylates PIP3 inhibiting Akt. Altogether, activation of PTP1B and PTEN impairs insulin signalling (Steinbrenner, 2013).
In recent years, several cancer studies have shown an association between
high Se intake and the activation of a recently recognised metabolic pathway called
ER stress (Wu et al., 2005; Zu et al., 2006; Hwang et al., 2007). High Se
concentrations were shown to cause ER-stress-mediated cell death by increasing
mobilization of calcium and caspases-3 and 9 (Uguz and Naziroglu, 2012).
Interestingly, ER stress has also been shown to be activated in animal models of
obesity and diabetes and to be implicated in impairing the insulin signalling pathway
and causing hepatic insulin resistance (Ozcan et al., 2004). Overexpression of ER
Page 45 of 167
stress markers has been observed in liver and adipose tissue from obese and
diabetic animals and in humans (Hotamisligil, 2010; Hummasti and Hotamisligil,
2010). Furthermore, ER stress has also been reported to play a key role in the
development of endothelial dysfunction in animal models of diabetes and
atherosclerosis (Kassan et al., 2012). However, the role of ER stress in insulin
resistance or endothelial dysfunction mediated by high Se has never been
investigated.
1.5. Endoplasmic Reticulum (ER) Stress
The ER is a multi-functional organelle important for cellular homeostasis. One of the
critical functions of ER is to sequester calcium (Ca2+) from the cytosol back to the ER
leading to calcium storage at high concentrations as recently reviewed by Schwarz
(Schwarz and Blower, 2016). ER has both smooth and rough components; the
smooth ER is mainly for lipid synthesis and metabolism while the rough ER controls
the synthesis, folding and structural manufacturing of proteins that are eventually
secreted or lodged in the Golgi apparatus (Schwarz and Blower, 2016), Proteins and
plasma membranes are translated in the ER membrane-associated ribosome also
known as the rough ER followed by transportation to the ER lumen (Schwarz and
Blower, 2016). This makes the ER an important organelle in proteostasis, a quality
control process in the cell that keeps proteomes functional (Flamment et al., 2012).
Disturbances to the function of the ER lead to accumulation of misfolded or unfolded
proteins in the ER lumen (Schröder and Kaufman, 2005) and this is known as ER
stress. Accumulation of unfolded proteins lead to the activation of a pro-survival
cellular response called the unfolded protein response (UPR). The purpose of UPR
is to recover ER homeostasis and enhance cell survival (Schröder and Kaufman,
Page 46 of 167
2005). However, if the response is insufficient, the UPR is prolonged, resulting in ER
stress and cells may become dysfunctional and undergo apoptosis (Schröder and
Kaufman, 2005; Flamment et al., 2012).
The three stress-sensing proteins found on the ER membrane are normally
kept bound to the immune-globulin protein (BiP) also known as Glucose regulated
protein 78 (GRP78) to be inactive under normal conditions and cell function
(Schröder, 2008; Hetz, 2012). Three stress-sensing proteins found on the ER
membrane are involved in the UPR response: the inositol-requiring enzyme (IRE-
1α), the protein kinase RNA-like ER kinase (PERK) and activating transcription factor
6 (ATF6) (Schröder and Kaufman, 2005; Flamment et al., 2012). During UPR, BiP
detaches to bind to misfolded proteins, activating the three stress-sensing proteins
(PERK, ATF6 and IRE-1α) (Schröder and Kaufman, 2005; Flamment et al., 2012).
Activated PERK phosphorylates eukaryotic initiation factor 2 (eIF2α), attenuates
protein translation, reduces the load of new protein synthesis and prevents further
accumulation of unfolded proteins within the ER.
Activated ATF6 cleaves to form ATF6 protease of 50kDA (ATF6p50).
ATF6p50 transcription factor enhances the expression of chaperone genes, such as
BiP, to increase the folding capacity within the ER (Hetz, 2012). Activated IRE-1α
triggers the activation of X-box binding protein (XBP-1) for cellular maintenance
(Schröder and Kaufman, 2005; Flamment et al., 2012; Inagi, Ishimoto and Nangaku,
2014). Paradoxically, chronic activation of the UPR promotes selective translation of
activating transcription factor 4 (ATF4) by phosphorylated eIF2α. ATF4 induces
expression of the pro-apoptotic protein CAAA/EBPα-homologous protein (CHOP)
and activates the expression of growth arrest and DNA damage-inducible protein
Page 47 of 167
(GADD34) (Schröder and Kaufman, 2005; Inagi, Ishimoto and Nangaku, 2014).
Activation of GADD34 results in a feedback loop as it interacts with protein
serine/threonine phosphatase (PP1) to dephosphorylate eIF2α in order to restore
global protein translation and suppress ATF4 translation to basal levels (Ma and
Hendershot, 2003). However, more experimental work is needed to further confirm
the role of GADD34 as a regulator of ER stress. Nonetheless, constant activation of
ER stress leads to irreversible ER damage resulting in cell apoptosis (Tabas and
Ron, 2011; Hetz, 2012). As shown in Figure 1.7, chronic UPR further activates
apoptosis through the mitochondrial apoptosis pathway.
Page 48 of 167
Figure 1.7. The UPR pathway. BiP dissociates from the luminal side of PERK, IRE1 and ATF6 thus activating them. Activated PERK phosphorylates eIF2α and inhibits protein translation to recover the cell and also increases translation of ATF4, a transcription factor that activates expression of several UPR target genes in favour of cell survival. Prolonged UPR due to sustained ER stress induces apoptosis through the activation of CHOP, an apoptotic marker and GADD34. Activation of IRE1 triggers its endo-ribonuclease activity to induce splicing of XBP-1 mRNA to produce a spliced form of XBP-1mRNA (sXBP-1). sXBP-1 is an active transcription factor that activates the expression of Regulated IRE1 dependent decay (RIDD) microRNA, which partake in the ER-associated protein degradation. Also RIDD, regulates the expression of chaperones in order to enhance folding and degradation of misfolded proteins. In addition, IRE1 activates phosphorylation of ASK-1 and JNK which recruits TRAF2 which are implicated in apoptosis during sustained ER stress (adapted from; (Hetz, 2012).
Unresolved ER stress initiates transcriptional up-regulation and inhibition of
the B cell lymphoma 2 (BCL-2) family of protein (BAX, BAK and BCL-2 proteins)
which are known to inhibit or promote apoptosis (McCullough et al., 2001; Hitomi et
al., 2004; Urra et al., 2013). ER stress is known to further trigger the activation of the
Page 49 of 167
pro-apoptotic proteins, BAX and/or BH antagonist killer (BAK),and at the same time
inhibit BCL-2 protein to trigger caspase dependent apoptosis (McCullough et al.,
2001; Hetz, 2012). Activation of a pro-apoptotic marker of ER stress, CHOP,
promotes the transcriptional upregulation of BCL-2-interacting-mediator of cell death
(BIM) and down regulates the expression of BCL-2 protein (Hetz, 2012). Up-
regulation of BIM and inhibition of BCL-2 proteins activates cytosolic release of
cytochrome c that in turn causes the activation of the caspase cascade to initiate
apoptosis (Szegezdi et al., 2006). Caspases are a family of endoproteases that
regulate cell death; they are the cysteine proteases that cleave specific aspartic acid
resides (Morishima et al., 2002). Caspases involved in apoptosis are classified by
their mode of action as either initiator (caspase-8 and -9) or effector caspases
(caspase-3, -6 and -7) (Kroemer and Martin, 2005). Cytochrome c binds to the
apoptotic protease-activating factor-1 (APAF1) to form an apoptosome which recruits
the initiator caspase-9 (Elmore, 2007). Activated caspase-9 cleaves the pro-
caspases-3 and -7 to initiate DNA fragmentation, chromatin condensation and
nuclear degradation leading to apoptosis (Elmore, 2007; Fuchs and Steller, 2011).
Caspases-3 and -7 have been implicated in ER-stress-induced apoptosis
(Morishima et al., 2002; Cheung et al., 2006; Tabas and Ron, 2011). In mouse
models cytochrome c release activates caspase-12 and induces ER-stress-mediated
apoptosis (Morishima et al., 2002). However, caspase-12 is lacking in humans and
instead ER-stress-mediated apoptosis in human cells is thought to be initiated by the
activation of caspase-8 which cleaves caspase-3 and -7 to trigger ER-stress-
mediated programmed cell death (Hetz, 2012). At the same time activation of the
IRE1α pathway leads to induction of the inflammatory and pro-apoptotic signalling
pathways such as c-Jun terminal kinases (JNK), apoptosis signal-regulating kinase
Page 50 of 167
(ASK1) and TNF-α receptor associated factor 2 (Inagi, Ishimoto and Nangaku,
2014). JNK is known to phosphorylate BCL-2 leading to the suppression of BCL-2;
inhibited BCL-2 activates release of the cytochrome c to activate the intrinsic
apoptosis pathway (Szegezdi et al., 2006). Moreover, recruitment of the ASK1
protein leads to the initiation of apoptosis through a complex mitogen-activated
protein kinase MAPKs-JNK-ASK1 signalling pathway which activates caspase-8
downstream, an initiator caspase which then activates effector caspases-3 and -7
(Zuo et al., 2004). In addition, activated IRE1α controls ER protein-loading by
degrading ER-associated microRNA (miRNA) known as IRE1-dependent decay
(RIDD). The ability of activated IRE1α to switch from splicing XBP-1 to
endoribonuclease activity is regulated by the threshold of the ER stress. During high
or chronic ER stress, IRE1α is activated to degrade RIDD miRNA more that to
splice the XBP-1 mRNA to prevent ER mRNA overloading (Hetz, Chevet and Oakes,
2015).
1.5.1 ER stress inhibitors; uses of chemical chaperones
Dysfunction of the calcium regulation in the ER or abnormal accumulation of mis-
folded proteins due to increased production of proteins or lipid inaugurates ER stress
(Hetz, 2012). The use of chemical chaperones has been shown to prevent and
reduce protein mis-folding and ER stress (Ozcan et al., 2006; Kuang et al., 2010;
Kim et al., 2013; Liu et al., 2016). Sodium 4-phenylbutyric acid (PBA) is a short-chain
unsaturated fatty acid which has chemical chaperone properties (Humeres et al.,
2014). PBA has been shown to improve ER folding and trafficking and therefore
reduces ER stress (Ozcan et al., 2006; Kuang et al., 2010; Liu et al., 2016).
Extensive research has been done to show the ability of PBA to restore proteostasis
Page 51 of 167
of the protein called cystic fibrosis transductance regulator which is prone to
misfolding and when misfolded causes cystic fibrosis (Balch et al., 2008). Hence,
PBA has been studied and developed as a treatment of cystic fibrosis. Other than for
fibrosis, PBA has been shown to reverse ER-stress-induced diabetes in the obese
Zucker rat (Ozcan et al., 2006).
One study showed that upon infection of astrocytes with the ts1 virus, there
was accumulation of gPr80env in the ER, initiating the UPR and a subsequent chain
of ER-stress events to cause cystic fibrosis (Liu et al., 2004). Moreover another
study showed that ts1 infected astrocytes resist accumulation of the gPr80env when
treated with 5 and 10 mM of PBA, emphasising the importance of PBA in prevention
of ER-stress induction in astrocyte cells (Kuang et al., 2010) . Additionally, PBA was
shown to suppress UPR target genes such as BiP and ER stress markers such p-
eIF2a and ATF4 in ts-1 infected astrocytes (Kuang et al., 2010). It did this by
increasing the protein-folding capacity rather than the degradation of misfolded
proteins further accentuating the role of PBA as a chemical chaperone that prevents
ER stress (Kuang et al., 2010). It is well established that tunicamycin and
thapsigargin are ER-stress inducers that initiate ER stress by inhibiting glycosylation
of proteins on the N-linked glycan and inhibit sarco/ER calcium ATPase, respectively
(Kubota et al., 2006). Several studies have shown that PBA prevents ER stress
induced by thapsigargin and tunicamycin in different cell lines such as astrocytes,
murine cardiac fibroblast and hepatocytes (Liu et al., 2004; Ozcan et al., 2006;
Kuang et al., 2010; Humeres et al., 2014).
ER stress is associated with conditions such as neurodegenerative disease,
cancer, diabetes and CVD as well as being implicated in atherosclerosis plaque
Page 52 of 167
rupture (Ozcan et al., 2006; Myoishi et al., 2007; Tabas, 2009; Kuang et al., 2010;
Wang and Kaufman, 2012). In recent years, it has been shown that several
metabolic situations, such as obesity and diabetes, increase the demand for protein
synthesis in the ER in the liver and other insulin-sensitive tissues, leading to an ER-
stress response and thereby contributing to the development of insulin resistance
and endothelial dysfunction (Ozcan et al., 2004; Jeschke et al., 2012). The three
arms of the UPR are intimately linked to inflammatory pathways participating in the
development of insulin resistance and eventually endothelial dysfunction.
Previous studies have implicated ER stress in the pathogenesis of hepatic
insulin resistance as well as atherosclerosis (Hotamisligil, 2010). Conditions such as
increased protein synthesis observed in obesity and other insulin-resistant states
lead to ER dysfunction (Araki, Oyadomari and Mori, 2003; Ozcan et al., 2004;
Sharma et al., 2008). It has been shown that a high-fat diet and pharmacologically-
induced ER stress in mice and cultured hepatocytes, respectively, result in increased
expression of protein tyrosine phosphatase (PTP)1B protein and its mRNA. PTP1B
is a notorious negative regulator of insulin signalling as it can dephosphorylate
tyrosine residues on the insulin receptor and IRS1/2 (Delibegovic et al., 2009;
Agouni et al., 2011). Agouni and colleagues showed that liver-PTP1B-deficient mice
had reduced hepatic ER stress response when fed a high-fat diet and were more
insulin sensitive than their wild-type littermates (Agouni et al., 2011).
ER stress has been implicated as one of the mechanisms involved in insulin
resistance through the activation of IRE1-dependent-JNK and nuclear factor kappa B
(NF-κB) (Ozcan et al., 2004; Hummasti and Hotamisligil, 2010; Ozcan and Tabas,
2012). IRE1-dependent-JNK leads to inhibition of insulin signalling by inactivating
Page 53 of 167
tyrosine phosphorylation of the insulin receptor; increases phosphorylation of the
IRS-1/2 on serine307 in insulin sensitive cells and organs, particularly liver and
adipose tissue resulting in insulin resistance (Ozcan et al., 2004; Hummasti and
Hotamisligil, 2010; Ozcan and Tabas, 2012). Chemical chaperones,
tauroursodeoxycholic acid (TUDCA) and PBA, have been shown to reverse ER
stress, restore glucose metabolism and improve insulin sensitivity in type 2 diabetic
mouse models (Ozcan et al., 2006; Yam et al., 2007; Amin et al., 2012). Additionally,
young diabetic mice treated with TUDCA showed reduction in ER stress markers as
well as increased levels of adiponectin and high circulating amounts of cholesterol
and C-reactive protein, suggesting an improved metabolic function in adipose tissue
and liver, thus preventing impaired ischaemia-induced neovascularization (Amin et
al., 2012). The use of chemical chaperones to reverse impaired insulin signalling
highlights the role of ER stress in insulin resistance.
1.6. The role of ER stress in endothelial dysfunction and cardiovascular
disease
Several studies have implicated ER stress in the development of atherosclerosis
(Erbay et al., 2009; Hotamisligil, 2010; Flamment et al., 2012; Chistiakov et al.,
2014). Expression of the ER-stress markers, ATF4 and XBP-1, was increased in
macrophages loaded with cholesterol (Li et al., 2005); furthermore, ER stress
markers, CHOP and BiP, were elevated in ruptured atherosclerotic plaques from
human coronary artery autopsy samples (Myoishi et al., 2007). Macrophage
apoptosis is a major process in the progression of advanced atherosclerosis and cell
models show that prolonged ER stress is responsible for CHOP-mediated
macrophage apoptosis through ER release of calcium and Ca2+/calmodulin-
Page 54 of 167
dependent protein kinase II (CaMKII) (Ozcan and Tabas, 2012). Studies mentioned
indicate that the ER stress response is linked to the development of atherosclerosis
and can increase the risk of CVD. Although ER stress is implicated in endothelial
dysfunction, the role of ER stress in the vasculature is yet to be fully validated.
A number of studies on cultured endothelial cells, animal models and humans
have linked ER stress to endothelial dysfunction (Sheikh-Ali et al., 2010; Basha et
al., 2012; Kassan et al., 2012; Ozcan and Tabas, 2012; Galán et al., 2014).
Homocysteine has been found to be a risk factor in CVD and in cultured endothelial
cells; homocysteine has been found to activate CHOP via the IRE1 pathway
resulting in ER-stress-mediated endothelial-cell death (Zhang et al., 2001).
Moreover, one study found elevated mRNA ER stress markers, IRE1 and ATF6, in
anatomical sites marked with atheroma and reduced blood flow from pig aortic
arches (Davies et al., 2013), thereby associating ER stress activation with disturbed
shear stress. Shear stress is defined as ―a biomechanical force determined by blood
flow‖ (Cunningham and Gotlieb, 2005). Disturbed shear stress leads to endothelial
dysfunction due to low endothelial NO-synthase (eNOS) production, low vasodilation
and low endothelial repair coupled with increased ROS and apoptosis. Endothelial
dysfunction as a preceding factor for atherosclerosis eventually results in ischemic
injury and CVD (Cunningham and Gotlieb, 2005).
Angiogenesis is one of the markers of endothelial dysfunction and current
studies have shown an involvement of ER stress markers in the angiogenesis
process (Dong et al., 2011; Lenna, Han and Trojanowska, 2014; Urra and Hetz,
2014; Binet and Sapieha, 2015). GRP78/BiP overexpression has been reported in
the synovium of rheumatoid arthritis patients, in contrast to mice models in which
Page 55 of 167
GRP78/BiP activation was linked to VEGF-induced angiogenesis (Lenna, Han and
Trojanowska, 2014). One study was investigating the role of GRP78 in tumour
growth by looking at the early phase of tumour growth called neovascularization,
also known as tumour angiogenesis; the study found that in heterozygote GRP78+/-
mice implanted with E0771 breast cancer cells, there was a 70% reduction in
tumour angiogenesis compared to GRP78 +/+ mice (Dong et al., 2011). The results
showed not only that ER stress is involved in tumour angiogenesis but
overexpression of ER-stress markers inhibits angiogenesis in the early phases of
cancer compared to the late phase of tumour implantation (Dong et al., 2011). In
addition experimental evidence suggests that ER stress might be involved in
endothelial dysfunction and diabetes associated vascular complications (Basha et
al., 2012). Anti-oxidants have been used as a therapy for the oxidative stress
implicated in type 2 diabetes (Samuel et al., 2010). However, Se (an anti-oxidant as
selenoproteins) has been shown to have insulin mimetic effects as well as impair
insulin signalling in insulin sensitive organs (Stapleton, 2000; Steinbrenner et al.,
2011).
High Se levels have a potential to induce ER stress (Wu et al., 2005;
Wallenberg et al., 2014). Several studies have linked ER stress to insulin resistance
and type 2 diabetes (Araki, Oyadomari and Mori, 2003; Ozcan et al., 2004, 2006;
Hummasti and Hotamisligil, 2010). Although Se status has been implicated as a risk
factor for type 2 diabetes and CVD ( Stranges et al. 2010; Stranges et al. 2007;
Steinbrenner et al. 2011; Laclaustra et al. 2010; Rayman & Stranges 2013; Rayman
2012; Bleys, Navas-Acien & Guallar 2008), few studies have linked the role of Se-
induced ER stress to the aetiology or progression of type 2 diabetes or other human
diseases (Wu et al., 2005; Zu et al., 2006; Hwang et al., 2007; Wallenberg et al.,
Page 56 of 167
2014). Moreover, the role of Se-induced ER stress on endothelial dysfunction or
diabetes complications such as vascular disease is unknown.
1.7. Selenium-induced ER Stress.
Se has been shown to activate apoptosis in prostate cancer cells through induction
of ER stress (Wu et al., 2005). In the study by Wu et al., 10 µM of methylseleninic
acid (MSA) induced ER stress in the human prostate cancer cell line, PC-3, and
furthermore induced ER stress-mediated apoptosis in a dose dependent manner
(Wu et al., 2005). ER-stress markers, phospho-PERK, GRP78/BiP and phospho-
eIF2 were activated by MSA in a time dependent manner from 6 hours to 15 hours.
Furthermore, while the ER-stress-associated apoptotic markers (cleaved caspase
12, PARP and CHOP) increased in a dose dependent manner, the markers of ER
stress (phospho-PERK, GRP78/BiP and phospho-eIF2) decreased (Wu et al.,
2005). Overexpression of GRP78/BiP alleviated MSA-induced ER stress (Wu et al.,
2005). The results shows that chronic ER stress activation leads to cell death.
Although the chronic ER stress dampens further activation of unfolded protein
response markers, continuous stimulation of chaperones such as BiP prevents
chronic ER stress activation.
Recently, a study was carried out to investigate the ability of MSA and
selenite to induce apoptosis in primary effusion lymphoma (PEL) cell lines which
concluded that MSA and selenite induce apoptosis through the activation of caspase
3, caspase 7 and caspase 9 while MSA induces caspase-9 dependent apoptosis
(Shigemi et al., 2016). Furthermore, MSA and selenite induced apoptosis via the ER
stress pathway though CHOP expression (Shigemi et al., 2016). High selenite
Page 57 of 167
concentration, 20 µM, has been shown to induce apoptosis through the activation of
ER stress in a time-dependant manner in human acute promyelocytic leukemia
(NB4) cells (Guan et al., 2009). In spite of reports showing the association between
ER stress and development of endothelial dysfunction in animal models of diabetes
and atherosclerosis, the role of ER stress in insulin resistance or endothelial
dysfunction mediated by high Se has never been investigated.
Page 58 of 167
1.8. Hypothesis:
Some epidemiological studies indicate that a supra-nutritional intake of Se correlates
positively with increased risk of diabetes and associated CVD; however, the
underpinning molecular mechanisms are not yet elucidated. ER-stress activation has
been implicated in insulin resistance, endothelial dysfunction and Se-induced cell
death in prostate cancer cells. Therefore, the hypothesis is that a high intake of Se
activates the ER-stress response in the endothelium, leading to endothelial
dysfunction.
1.9. Aims and Objectives:
Aim 1. To investigate the effect of Se treatment on the activation of ER stress
response in cultured endothelial cells and hepato-carcinoma cell lines.
Objectives:
1. To determine the dose- and time-response of Se treatment on ER-stress
activation in cultured hepato-carcinoma cell lines and endothelial cells using
selenite as source of Se.
2. To investigate arms of the ER-stress pathway activated by high Se
concentration in endothelial cells.
3. To determine the effects of high Se on the viability of endothelial cells and
hepato-carcinoma cell lines.
Aim 2. To investigate the role of high-Se-induced ER stress in endothelial cell
function.
Objectives:
1. To investigate the effect of high-Se-induced ER stress on NO availability in
cultured endothelial cells.
Page 59 of 167
2. To determine the impact of Se-induced ER stress on the NO signalling
pathway using western blot technique in cultured endothelial cells.
3. To investigate the impact of high Se concentration on ER-stress-mediated
production of ROS in cultured endothelial cells.
Aim 3. To determine the effect of high-Se-induced ER stress on the capacity of
endothelial cells for angiogenesis and apoptosis.
Objectives:
1. To determine the effect of high-Se-mediated ER stress on the process of
angiogenesis using cultured endothelial cells as models.
2. To investigate the impact of high Se and the involvement of ER stress on
endothelial-cell death.
3. To determine the apoptotic pathway involved in the ER-stress-mediated
apoptosis caused by high Se concentration in cultured endothelial cells.
Page 60 of 167
Chapter 2. Materials and Methods
Page 61 of 167
2.1. Cells and cell culture
EA.hy926 cell line, a hybrid cloned from the human umbilical vein cells and the A549
lung carcinomatous cells and HepG2 cells, hepatocellular carcinoma cells, were
obtained from the American Type Culture Collection (ATCC). Human umbilical vein
endothelial cells (HUVECs) were obtained from Lonza (Slough, UK.). EA.hy926 and
HepG2 cells were routinely cultivated in high glucose (4.5g/L) Dulbecco's Modified
Eagle's Medium (DMEM) (Sigma, Gillingham, UK.) supplemented with 10% foetal
bovine serum (FBS; Invitrogen, Paisley, UK.), L-glutamine (2 mmol/L) and 100
I.U/mL of penicillin and 100 µg/mL of streptomycin. (Sigma, Gillingham, UK.), and
were maintained at 37 °C in a humidified atmosphere with 5% carbon dioxide (CO2)
(Agouni et al., 2010). To maintain the cell lines, cells were passaged at 80-90% of
confluence using trypsin-EDTA (Sigma, Gillingham, UK.), then plated in 25 cm2
ventilated flasks and six well plates.
HUVECs were routinely maintained in M200 media (Gibco® through Life
Technologies, Paisley, UK). M200 media forms a complete culture environment for
human large vessel endothelial cells. It contains both essential and non-essential
amino acids and vitamins. To support the plating and proliferation, the media was
supplemented with low serum growth supplement (Gibco® through Life
Technologies, Paisley, UK). The low serum growth supplement (LSGS) components
included foetal bovine serum, recombinant human basic fibroblast growth factor,
hydrocortisone, recombinant human epidermal growth factor and antibiotics.
HUVECS were seeded at cell density of 10,000-20,000 cells/cm2 per well in a
ventilated T75 cm2. The cells were maintained at 37°C in a 95% humidified
atmosphere with 5% CO2. Cells were left to reach a 70-80% confluence before
passing. Cells were detached with StemPro® Accutase® Cell Dissociation Reagent
Page 62 of 167
(Gibco® through Life Technologies, Paisley, UK) which is less harsh to human
primary cell lines than trypsin-EDTA. Media was changed every 48 hours until
desired confluence was reached. The HUVECs were maintained up to passage 6
post-recovery.
2.2. MTT viability assay
This assay is based on the conversion of the yellow tetrazolium salt 3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to purple formazan
crystals by metabolically active cells and provides a quantitative estimate of viable
cells (Vistica et al., 1991). EA.hy926 cell lines, HUVECs and HepG2 cells were
seeded in 96-well plates (50,000 cells/well), grown for 24 hours, and then treated for
24 hours with 0.5µM, 2µM, 3µM, 5µM, 10µM, 20µM, 30µM,100µM and 1000µM
sodium selenite, sodium selenate and seleno-methionine (SelMet) (Sigma-Aldrich,
Gillingham, UK). After this period, MTT (Sigma-Aldrich, Gillingham, UK) at the final
concentration of 0.5 mg/mL was added to each well and incubated for 4 hours at
37°C, 95% humidified incubator with 5% CO2. Then, 99.7% (v/v) of Dimethyl
Sulfoxide (DMSO) (Fisher Scientific, USA), was added to each well to solubilise the
MTT reagent. Spectrophotometric absorbance was measured at 540 nm (reference
620 nm) using a multi-plate reader. Experiments were performed in sample size of 4
in 16 replicates, and the relative cell viability (%) was expressed as a percentage
relative to the untreated control cells.
Page 63 of 167
2.3. ER stress induction; time course and dose response of sodium selenite For Se treatments, HUVECs and HepG2 cells were seeded into 6-well plates at the
density of 200,000 cells/well or seeded into a well-ventilated T25cm2 at a density of
500 000 cells/well 24 hours before the treatments. Sodium selenite, sodium selenate
and seleno-methionine (SelMet) (Sigma-Aldrich, Gillingham, UK) have been reported
to be used in cell cultures, animal and human studies to study the effects of high Se
in cancer cells (Rayman, 2005; Goodman et al., 2011; Dennert et al., 2012; S.-H.
Park et al., 2012). Inorganic Se compounds are mostly used in nutritional
supplement (Fairweather-Tait, Collings and Hurst, 2010). To investigate the optimal
dose and optimal time for Se to induce ER stress in cells, a stock solution of 1 mM
sodium selenite was prepared by adding 1 g of sodium selenite into 5.8 mL of sterile
phosphate buffered saline (PBS) and filtered through a 0.2 μm filter. Then, dose-
response and time-course studies were performed in the cells. Briefly, twenty-four
hours after cells were seeded into 6-well plates at the density of 200,000 cells/well,
culture media were replaced with fresh complete media (M200 media and LSGS) for
HUVECs and for EA.hy926 cell lines with 10% FBS DMEM with L-Glutamine (2
mmol/L), 100 I.U/mL of penicillin and 100 µg/mL of streptomycin. Cells were then
incubated with sodium selenite at different concentrations ranging from normal
concentrations to supra-nutritional concentrations of (0.5 -10 µM) at different time
points (4, 8 and 24 hours) with and without a chemical chaperone PBA (Sigma-
Aldrich, Gillingham, UK). The cells were finally harvested for different experiments.
2.4. RNA extraction
To determine the effect of dose-response and time-course of sodium selenite on the
mRNA expression of various genes including those related to ER stress response,
HUVECs were seeded at a density of 200,000 cells/well in a 6-well plates and then
Page 64 of 167
treated with sodium selenite when they were 60-70% confluent. Cells were treated
with 0.5, 5 and 10 µM of sodium selenite for 4, 8 or 24 hours. HepG2 cells were
seeded at a density of 200,000 cells/well in a 6-well plates and then treated with 0.5,
5 and 10 µM sodium selenite when they were 60-70% confluent for 8 hours. Cell-
culture medium was removed from plates and they were then washed twice with
1mL of PBS. Total RNA was isolated from HUVECs and HepG2 cells using RNeasy
Mini Kit (QIAGEN, Manchester, UK). RNeasy technology simplifies total RNA
isolation by using guanidine-isothiocyanate lysis with the speed and purity of silica-
membrane purification. RNA extraction was performed following the manufacturer‘s
protocol with a modification of eluting the RNA pellet with 30 µL of nucleic acid-free
water, leaving to incubate for 10 minutes at room temperature then spinning for 1
minute at ≥8000 g. RNA was subsequently quantified using a Nanodrop
spectrophotometer (Thermo Fisher Scientific, Loughborough, UK).
2.5. cDNA synthesis and mRNA gene expression analyses
RNA was then purified by digesting DNA. Briefly, a total of from 200 ng of total RNA
to 1µg of total RNA was used and mixed in 96-well polymerase chain reaction (PCR)
plates with 1X reaction buffer, DNase I (Thermo Fisher Scientific, Loughborough,
UK) and topped up to a total of 10 µL with nucleic acid-free water (Sigma-Aldrich,
Gillingham, UK). The reaction mixture was digested by heating to 37°C for 30
minutes in a thermal cycler (Applied Biosystems, UK). The reaction was stopped by
incubating at 65°C for 10 minutes with 1 µL of 1X EDTA in a thermal cycler.
After DNA digestion, cDNA was synthesised from the same reaction plate.
Master mixer was prepared containing 5X reaction buffer, Riboblock RNAse inhibitor,
deoxynucleotide triphosphates (dNTPs) and reverse transcriptase enzyme (Thermo
Page 65 of 167
Fisher Scientific, Loughborough, UK) and topped up with nucleic acid-free water to
make 1X concentration. One µL of Oligo(dT) (Sigma-Aldrich, Gillingham, UK), a
short sequence of deoxy-thymine nucleotides primer to polymerise to the poly (A) tail
of the mRNA, was added to each reaction and incubated at 65°C for 5 minutes in a
thermal cycler (Applied Biosystems, UK). After incubating with Oligo(dT), 8 µL of
Master Mix were added to make up a total volume of 20 µL and the cDNA was
synthesised for 1 hour at 42°C in a thermal cycler followed by 5 minutes at 70°C to
stop the reaction. The cDNA was then diluted 1:10 with Tris-EDTA buffer and used
for immediate analysis or stored at -80°C until subsequent use.
Targeted genes were amplified by real time PCR (qPCR) using GoTaq®
qPCR Master mix (Promega Corporations, Madison, USA). GoTaq® qPCR Master
Mix is a 2X master mix that includes a proprietary dsDNA-binding dye, GoTaq® Hot
Start Polymerase, magnesium chloride (MgCl2), dNTPs and a proprietary reaction
buffer excluding cDNA sample and primers of targeted genes (Promega, 2014), as
previously described (Agouni et al., 2011). A master mix was prepared by mixing the
following reagents for each sample: 3 µL of nucleic acid-free water, 6 µL of 2X
GoTaq® qPCR Master mix and 1 µL of forward and reverse primers each. Eight µL
of prepared master mix was then added to each well containing 2 µL of cDNA
samples or standard curve samples. Five standards were prepared for each gene by
serial dilutions of 1:3 of the sample containing both the highest dose of treatment
making a range of 1:1 to 1:81. The 96-well qPCR plates with samples were spun for
1 minute at 3,600 g. The samples were then amplified in Applied Biosystems 7500
instrument for 40 cycles with parameters as follows: 94°C for denaturing (30
seconds), 60°C (30 seconds) for annealing and 72°C (1 minute) for elongation.
Page 66 of 167
Relative gene expression was calculated using the standard curve method. The list
of primers used in the experiments is shown in Table 2.1.
Table 2.1 List of human forward and reverse primers used in qPCR experiments.
Target
Gene
5′ → 3′ Forward primer 5′ → 3′ Reverse primer
β-Actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT
BiP CATCACGCCGTCCTATGTCG CGTCAAAGACCGTGTTCTCG
CHOP GAACGGCTCAAGCAGGAAATC TTCACCATTCGGTCAATCAGAG
ATF4 CCCTTCACCTTCTTACAACCTC TGCCCAGCTCTAAACTAAAGGA
VEGF-A AGGGCAGAATCATCACGAAGT AGGGTCTCGATTGGATGGCA
2.6. Conventional PCR for XBP-1
To further investigate the activation of Se-induced ER stress in HUVECs, spliced and
unspliced XBP-1 mRNA expression was determined with conventional PCR. The
size difference between the spliced and the unspliced XBP-1 is 26 base pairs. To
make PCR products, 0.5 µL of cDNA, 7.5 µL of nuclease free water (Promega
Corporations, Madison, USA) 10 µL of Gotaq® G2 Hot Start Green Master Mix
(Promega Corporations, Madison, USA), 2 µL of human XBP-1 forward primer
5‘CCTTGTAGTTGAGAACCAGG3‘ and reverse primer
5‘GGGGCTTGGTATATATGTGG3‘ (Sigma-Aldrich, Gillingham UK) were amplified
with a Techne thermal cycler (Bibby Scientific Ltd, Staffordshire UK ) . The
amplification process was as follows;
Page 67 of 167
Denaturing;
94 ºC for 5 minutes
Annealing;
94 ºC for 30 seconds
58 ºC for 30 seconds x40 cycles
72 ºC for 1 minute
Extension; 72 ºC for 7 minutes
Holding stage; 4 ºC indefinitely.
In each experiment, both positive (thapsigargin treated cDNA) and negative
control samples (no cDNA sample) were included for quality control measures. PCR
products were electrophoresed on 2.5% agarose gel with 8 µL of Safe View gel
nucleic acid stain (NBS Biological ltd, UK) and gels were visualized with Gel Doc™
EZ Imager (Bio-Rad, USA).
2.7. Western Blot
2.7.1. Protein extraction
After treatments, plates were removed from the incubator and put on ice to keep the
temperature as close to 4°C as possible to inhibit any enzymatic activity that might
cause protein degradation (proteases) or dephosphorylation of phosphatases. Media
were disposed of and cells were carefully washed twice with 1 mL of cold PBS.
Then, whole-cell lysates were prepared by extraction in 200 µL/well of radioimmuno-
precipitation assay (RIPA) lysis buffer (10 mM Tris-HCl, pH 7.4; 150 mM NaCl; 0.1%
SDS; 1% Triton-X100; 1% Sodium deoxycholate; 1 mM NaF; 5 mM EDTA; 1 mM
sodium orthovanadate; cocktail of protease inhibitors (Thermo Fisher Scientific,
Loughborough, UK) at 4°C (Agouni et al., 2011). The cells were then scraped using
a cell scraper to collect all the lysates in one corner of the well and then transferred
Page 68 of 167
into labelled 1.5 mL micro tubes (Eppendorf) using a 200 µL pipette. The cell lysates
were then clarified by centrifugation at 4°C for 15 minutes at 14,000 g. The
supernatant was carefully transferred without disturbing the pellet of cell debris, into
new labelled 1.5 mL micro tubes. Cell lysates (samples) were assayed for protein
quantification following procedure on section 2.7.2 and then stored at -20°C until
further analysis.
2.7.2 Protein assay
Protein concentrations were determined using the colorimetric bicinchoninic acid
(BCA) assay (Thermo Fisher Scientific, Loughborough, UK). BCA assay is based on
the principle of reduction of Cu+2 to Cu+ by proteins in an alkaline environment
(Olson and Markwell, 2007). The BCA assay primarily relies on two reactions; firstly,
the peptide bonds in protein reduce copper (Cu+2) ions from the cupric sulfate to
form cuprous cation (Cu+) (a temperature dependent reaction). Secondly, two
molecules of bicinchoninic acid chelate with each Cu+ ion formed in the first reaction,
forming a purple-coloured product that strongly absorbs light at a wavelength of 540-
562 nm. The bicinchoninic acid-Cu+ complex is influenced in protein samples by the
presence of cysteine/cysteine, tyrosine, and tryptophan side chains. At higher
temperatures (37 to 60°C), peptide bonds assist in the formation of the reaction
product (purple coloured complex). The amount of purple colour produced (BCA/Cu+
complex) or reduced Cu+2 is proportional to the amount of protein present in the
solution (Olson and Markwell, 2007).
Bovine serum albumin (BSA) standard curve samples (0.125, 0.25, 0.5, 0.75,
1, 1.5 and 2 mg/mL) were prepared in RIPA per the manufacturer‘s instructions
(Thermo Fisher Scientific, Loughborough, UK). Then, 5 µL of samples and standards
Page 69 of 167
were added in duplicates into a 96-well plate. The blank used was RIPA buffer only.
Then, 200 µL of mixture of Pierce™ BCA reagents A and B (Thermo Fisher
Scientific, Loughborough, UK) at the ratio of 1:50, was added to each well containing
standards, samples or blanks. The plate was then gently mixed for few seconds on a
plate shaker. After incubation for 30 minutes at 37°C, a purple colour had developed
in the wells. Then the amount of protein present in each well was quantified by
measuring the absorption spectrum at 540 nm within one hour of incubation and by
comparing with known concentrations of the BSA standard curve. Briefly, a standard
curve was constructed using Microsoft Excell and the protein concentrations were
calculated using the standard curve obtained. The desired coefficient of
determination (R2) was always over 0.96.
2.7.3. Sample preparation and protein denaturation for electrophoresis.
Protein samples were prepared for gel electrophoresis by mixing them in a 1:1 ratio
with loading buffer containing 250 mM Tris-HCl pH 6.8, 10% sodium dodecyl sulfate
(SDS), 50% glycerol and 0.025% bromophenol blue. SDS is an anionic detergent
which denatures secondary and non–disulphide–linked tertiary structures, and
applies a negative charge to each protein in proportion to its mass. Glycerol is added
to increase the density of the samples to layer the samples at the bottom of the gels,
and 50% bromophenol blue is a tracking dye to monitor protein migration. Then
samples were heated to 95°C (6 minutes) in a heating block to further promote
protein denaturation and help SDS to bind. Samples were then processed for
western blotting or stored at -20°C until further analysis.
Page 70 of 167
2.7.4. Western blotting analysis.
After protein concentration and sample preparation as previously outlined, equivalent
amounts of protein (20-25 μg) per sample were resolved by SDS-polyacrylamide
gels (4-12%) (Sigma-Aldrich, Gillingham UK) for 1 hour 30 minutes at 100 volts in a
TruPAGE™ TEA-Tricine SDS running buffer (Sigma-Aldrich, Gillingham UK) and
transferred to a Immobilon-FL polyvinylidene difluoride (PVDF) transfer membrane
(Merk Millipore®, Tullagreen, Germany) pre-soaked in methanol to activate the
membrane. A wet transfer method was used to transfer proteins form the gel to the
PVDF membrane for 2 hours at 70 volts or at 35 volts overnight (16 hours) at 4ºC in
a NuPAGE® transfer buffer (Novex by Life Technologies, USA). The membranes
were then blocked in Tris-buffered saline (TBS) containing 0.1% Tween 20 (TBS-T)
and 0.1% (w/v) non-fat dry milk at room temperature with regular shaking for 1 hour.
Blot membranes were washed four times with TBS-T, 10 minutes for each wash.
Membranes were then incubated overnight at 4°C with regular shaking with the
appropriate dilution of the following primary antibodies: polyclonal rabbit anti-BiP at
1:500 dilution, monoclonal rabbit anti-phospho-eIF2α (S473) at 1:1,000 dilution,
polyclonal rabbit anti- eIF2α at 1:1000, monoclonal mouse anti-eNOS antibody at
1:300 dilution, polyclonal rabbit anti-caveolin-1 at 1:300 dilution, monoclonal rabbit
anti-phospho-eNOS at 1:500 dilution, mouse, polyclonal rabbit anti-VIMP (SelS) at
1:500 (Cell Signalling Technology, Boston, USA) and mouse anti-β-actin diluted at
1:5,000 (Santa Cruz, UK) were used as a loading controls. All primary antibodies
recognize human proteins.
The membranes were then washed at least three times for 10 minutes per
wash in TBS-T and incubated for 1 hour at room temperature with the appropriate
fluorophore conjugated goat anti-mouse or goat anti-rabbit antibodies 1:1,5000
Page 71 of 167
(LICOR, UK). Immuno-reactivity was visualized with fluorophore conjugated
secondary antibodies were detected immediately after washing with ODYSSEY®CLx
infrared imaging system scanner (LI-COR Biotechnology - UK Ltd, Cambridge, UK).
Each experiment was repeated at least three times.
2.8. Measurement of apoptosis using flow cytometry
Apoptosis was measured using ApoScreen® Annexin V Apoptosis Kit
(SouthrenBiotech, LifeTechnologies, UK). The ApoScreen® Annexin V Apoptosis Kit
employs an R-phycoerythrin-labelled Annexin V (Annexin V-PE) in concert with 7-
amino actinomycin dye (7-AAD) to evaluate sub-populations of cells undergoing
apoptosis. During the early stages of apoptosis, cells begin to display the inner
phospholipid membrane component called phosphatidylserine (PS) on the outer cell
membrane. PS becomes readily detectable by staining the cells with Annexin V-PE.
As the plasma membrane becomes increasingly permeable during the later stages of
apoptosis, 7-AAD can readily move across the cell membrane and bind to cellular
DNA, providing means for identifying those cells that have lost membrane integrity
through mechanisms including necrosis. When cells are double stained with Annexin
V-PE and 7-AAD, four different cell populations may be observed as shown in Figure
2.1: unstained cells, cells stained with Annexin-V or 7-ADD only, and cells that are
stained with both Annexin V and 7-ADD dyes.
Page 72 of 167
Figure 2.1. FACS analyses of the apoptotic cells. PE represents the detector for the Annexin V and PerCPcy5-5 represent the detector for 7-AAD dye. Q1 is for necrosis, Q3 is the negative live cells and Q2 and Q4 are apoptotic cells.
EA.hy926 cells were plated in 6-well plates and after reaching 70-80%
confluence, were treated with various concentrations of sodium selenite for 24 hours
in the presence or absence of PBA (Sigma-Aldrich, Gillingham, UK). Cells were then
detached with trypsin and centrifuged. PBA is a chemical chaperone that inhibits ER
stress by stabilising protein conformation in the ER (Ozcan et al., 2006 ). Medium
was discarded and the pellet was washed twice with PBS. Cells were then re-
suspended in cold 1X binding buffer at the concentration of 106 to 107 cells/mL. Then
100 µL of cell suspension was added to one Falcon tube for each sample. Cells and
controls were incubated with 10 µL of Annexin V-PE dye for 15 minutes on ice,
protected from light, followed by addition of 380 µL of 1X binding buffer and 10 µL of
7-ADD dye. Samples were then immediately analysed by FACS Canto II and data
captured and analysed.
Page 73 of 167
Compensation set up was performed before each experiment to assure the
accuracy and the quality of the results and to discriminate ‗spillover‘ of 7–ADD
fluorescence on the background of the Annexin V fluorescence. Four tubes were set
up as follows:
Tube 1: No stain
Tube 2: 7-ADD dye
Tube 3: Annexin V dye
Tube 4: Both 7-ADD and Annexin-V dyes.
Samples were analysed, compensation was performed and targeted at less than 40% of the ‗spillover‘ of each dye into the other dye (PE-%PerCy5-5=20% and PerCy5-5-%PE= 39%).
2.9. Caspases 3/7 activity
Caspases 3/7 activity was measured using Caspase-Glo® 3/7 Assay (Promega
Corporation, Madison, USA). Caspase-Glo® 3/7 reagent contains a pro-luciferin
attached to Z-DEVD-amino-luciferin, which is an alternative substrate for luciferase
and specific for protease cleavage by caspase-3 and caspases-7. Caspase-3/7
cleaves DEVD (Benzyloxycarbonyl-Asp (OMe)-Glu (OMe)-Val-Asp (OMe) just after
the second aspartic acid residue (D), and the resulting aminoluciferin. Aminoluciferin
is a luminescent substrate for the luciferase reaction. The light output from the
luciferase reaction is directly proportional to the activity of the caspases enzyme.
EA.hy926 cells were grown in a 96-well white-walled plates at the density of
10,000 cells per well in 100 μL of DMEM media constituted with 10% FBS, 1%
penicillin/Streptomycin and 1% NEAA. Cells were incubated at 37°C in 5% CO2 and
incubated at 95% humidity for 24 hours before treatments. Thereafter, cells were
treated with varying concentrations of sodium selenite, as stipulated before, or 1mM
Page 74 of 167
of staurosporine in the presence or absence of 20 mM of PBA and 50 µM of
Caspase® 3/7 inhibitor in serum, antibiotics and NEAA-free medium for either 8 or
24 hours. Culture Plates were left to equilibrate at room temperature for 15 minutes
and 100 µL of Caspase-Glo® 3/7 Reagent (Promega Corporations, Madison, USA)
was added to each well. The mixture was mixed by using a plate shaker at 400 rpm
for 30 seconds and left in the dark at room temperature for 2 hours. The activity of
caspase 3/7 was then measured using a luminometer. The optical densities were
subtracted from the blank and the activity was plotted as a percentage and analysed
using one way-ANOVA using Graph Pad Prism version 7 software.
2.10. Measurement of reactive oxygen species
Reactive oxygen species such as H2O2, peroxynitrite (ONOO-), hydroxyl radicals
(OH), hydroperoxyl radicals (HOO), superoxide (O2–) and oxygen radicals are
produced in cells and the accumulation of intracellular ROS contributes to insulin
resistance and endothelial dysfunction. Dihydroethidium (DHE) dye is specifically
oxidised by O2–, the main ROS in the vasculature, and the oxidized dye intercalates
with nuclear DNA to fluoresce a red colour. The fluorescence intensity in the nucleus
is proportional to the amount of O2– present in the cell (Uy, McGlashan and Shaikh,
2011).
EA.hy926 cells were plated at the density of 200,000 cells per well and left to
grow to 60-70% of confluency. Twenty-four hours later, sodium selenite prepared in
PBS was added to the media at the concentrations of 0.5, 5, 10 and 20 µM and
incubated for 8 hours at 37°C, 95% humidity and 5% CO2. We have used H2O2 at the
concentration of 100 μM incubated for 45 minutes as a positive control. After
treatments, medium was transferred into 15 mL tubes. Cells were detached with
Page 75 of 167
trypsin-EDTA for 2-3 minutes at 37°C, 95% humidity and 5% CO2 and trypsin
deactivated with 2 mL of complete medium. Cells were then transferred into 15 mL
tubes containing the medium followed by centrifugation at 500 g for 10 minutes. The
pellet was washed twice with PBS. Cells were then re-suspended in 1 mL of PBS
and mixed with DHE at a final concentration of 10 µM. Cells were left for staining for
30 minutes in the incubator at 37°C, 95% humidity and 5% CO2. ROS were then
measured by flow cytometry using FACS CANTO II (BD Bioscience, UK). Negative
and positive cells were plotted using the positive sample and DHE negative cells
(P2) were separated from the positive cells (P3). All cells in the P3 channel were
considered positive for DHE as shown in Figure 2.2. Cells positive for DHE were
plotted in the graph pad and samples compared to the negative control.
Figure 2.2. FACS gate discriminating DHE positives from DHE negative cells. EA.hy926 cells treated with 100 μM of H2O2 to discriminate DHE positive cells from the DHE negative cells. DHE negative cells were captured in the P2 channel and the DHE positive cells were collected in the P3 channel.
2.11. Nitric Oxide (NO) measurement: Griess assay
Nitric Oxide (NO) is rapidly oxidized to nitrite and/or nitrate by oxygen therefore NO
produced can be estimated by determining the concentration of nitrite and nitrate
end-products in biological systems. The Griess test was used to measure the
concentration of nitrite as an indirect way of estimating the levels of NO. In this
Page 76 of 167
method, the Griess reagent kit (Molecular Probes, Life Technologies, UK) was used
following the manufacturer‘s protocol.
HUVECs cells were plated in 96-well plates at a density of 10,000 cells per
well and left to attach for 24 hours. Then, cells were treated with 0.5, 5, 10 and 20
µM sodium selenite in the presence or absence of 20 mM of PBA for 24 hours. For
treatments in the presence of PBA, cells were pre-treated with PBA for 12-14 hours
before addition of selenite. Standards were prepared from a manufacturer‘s stock
100 µM of nitrite in 1:2 serial dilutions with the lowest concentration being 1.56 µM of
nitrite. Samples were then allowed to react with 20 µL of 1:1 of sulphanilamide (SA):
N-naphthyl-ethylenediamine (NED). The samples and standards were then topped
up to 300 µL with deionized water and incubated for 30 minutes at room
temperature. SA was dissolved in 5% phosphoric acid to react with nitrite and/or
nitrate to form a transient diazonium salt and NED, followed by a, a stable azo
compound. Spectrophotometric absorbance was measured at 540 nm using a multi-
plate reader. The intensity of the azo dye is directly proportional to the amount of
nitrite/nitrate in the sample which is also proportional to the amount of NO produced.
2.12. In vitro tube-like structure formation assay on Matrigel® matrix
HUVECs were seeded into 6-well plates at the density of 200,000 cells/well
overnight followed by treatment with 0.5, 5 and 10 µM of sodium selenite for 24
hours in the absence or presences of PBA (Sigma, Gillingham, UK) or PERK
Inhibitor I, GSK2606414 (Calbiochem®, Millipore, USA). Then, cells were seeded
(100 000 cells per well) on 24-well culture plates coated with a basement membrane
preparation extracted from Engelbreth-Holm-Swarm murine sarcoma (Matrigel®; BD
Bioscience, Oxford, UK). To perform the experiment, 250 µL of Matrigel® substrate
Page 77 of 167
diluted with serum-free medium (1∶1 dilution) was added into each well of 24-well
plates and allowed to solidify for 1 hour at 37°C. While the Matrigel®; was solidifying,
cells were washed with 1 mL of PBS twice, trypsinised and centrifuged to collect
cells in a 15 mL tube. Supernatant was discarded then, cells were mixed with M200
medium supplemented with LSGS and plated on coated 24 well plates. Untreated
cells cultured in M200 medium without LSGS were used as the negative control.
HUVECs were incubated for further 6 hours and tube-like structures formation was
examined using an inverted phase contrast microscope. Then, using ImageJ
software, the number of tubes formed (Mesh) were counted in 5 different blind fields,
averaged then compared across the different samples. Experiments were performed
in triplicates.
2.13. Statistical Analysis
Statistical analysis was performed using GraphPad Prism® version 7 software using
both one-way Analysis of Variance (ANOVA) and two-way ANOVA. A p-value of less
than 0.05 was considered as statistically significant between the control and the
different concentrations of sodium selenite. Results were expressed as mean,
standard error of the mean (SEM). Dunnett‘s and Tukey‘s multiple comparison test
(post hoc test) were performed from data showing statistically significant results in
one-way ANOVA whereas Bonferroni‘s post-hoc test was performed from data
showing statistically significant results in two-way ANOVA.
Page 78 of 167
Chapter 3. Results
High selenium treatment activates the ER stress response in cultured endothelial cells and hepatocytes.
Page 79 of 167
3.1 Introduction
Se is an essential trace element in human health (Rayman, 2012). Se concentration
has a ―U‖ shaped relationship to human disease, meaning that both very high
plasma Se concentrations (>2M or >300 g/day of Se) and Se deficient status (<
0.5 M/ 60 g/day of Se) are associated with an increased risk of diseases such as
type 2 diabetes and CVD (Stranges et al. 2010). Most of the Se supplements for
human and animal consumption contain the inorganic form of Se, selenite (Rayman,
Infante and Sargent, 2008; Burk and Hill, 2015). Selenite has been well investigated
due to its anti-oxidant activity as it is plays a role in cellular redox homeostasis
(Rayman, 2012; Burk and Hill, 2015). Se is available in both organic and inorganic
forms; inorganic forms of Se include, selenite and selenate, while the organic forms
are mainly found in nutritional supplements such as SelMet, MSA and
selenocysteine (Burk and Hill, 2015). It has been previously shown that selenite is
more toxic to cells than selenate (Brasher and Scott Ogle, 1993; Abdo, 1994; Burk
and Hill, 2015). However, once absorbed by the cells, selenate is completely
converted to selenite which is then converted to methylselenol, the active form of Se
(Burk and Hill, 2015). Methylselenol is used in the biosynthesis of selenocysteine
(Burk and Hill, 2015), the 21st amino acid needed for the synthesis and function of
selenoproteins.
High Se concentrations were shown to induce cell death in prostate cancer
cells and it was postulated that this Se-induced cytotoxicity was mediated through
the induction of a newly recognised metabolic pathway called endoplasmic reticulum
(ER) stress (Wu et al., 2005). Using PC3 human prostate cancer cells, Wu and co-
workers (2005) showed that several ER stress markers such as binding
Page 80 of 167
immunoglobulin protein also known as glucose regulated protein 78 (BiP/GRP78),
phosphorylated protein kinase RNA-like ER kinase (phospho-PERK),
phosphorylated eukaryotic initiation factor-2 alpha (phospho-eIF2) and
CAAA/EBPα-homologous protein (CHOP) were induced by treatment with
methylseleninic acid (MSA), a source of Se. Of relevance, the levels of CHOP, a pro-
apoptotic transcription factor normally induced during ER stress (Wang and
Kaufman, 2016) were elevated after a 24 hour MSA treatment and this increase was
accompanied by increases in the levels of additional apoptotic markers such as
caspase 7, caspase 2 and cleaved PARP. Thus, at least in prostate cancer cells, ER
stress seems to mediate Se induced cell death (Wu et al., 2005). Furthermore, high
selenite concentration, 20 µM, has been shown to induce apoptosis through
activation of ER stress in a time dependant manner in NB4 cells, a type of human
acute promyelocytic leukemia cells (Guan et al., 2009).
In recent years, several studies have shown an association between high Se
intake and the activation of ER stress (Wu et al., 2005; Zu et al., 2006; Hwang et al.,
2007). Interestingly, ER stress has also been shown to be activated in animal
models of obesity and diabetes and to be implicated in impairing the insulin
signalling pathway and causing hepatic insulin resistance (Ozcan et al., 2004).
Overexpression of ER stress markers has been observed in liver and adipose tissue
from obese and diabetic animals and in humans (Hotamisligil, 2010; Hummasti and
Hotamisligil, 2010). Furthermore, ER stress has also been reported to play a key role
in the development of endothelial dysfunction in animal models of diabetes and
atherosclerosis (Kassan et al., 2012). However, the role of ER stress in insulin
Page 81 of 167
resistance or endothelial dysfunction mediated by high Se has never been
investigated.
3.2 Results
3.2.1 High Selenium treatments cause ER stress induction in hepatocytes
Previous studies have shown that high ER stress leads to hepatic insulin resistance
(Ozcan et al., 2004). Furthermore, high Se was shown to impair hepatic insulin
sensitivity in rat normal hepatocytes cell line BRL-3A (Zeng et al., 2012). Human
cancer studies suggested that high Se intake leads to impaired insulin sensitivity
therefore leading to increased risk of type 2 diabetes (Laclaustra et al., 2010). To
address the impact of high Se concentrations on ER stress activation, the effect of
Se on the activation of ER stress response was assessed in cultured cells
hepatocytes, HuH-7 cells and HepG2 cells and endothelial cells EA.hy926 cells and
Human Umbilical Vein Endothelial cells (HUVECs). ER stress was assessed by
assessing the phosphorylation levels of eIF2-α, an ER stress marker activated upon
auto phosphorylation of protein kinase RNA-like ER kinase (PERK) in order to
attenuate further protein translation and at the same time selectively stimulate
translation of Activating translating factor 4 (ATF-4) to increase the stimulation of the
unfolded protein response target genes to alleviate ER stress (Wang and Kaufman,
2016).
Our results show that Se in the form of selenite induces ER stress in a time
and dose dependent manner. Figure 3.1 shows that eIF2-α phosphorylation
increased 30 minutes after selenite treatment, at both 10 and 30 µM concentrations,
and peaked at 1 hour, remaining stable up to 12 hours after treatment (Figure 3.1D).
Interestingly, cells treated with physiological concentrations of selenite (0.5 µM)
Page 82 of 167
showed phosphorylation of eIF2 as early as 30 minutes and remained constant for
24 hours, however high concentrations of selenite (30 µM) showed the level of
phosphorylation to decline after 8 hours (Figure 3.1C) compared to 10 µM treated
cells which phosphorylation of eIF2a peaked from 1 hour and remained constant for
24 hours as shown in Figure 3.1B. The enhanced phosphorylation of eIF2-α
indicates the activation of the PERK/ eIF2-α arm of the ER stress response.
Figure 3.1. High Se treatments enhance phosphorylation of eIF2-α on serine 51 active site (S51). Phosphorylation of eIF2-α in HuH 7 cells treated with sodium selenite at the concentrations of 0.5 μM (A), 10 μM (B) and 30 μM (C) at the indicated time points. GAPDH is a loading control. These are representative figures of two independent experiments.
Page 83 of 167
To further assess the activation of ER stress response in these cells, we also
investigated the expression of another key ER stress marker, CHOP. As a positive
control for ER stress induction, HuH-7 cells were treated with tunicamycin, a general
glycosylation inhibitor that is known to be as a powerful pharmacological inducer of
ER stress, besides treatment with selenite. As shown in Figure 3.2, the treatment of
cells with both tunicamycin and selenite enhanced CHOP expression, indicating the
activation of ER stress response. CHOP expression in HuH-7 cells peaked at 3
hours and declined after 8 hours in cells treated with high selenite concentrations,
30µM.
Figure 3.2. High Se treatments activation of CHOP. Expression of CHOP protein in HuH-7 cells treated with either tunicamycin (Tun, 5 μg/mL for 2h) or sodium selenite at the concentrations of 30 μM at the indicated time points. This is a representative figure of two independent experiments.
Page 84 of 167
In addition to Huh7 cells, the effect of high Se was also investigated in HepG2
cells. This time, ER stress induction was examined by qPCR to assess the
transcriptional up-regulation of known ER stress effector proteins. mRNA expression
of BiP, ATF-4 and CHOP was assessed. Figure 3.3A-B shows that there was no
significant activation of the ER stress markers BiP and CHOP in hepatocytes 8 hour
post-selenite treatment (p<0.05), however there is a positive trend associating high
BiP and CHOP expression with increasing concentrations of selenite in HepG2 cells
(Figure 3.3A-B). Nonetheless, ATF4 mRNA expression was significantly increased
compared to untreated (CTL) samples (2.7-fold, p<0.001) in HepG2 cells treated with
supraphysiological selenite concentrations (10 µM) compared to physiological
concentrations (0.5 µM).
Page 85 of 167
C T L
0 .5
M
5 M
1 0 M
T ha p
s
0
2
4
6
81 0
1 5
2 0
2 5
3 0
B iP , H e p g 2
S e le n it e c o n c e n t r a t io n
Fo
ld c
ha
ng
e i
n e
xp
re
ss
ion
(re
lati
ve
to
CT
L)
C T L
0 .5
M
5 M
1 0 M
T ha p
s
0
2
4
6
8
5 0
1 0 0
1 5 0
2 0 0
2 5 0
C H O P , H e p g 2
S e le n it e c o n c e n t r a t io n
Fo
ld c
ha
ng
e i
n e
xp
re
ss
ion
(re
lati
ve
to
CT
L)
C T L
0 .5
M
5 M
1 0 M
T ha p
s
0
2
4
6
8A T F 4 , H e p g 2
S e le n it e c o n c e n t r a t io n
Fo
ld c
ha
ng
e i
n e
xp
re
ss
ion
(re
lati
ve
to
CT
L)
*
A B
C
Figure 3.3. High Se treatment induces ER stress in hepatocytes. mRNA expression of BiP (A), CHOP (B) and ATF4 (C) at 8 hours post selenite stimulation. Relative mRNA expression was normalised to a housekeeping gene expression (β-actin) and fold change was determined relative to the control sample, which is the untreated sample. High selenite concentrations, 5 and 10 µM, did not significantly induces ER stress markers BiP (A) and CHOP (B), however there is a trend showing higher BiP and CHOP expression as selenite concentrations increase. Treatment of hepatocytes with 10 µM of selenite significantly increased ATF4 (C) mRNA expression at 8 hours post selenite treatment (2.7 fold increase p<0.001). Data are presented as mean ± SEM and were analysed using one-way ANOVA followed by Dunnett‘s post-hoc test. *P< 0.001 vs. CTL. N = 3 independent experiments. Thapsigargin (300 nM) for 8 hours was used as a positive control.
Page 86 of 167
3.2.2 High selenium treatment activates the ER stress response in a time- and
dose- dependent manner in endothelial cells
Several studies have shown that high Se impairs insulin signalling and results in
insulin resistance and hence increase the risk of type 2 diabetes in both animal and
human studies (Bleys, Navas-Acien and Guallar, 2007; Steinbrenner, 2013). Insulin
resistance is intimately associated with endothelial dysfunction, however the
mechanism by which high Se induces endothelial dysfunction is yet to be elucidated.
Therefore, we investigated the impact of high Se treatment in endothelial dysfunction
by looking at ER stress activation in cultured endothelial cells. To investigate the
effect of high versus low concentrations of Se on ER stress induction in endothelial
cells, HUVECs cells were treated with different concentrations of sodium selenite
ranging from physiological levels, or 0.5 μM to the supra-physiological
concentrations of 10 μM. Then mRNA expression of key ER stress genes were
analysed by qPCR (BIP, CHOP and ATF4). As shown on Figure 3.4, a physiological
dose of selenite (0.5 μM) did not affect the mRNA expression of any of the ER stress
markers investigated at any of the three time points. However, higher selenite
concentrations (5 and 10 μM) led to a significant increase in CHOP and ATF4 mRNA
expression at all three times points, while BIP mRNA expression was only increased
24 hours post-selenite treatment (Figure3.4B-C).
Page 87 of 167
Figure 3.4. High Se induces ER stress in endothelial cells. mRNA expression of BiP (A), ATF4 (B) and CHOP (C) at 4 hours, 8 hours and 24 hours post selenite treatment. Relative mRNA expression was normalised to a housekeeping gene expression (β-actin) and fold change was determined relative to the control sample that is an untreated sample. High selenite concentrations induces ER stress markers BiP (A), ATF4 (B) and CHOP (C) with a significant increase at 24 hours post selenite treatment (p<0.05). Data are presented as mean ± SEM and were analysed using two-way ANOVA followed by Bonferroni‘s post-hoc test. *P< 0.05 vs. CTL. N = 3 independent experiments.
Page 88 of 167
3.2.3 High Selenium treatments cause ER stress induction in endothelial cells
We next assessed eIF2-α phosphorylation after selenite treatment in endothelial
cells. Once again, sodium selenite concentrations ranged from normal to supra-
physiological concentrations (0.5, 5, and 10 µM). As shown in Figure 3.5, sodium
selenite treatment at low physiological concentration revealed low fluorescent signal
indicating that 0.5M did not affect the phosphorylation of eIF2-α on serine 51
throughout the period of incubation. Interestingly, however, higher concentrations of
selenite at 5 and 10 µM induced eIF2-α phosphorylation as Figure 3.5 shows that
higher concentrations of selenite produced intense signal on the western blot .
Moreover, incubating HUVEC cells for 24 hours with physiological concentrations
(0.5 µM) of selenite also does not increase BiP levels. Nonetheless, high Se
concentration, 5 and 10 µM, increased expression of BiP. Figure 3.5 shows that
sodium selenite not only induces ER stress in endothelial cells but also induces ER
stress in a dose-dependent manner. Thapsigargin was used as a positive control for
ER stress induction.
Figure 3.5. High Se treatment enhances activation of BiP and phosphorylation of eIF2-α at serine 51. Sodium selenite induced phosphorylation of eIF2-α and BiP in HUVECs cells
treated with sodium selenite at the concentrations of 0.5 μM, 5 μM and 10 μM. -Actin is a loading control. This is representative figure of two independent experiments.
Page 89 of 167
3.2.4 High selenium activates spliced XBP-1 in endothelial cells
To validate the induction of ER stress by sodium selenite, XBP-1 splicing was
investigated. Under conditions of stress, the activation of IRE1α, triggers an
endoribonuclease activity that selectively cleaves a 26-nucleotide segment from
XBP1 mRNA into spliced XBP-1 mRNA and unspliced form. The spliced XBP-1
mRNA introduces a translational frameshift that creates transcriptionally active XBP-
1 (XBP-1s) to enhance protein folding and at the same time promote Endoplasmic
reticulum-associated protein degradation (ERAD) pathway to resolve chronic ER
stress through cell death. Figure 3.6 shows that unlike physiological concentration of
selenite (0.5 µM), high selenite concentrations, 5 and 10 µM, activated the splicing of
XBP-1 mRNA. The results shows that high Se in form of selenite induces ER stress
in endothelial cells.
Chemical chaperones, such as PBA, are thought to protect cells against ER
stress by mechanisms that are not completely clear (Ozcan et al., 2006; Kim et al.,
2013). We wanted to investigate whether the use of a chemical chaperone could
decrease ER stress in our system. Since PBA is a known chemical chaperone that
prevents ER stress activation, we expected to see un-spliced XBP-1 only in the
presence of PBA. However, PBA treatment resulted in XBP-1 splicing in the
presence of selenite treatment indicating that PBA activates ER stress in the
presence of selenite in endothelial cells, as shown in Figure 3.6.
Page 90 of 167
Figure 3.6. High Se treatment activates splicing of the XBP-1 mRNA. High Se concentrations (5 µM and 10 µM) lead to XBP-1 splicing unlike the physiological concentration (0.5 µM). This is a representative figure of three independent experiments.
3.2.5 Effects of high selenium on viability of endothelial cells and hepatocytes.
Induction of ER stress is reported to be associated with cell death and therefore, we
investigated the effect of ER-stress induction by high Se treatments on cell viability in
both endothelial cells and hepatocytes. EA.hy926 endothelial cells were treated with
varying concentrations of both inorganic (selenite, selenate) and organic (seleno-
methionine, SelMet) sources of Se while hepatocytes (HuH-7) were only treated with
different concentrations of selenite. Then, cell viability was assessed using the MTT
assay. As shown in Figure 3.7, the impact of Se on cell viability has proven to be
dose dependant, cell specific and driven by the type of Se. Endothelial cells,
EA.hy926, show to be more sensitive to selenite, than selenate and less sensitive to
SelMet. Figure 3.7A shows that higher selenite concentration, 10 µM, reduces
EA.hy926 viability to 42% (p<0.0001) compared to control (CTL) and to treatment
with a low 0.5 µM dose. Interestingly, another high concentration, 5 M
concentration, of selenite (Figure 3.7A), selenate (Figure 3.7B), and SelMet (Figure
3.7C), did not significantly reduce viability of EA.hy926 cells. Importantly, more
selenate (100 M) compared to 10 µM of selenite was required to significantly
reduce EA.hy926 cell viability to 49% (p<0.001).
XBP1s XBP1u
Thaps 0 μM 0.5 μM 5 μM 10 μM
+PBA
0 μM 0.5 μM 5 μM 10 μM
Page 91 of 167
Concentrations of Se considered to be high (5-10 µM) did not significantly
reduce hepatocytes cell viability in all three forms of Se. Interestingly, the organic
form of Se, SelMet, and inorganic form of Se, selenate, did not affect hepatocyte
viability at concentrations up to 100 M , as shown on Figure 3.7F and Figure 3.7E,
respectively. Additionally, varying concentrations of selenite (0.5 M- 10 M)
treatment did not affect HuH-7 cell viability (Figure 3.7G). On the other hand,
supranutritional concentrations of selenite (of more than 20 M) of selenite
negatively affected hepatocytes, significantly reducing HepG2 cells viability to 65%-
10% (p<0.001) in a concentrations dependent manner (Figure 3.7D).
Page 92 of 167
Figure 3.7. Effects of high Se on viability of endothelial cells and hepatocytes. Cell viability of EA.hy926 endothelial cells treated with different concentrations of sodium selenite (A), selenate (B) and SelMet (C). Cell viability of HepG2 treated with varying concentrations of selenite (D), selenate (E) and SelMet (F). HuH-7 hepatocytes treated with various concentrations of sodium selenite (G). Relative cell viability was expressed as a percentage (%) relative to the untreated control cells (NC). Data are presented as mean ± SEM and were analysed using one-way ANOVA followed by Dunnett‘s multiple post-hoc test. Se treatments were compared to CTL. ***P<0.001, ****P<0.0001 vs. CTL. N = 4 (A-G).
Page 93 of 167
3.3 Discussion
Previous studies have shown that high Se concentrations induce ER stress response
in different cell lines such as human promyelocytic leukaemia cells, prostate cancer
cells, adipocytes, human neurons, HeLa cells and pancreatic β-cell (Wu et al., 2005;
Zu et al., 2006; Hwang et al., 2007; Wallenberg et al., 2014). Some of these studies
have shown that Se causes ER stress in a dose- and time-dependent fashion (Zu et
al., 2006; Guan et al., 2009). The present study extends the published findings and
provides further evidence to support the role of high Se concentrations in activating
ER stress in cultured endothelial cells. Our work shows that treatment with Se in the
form of selenite induces a number of ER stress markers in a time- and dose-
dependent manner both at the mRNA and protein levels in endothelial cells. To the
best of our knowledge, these findings are novel and have not been reported by other
groups in endothelial cells.
Chronic activation of the UPR activates the expression of the pro-apoptotic
protein CAAA/EBPα-homologous protein (CHOP) which is positively controlled by
the PERK-ATF4 axis of the UPR (Schröder and Kaufman, 2005; Hetz, 2012). CHOP
is a transcription factor which in turn promotes the transcription of growth arrest
genes such as Bcl-2 Interacting mediator (BIM) proteins and the BH3 class family to
result in apoptosis (Flamment et al., 2012; Inagi, Ishimoto and Nangaku, 2014).
Therefore, due to the potential of chronic ER stress to induce cell death, the effects
of high Se on cell viability were first investigated. At concentrations of Se that we find
induce markers of ER stress, we see no evidence of compromised viability, at least
in hepatocytes (HuH-7 and HepG2) at the time point examined (24h). Conversely,
endothelial cells were found to be more sensitive to selenite; 10 µM of sodium
Page 94 of 167
selenite significantly reduced cell viability in endothelial cells compared to
hepatocytes
Genetic differences between cell lines studied could contribute to the
differences in sensitivity to Se we observed. For example, it has already been
established that HuH-7 cell lines are Trp53 mutant (Hsu et al., 1993). Trp53 (or
transformation related protein 53) is a gene coding for a tumour suppressor
transcription factor, p53, that is pivotal for cell cycle control and apoptosis induction
in response to DNA damage treatments and other insults such as hypoxia and
telomere shortening (Pietsch, Humbey and Murphy, 2006). The mechanism by which
p53 induces apoptosis are more complex; it can stimulate many pro-apoptotic genes
as well as bind and inactivate anti-apoptotic Bcl-2 protein to promote apoptosis. p53
mutant cells tend to escape apoptosis; DNA damaged cells may continue dividing
without pausing for DNA repairing process resulting in uncontrolled cell division and
cell growth hence making cells cancerous and resistant to anti-cancer drugs and
irradiation in some tumour cells (Brosh and Rotter, 2009; Amaral et al., 2010).
Our results in Figure 3.7G shows that 10µM of selenite did not reduced HuH-7
viability, a Trp53 mutant cell line with p53 mutation, unlike in HepG2 and EA.hy926
cells (Figure 3.7A and 3.7D); both known to have wild type p53 and therefore normal
levels of p53 protein (Kao et al., 2004; Yang et al., 2007). The results showed that
endothelial cells) are more sensitive to high Se in the form of selenite than HepG2
cells which are also more sensitive to selenite treatment than HuH-7 cells. Figure 3.7
A, D and G plainly show that 10 µM of selenite significantly reduced endothelial cell
viability compared to both hepatocytes cell lines. Moreover, comparing 5, and 10 µM
of all the Se forms used, selenite ( vs selenate and SelMet) appeared to negatively
affect cell viability of endothelial cells more than HepG2 cells and HuH-7 cell lines.
Page 95 of 167
Se is known to cause cell death and DNA damage in animal and human cell
culture at high concentrations attracting a considerable attention as a possible anti-
cancer agent (Duffield-Lillico et al., 2003; Wu et al., 2005; Guan et al., 2009).
Therefore, it is not surprising to find that 5 µM and 10 µM concentrations 5 and 10
µM) of selenite caused cell death, as shown in Figure 3.7A, as these are the same
concentrations that induces ER stress mechanism in endothelial cells (Figures 3.5
and 3.6). It has been established that high Se supplementation leads to ER stress
induction and cell death in cancer and prostate cancer (Wu et al., 2005; Zu et al.,
2006; Hwang et al., 2007; Wallenberg et al., 2014), in addition chronic ER stress is
known to activate the apoptosis pathway through the activation of a pro-apoptotic
marker CHOP (Oyadomari and Mori, 2004; Hetz, 2012). We therefore report that
high Se concentration not only leads to ER stress induction in human endothelial
cells but also reduced endothelial cell viability as shown in Figures 3.5-3.7A. Figures
3.7A and 3.7D show that endothelial cells and hepatocytes are more sensitive to
selenite than other forms of Se (selenate and SelMet) used in the study.
Although selenite reduced cell viability in hepatocytes at high concentration
(higher than 20 µM), the concentrations above 20 µM are considered supranutritional
concentrations and are not practical for human supplementations. Our results
suggest that different cell cultures respond differently to the type of Se sources and
the concentrations used in experiments. The physiological requirement for maximal
selenoprotein function for human health and protection against some cancers is 45-
120 µg/day which is equivalent to optimal physiological level of 0.5-2 µM in human
plasma (Thomson, 2004) and the concentrations used (0, 0.5, 5 and 10 µM) in the
experiment fall within the acceptable range required for Se supplementation with 5
Page 96 of 167
and 10 µM marked as tolerable non-toxic high concentration for human consumption
(Burk, 2002; Burk and Hill, 2015).
Se is an element known for its anti-oxidant function (when present as
selenoproteins) and its insulin-mimetic actions when taken at physiological and
nutritional amounts (Stapleton et al., 1997). However, high supra-nutritional Se
intake has been found to impair insulin sensitivity and therefore increase the risk of
type 2 diabetes and be associated with endothelial dysfunction and CVD (Mueller et
al., 2009; Saverio Stranges et al., 2010; Rayman, 2012; Chistiakov et al., 2014).
Several in vivo and in vitro studies have shown that high Se intake is involved in
impairing insulin signalling and linked to atherosclerosis and increased risk of CVD
(Ozcan et al., 2004, 2006; Myoishi et al., 2007; Tabas, 2009); however, the
underlying molecular mechanism(s) are yet to be elucidated. From cancer studies, it
was observed that treatment of cancer cells with high amounts of Se leads to cell
death through the activation of ER stress (Wu et al., 2005; Zu et al., 2006; Guan et
al., 2009; Chistiakov et al., 2014). In comparison, our results showed that high Se
(selenite) concentrations result in cell death; 39% (p=0.0122) of human endothelial
cells were viable post 10 µM of selenite treatment. However, the mechanism(s)
involved are yet not known. We therefore selected 5 and 10 µM of selenite as a
model for high Se supplementation and 0.5 µM as a physiological concentration to
investigate the role of ER stress in high Se intake using human umbilical vein
endothelial cells as model.
ER stress has also been reported to be activated in various insulin-resistant
states and was shown to contribute to insulin resistance and vascular dysfunction via
the activation of complex inflammatory pathways (Araki, Oyadomari and Mori, 2003;
Page 97 of 167
Hotamisligil, 2010; Agouni et al., 2011; Basha et al., 2012; Flamment et al., 2012).
Therefore, we hypothesised that high Se intake would be associated with the
activation of ER stress response in cultured endothelial cells leading to endothelial
dysfunction, precursors of diabetes associated CVDs. Our results show that: (i) Se
induces ER stress in a dose- and time-dependent manner in hepatocyte HuH-7 cells,
measured as phosphorylation of eIF-2α and (ii) high selenite concentration activated
the induction of CHOP in a time dependant manner. Taken together, our results are
in agreement with Guan et al (2009), which showed that selenite induced ER stress
in pro-myloecytic cells, in a time dependant manner (Guan et al., 2009).
It must be noted that 30 µM of selenite is toxic to human consumption
therefore 10 µM was the selected dose to represent high selenite concentration.
Interestingly, treatment with 5 µM and 10 µM Se increased mRNA expression of ER
stress markers, BiP and CHOP in HepG2 cells, but this increase was not statistically
significant. Cell viability assay suggest that hepatocyte might have a high threshold
for selenite and other Se sources concentrations and therefore be a robust cell
model in Se induced ER stress studies perhaps due the fact that HepG2 cells
express p53 wild type and have well expressed p53 protein (Kao et al., 2004).
Some recent studies have shown that ER stress activation in models of
diabetes and hypertension is associated with endothelial dysfunction, the initial step
for the development of atherosclerosis (Basha et al., 2012). Our data clearly shows
that high Se intake leads to the activation of ER stress in endothelial cells. Our
results suggest that Se in the form of selenite activates ER stress through the PERK
arm of the unfolded protein response (UPR) mechanism. Disturbance in the normal
function of the ER leads to accumulation of mis-folded proteins in the ER lumen
Page 98 of 167
causing activation of the UPR to restore ER homeostasis. However, if the ER stress
dysfunction persists, ER stress eventually causes cell death or apoptosis. There are
three ER stress-sensing proteins (PERK, IREα and ATF6) on the ER lumen, all
bound with the chaperone BiP and kept inactive through this interaction. During UPR
activation, BiP dissociates from these three stress-sensing proteins to alleviate the
stress by up-regulating the transcription and translation of UPR chaperones including
BiP to correct the ER stress and dysfunction (Schröder and Kaufman, 2005; Hetz,
2012).
Se in the form of selenite has been demonstrated to induce necroptosis-like
cell death in HeLa cells (Wallenberg et al., 2014). The former study also showed
evidence of increased ER resident proteins, BiP and CHOP; indicating the induction
of ER stress in HeLa cells with selenite treatment. Our results shows that high Se
concentrations induced the activation of BiP protein in endothelial cells as well as the
phosphorylation of eIF2α by western blot technique. Both qPCR and western blot
technique shows that at 24 hours high Se induced transcription of ATF4 and CHOP
and the same there is protein translation at 24 hours of ER stress markers (BiP and
P-eIF2α), suggesting that ER transcription and translation of ER stress markers
concurrently occurs in order to rescue the cells from dysfunction or attenuate the
cells to preserve cell function and metabolism.
Furthermore, high Se concentration leads to XBP-1 splicing in endothelial
cells. Although pre-treating endothelial cells with a chemical chaperone, PBA,
induced XBP-1 levels and splicing instead of inhibiting it as it would be expected for
a chemical chaperone (Ozcan et al., 2006), we think this is due to the fact that PBA
has been shown to have transcriptional up-regulating effect (Perlmutter, 2006). XBP-
Page 99 of 167
1 is a transcription factor activated by a non-canonical splicing reaction mediated by
the endonuclease IRE1 ( Hetz, 2012). XBP-1 controls the expression of genes that
encode for proteins involved in protein folding and endoplasmic-reticulum-associated
protein degradation (ERAD) process and protein quality control mechanism (Hetz,
2012), such as CHOP. Since high Se induced XBP-1 splicing, it is therefore not
surprising that it also induced activation of CHOP protein in HuH-7 cells. In
endothelial cells, moreover, there is a significant activation of CHOP mRNA after
treatment with high Se concentrations.
During ER stress, PERK dimerization followed by auto-phosphorylation leads
to phosphorylation of eIF2α to attenuate further general protein synthesis except for
the selective translation of the ATF4 mRNA. ATF4 mRNA is a transcription factor
controlling the transcription of genes involved in the unfolded protein response for
survival as well as in ERAD to correct the perpetuating ER dysfunction through
apoptosis (Hetz, 2012). ATF4 transcription factor is thought to be activating XBP-1
and CHOP, however XBP-1 is known to get spliced upon activation, dimerization and
auto-phosphorylation of the IRE1α arm. It is therefore not clear which arm of the ER
stress Se activates nevertheless it is evident that high Se induces ER stress in
endothelial cells.
Page 100 of 167
Chapter 4 Results
High selenium treatment induces molecular changes in endothelial cells
Page 101 of 167
4.1. Introduction
The endothelium is composed of a monolayer of endothelial cells that line the entire
innermost tunica intima of all vessels in the body. The primary function of the
endothelium is to form a semipermeable membrane to retain the plasma and to aid
the transfer of nutrients and white blood cells between tissues. It is recognised as
being an endocrine organ able to sense mechanical and hormonal changes in the
blood, but also to secrete various mediators and hormones (Rajendran et al., 2013).
Endothelial cells regulate vascular homeostasis through the control of various
vascular functions including angiogenesis, smooth muscle cell proliferation,
migration of leukocytes and the maintenance of blood fluidity by balancing levels of
pro- and anti-coagulants, growth factors, pro and anti-inflammatory molecules
(Triggle and Ding, 2011). The endothelium senses shear stress produced by blood
flow and responds to signals such as acetylcholine by secreting vasodilators namely
nitric oxide, prostacyclin and vasoconstrictors such as endothelin to act on vascular
smooth muscles to adjust for local blood flow (Davignon and Ganz, 2004). Shear
stress is a key activator of eNOS in normal physiology, and this adapts organ
perfusion to changes in cardiac output. Dimmeler and colleagues has shown that
activation of eNOS in endothelial cells is through the stimulation of
phosphatidylinositol-4, 5-bisphosphate 3-kinase (PI(3)K/Akt) pathway (Dimmeler et
al., 1999). Shear stress in Human Umbilical Vein cells stimulates phosphorylation of
the protein kinase B at serine 473 active site also known as Akt (Phospho-Akt
ser473) on the serine residues of the active enzyme to enhance the phosphorylation
of eNOS in order to activate production of NO (Dimmeler et al., 1999).
Nitric oxide (NO) is mainly generated from L-arginine from citruline by
endothelial nitric oxide synthase (eNOS) in the presence of co-factors such as
Page 102 of 167
tetrahydrobiopterin (BH4), NADPH and oxygen (Luiking, Engelen and Deutz, 2010).
NO is rapidly converted to the NO metabolites nitrate and nitrite in less than one
second in vivo, therefore nitrate and nitrites are used to measure the availability of
NO to assess endothelial function (Dimmeler et al., 1999; Luiking, Engelen and
Deutz, 2010). NO regulates blood flow, promote angiogenesis, inhibit thrombosis,
maintain cellular redox state, cell immunity, and neuronal survival (Luiking, Engelen
and Deutz, 2010). NO is a main vasodilator, the gas diffuses to the vascular smooth
muscle cells to activate guanylate cyclase, which leads to cGMP-mediated
vasodilatation. In situation of hypoxia, low production of L-arginine and BH4, eNOS
converts production of NO to superoxide (O2–) by the endothelium and this is known
as ―uncoupling‖ of eNOS (Deanfield, Halcox and Rabelink, 2007; Luiking, Engelen
and Deutz, 2010). Uncoupled eNOs occurs mainly in pathological conditions such as
hypertension, hypercholesterolemia and diabetes (Luiking, Engelen and Deutz,
2010) and this leads to increased production of reactive oxygen species (ROS)
(Deanfield, Halcox and Rabelink, 2007). Increased ROS in form of superoxide reacts
with available NO resulting in a by-product called peroxynitrite and this reaction
activates inflammatory chemokines. Reduced bioavailability of NO through impaired
production of NO leads to impaired vascular tone and activates inflammatory
response therefore leading to endothelial dysfunction (Levick, 2003) (Bogdan, 2001;
Hermann, Flammer and Lscher, 2006).
Any disturbance in the function of the endothelial cells is referred to as
endothelial dysfunction, a hallmark of CVD and a recognised early step in the
development of atherosclerosis and coronary heart disease (Flammer et al., 2012).
Endothelial dysfunction generally is defined as the imbalance between vasodilation
and vasoconstriction with the balanced tipped towards vasoconstriction and
Page 103 of 167
inflammatory response. Endothelial dysfunction contributes to vascular injury and
damage which results in lipid deposition and oxidative stress within the vessel wall,
triggering the activation of several inflammatory responses such as tumour necrosis
factor (TNF)-α, c-Jun amino-terminal kinase (JNK) and Nuclear Factor (NF)-κB which
can in turn worsen endothelial dysfunction (Libby, 2012).
Whether ER stress plays a causative role in endothelial dysfunction remains
to be established but it is important to mention that ER stress has been shown to be
involved in the development of atherosclerosis (Erbay et al., 2009; Hotamisligil,
2010; Flamment et al., 2012; Chistiakov et al., 2014). Expression of the ER stress
markers, ATF4 and XBP-1, was increased in macrophages loaded with cholesterol
(Li et al., 2005) indicating that ER stress response is linked to the development of
atherosclerosis and can increase the risk of CVD. Also, the ER stress markers
CHOP and BIP were elevated in ruptured atherosclerotic plaques from human
coronary artery autopsy samples (Myoishi et al., 2007). Macrophage apoptosis is a
major process in the progression of advanced atherosclerosis and cell models show
that prolonged ER stress is responsible for CHOP-mediated macrophage apoptosis
through ER release of calcium and Ca2+/calmodulin-dependent protein kinases II
(CaMKII) (Ozcan and Tabas, 2012) . Overall, chronic ER stress plays an important
role in the development of insulin resistance and endothelial dysfunction resulting in
increased risk of type 2 diabetes and associated CVD.
The use of anti-oxidants has been trialled to prevent chronic diseases caused
by oxidative stress (Lippman et al., 2009; Goodman et al., 2011; Rayman, 2012).
Dietary supplements such as the trace element Se, which is required for the
synthesis of the anti-oxidant selenoproteins (Brenneisen, Steinbrenner and Sies,
Page 104 of 167
2005; Lipinski, 2011) have been used to reduce the effects of oxidative stress in
various disease states including cancer, neurodegenerative disorders, type 2
diabetes and CVD (Rayman, 2012; Pillai, Uyehara-Lock and Bellinger, 2014).
However, increasing evidence from human, animal and in vitro studies suggests that
both low and high Se concentrations are associated with increased risk of type 2
diabetes and CVD (Bleys, Navas-Acien and Guallar, 2007; Bleys et al., 2008;
Labunskyy et al., 2011; Rayman et al., 2012; Rayman and Stranges, 2013; Rocourt
and Cheng, 2013; Zhou, Huang and Lei, 2013) making inappropriately high or low
Se intakes yet another risk factor for cardio-metabolic disorders. The aim of the
study was therefore to investigate the effect of high Se induced ER stress in
endothelial function.
Page 105 of 167
4.2 Results
4.2.1 ER stress response induced by high selenium impairs nitric oxide (NO)
bioavailability in endothelial cells.
NO is a biomolecule involved in the regulation of vascular tone and anti-
arteriosclerotic effects. Reduced NO bioavailability is one of the hallmarks of
endothelial dysfunction, an independent predictor of future adverse cardiovascular
events. Apoptotic endothelial cells are dysfunctional and exhibit reduced production
of NO. Therefore, we decided to assess the effect of ER stress induced by high Se
on endothelial function and apoptosis by measuring NO production using the Griess
indirect assay.
EA.hy926 endothelial cells were treated with physiological or high
concentrations of sodium selenite in the presence or absence of chemical chaperone
PBA for 24 hours. Then, culture medium was removed and their content in
nitrite/nitrate that is proportional to the amounts of NO produced was determined
using the Griess assay.
As observed in Figure 4.1, high selenite concentrations (5 and 10 μM), but not
the physiological concentration (0.5 μM), caused a significant decrease in NO
production as evidenced by the reduction in nitrite levels. Importantly, the pre-
treatment of cells with the chemical chaperone PBA completely prevented the
decrease in NO production caused by high Se, suggesting the potential involvement
of the ER stress response in this effect.
Page 106 of 167
Figure 4.1. High Se-induced ER stress response impairs nitric oxide (NO) bioavailability in endothelial cells. The bar chart shows nitrite concentration levels (μM), which are proportional to NO production, in EA.hy926 cells treated with various concentrations of sodium selenite in the presence or absence of PBA. Values are expressed as mean ± SEM were analyzed two-way ANOVA, followed by Bonferroni‘s multiple comparison test.*P<0.05, **P<0.01 and ***P<0.001 vs control. N = 4 in each group.
Page 107 of 167
To further assess the potential effect of high-Se-induced ER stress on endothelial
function, we analysed by western blot the expression and phosphorylation of
endothelial nitric oxide synthase (eNOS) at Ser 1177 which is recognised as the key
amino acid residue in the active site of the enzyme. Also, we analysed the
expression of phosphorylated Akt, a protein that when phosphorylated through the
PI(3)KI/Akt pathway influences the phosphorylation of eNOS for NO production in a
Ca2+ independent manner. Treating HUVECs with high selenite concentrations (5
and 10 μM) non significantly decreased the phosphorylation of Akt on serine 473
compared to untreated cells and cells treated with physiological concentration (0.5
μM) as shown in Figures 4.2A and B; indicating that high selenite concentrations
impairs the PI(3)KI/Akt pathway in endothelial cells. In addition, HUVECs with 5 and
10 µM of selenite showed a non-significant reduction in phosphorylation of eNOS on
serine 1177 (p>0.05), (Figures 4.2C and D). However, co-treatment of HUVECs with
PBA and selenite significantly reduced the phosphorylated Akt levels (p<0.001) as
seen in Figure 4.2B. Interestingly, the quantitative analysis showed a non-significant
improvement of phosphorylated eNOS levels (p>0.05) as depicted in Figure 4.2D
compared to phosphorylated Akt in endothelial cells co-treated with PBA and high
selenite concentrations (5 and 10 µM). The result in Figure 4.2 D suggest a possible
involvement of the chemical chaperone PBA in ameliorating the Se-induced ER
stress response.
Page 108 of 167
Figure 4.2. Effect of high Se treatments on expression of Akt and eNOS phosphorylation. Effect of Se in the form of selenite on Akt phosphorylation (A and B) and eNOS phosphorylation (C and D) in HUVECs treated with varying concentrations of selenite in the presence or absence of PBA for 24 hours. The protein expression was corrected to total Akt and total eNOS respectively.β-actin was used as a loading control. (***P<0.0001 vs. CTL Data (B and D) are expressed as mean ±SEM (p<0.05) and were analyzed one-way ANOVA, followed by Dunnett‘s multiple comparison test. The blots shown are representative of 3 independent experiments.
Page 109 of 167
4.2.2. High-selenium-induced ER stress response enhances oxidative stress in
endothelial cells
Se (as selenoproteins) has anti-oxidant properties; however supra-nutritional doses
of this trace element have been reported to be associated with ROS induction (Guan
et al., 2009; Wang et al., 2014). ROS and ER stress can co-exist in an
interconnected relationship where one can be both a cause and a consequence of
the other (Malhotra and Kaufman, 2007). Oxidative stress, ROS, is known to reduce
NO bioavailability in the system and participate in the pathogenesis of endothelial
dysfunction. ROS, particularly superoxide (O2–) (Levick, 2003; Bashan et al., 2009).
Therefore, we aimed to determine the effect of high concentrations of Se on ROS
generation, specifically of superoxide (O2–), the main ROS in the vasculature. Cells
were treated with various amounts of selenite or positive control of H2O2 (100 μM) in
the presence or absence of the chemical chaperone PBA. Then cells were stained
with DHE dye before analysing the percentage of positive cells by flow cytometry (for
experimental details, refer to chapter 2). DHE dye reacts with superoxide to form a
DNA binding fluorescent product. The amount florescent produced is proportional to
the amount of superoxide present in the cells (Zhao et al., 2003).
As shown in Figure 4.3A, both high concentrations of selenite (5 and 10 μM)
and H2O2 treatment dramatically increased the percentage of DHE-stained cells to
60% (p<0.01) compared to the physiological concentration of selenite (0.5 μM) and
negative control, 21% and 20% respectively, indicating selenite treatment induces
oxidative stress. Importantly, the pre-treatment of endothelial cells with PBA
completely prevented pro-oxidative effects of high concentrations of selenite,
indicating that PBA may have a protective role against oxidative stress induction.
Page 110 of 167
Figure 4.3. High Se-induced ER stress response enhances oxidative stress in endothelial cells. Measurement of ROS production in endothelial cells. Cells were treated with different concentrations of sodium selenite or the positive control, H2O2 (100 μM), in the presence or absence of PBA. Cells were treated with the fluorescent dye DHE (10 μM) and the percentage of fluorescent-positive cells was determined by flow cytometry, as shown on chart B. The results (A) are expressed as mean ± SEM of five independent experiments and were analysed using one-way ANOVA followed by Tukey multiple post-hoc test. Representative histograms of flow cytometry are shown below. ***P<0.0001 vs control (CTL). N=4 in each group.
DH
E P
os
itiv
e c
ell
s %
O-2
le
ve
ls
PC
(H
2O
2)
CT
L
0.5
M
5
M
10
M
CT
L
0.5
M
5
M
10
M
0
2 0
4 0
6 0
8 0
_ _ _ _ _ _ _ _ _ _ _ _
+ P B A
*** ***
***
R O S , S e le n iteA
B
Page 111 of 167
4.3. Discussion.
Endothelial cells line up the vasculature to allow blood flow throughout the body. Any
changes in the function of endothelial cells leads to endothelial dysfunction and
presiding factor to atherosclerosis, which in turn is a hallmark for increased CVDs.
Se as an important constituent of selenoproteins involved in redox homeostasis,
immunity, cell metabolism and thyroid function, has been implicated in the increased
risk of CVDs (Rayman, 2012). On the other hand, high Se concentration has been
shown to induced ER stress mediated cell death in some cancer cells (Wu et al.,
2005). Some recent studies have shown that ER stress activation in models of
diabetes and hypertension is associated with endothelial dysfunction, the initial step
for the development of atherosclerosis (Basha et al., 2012), therefore the aim of the
study was to investigate the effect of high Se induced ER stress in endothelial
function using Human Umbilical Vein cells (HUVECs) as a endothelium model.
Our results show that high Se leads to the induction of ER stress markers, as
shown in chapter 3. Moreover, the experiments presented in this chapter indicate
that high Se treatment in endothelial cells leads to molecular changes that are
consistent with ER stress induction. To assess the consequences of high-Se induced
ER stress on endothelial function, we evaluated the effects of selenite treatment on
NO release. Firstly, our results show that endothelial cells treated with high Se
concentrations had reduced production of nitrite levels, indicating reduced bio-
availability of NO upon high Se. Importantly, HUVECs co-treated with PBA, a
chemical chaperone thought to act by inhibiting ER stress induction, significantly
improved nitrite production by the endothelial cells. Nitrite measurement is used to
indicate NO bioavailability because the half-life of NO in biological samples is less
than one second, as it is rapidly converted to nitrite and nitrate in the presence of
Page 112 of 167
oxygen and oxyheamoglobin (Privat et al., 1997). Nitrite and nitrate are therefore
metabolites of NO produced by the endothelium and either are frequently used to
measure the amount of NO produced by the endothelial cells as a marker of
endothelial function (Privat et al., 1997). The nitrite levels produced are directly
proportional to the amount of NO produced (Privat et al., 1997).
Reduced NO production is an important component of hypertension
(Hermann, Flammer and Lscher, 2006), and therefore plays a role in endothelial
dysfunction (Schulz, Gori and Münzel, 2011). Several studies have demonstrated
that high Se intake is inversely associated with CVDs and cardio-metabolic state
(Bleys, Navas-Acien and Guallar, 2008; S. Stranges et al., 2010). Furthermore,
several studies have shown contradicting relationship between high Se intake or Se
supplementation and increased blood plasma lipids such as triglycerides and high
density lipoproteins (Laclaustra et al., 2010; Rayman et al., 2011), hence more
interventional clinical trial must be done to clarify the relationship between high Se
intake and endothelial dysfunction and CVDs and establish the molecular
mechanism involved. Thus, our results in cultured cells showed that high Se
concentrations leads to endothelial dysfunction genuinely and therefore might lead to
increased CVDs risks. Additionally, owing to the fact that the use of a chemical
chaperone, PBA, increased levels of NO, the results suggest that ER stress is a
mechanism involved in high Se-induced endothelial dysfunction. Interestingly, ER
stress activation in response to high Se treatment in endothelial cells reduced the
phosphorylation of both AKT on serine 473 and eNOS on serine 1177. Our results
indicate the mechanism of action in ER stress-induced endothelial dysfunction in
high Se intake is through impaired phosphorylation of AKT at serine 473. It is
imperative to mention that there are no comparative studies that measured NO or
Page 113 of 167
NO metabolites to assess the effect of high Se on cardiovascular risks or endothelial
dysfunction.
It has been long established that low Se deficiency leads to a cardiomyopathy
known as Keshan disease which can be reversed trough Se supplementation (Chen
et al., 1980). Although several observational studies have shown that there is an
inverse association between high Se intake/levels and risk of CVD especially in
selenium sufficient population (Bleys, Navas-Acien and Guallar, 2007; Bleys et al.,
2008; S Stranges et al., 2010), some of the clinical trials done across the world show
inconsistent conclusion between the high Se intake and high risk of CVD. Post hoc
analysis of randomised trial particularly the Nutritional Prevention of Cancer trial
done in Eastern United States of America showed that there is high risk of type 2
diabetes among participants with high baseline plasma Se supplemented with high
dose of Se (200 g/ day) compared to placebo (Stranges et al., 2007). As type 2
diabetes is intimately associated with cardiovascular risks the results brought
concerns on high Se and cardiovascular risks, however a review on Se and CVDs
indicated that results from randomised controlled trials on the role of Se on CVDs are
inconclusive (Rees et al., 2013).
In addition, there is little to no evidence for a potential effect of high Se on
endothelial cells. However, studies in diabetic animal models indicate that high Se
impairs insulin signalling through the depletion of hydrogen peroxide needed to keep
phosphatase and tensin homolog (PTEN) protein inactive. Physiological amount of
H2O2 is needed in muscles to keep PTEN enzyme inactive to allow thee
translocation of Glucose transporter type 4 (GLUT4) to the cell surface during insulin
signalling However, studies have shown that overexpression of selenoproteins, such
Page 114 of 167
as SelP and GPx4, quench H2O2, activating PTEN which then leads to impaired
signalling of the PI(3)KI and impaired insulin signalling thereby leading to insulin
resistance and insulin resistance associated-endothelial dysfunction (Steinbrenner,
2013).
ER stress is reportedly associated with oxidative stress, both as a cause and
a consequence (Malhotra and Kaufman, 2007). Oxidative stress may thus in turn
further reduce NO bioavailability in the system and participate in the pathogenesis of
endothelial dysfunction. Indeed, reactive oxygen species (ROS), particularly
superoxide (O2–) can react very quickly with NO to produce peroxynitrite, another
potent free radical, thus reducing the amounts of available NO. Se is known for its
anti-oxidant activity but this is when present as selenoproteins; supra-nutritional
doses of Se, as selenite, were reported to increase the production of ROS. Wang
and others (Wang et al., 2014) observed that high Se intake (selenite) in rats lead to
a dramatic increase in ROS production in the liver thus impairing insulin signalling
and causing hepatic insulin resistance. Consistent with these observations, we
found that the treatment of endothelial cells with supra-nutritional concentrations of
selenite (5-20 μM) increased ROS production and that this accumulation of ROS was
prevented by the chemical chaperone PBA.
Moreover, our results in endothelial cells shows the increase in the expression
of ER stress markers such as CHOP mRNA has been observed as early as 8 hours
post selenite treatment while the increase in ROS production was observed later on
at 24 hours. This suggests that ER stress is likely to be a mechanism involved
preceding oxidative stress in endothelial cells but more detailed and conclusive time
points are need to confirm. Oxidative stress may affect endothelial function in various
Page 115 of 167
ways including the reduction of NO bioavailability. However, the accumulation of
ROS can also inactivate the phosphorylation of the insulin receptor on tyrosine
residues leading to endothelial insulin resistance which is also known to participate
in the onset of endothelial dysfunction (Bashan et al., 2009). There is evidence to
suggest that disrupted endothelial insulin signalling may disturb endothelial function.
Insulin stimulates endothelial cell production of nitric oxide (NO), and, therefore, local
insulin resistance at the level of the endothelium is expected to be associated with
reduced insulin-stimulated NO (Rains and Jain, 2011; Tiganis, 2011). One
recommendation from the study is to investigate the effects of high Se-induced ER
stress and oxidative stress on the insulin signalling pathway in endothelial cells.
Page 116 of 167
Chapter 5 Results
High Selenium Induced ER stress leads to impaired angiogenic capacity and apoptosis
Page 117 of 167
5.1. Introduction
Oxidative stress and insulin resistance have been associated with impaired
angiogenesis, a dominant marker of endothelial dysfunction and a cause of
blindness in diabetic patients (Cheng and Ma, 2015). Angiogenesis is an important
feature in normal physiology and several pathological processes that promotes and
enhances the formation of new blood vessels from pre-existing vessels (Carmeliet,
2005). Angiogenesis involves endothelial cell migration, proliferation and
differentiation to promote tissue survival after ischemic events and aid in tissue
repair after an injury hence it is considered essential in wound repairing and
therefore often studied as a mechanism of wound healing (Strømblad and Cheresh,
1996; Carmeliet, 2005; Kolluru et al., 2012; Johnson and Wilgus, 2014). Few adults‘
tissues that require ongoing angiogenesis include female reproductive organs,
injured tissue such as in heart attack and myocardial infarction and also organs
undergoing physiological growth (Ferrara, 1999; Levick, 2003).
Angiogenesis is controlled through the production of a precise balanced
growth and inhibitory factors in healthy tissues and it is tightly regulated (Adams and
Alitalo, 2007; Shibuya, 2011). Angiogenesis is tightly regulated by the pro-angiogenic
and anti-angiogenic factors that act on endothelial cells to induce or inhibit
endothelial growth and migration in order to initiate angiogenesis (Adams and Alitalo,
2007). Vascular endothelial growth factor (VEGF-A), platelet activating factor (PAF)
and fibroblast growth factors are important pro-angiogenic activators needed for
stimulating endothelial cell growth and migration in order to initiate angiogenesis .
VEGF-A is the most important molecule that control the morphogenesis of the blood
vessels and is abundant in tissues consistently forming new vessels such as
tumours, diabetic retina and myocardium and endothelium (Adams and Alitalo, 2007;
Page 118 of 167
Johnson and Wilgus, 2014). In tumour angiogenesis, commonly called angiogenic
switch, the blood vessels fail to become quiescent enabling constant new growth of
blood vessels compared to physiological angiogenesis in which the regulation is
tightly controlled (Adams and Alitalo, 2007).
During angiogenic switch, physiological stimuli such as hypoxia, oncogenic
stimuli or tumour suppression mutation and anti-cancer agent tip the balance in
favour of pro-angiogenesis (Adams and Alitalo, 2007; Johnson and Wilgus, 2014)
increasing expression of angiogenic activators especially VEGF-A and activation of
angiogenic genes in endothelial cells. High levels of VEGF-A allows initiation of
angiogenesis in quiescent endothelial cells while inhibition of VEGF-A stimulates
apoptosis of endothelial cells (Johnson and Wilgus, 2014). Wang and colleagues
showed that high glucose induced apoptosis in endothelial cells through down
regulation of VEGF mRNA expression. The study showed that pre-treating cells with
endogenous VEGFA prevented high glucose mediated apoptosis (Yang et al., 2008).
Moreover, some studies have shown that VEGF resistance leads to impaired
angiogenesis in type 2 diabetes resulting in development of various vascular
complications associated with type 2 diabetes (Shibuya, 2011) however the
molecular mechanism is not fully understood.
The role of angiogenesis in health has been mainly studied in diabetic animals
because impaired angiogenesis is a marker of vascular complications in type 2
diabetes (Kolluru et al., 2012; Cheng and Ma, 2015). Vascular complications
associated with type 2 diabetes are grouped as microvascular and macrovascular.
Microvascular complications include retinopathy, diabetic nephropathy and
neuropathy which all are resultant of impaired angiogenesis (Levick, 2003);
Page 119 of 167
macrovascular complications include CVD and ischemic heart failure. Both the
diabetic micro- and macrovascular disease are marked by endothelial dysfunction, a
hallmark of atherosclerosis (Levick, 2003). A form of CVD known as Keshan disease
is a cardiomyopathy known to be caused by low Se deficiency, but is prevented by
Se supplementation (Chen et al., 1980; Thomson, 2004). Several meta-analysis and
cross-sectional studies have outlined a ―U‖ shaped relationship between Se levels
and CVD, i.e. low Se intake (<90 µg/day) leads to cardiomyopathy and, on the other
hand, high Se intake (>190 µg/day) also increases the risk of CVD (Bleys et al.,
2009; Laclaustra et al., 2010; Rayman, 2012; Rayman and Stranges, 2013). The
molecular mechanism causing this increased risk of CVDs as a result of high Se
intake is yet to be identified. However, oxidative stress has been linked as a
mechanism behind low and high Se induced cardiovascular events (Rees et al.,
2013). The role of Se, as an anti-oxidant agent, in endothelial function and CVDs has
been well investigated (Chen et al., 1980; Burk, 2002; Rees et al., 2013; Pillai,
Uyehara-Lock and Bellinger, 2014) and several studies have shown the implication
of Se in angiogenesis (Jiang et al. 2000; Shi et al. 2013; Ishikura et al. 2014).
Methylselenol (CH3SeH), a metabolite of selenate and selenite, was shown to
have inhibitory effects on the expression of key molecules involved in angiogenesis
(Jiang, Ganther and Lu, 2000; Shi et al., 2013). Selenoprotein P (SeP) SeP has
been found to be elevated in serum of patients with impaired glucose tolerance; SeP
is found to impair insulin signalling resulting in insulin resistance; (Yang et al., 2000)
thus leading to the interest in the role of Se in angiogenesis . Recently, it has been
shown that liver derived SeP impairs the VEGF-induced angiogenesis in HUVECs
(Ishikura et al., 2014). In the absences of SeP, VEGF did not interfere with HUVECs
migration and formation of tube like structures in in vitro angiogenesis assay unlike in
Page 120 of 167
cells co-treated with SeP and VEGF. The results further showed delayed wound
healing in skins crafts of mice with wild type Sepp1 but mice with Sepp1-/- mice
showed improved wound healing (Ishikura et al., 2014) validating that Se therefore
impairs angiogenesis. The propose that, increased SeP act as anti-oxidant and
depletes the physiological amount of ROS present in cells necessary to activates the
phosphorylation of VEGF receptor thereby impairing angiogenesis (Ishikura et al.,
2014). Se is a cofactor for thioredoxin (TrxR) reductase which has pro-angiogenic
potential (Streicher et al., 2004; Dunn et al., 2010). The investigation on the changes
of the Se-dependent enzyme, TrxR in controlling angiogenesis revealed that
inhibited levels of TrxR increased VEGF expression leading to quicker angiogenic
response in bovine mammary endothelial cells (Streicher et al., 2004). The studies
shows that low Se status increases angiogenesis while high Se levels impaired
angiogenesis.
Animal model studies have associated low Se status to increased
angiogenesis in rat mammary carcinomas perhaps due to reduced inhibitory effect of
Se as an anti-oxidant on physiological ROS needed for activation of VEGF receptor
to promote angiogenesis (Jiang et al., 1999) . However, the mechanism behind
increased angiogenesis due to low Se levels is not fully established. In cultured cells,
one paper investigated the role of TrxR in endothelial derived VEGF production and
angiogenic development from Se deficient and Se supplemented bovine mammary
endothelial cells (BMECs). The study found that chemical inhibition of selenoproteins
TrxR stimulated cell proliferation, migration and angiogenesis in cells deficient with
Se compared to Se supplemented BMECs (Streicher et al., 2004). BMECs with
inhibited TrxR and Se supplementation had reduced cell proliferation, VEGF
production and impaired angiogenesis compared to cells with Se deficiency and
Page 121 of 167
normal TrxR activity (Streicher et al., 2004). The authors concluded that inhibited
selenoproteins TrxR are more essential than Se status for VEGF production, cell
proliferation and angiogenesis (Streicher et al., 2004) showing the essential role of
selenoproteins in angiogenesis. In addition the studies suggest that high Se status or
high selenoprotein activity impairs angiogenesis.
Biological mechanisms behind Se-induced endothelial dysfunction or
angiogenesis are complicated and maybe linked to the dual role of Se as a toxic
agent at high doses or concentrations or as an essential element important in
formation of antioxidant selenoproteins. Increasing the doses or the intake of Se
increases the formation of selenoproteins particularly glutathione peroxidase, but the
dose-response reaches a plateau between 70-90 ng/mL (~1.5 µM) (Thomson, 2004).
Thus, high Se doses or concentrations could potentially increase cardiovascular
events in population with optimal Se levels. Excessive Se has been shown to impair
micro vessel formation and promote apoptosis in endothelial cells, however Se
deficiency has opposing effects of promoting micro vessel formation and impairing
apoptosis (Dunn et al., 2010).
The contradictory effects of Se levels on health and diseases are yet to be
understood although it is thought that there are some unidentified compensatory
redox mechanisms that are induced by excessive or depleted Se levels. A number of
studies have proposed that Se supplementation in Se deficient or Se naïve patients
prevent atherosclerotic diseases due to its involvement in the formation of anti-
oxidant proteins known as selenoproteins (Flores-Mateo et al., 2006; Bleys et al.,
2008; Rees et al., 2013), however, few meta-analysis studies have shown that there
is a statistically significant inverse association between high Se intake and CVD
Page 122 of 167
(Jossa et al., 1991; Flores-Mateo et al., 2006; Bleys et al., 2009; S Stranges et al.,
2010).
Se is actively promoted across the world as an antioxidant nutrient and
therefore there is a need to understand the efficacy, mechanism of action and effect
on health and diseases. One potential mechanism underlying Se‘s role in
pathophysiology is its potential to stimulate ER stress induction. Several studies
have linked ER stress to insulin resistance and type 2 diabetes (Araki, Oyadomari
and Mori, 2003; Ozcan et al., 2004, 2006; Hummasti and Hotamisligil, 2010). At the
same time Se has been associated with type 2 diabetes and CVDs ( Stranges et al.
2010; Stranges et al. 2007; Steinbrenner et al. 2011; Laclaustra et al. 2010; Rayman
& Stranges 2013; Rayman 2012; Bleys, Navas-Acien & Guallar 2008). However,
few studies have linked the role of Se induced ER stress to the aetiology or
progression of type 2 diabetes and other human diseases (Wu et al., 2005; Zu et al.,
2006; Hwang et al., 2007; Wallenberg et al., 2014). Moreover, the role of Se-induced
ER stress on endothelial dysfunction or diabetes-complication vascular disease
complicated is not known. Since endothelial dysfunction in diabetes happens through
impaired angiogenic capacity, we therefore investigated the activation of ER stress in
Se-induced endothelial dysfunction measuring angiogenic capacity as a marker of
endothelial dysfunction.
A number of studies on cultured endothelial cells, animal models and humans
have linked ER stress to endothelial dysfunction (Sheikh-Ali et al., 2010; Basha et
al., 2012; Kassan et al., 2012; Ozcan and Tabas, 2012; Galán et al., 2014).
Homocysteine has been found to be a risk factor in CVD and in cultured endothelial
cells; it has been established that homocysteine induces the IRE1 pathway and
Page 123 of 167
subsequently activates CHOP resulting in ER stress mediated-endothelial cell death
(Zhang et al., 2001). Davies and co-workers (2013) demonstrated the relationship
between disturbed blood flow and ER stress activation and found elevated mRNA
expression of ER stress markers at anatomical sites where there is disturbed blood
flow, here termed as atherosclerosis, from pig‘s aortic arches (Davies et al., 2013).
Protein analysis showed that in sites with disturbed blood flow there is activation of
IRE1a and ATF6 pathways showing that ER stress is associated with shear stress.
Shear stress is ―a biomechanical force determined by blood flow‖ (Cunningham and
Gotlieb, 2005). Disturbed shear stress triggers endothelial dysfunction by decreasing
vascular wall function due to low endothelial nitric oxide synthase (eNOS)
production, low vasodilation and low endothelial repair coupled with increased ROS
and apoptosis eventually leading to atherosclerosis followed by ischemic injury and
CVD (Cunningham and Gotlieb, 2005). Angiogenesis can therefore be considered a
marker of endothelial dysfunction and an indicator of atherosclerosis. As it has been
outlined that ER stress is linked to atherosclerosis, our aim was to investigate the
role of Se-induced ER stress in angiogenesis in normal human endothelial cells.
Current studies have exposed a link between ER stress markers and the
angiogenesis process (Dong et al., 2011; Lenna, Han and Trojanowska, 2014; Urra
and Hetz, 2014; Binet and Sapieha, 2015). GRP78/BiP overexpression has been
reported in synovium of rheumatoid arthritis patients, in contrast to mice models in
which GRP78/BiP activation was linked to VEGF-induced angiogenesis (Lenna, Han
and Trojanowska, 2014). One study was investigating the role of GRP78 in tumour
growth by looking at the early phase of tumour growth called neovascularization also
known as tumour angiogenesis; the study found that in heterozygote GRP78+/- mice
implanted with E0771 breast cancer cells, there was a 70% reduction in tumour
Page 124 of 167
angiogenesis compared to GRP78 +/+ mice (Dong et al., 2011). The results showed
that not only ER stress in involved in tumour angiogenesis but overexpression of ER
stress markers inhibits angiogenesis in the early phases of cancer compared to the
late phase of tumour implantation (Dong et al., 2011).
The use of chemical chaperones to alleviate ER stress as a treatment of
action for various disorders such as in insulin resistance has proven to be beneficial
although the molecular mechanism is not known. PBA and TUDCA have been
shown to be potential therapeutic agents in the treatment of ER stress related
diseases like rheumatoid arthritis, neurodegenerative diseases, Alzheimer‘s, TCA
cycle disorders and insulin resistance (Ozcan et al., 2006; Engin and Hotamisligil,
2010; Kuang et al., 2010; Galán et al., 2014; Humeres et al., 2014; Liu et al., 2016).
Although literature review so far shows an association between Se and angiogenesis
as well as ER stress as a mechanism involved in impaired angiogenesis, there is no
information on the role of ER stress induction on impaired angiogenesis due to high
Se intake or concentrations.
Several studies have shown that upon unresolved ER stress, an apoptotic
cascade is activated through the induction of CHOP (Hetz, 2012). It has been well
established that during ER stress, the PERK-eIF2α-ATF4 axis is stimulates CHOP
induction (Szegezdi et al., 2006; Hetz, 2012) . CHOP works as a transcriptional
factor that regulates signalling proteins working in the apoptotic pathway;
researchers have established that Chop-/- mice and cells (mouse pancreatic beta
cells and mouse embryonic fibroblasts) are resistant to ER stress-induced apoptosis
thereby proposing the role of CHOP in ER stress-induced cell death (Oyadomari et
al., 2001; Szegezdi et al., 2006). CHOP has been found to regulate pro-survival and
Page 125 of 167
anti-survival proteins involved in apoptosis such as B-cell lymphoma-2 (Bcl-2) and
BAX, respectively (Szegezdi et al., 2006). A study found that cells which
constitutively overexpress CHOP genes had reduced cell survival and increased
apoptosis once treated with ER stress inducers thapsigargin and tunicamycin
(McCullough et al., 2001). The study further elaborated that overexpression of
chop/gadd153 genes down-regulated the expression of bcl2 genes and reduced
levels of Bcl-2 proteins (McCullough et al., 2001). Bcl-2 protein is an anti-apoptotic
marker therefore overexpression of chop/gadd153 gene led to increased production
of CHOP protein. The results suggest that ER stress-mediated apoptosis is
regulated by BCL2 family of proteins which includes the anti-apoptotic Bcl-2 and the
pro-apoptotic BAX/BAK protein. Furthermore, induction of CHOP leads to
translocation of the BAX/BAK, a pro-apoptotic protein, from cytosol to the
mitochondria to activate caspases-3 mediated apoptosis also known as
mitochondria-mediated apoptosis during chronic ER stress (Schröder, 2008; Sano
and Reed, 2013).
Although the regulation of BAX/BAK and Bcl-2 proteins by ER stress in no
well understood, it is postulated that c-Jun kinase (JNK) is activated during activation
ER stress (activation of the IRE1α) and JNK phosphorylates the Bcl-2 localised in
the ER and BIM, the pro-apoptotic protein, leading to the activation of the caspase
activation (Szegezdi et al., 2006; Sano and Reed, 2013) via the mitochondrial
induced apoptosis. It is worth mentioning that cytochrome c is not essential for ER
stress–induced apoptosis through caspases activation because, murine cells
(C2C12 cells) have been shown to go through ER stress induced apoptosis without
the release of cytochrome c from the mitochondria. The study showed that
thapsigargin or tunicamycin treated C2C12 cells have the same amount of
Page 126 of 167
cytochrome c release as the untreated but there was direct activation of caspases 9
by caspase 12 (Morishima et al., 2002).
Cysteine-dependent aspartate-directed proteases (Caspases) are central
regulators of apoptosis; initiator caspases (Caspases-2, -8, -9, -10, -11 and -12)
intimately coupled with effector caspases (Caspases-3, -6 and -7) to execute the
apoptosis pathway (Elmore, 2007; Fuchs and Steller, 2011). The initiator caspase
once cleaved, is active and will, in turn activate the effector caspases to promote
apoptosis. Although mitochondria-mediated apoptosis and the role of caspases in
apoptosis pathway is well documented (Elmore, 2007), the role of caspases on ER
stress-induced apoptosis is not conclusively ascertained. Even though it has been
shown that some caspases are participating in ER stress induced apoptosis, the
identity of specific caspases involved in ER stress-induced apoptosis are yet to be
fully identified. Nonetheless, caspase 12 has been implicated as an essential
mediator in ER stress-induced apoptosis in rodents.
Caspase 12 is only expressed in rodents, but silent in humans. Therefore,
caspase 12 does not play a role in ER stress-induced apoptosis in human cell lines
and primary cells; instead it has been shown been that caspase 4 has a similar role
in human cell studies (Morishima et al., 2002; Hitomi et al., 2004; Szegezdi et al.,
2006). Nevertheless, murine cells treated with either tunicamycin or thapsigargin
triggered activation of caspase 12, 9 and 3 independent of cytochrome c release
(Morishima et al., 2002). ER stress inducers activates caspase 12 which cleaves and
activates caspase 9 to initiate ER stress mediated apoptosis (Morishima et al.,
2002). Other caspases that are cytochrome c release dependent have been
researched; the involvement of caspase 2, -3 and 7 have been linked to ER stress
induced apoptosis (Morishima et al., 2002; Cheung et al., 2006; Tabas and Ron,
Page 127 of 167
2011). For example one study showed that treatment of glomerular mesangial cells
with advanced glycation end-products (AGEs) induced caspase 3 mediated-
apoptosis in a dose dependent manner via ER stress induction (Chiang, et al.,
2016).
It has been shown that Se activates CHOP expression in leukemic cells
thereby leading to apoptosis termed as ER stress mediated apoptosis (Wu et al.,
2005). Methylseleninic acid (MSA) induces ER stress in the human prostate cancer
cell lines (PC-3 cells) and furthermore induced ER stress mediated apoptosis in a
dose dependent manner (Wu et al., 2005). The results of this former study indicated
that 10 µM of MSA induced ER stress markers phospho-PERK, GRP78/BiP and
phospho-eIF2 from 6 hours to 15 hours. Furthermore, as the ER stress associated-
apoptotic markers (cleaved caspase 12, PARP and CHOP) increased proportionally
with the dose of MSA the markers of ER stress decreased while overexpression of
GRP78/BiP alleviates MSA-induced ER stress (Wu et al., 2005).
Recently, a study to investigate the ability of MSA and selenite to kill primary
effusion lymphoma cell lines and the mechanisms involved in the cell death
associated to the mentioned Se compounds was reported. The study concluded that
MSA and selenite induce apoptosis through the activation of caspase 3, caspase 7
and caspase 9 with the activation of caspase 9 prominent in MSA induced apoptosis
(Szegezdi et al., 2006; Xiang, Zhao and Zhong, 2009; Uguz and Naziroglu, 2012)
(Shigemi, et al., 2017). Furthermore, MSA and selenite induced apoptosis activated
via the ER stress pathway though CHOP expression (Shigemi, et al., 2017). Our
previously described results suggest that Se (selenite) induces ER stress in
Page 128 of 167
endothelial cells however we wanted to further mechanistically investigate the impact
of Se induced ER stress in angiogenic capacity.
5.2 Results
5.2.1. High selenium impairs angiogenesis mediated by ER stress in endothelial cells We investigated the effect of Se on the process of angiogenesis, a marker of
endothelial function. We firstly compared our control growth conditions with a
positive inducer of angiogenesis, namely VEGF-A. We found that endothelial cells
incubated with pure growth media, supplemented with low growth cell supplements
containing growth factors for human endothelial cells, formed a number of tube like
structures on Matrigel® that was no different from cells treated with 50 ng/mL of
VEGF-A (as shown in Figure 5.1). Figure 5.1B shows the quantification of these
results, confirming that there was no significant difference between cells grown
under our control conditions or treated with the positive angiogenesis inducer VEGF-
A. Therefore, our control conditions were adequate to promote tube-like structure
formation in our assay, and any potential changes that occurred in cells due to the
treatment with selenite could be assessed.
Figure 5.1A shows that there is a dramatic reduction in number of tube like
structures formed in endothelial cells treated with selenite compared to control, at
doses of 5 µM (19 tubes, p<0.001) and 10 µM (1 tube, p<0.0001). Treatment with
physiological concentrations of selenite (0.5 µM) led to a small reduction in tube-like
structure formation, and the reduction was not statistically significant (31.8 meshes,
p=0.1926). Interestingly, the use of chemical chaperone PBA improved angiogenesis
in high selenite treated cells.
Page 129 of 167
Figure 5.1. High Se impairs angiogenic capacity of endothelial cells. High selenite (5 μM, P=0.0030 and 10 μM, P<0.0001) concentrations induced endothelial dysfunction by impairing process of angiogenesis through the activation of ER stress. Representative picture of tube-like formation on Matrigel® are shown for cells treated with various concentrations of selenite (A). Values represent the average number of tube like structures formed (B) expressed as mean ± SEM and were statistically-treated using one-way ANOVA followed by Tukey multiple post-hoc test. ** p<0.001, *** p<0.0001, vs CTL. N = 4 in each group.
High selenite concentrations dramatically inhibited formation of tube like
structures formed on the Matrigel® compared to the control. As depicted in Figure
5.1 A, there is a distorted formation of tube like structures on endothelial cells treated
with 5 µM of selenite. The tubes were counted with Image J Software (Angiogenesis
Page 130 of 167
assay) to give out the number of tubes formed per well and statistical analysis was
performed on Graph Pad Prism. Treating HUVECs with 5 M of selenite inhibited
tube-like structure formation with 19 meshes (tube like structures) compared to the
untreated samples with 34 meshes formed (p<0.05). Figure 5.1B shows furthermore
highlight that there is a significant difference of the meshes formed between the 5
µM selenite treated cells and the untreated cell with a p value of less than 0.0001
(p<0.05). Interestingly, PBA prevented impaired angiogenic in endothelial cells
treated with 5 µM of selenite, and the quantification represented in Figure 5.1B
clearly depicts that there is significant difference in the number of tubes formed in
cells treated with 5 µM of selenite only and if compared to that of cells pre-treated
with PBA prior to selenite treatment. Furthermore, we observed the same in
endothelial cells treated with a higher selenite concentration (10 µM).
There was complete impairment in the formation of tube like structures in
endothelial cells treated with 10 µM selenite, and PBA pre-treatment completely
prevented this impairment, hence prevented impaired angiogenesis. In vitro
angiogenesis assay shows that at 10 µM of selenite treatment the cells clumped and
did not form tube like structures; quantitative analysis of the data shows that 1 tube
was formed (Figure 5.1B). PBA significantly prevented or reduced this impaired
formation of tube like structures, as an average of 26 meshes were analysed
(p<0.0001). Our results show that the chemical chaperone PBA prevented Se
induced impaired angiogenesis at both 5 µM and 10 µM selenite concentrations and
further support our conclusion that ER stress in involved in Se induced endothelial
dysfunction.
Page 131 of 167
5.2.2. High selenium stimulates VEGF-A expression in endothelial cells is
mediated by ER stress and time dependent
We investigated the effect of Se on mRNA expression of VEGF-A, an important
angiogenesis activator. We compared the gene expression of VEGF-A in a time
depended manner upon treating cells with selenite for 8 and 24 hours with varying
concentrations of selenite in the absences or presence of PBA. The results in Figure
5.2 show that high selenite (5 µM and 10 µM) stimulated VEGF-A gene expression in
a dose dependent manner (5 µM; 6.3-fold, p<0.05 and 10 µM; 17.1-fold p<0.001 vs
CTL), 8 hours‘ post-selenite treatment. However, 24 hours‘ post-selenite treatment,
VEGF-A expression reduced to basal levels (5 µM; 0.9-fold, p=0.99 and 10 µM; 1.3-
fold, p=0.99 vs CTL). Cells co-treated with PBA and high selenite, 5 µM and 10 µM,
showed an increase of VEGF-A expression, 5.7-fold and 5.9-fold, respectively, if
compared to the control levels, but this increase was not statistically significant.
At 24 hours, there was no significant effect of selenite on the expression of VEGF-A
mRNA in endothelial cells treated with high selenite concentrations, 5 µM and 10 µM
(1-1.3-fold, p=0.99 vs CTL) compared to the untreated and the 0.5 µM of selenite
treated cells. In Figure 5.2B, we show that PBA moderately increased VEGF-A
mRNA expression by approximately 2-fold in cells treated with 5 and 10 µM of
selenite.
Page 132 of 167
Figure 5.2. High Se increased VEGF-A mRNA expression in a time dependent manner in endothelial cells. HUVECs treated with only selenite for 8 hours increased VEGF-A mRNA expression (Figure 5.2A) in a dose dependent manner. High selenite concentrations, 10 µM, led to a significant increase of VEGF-A mRNA expression by 15 fold, p<0.0001, post 8 hour incubation of cells with selenite in the absence of PBA. (Figure 5.2A). There was no significant change in the VEGF-A mRNA expression across selenite concentrations at 24 hours of treatment (Figure 5.2C). Figure 5.2C shows a significant decrease of VEGF-A mRNA expression at high selenite from 8 hours to 24 hours. (Figure 5.2C). PBA reduced VEGF-A mRNA expression to basal levels like CTL. Data is expressed as mean ±SEM and were analysed using one-way ANOVA followed by Tukey multiple post-hoc test. *** P<0.001 vs CTL. N = 3 in each group. Figure 5.2C Data is expressed as mean ± SEM, *p<0.05, ****p<0.001 (two-way ANOVA followed by Bonferroni multiple post hoc test.)
Page 133 of 167
5.2.3 High selenium induces apoptosis in endothelial cells through ER stress
activation.
To further confirm that cell death caused by high Se involves an apoptotic
mechanism and to understand the role played by ER stress response in this effect,
we stained endothelial cells treated or not with Se in the presence or absence of a
chemical chaperone (PBA) with 7-ADD and Annexing V dye and then analysed by
flow cytometry. As shown in Figure 5.3, the treatment of cells with high doses of
selenite (5-20 µM) caused an increase in the percentage of apoptotic cells while cells
pre-treated with the chemical chaperone PBA were protected (Figure 5.3A and
5.3C). Furthermore, a high dose of selenite (1000 µM) also caused a significant
increase in the percentage of apoptotic cells though cells pre-treated with the
chemical chaperone PBA were protected (Figure 5.3B and 5.3 D).
Altogether, apoptosis quantification by flow cytometry analysis of cells treated
with and without PBA strongly indicates that high Se elicited apoptosis in endothelial
cells. The protection afforded by the chemical chaperone PBA indicates apoptosis is
induced via a mechanism potentially involving the ER stress response.
Page 134 of 167
Figure 5.3. High concentrations of Se induce apoptosis through the activation of ER
stress. Quantification of apoptotic EA.hy926 endothelial cells treated with different doses of
selenite in the presence or absence of PBA (A) or treated with various concentrations of
selenate in the presence or absence of PBA (B). Representative histograms of flow
cytometry are shown for cells treated with selenite (C) and for those treated with selenate
(D). Values represent the percentage of apoptotic cells for each treatment and are
expressed as mean ± SEM and were analysed using one-way ANOVA followed by Tukey
multiple post-hoc test. *** P<0.001 vs CTL. N = 4 in each group.
Page 135 of 167
5.2.4. High selenium causes ER stress-mediated apoptosis through the
activation of caspases 3/7 in endothelial cells.
We further investigated the apoptotic pathway involved the ER stress-mediated
apoptosis caused by high Se intake. Compared to the untreated (CTL) cells, 5 µM of
selenite at 8 and 24 hours significantly increased the activity of caspases 3 and 7 by
1.5-fold (p<0.001) and 2-fold (p<0.001), respectively. Interestingly, PBA pre-
treatment completely prevented the activation of caspases 3/7 strongly indicating
that selenite-induced ER stress can activate the executioner caspases 3/7.
Surprisingly, higher doses of selenite (10 and 20 μM) did not affect caspase 3/7
activity (Figure 5.4). All the experiments were corrected to the number of viable cells
and compared to the untreated (CTL) experiment. 1 µM of staurosporine was used
as a positive apoptosis inducer.
Figure 5.4. High Se causes ER stress-mediated apoptosis through the activation of caspases 3/7 in endothelial cells. Caspases 3/7 activity in EA.hy926 endothelial cells treated with various doses of selenite or staurosporine (positive control or PC) in the presence or absence of PBA for 8 hours (A) or 24 hours (B). High selenite concentrations (5 µM) showed high activation of caspases 3/7 at both 8 and 24 hours. PBA reduced the activation of caspases 3/7. Values represent the percentage of caspases 3/7 activity as % of control (CTL) and are expressed as mean ± SEM and were analysed using one-way ANOVA followed by Tukey multiple post-hoc test. *** P<0.001 vs indicated groups. N = 3 in each group.
Page 136 of 167
5.3 Discussion
The aim of this study was to investigate the impact of Se induced ER stress in
angiogenic capacity of endothelial cells and mechanism involved. This is the first
study to investigate the effect of Se-induced ER stress in angiogenesis and to
demonstrate that Se in the form of selenite impairs angiogenic capacity in human
primary cells. The present data showed that high Se intake prevented formation of
tube like structures in the Matrigel® showing that high Se concentration impairs
angiogenesis, highlighting the fact that high Se intake result in endothelial
dysfunction. Interestingly the use of the chemical chaperone PBA, prevented
impaired angiogenesis in cells treated with high Se concentrations (5 µM and 10 µM)
of Se sources. This strongly suggests that ER stress mechanism are involved in
impaired angiogenesis due to high Se intake.
The growth of new blood vessels by angiogenesis is essential for wound and
tissue repairing and in cancer physiology in tumour progression (Carmeliet, 2005).
Blood vessels growth is significantly affected by the VEGF-A that is secreted by
macrophages, cancer cells during hypoxia and endothelial cells (Folkman and Shing,
1992). Few studies have found that low Se status increased production of VEGF-A
post angiogenic development (Jiang et al., 1999; Jiang, Ganther and Lu, 2000;
Streicher et al., 2004). Additionally, TrxR inhibited bovine mammalian endothelial
cells (BMECs) supplemented with 20 ng/mL of selenite showed increased protein
expression of VEGF-A but had less tube formation compared to Se deficient BMECs
in an in vitro angiogenesis assay (Streicher et al., 2004).
Our results as shown in Figure 5.1 agree with Streicher results showing that
high Se supplementation prevents tube formation. However, the Streicher study
Page 137 of 167
used lower selenite concentration of 20 ng/mL (0.12 µM) in bovine mammary cells
compared to our study in which we used endothelial cells and 5 and 10 µM of
selenite). This shows that Se metabolism tolerance of Se might be cell specific.
Importantly, Jiang and co-workers (2000) found that 5 µM of methylselenol and 10
µM of selenite reduced cell viability and tube formation in HUVECs post 72 hours of
treatment. In their study, cells were treated with Se sources when already seeded
into the Matrigel®, whereas in our study, cells were treated for 24 hours with high
selenite (5 µM and 10 µM) and treatment was followed by seeding on the Matrigel®.
Our study is the first to report the role of ER stress in impaired angiogenesis
because of high Se concentrations. The results in Figure 5.1 showed that with co-
treatment of PBA and selenite, the angiogenic capacity of endothelial cells was
preserved, as PBA significantly prevented impaired angiogenesis in HUVECs treated
with 5 µM and 10 µM selenite. PBA has been shown to prevent or reverse ER stress
induction in several animal models and cell lines (Hotamisligil, 1999; Ozcan et al.,
2006; Kuang et al., 2010; Liu et al., 2016).
One study demonstrates the effect of high Se in the expression of VEGF-A, a
regulator for angiogenesis (Shibuya, 2011; Johnson and Wilgus, 2014). It was crucial
to therefore investigate the role of VEGF-A in Se induced endothelial dysfunction.
Our results show that high Se reduces the expression of VEGF-A in a time
dependant manner (compare Figure 5.2 panels A and B). Oxygen tension has been
shown to be the key regulator of VEGF-A gene expression in vivo and in vitro. Under
hypoxic state VEGF-A mRNA expression is induced through the activation of
hypoxia inducing factor-1α (HIF-1α) in normal and transformed cultured cells as well
as under ischemic injury in humans and animal models. Therefore VEGF-A is a
mediator of spontaneous revascularisation following myocardial ischemia and in
Page 138 of 167
wound repairing (Banai et al., 1994; Ferrara, 1999). Results from previous chapters
have shown that selenite induced reactive oxygen species making the environment
hypoxic, we propose that ROS-induced hypoxia activates hypoxia initiation factor-1α
(HIF1α) which in turn stimulates the expression of VEGF-A gene. VEGF-A then
activated and maintain angiogenesis therefore our results suggest that HUVECs
cells might undergo compensatory mechanism in the early hours after selenite
treatment (8 hours). 5 and 10 µM of selenite (Figure 5.2B) significantly reduced gene
expression of VEGF-A at 24 hours compared to 24 hours as shown in Figure 5.2C. It
is well established that VEGF-A expression stimulate the activation of adhesion
molecules such as vascular adhesion molecules-1 (VCAM-1) and as well as
inflammatory molecules such as interleukin-6 and apoptotic markers Bcl-2 in
endothelial cells (Carmeliet, 2005). Our study could potentially be further developed
to investigate the expression of adhesion molecules and inflammatory markers due
to increased VEGF-A mRNA expression at time points between 8 hours and 24
hours to investigate the cellular coping mechanism involved before programmed cell
death induction.
Additionally, to validate the role of VEGF-A in Se induced impaired
angiogenesis, we propose to further investigate the VEGF-A protein expression at
different time points to fully appreciate the role of ER stress in VEGF-A regulated
angiogenesis process. VEGF-A drives tumour angiogenesis and in normal
physiological conditions drives formation of new blood vessels. As our results
showed reduced gene expression of VEGF-A at 24 hours post selenite exposure, we
investigated the effect high selenite in angiogenesis process. High Se concentrations
in the form of selenite impaired formation of new blood vessels as depicted in Figure
5.1. Our results correlate with several studies that Se supplementation and
Page 139 of 167
increased selenoproteins impaired angiogenesis (Jiang et al., 1999; Streicher et al.,
2004; Shi et al., 2013). It is interesting to note that co-treating HUVECs with PBA, a
chemical chaperone, prevented the effects of high selenite on tube formation as well
as VEGF-A gene expression remained at basal levels like in untreated cells and
under selenite physiological concentrations. The results as shown in Figure 5.1 and
Figure 5.2 suggests that Se induced ER stress is involved in impaired angiogenesis.
5 and 10 µM of selenite completely prevented endothelial cells to perform the vital
function of forming new blood vessels (tube-like structures) under Matrigel®, an in
vitro angiogenesis assay.
One study demonstrated that 5 µM and 10 µM of Se in the form of purified
human Selenoprotein P (SelP) impaired VEGF-A-induced angiogenesis in HUVECs
as well as endothelial cell immigration (Ishikura et al., 2014). The study used SelP
instead of selenite as a source of Se, however the results correlate with our results.
In human studies, it has been shown that patients given high Se sources such as
Seleno-yeast 300ug/day in SELECT trial or selenomethionine in NHANES study,
developed increased the risk of type 2 diabetes a risk factor for cardiovascular
events (Bleys et al., 2009; Laclaustra et al., 2010; Rees et al., 2013). However the
role of high Se intake and risk of CVD is contradictory and molecular mechanisms
behind high risk of CVDs associated with high Se intake are under investigation. Our
results show that ER stress mechanism might drive high Se-induced endothelial
dysfunction. Cells pre-treated with the chemical chaperone PBA thought to act
through inhibition of ER stress, significantly showed improved angiogenesis
compared to cells treated with 5 µM and 10 µM of selenite only.
Selenite is known to be toxic to cells. However, whether this toxicity is due to
a direct toxic effect of the high Se dose or to the activation of regulated apoptotic
Page 140 of 167
mechanisms where the activation of ER stress observed above may play a pivotal
role, is not clear. Therefore, we decided to investigate the nature of the cell death
pathway at play caused by high-Se treatment (10 µM) in endothelial cells. The UPR
is initially activated as a pro-survival pathway to protect the cells from increased
accumulation of misfolded and unfolded proteins within the ER; however chronic
activation of UPR or ER stress can lead to apoptosis. Over-expression of CHOP has
been reported to lead to cell-cycle arrest and apoptosis (Zhang and Kaufman, 2008;
Claudio Hetz, 2012). Chop-/- mice exhibit reduced apoptosis in response to ER stress
therefore CHOP plays an important role in apoptosis induced by ER stress
(Oyadomari and Mori, 2004) . We have shown above that high Se caused induction
of ER stress and we investigated the role of Se induced ER stress in apoptosis in
endothelial cells; the connection between the two phenomena is not clear. To further
confirm that cell death caused by high Se involves an apoptotic mechanism and to
understand the role played by ER stress response in this effect, we labelled
endothelial cells treated or not with Se in the presence or absence of a chemical
chaperone (PBA) with 7-AAD and Annexin V and then analysed by flow cytometry.
Although, the reduction of cell viability indicates cell death in endothelial cells
treated with high Se, the nature of this death is not identified. Interestingly, we found
that selenite at higher doses, 5-20 μM, induces apoptosis; however, another form of
inorganic Se ―selenate‖ did not induce apoptosis at human physiological doses. The
difference between selenate and selenite might be due to their metabolism because
selenite is absorbed passively into cells compared to selenate which is absorbed in a
more regulated manner using selenate/OH- co-transport mechanism. This difference
in uptake has not yet been investigated in the cell lines we utilised. Importantly, the
pre-treatment of endothelial cells with the chemical chaperone, PBA, which is known
Page 141 of 167
to increase ER homeostasis and reduce the ER stress response (Ozcan et al., 2006;
Yam et al., 2007; Amin et al., 2012) ), completely prevented high-selenite mediated
apoptosis, strongly suggesting the involvement of ER stress.
ER stress activation may lead to cell death through various mechanisms;
however, over-expression of the pro-apoptotic protein CHOP is by far the most
important one (Araki, Oyadomari and Mori, 2003; Scull and Tabas, 2011; Flammer et
al., 2012; Inagi, Ishimoto and Nangaku, 2014). CHOP can induce apoptosis through
different mechanisms such as; i) interacting with members of the BCL-2 family
proteins to down-regulate the transcription of anti-apoptotic protein BCL-2 resulting
in activation of the pro-apoptotic proteins BAX and BAK and causing mitochondrial-
mediated apoptosis, ii) the activation of the calcium signaling pathway (activation of
CaMKII) or finally through the activation of caspase family, chiefly caspases 3 and 12
(Scull and Tabas, 2011). Chronic activation of the UPR activates pro-apoptotic
mediators, JNK, TRAF2 and AKS1 through phosphorylation of IRE-1α. Activation of
JNK, TRAF2 and ASK1 will eventually lead to the activation of caspase 3. Caspase 3
is structurally similar to caspase 7 and might compensate for the lack of caspase 7;
its role is to activate apoptosis. Therefore, ER stress signals are involved in
activation of caspases 3/7 leading to mitochondrial dysfunction and apoptosis.
Caspase activity has been associated with ER stress but the identity of the
applicable caspases involved has not been confirmed. Caspases 3/7 are critical
mediators of mitochondrial events of apoptosis. High Se concentrations were
reported in cancer cell lines to cause cell death mediated by ER stress by increasing
calcium mobilization and the activation of caspases-3 and 9 (Wu et al., 2005;
Szegezdi et al., 2006; Guan et al., 2009; Xiang, Zhao and Zhong, 2009; Uguz and
Page 142 of 167
Naziroglu, 2012). Consistent with these results, we found that high doses of selenite,
5-20 µM, caused ER stress-mediated apoptosis through the activation of caspases
3/7 in endothelial cells (Figure 5.4).
A chemiluminescence test looking at the activation of the caspase 3/7
enzymes was used to determine the involvement of caspases 3/7 in ER stress-
induced apoptosis observed in the presence of high Se. EA.hy926 endothelial cells
were treated with varying doses (0.5, 5, 10 and 20 μM) of selenite in the presence or
absence of PBA for either 8 hours or 24 hours. As a positive control, some cells were
treated with staurosporine, an inhibitor of protein kinase C (PKC), at the
concentration 1 M for 4 hours. Our data showed an increased activity of caspases
3/7 at both 8 and 24 hours with high dose of selenite (5 μM). The involvement of ER
stress in this phenomenon was highlighted by the complete reversal of high selenite-
induced increase in caspase 3/7 activity in the presence of the chemical chaperone
PBA.
Our results furthermore demonstrate the role of ER stress in Se induced
endothelial dysfunction. Additionally, high Se intake impaired angiogenesis and
activated apoptosis in normal human endothelial cells through ER stress induction.
We demonstrate that high Se intake increases the risk of CVD through an ER stress
dependent mechanism.
Page 143 of 167
Chapter 6. General discussion
Page 144 of 167
6. General Discussion
Previous research has raised questions on the role of high Se in CVD because high
Se has been shown to cause insulin resistance in animal models also increasing the
risk of type 2 diabetes in Se replete populations supplemented with high Se.
However, the role of high Se in CVD has shown to be ambiguous; importantly the
direct effect of high Se on endothelial dysfunction and the molecular mechanisms
involved are not yet established. Furthermore, high Se induces apoptosis mediated
by ER-stress in prostate-cancer cell lines, adipocytes, human neurons and
pancreatic β cells (Wu et al., 2005; Zu et al., 2006; Hwang et al., 2007; Wallenberg
et al., 2014). This study shows that high Se causes endothelial dysfunction through
induction of ER stress.
6.1. High Se concentration induces ER stress in cells
The present study is the first to report that high Se induces ER stress in vascular
endothelial cells, i.e. human umbilical vein endothelial cells (HUVECs). The present
study not only adds to the existing evidence that high Se induces ER stress in cell
culture (Wu et al., 2005; Ozcan et al., 2006; Scull and Tabas, 2011; Sano and Reed,
2013; Wallenberg et al., 2014) but that treatment with Se in the form of selenite
induces several ER stress markers in a time- and dose-dependent manner, both at
the mRNA and protein levels in endothelial cells and liver carcinoma cell lines. To
the best of our knowledge, these findings are novel and have not been reported by
other groups in endothelial cells or liver carcinoma cell lines.
We were the first to show that high-Se induced ER stress in endothelial cells,
but we also found that cell viability was reduced more prominently in endothelial cells
and HepG2 cell lines than in HuH-7 cell lines with concentrations considered to be
Page 145 of 167
high (5 µM and 10 µM). This is because both endothelial cells and HepG2 cells used
were p53 wild type in contrast to HuH-7 which is p53 mutant. Cells with p53 mutation
tend to escape apoptosis, prolonging cell proliferation and survival (Brosh and
Rotter, 2009; Amaral et al., 2010). However, the doses used were not toxic to cells
because the form of cell death observed was apoptosis and not necrosis, as evident
from the apoptosis assay performed.
Whilst we proved here that high Se induces ER stress in endothelial cells by
using a chemical chaperone PBA, we recommend that in future, molecular genetic
assays should be more specific to confirm our hypothesis. We recommend that
knockdown or overexpression of one of the ER stress markers, such as PERK or
CHOP, will confidently establish the involvement of high Se in ER-stress induction. It
has been shown that cells with CHOP -/- have delayed ER-stress-induced cell death;
at the same time over-expression of BiP in cells was shown to prevent ER stress
induction (Oyadomari and Mori, 2004; Quick and Faison, 2012; Han et al., 2013).
One more recommendation is that post-transcriptional activation should be assessed
by looking at the protein markers, for example the ATF4, PERK and IRE1α ER stress
markers. Chemical chaperones such as PBA have been shown to have an effect in
upregulation of some ER-stress transcription factors in fibroblasts (Perlmutter et al.,
2006). Our results show that PBA prevented the accumulation of ROS in endothelial
cells as well as alleviating NO production, hence we further assume that besides its
function as a chemical chaperone, it also has anti-oxidant activity.
Another limitation of the study is the sample size used to investigate the
expression of BiP and p-eIF2α in endothelial cells. Even though more than five
sample sizes were investigated, the western-blot technique was troublesome. The
Page 146 of 167
signals of both BiP and p-eIF2α bands were not sufficient for the investigation. To
further validate the experiments, a more robust method such as ELISA technique
and immunohistochemistry could be used, despite being more expensive. Though
our results are from two independent experiments, they both indicate that chronic
use of high Se leads to ER-stress activation. This suggests that high Se intake may
cause ER-stress activation, not only in endothelial cells but in hepatocytes, therefore
affecting not only would the vasculature but the liver as well.
6.2. ER stress induced by high Se leads to endothelial dysfunction
This is first study to prove that ER stress induced by high Se causes endothelial
dysfunction. Our results expand the knowledge of the effect of high Se on endothelial
dysfunction and CVD. Importantly, this is the first study to prove that high Se impairs
angiogenesis via endoplasmic reticulum stress. ROS have been implicated in the
cause or result of ER stress induction (Kawasaki et al., 2012; Han et al., 2013; Urra
et al., 2013; Wallenberg et al., 2014). Furthermore, increased production of ROS
dampen down the availability of NO (Schulz, Gori and Münzel, 2011; Uy, McGlashan
and Shaikh, 2011). At the same time, impaired NO signalling results in impaired
vasodilation and impaired NO-mediated angiogenesis (Shibuya, 2011; Johnson and
Wilgus, 2014) . All these factors cause endothelial dysfunction. The results not only
indicate that high Se leads to endothelial dysfunction by impairing the NO signalling
pathway, increasing ROS production and inhibiting angiogenesis, but also that ER
stress is one of the mechanisms involved.
The second important finding is that high Se intake causes endothelial cell
death mediated via caspase 3/7 activation. Chronic ER stress activates caspase-
mediated apoptosis (Scull and Tabas, 2011; Han et al., 2013). Only one study, to the
Page 147 of 167
best of our knowledge, determined the apoptotic signalling pathway induced by Se in
promyelocytic leukemia cells (Guan et al., 2009). Therefore, our results reinforce
those of Guan et al. (2009) showing that long-term exposure of endothelial cells to
high Se concentration activated caspases and ROS, resulting in ER stress-mediated
apoptosis. Our findings broadly suggest that long-term intake of high Se in a
population with optimal serum Se will increase the risk of CVD by inducing ER-
stress-mediated endothelial dysfunction.
The main limitation of the study is the use a chemical chaperone as an
inhibitor of ER stress to investigate the mechanism involved in endothelial
dysfunction induced by high Se. Although the literature shows that PBA inhibits ER-
stress-mediated disease such as insulin resistance and renal fibrosis in mice and
cultured cells (Ozcan et al., 2006; Liu et al., 2016), it would have been more
significant if we had opted for the use of molecular techniques such as knock-down
or overexpression of molecular chaperones involved in UPR such as BiP and PERK.
A further limitation is that the only vascular endothelial cells were used in the
investigation. Future research should include the use of myocardial tissue, for
example cardiomyocytes, to assess the effects on heart tissue in high Se
intake/status and could also use animal models to investigate the CVD endpoints.
Well-planned observational studies that include populations with both low and
optimal serum Se status supplemented with Se supplements will be necessary to
assess the impact of high Se on CVD. We recommend that new clinical trials that
investigate the use of high Se as an anti-cancer treatment in a Se replete population
should monitor CVD risk, for example by measuring blood NO production.
Furthermore, the general population must be educated on the use of Se
Page 148 of 167
supplements and made aware of the potential risk of CVD and type 2 diabetes in a
population with optimal serum Se status. We also recommend a study to investigate
the effects of ER stress induced by high Se and oxidative stress on the insulin
signalling pathway in endothelial cells.
6.3. Summary
Altogether, findings summarised in figure 6.1 indicate that high Se impairs the
function of endothelial cells and the underpinning cellular mechanism is ER stress.
These results provide the foundation for future animal and human studies to answer
the question of whether high Se intake increase the risk of CVD. Furthermore,
understanding the molecular and cellular mechanisms involved in high-Se-induced
endothelial dysfunction will help in the monitoring the effects of using high Se as a
cancer chemotherapy agent.
This thesis additionally warns the public to be aware of the risks of the use of
Se supplements as a prophylactic agent against oxidative-stress disease. We
specifically advise the public to be aware of the Se status in their area before
deciding to take a Se supplement. Lastly we discourage RCTs on the effect of Se
supplements in populations that already have optimal serum/plasma Se; same
conclusion from selenium and prostate cancer studies (Lippman et al., 2009; Kristal
et al., 2014).
Page 149 of 167
Figure 6.1. Summary of mechanism by which high Se induces endothelial dysfunction through ER stress activation. High Se activates ER stress induction in endothelial cells. High Se-induced ER stress inhibits the phosphorylation of protein kinase C also known as Akt which further impairs NO signalling via reduced phosphorylation of eNOs. Both ROA and ER stress induced caspase 3/7 activating leading to ER stress mediated apoptosis. Moreover, reduced availability of NO leads to inhibition of angiogenesis. Overall impaired angiogenesis, reduced NO and apoptosis results in endothelial dysfunction.
Page 150 of 167
Reference List
Abdo, K. M. (1994) ‗Sodium Selenate and Sodium Selenite‘, National Toxicology Report on Toxicity Studies, Toxicity R(38), p. 127. Adams, R. H. and Alitalo, K. (2007) ‗Molecular regulation of angiogenesis and lymphangiogenesis.‘, Nature reviews. Molecular cell biology, 8(6), pp. 464–478. doi: 10.1038/nrm2183. Agouni, A. et al. (2010) ‗In vivo differential effects of fasting, re-feeding, insulin and insulin stimulation time course on insulin signaling pathway components in peripheral tissues‘, Biochemical and Biophysical Research Communications, 401(1), pp. 104–111. doi: 10.1016/j.bbrc.2010.09.018. Agouni, A. et al. (2011) ‗Liver-specific deletion of protein tyrosine phosphatase (PTP) 1B improves obesity- and pharmacologically induced endoplasmic reticulum stress.‘, The Biochemical journal, 438(2), pp. 369–78. doi: 10.1042/BJ20110373. Amaral, J. D. et al. (2010) ‗The role of p53 in apoptosis.‘, Discovery medicine, 9(45), pp. 145–152. doi: 10.1039/b905129p. Amin, A. et al. (2012) ‗Chronic inhibition of endoplasmic reticulum stress and inflammation prevents ischaemia-induced vascular pathology in type II diabetic mice‘, Journal of Pathology, 227(2), pp. 165–174. doi: 10.1002/path.3960. Araki, E., Oyadomari, S. and Mori, M. (2003) ‗Endoplasmic reticulum stress and diabetes mellitus‘, Intern Med, 42(1), pp. 7–14. Available at: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12583611. Arnér, E. S. J. (2010) ‗Selenoproteins-What unique properties can arise with selenocysteine in place of cysteine?‘, Experimental Cell Research, pp. 1296–1303. doi: 10.1016/j.yexcr.2010.02.032. Balch, W. E. et al. (2008) ‗Adapting proteostasis for disease intervention.‘, Science (New York, N.Y.), 319(5865), pp. 916–9. doi: 10.1126/science.1141448. Banai, S. et al. (1994) ‗Upregulation of vascular endothelial growth factor expression induced by myocardial ischaemia: implications for coronary angiogenesis.‘, Cardiovascular research, 28(8), pp. 1176–9. doi: 10.1093/cvr/28.8.1176. Basha, B. et al. (2012) ‗Endothelial dysfunction in diabetes mellitus: Possible involvement of endoplasmic reticulum stress?‘, Experimental Diabetes Research. doi: 10.1155/2012/481840. Bashan, N. et al. (2009) ‗Positive and Negative Regulation of Insulin Signaling by Reactive Oxygen and Nitrogen Species‘, Physiological Reviews, 89(1), pp. 27–71. doi: 10.1152/physrev.00014.2008.
Page 151 of 167
Baum, M. K. et al. (2013) ‗Effect of micronutrient supplementation on disease progression in asymptomatic, antiretroviral-naive, HIV-infected adults in Botswana: a randomized clinical trial.‘, JAMA, 310(20), pp. 2154–63. doi: 10.1001/jama.2013.280923. Bhatnagar, P. et al. (2015) ‗The epidemiology of cardiovascular disease in the UK 2014.‘, Heart (British Cardiac Society), p. heartjnl-2015-307516-. doi: 10.1136/heartjnl-2015-307516. Binet, F. and Sapieha, P. (2015) ‗ER stress and angiogenesis‘, Cell Metabolism, pp. 560–575. doi: 10.1016/j.cmet.2015.07.010. Bleys, J. et al. (2008) ‗Serum selenium and serum lipids in US adults‘, American Journal of Clinical Nutrition, 88(2), pp. 416–423. doi: 88/2/416 [pii]. Bleys, J. et al. (2009) ‗Serum selenium and peripheral arterial disease: Results from the national health and nutrition examination survey, 2003-2004‘, American Journal of Epidemiology, 169(8), pp. 996–1003. doi: 10.1093/aje/kwn414. Bleys, J., Navas-Acien, A. and Guallar, E. (2007) ‗Serum selenium and diabetes in U.S. adults‘, Diabetes Care, 30(4), pp. 829–834. doi: 10.2337/dc06-1726. Bleys, J., Navas-Acien, A. and Guallar, E. (2008) ‗Serum selenium levels and all-cause, cancer, and cardiovascular mortality among US adults.‘, Archives of internal medicine, 168(4), pp. 404–410. doi: 10.1001/archinternmed.2007.74. Bogdan, C. (2001) ‗Nitric oxide and the immune response.‘, Nature immunology, 2(10), pp. 907–16. doi: 10.1038/ni1001-907. Brasher, A. M. and Scott Ogle, R. (1993) ‗Comparative toxicity of selenite and selenate to the amphipod Hyalella azteca‘, Archives of Environmental Contamination and Toxicology, 24(2), pp. 182–186. doi: 10.1007/BF01141346. Brenneisen, P., Steinbrenner, H. and Sies, H. (2005) ‗Selenium, oxidative stress, and health aspects‘, Molecular Aspects of Medicine, pp. 256–267. doi: 10.1016/j.mam.2005.07.004. Brosh, R. and Rotter, V. (2009) ‗When mutants gain new powers: news from the mutant p53 field‘, Nat Rev Cancer, 9(10), pp. 701–713. doi: 10.1038/nrc2693. Burk, R. F. (2002) ‗Selenium, an antioxidant nutrient.‘, Nutrition in clinical care : an official publication of Tufts University, 5(2), pp. 75–9. doi: 10.1046/j.1523-5408.2002.00006.x. Burk, R. F. and Hill, K. E. (2015) ‗Regulation of Selenium Metabolism and Transport‘, Annual Review of Nutrition, 35(1), p. 150514143029003. doi: 10.1146/annurev-nutr-071714-034250.
Page 152 of 167
Carmeliet, P. (2005) ‗Angiogenesis in life, disease and medicine.‘, Nature, 438(December), pp. 932–936. doi: 10.1038/nature04478. Carnicer, R. et al. (2013) ‗Nitric oxide synthases in heart failure.‘, Antioxidants & redox signaling, 18(9), pp. 1078–99. doi: 10.1089/ars.2012.4824. Chen, X. et al. (1980) ‗Studies on the relations of selenium and Keshan disease‘, Biological Trace Element Research, 2(2), pp. 91–107. doi: 10.1007/BF02798589. Chen, X. J. et al. (2012) ‗Sodium selenite-induced apoptosis mediated by ROS attack in human osteosarcoma U2OS cells‘, Biological Trace Element Research, 145(1), pp. 1–9. doi: 10.1007/s12011-011-9154-2. Cheng, R. and Ma, J. xing (2015) ‗Angiogenesis in diabetes and obesity‘, Reviews in Endocrine and Metabolic Disorders, pp. 67–75. doi: 10.1007/s11154-015-9310-7. Cheung, H. H. et al. (2006) ‗Involvement of caspase-2 and caspase-9 in endoplasmic reticulum stress-induced apoptosis: A role for the IAPs‘, Experimental Cell Research, 312(12), pp. 2347–2357. doi: 10.1016/j.yexcr.2006.03.027. Chistiakov, D. A. et al. (2014) ‗Role of endoplasmic reticulum stress in atherosclerosis and diabetic macrovascular complications‘, BioMed Research International. doi: 10.1155/2014/610140. Cold, F. et al. (2015) ‗Randomised controlled trial of the effect of long-term selenium supplementation on plasma cholesterol in an elderly Danish population‘, British journal of nutrition, pp. 1807–1818. doi: 10.1017/S0007114515003499. Cox, A. J. et al. (2014) ‗Contributors to mortality in high-risk diabetic patients in the Diabetes Heart Study‘, Diabetes Care, 37(10), pp. 2798–2803. doi: 10.2337/dc14-0081. Cunningham, K. S. and Gotlieb, A. I. (2005) ‗The role of shear stress in the pathogenesis of atherosclerosis‘, Laboratory Investigation, 85, pp. 9–23. doi: 10.1038/labinvest.3700215. Davies, P. F. et al. (2013) ‗The atherosusceptible endothelium: Endothelial phenotypes in complex haemodynamic shear stress regions in vivo‘, Cardiovascular Research, pp. 315–327. doi: 10.1093/cvr/cvt101. Davignon, J. and Ganz, P. (2004) ‗Role of endothelial dysfunction in atherosclerosis.‘, Circulation, 109(23 Suppl 1), p. III27-32. doi: 10.1161/01.CIR.0000131515.03336.f8. Deanfield, J. E., Halcox, J. P. and Rabelink, T. J. (2007) ‗Endothelial Function and Dysfunction‘, Circulation, 115(10), p. 1285 LP-1295. doi: 10.1161/CIRCULATIONAHA.106.652859.
Page 153 of 167
Delibegovic, M. et al. (2009) ‗Liver-specific deletion of protein-tyrosine phosphatase 1B (PTP1B) improves metabolic syndrome and attenuates diet-induced endoplasmic reticulum stress‘, Diabetes, 58(3), pp. 590–599. doi: 10.2337/db08-0913. Dennert, G. et al. (2012) ‗Selenium for preventing cancer‘, Sao Paulo Medical Journal, p. 67. doi: 10.1111/j.1756-5391.2011.01150.x. Diabetes UK (2015) Facts and Stats, https://www.diabetes.org.uk/About_us/What-we-say/Statistics/ (Accessed: 13/07/2016). doi: 10.1007/s11245-009-9073-4. Dimmeler, S. et al. (1999) ‗Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation.‘, Nature, 399(June), pp. 601–605. doi: 10.1038/21224. Donath, M. Y. and Shoelson, S. E. (2011) ‗Type 2 diabetes as an inflammatory disease‘, Nature Reviews Immunology, 11(2), pp. 98–107. doi: 10.1038/nri2925. Dong, D. et al. (2011) ‗A critical role for GRP78/BiP in the tumor microenvironment for neovascularization during tumor growth and metastasis‘, Cancer Research, 71(8), pp. 2848–2857. doi: 10.1158/0008-5472.CAN-10-3151. Drouin, P. et al. (2013) ‗Diagnosis and classification of diabetes mellitus.‘, Diabetes care, 36 Suppl 1, pp. S67-74. doi: 10.2337/dc13-S067. Duffield-Lillico, A. J. et al. (2003) ‗Selenium supplementation, baseline plasma selenium status and incidence of prostate cancer: An analysis of the complete treatment period of the Nutritional Prevention of Cancer Trial‘, BJU International, 91(7), pp. 608–612. doi: 10.1046/j.1464-410X.2003.04167.x. Dunn, L. L. et al. (2010) ‗The emerging role of the thioredoxin system in angiogenesis‘, Arteriosclerosis, Thrombosis, and Vascular Biology, pp. 2089–2098. doi: 10.1161/ATVBAHA.110.209643. Elmore, S. (2007) ‗Apoptosis: a review of programmed cell death.‘, Toxicologic pathology, 35(4), pp. 495–516. doi: 10.1080/01926230701320337. Engin, F. and Hotamisligil, G. S. (2010) ‗Restoring endoplasmic reticulum function by chemical chaperones: An emerging therapeutic approach for metabolic diseases‘, Diabetes, Obesity and Metabolism, 12(SUPPL. 2), pp. 108–115. doi: 10.1111/j.1463-1326.2010.01282.x. Erbay, E. et al. (2009) ‗Reducing endoplasmic reticulum stress through a macrophage lipid chaperone alleviates atherosclerosis.‘, Nature medicine, 15(12), pp. 1383–91. doi: 10.1038/nm.2067.
Page 154 of 167
Fairweather-Tait, S. J., Collings, R. and Hurst, R. (2010) ‗Selenium bioavailability: Current knowledge and future research requirements‘, American Journal of Clinical Nutrition. doi: 10.3945/ajcn.2010.28674J. Ferrara, N. (1999) ‗Role of vascular endothelial growth factor in the regulation of angiogenesis.‘, Kidney international, 56(3), pp. 794–814. doi: 10.1046/j.1523-1755.1999.00610.x. Flamment, M. et al. (2012) ‗New insights into ER stress-induced insulin resistance‘, Trends in Endocrinology and Metabolism, pp. 381–390. doi: 10.1016/j.tem.2012.06.003. Flammer, A. J. et al. (2012) ‗The assessment of endothelial function: From research into clinical practice‘, Circulation, 126(6), pp. 753–767. doi: 10.1161/CIRCULATIONAHA.112.093245. Flores-Mateo, G. et al. (2006) ‗Selenium and coronary heart disease: a meta-analysis‘, The American journal of clinical nutrition, 84(4), pp. 762–773. doi: 10.1016/j.micinf.2011.07.011.Innate. Folkman, J. and Shing, Y. (1992) ‗Angiogenesis‘, Journal of Biological Chemistry, pp. 10931–10934. Fowler, M. J. (2011) ‗Microvascular and macrovascular complications of diabetes‘, Clinical Diabetes, 29(3), pp. 116–122. doi: 10.2337/diaclin.29.3.116. Fuchs, Y. and Steller, H. (2011) ‗Programmed cell death in animal development and disease‘, Cell, 147(4), pp. 742–758. doi: 10.1016/j.cell.2011.10.033. Gage, M. C. et al. (2013) ‗Endothelium-specific insulin resistance leads to accelerated atherosclerosis in areas with disturbed flow patterns: A role for reactive oxygen species‘, Atherosclerosis, 230(1), pp. 131–139. doi: 10.1016/j.atherosclerosis.2013.06.017. Galán, M. et al. (2014) ‗Mechanism of endoplasmic reticulum stress-induced vascular endothelial dysfunction‘, Biochimica et Biophysica Acta - Molecular Cell Research, 1843(6), pp. 1063–1075. doi: 10.1016/j.bbamcr.2014.02.009. Goodman, M. et al. (2011) ‗Clinical trials of antioxidants as cancer prevention agents: Past, present, and future‘, Free Radical Biology and Medicine, pp. 1068–1084. doi: 10.1016/j.freeradbiomed.2011.05.018. Guan, L. et al. (2009) ‗Sodium selenite induces apoptosis by ROS-mediated endoplasmic reticulum stress and mitochondrial dysfunction in human acute promyelocytic leukemia NB4 cells.‘, Apoptosis : an international journal on programmed cell death, 14(2), pp. 218–225. doi: 10.1007/s10495-008-0295-5.
Page 155 of 167
Han, J. et al. (2013) ‗ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death‘, Nature Cell Biology, 15(5). doi: 10.1038/ncb2738. Hermann, M., Flammer, A. and Lscher, T. F. (2006) ‗Nitric Oxide in Hypertension‘, The Journal of Clinical Hypertension, 8(12 Suppl 4), pp. 17–29. doi: 10.1111/j.1524-6175.2006.06032.x. Hetz, C. (2012) ‗The unfolded protein response: controlling cell fate decisions under ER stress and beyond‘, Nat Rev Mol Cell Biol. doi: 10.1038/nrm3270. Hetz, C., Chevet, E. and Oakes, S. A. (2015) ‗Proteostasis control by the unfolded protein response.‘, Nature cell biology, 17(7), pp. 829–38. doi: 10.1038/ncb3184. Hitomi, J. et al. (2004) ‗Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Abeta-induced cell death.‘, The Journal of cell biology, 165(3), pp. 347–56. doi: 10.1083/jcb.200310015. Hotamisligil, G. S. (1999) ‗The role of TNFalpha and TNF receptors in obesity and insulin resistance.‘, Journal of internal medicine, 245(6), pp. 621–625. doi: 10.1046/j.1365-2796.1999.00490.x. Hotamisligil, G. S. (2010) ‗Endoplasmic reticulum stress and atherosclerosis‘, Nature Medicine, 16(4), pp. 396–399. doi: 10.1038/nm0410-396. Hsu, I. C. et al. (1993) ‗P53 gene mutation and integrated hepatitis b viral DNA sequences in human liver cancer cell lines‘, Carcinogenesis, 14(5), pp. 987–992. doi: 10.1093/carcin/14.5.987. Hu, F. B. (2011) ‗Globalization of diabetes: The role of diet, lifestyle, and genes‘, in Diabetes Care, pp. 1249–1257. doi: 10.2337/dc11-0442. Huang, Z., Rose, A. H. and Hoffmann, P. R. (2012) ‗The role of selenium in inflammation and immunity: From molecular mechanisms to therapeutic opportunities‘, Antioxidants & redox signaling journal, 16(7), pp. 705–743. doi: 10.1089/ars.2011.4145. Humeres, C. et al. (2014) ‗4-Phenylbutyric acid prevent cytotoxicity induced by thapsigargin in rat cardiac fibroblast‘, Toxicology in Vitro, 28(8), pp. 1443–1448. doi: 10.1016/j.tiv.2014.07.013. Hummasti, S. and Hotamisligil, G. S. (2010) ‗Endoplasmic reticulum stress and inflammation in obesity and diabetes‘, Circulation Research, pp. 579–591. doi: 10.1161/CIRCRESAHA.110.225698. Hwang, D. et al. (2007) ‗Selenium acts as an insulin-like molecule for the down-regulation of diabetic symptoms via endoplasmic reticulum stress and insulin signalling proteins in diabetes-induced non-obese diabetic mice‘, Journal of Biosciences, 32(4), pp. 723–735. doi: 10.1007/s12038-007-0072-6.
Page 156 of 167
Inagi, R., Ishimoto, Y. and Nangaku, M. (2014) ‗Proteostasis in endoplasmic reticulum-new mechanisms in kidney disease.‘, Nature reviews. Nephrology, 10(7), pp. 369–78. doi: 10.1038/nrneph.2014.67. Ishikura, K. et al. (2014) ‗Selenoprotein P as a diabetes-associated hepatokine that impairs angiogenesis by inducing VEGF resistance in vascular endothelial cells‘, Diabetologia, 57(9), pp. 1968–1976. doi: 10.1007/s00125-014-3306-9. Jeschke, M. G. et al. (2012) ‗Severe Injury Is Associated With Insulin Resistance, Endoplasmic Reticulum Stress Response, and Unfolded Protein Response‘, Annals of Surgery, 255(2), pp. 370–378. doi: 10.1097/SLA.0b013e31823e76e7. Jiang, C. et al. (1999) ‗Selenium-induced inhibition of angiogenesis in mammary cancer at chemopreventive levels of intake‘, Molecular Carcinogenesis, 26(4), pp. 213–225. doi: 10.1002/(SICI)1098-2744(199912)26:4<213::AID-MC1>3.0.CO;2-Z. Jiang, C., Ganther, H. and Lu, J. (2000) ‗Monomethyl selenium-specific inhibition of MMP-2 and VEGF expression: Implications for angiogenic switch regulation‘, Molecular Carcinogenesis, 29(4), pp. 236–250. doi: 10.1002/1098-2744(200012)29:4<236::AID-MC1006>3.0.CO;2-E. Johnson, C. C., Fordyce, F. M. and Rayman, M. P. (2010) ‗Symposium on ―Geographical and geological influences on nutrition‖: Factors controlling the distribution of selenium in the environment and their impact on health and nutrition.‘, The Proceedings of the Nutrition Society, 69(1), pp. 119–132. doi: 10.1017/S0029665109991807. Johnson, K. E. and Wilgus, T. A. (2014) ‗Vascular Endothelial Growth Factor and Angiogenesis in the Regulation of Cutaneous Wound Repair.‘, Advances in wound care, 3(10), pp. 647–661. doi: 10.1089/wound.2013.0517. Jossa, F. et al. (1991) ‗Serum selenium and coronary heart disease risk factors in southern Italian men‘, Atherosclerosis, 87(2–3), pp. 129–134. doi: 10.1016/0021-9150(91)90015-U. Kao, C.-F. et al. (2004) ‗Modulation of p53 transcription regulatory activity and post-translational modification by hepatitis C virus core protein.‘, Oncogene, 23(14), pp. 2472–2483. doi: 10.1038/sj.onc.1207368. Karpe, F., Dickmann, J. R. and Frayn, K. N. (2011) ‗Fatty acids, obesity, and insulin resistance: Time for a reevaluation‘, Diabetes, pp. 2441–2449. doi: 10.2337/db11-0425. Kassan, M. et al. (2012) ‗Endoplasmic reticulum stress is involved in cardiac damage and vascular endothelial dysfunction in hypertensive mice.‘, Arteriosclerosis, thrombosis, and vascular biology, 32(7), pp. 1652–1661. doi: 10.1161/ATVBAHA.112.249318.
Page 157 of 167
Kawasaki, N. et al. (2012) ‗Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue.‘, Scientific reports, 2, p. 799. doi: 10.1038/srep00799. Kim, H. J. et al. (2013) ‗Inhibition of endoplasmic reticulum stress alleviates lipopolysaccharide-induced lung inflammation through modulation of NF-κB/HIF-1α signaling pathway.‘, Scientific reports, 3, p. 1142. doi: 10.1038/srep01142. Klein, E. a et al. (2011) ‗Vitamin E and the risk of prostate cancer: the Selenium and Vitamin E Cancer Prevention Trial (SELECT).‘, JAMA : the journal of the American Medical Association, 306(14), pp. 1549–56. doi: 10.1001/jama.2011.1437. Kljai, K. and Runje, R. (2001) ‗Selenium and glycogen levels in diabetic patients.‘, Biological trace element research, 83(3), pp. 223–9. doi: 10.1385/BTER:83:3:223. Kolluru, G. K. et al. (2012) ‗Endothelial Dysfunction and Diabetes: Effects on Angiogenesis, Vascular Remodeling, and Wound Healing‘, International Journal of Vascular Medicine, 2012, pp. 1–30. doi: 10.1155/2012/918267. Kristal, A. R. et al. (2014) ‗Baseline selenium status and effects of selenium and vitamin E supplementation on prostate cancer risk‘, Journal of the National Cancer Institute, 106(3). doi: 10.1093/jnci/djt456. Kroemer, G. and Martin, S. J. (2005) ‗Caspase-independent cell death.‘, Nature medicine, 11(7), pp. 725–730. doi: 10.1038/nm1263. Kuang, X. et al. (2010) ‗Phenylbutyric acid suppresses protein accumulation-mediated ER stress in retrovirus-infected astrocytes and delays onset of paralysis in infected mice‘, Neurochemistry International, 57(7), pp. 738–748. doi: 10.1016/j.neuint.2010.08.010. Kubota, K. et al. (2006) ‗Suppressive effects of 4-phenylbutyrate on the aggregation of Pael receptors and endoplasmic reticulum stress‘, Journal of Neurochemistry, 97(5), pp. 1259–1268. doi: 10.1111/j.1471-4159.2006.03782.x. Kubota, T. et al. (2011) ‗Impaired insulin signaling in endothelial cells reduces insulin-induced glucose uptake by skeletal muscle‘, Cell Metabolism, 13(3), pp. 294–307. doi: 10.1016/j.cmet.2011.01.018. Labunskyy, V. M. et al. (2011) ‗Both maximal expression of selenoproteins and selenoprotein deficiency can promote development of type 2 diabetes-like phenotype in mice.‘, Antioxidants & redox signaling, 14(12), pp. 2327–2336. doi: 10.1089/ars.2010.3526. Labunskyy, V. M., Hatfield, D. L. and Gladyshev, V. N. (2014) ‗Selenoproteins: molecular pathways and physiological roles.‘, Physiological reviews, 94(3), pp. 739–77. doi: 10.1152/physrev.00039.2013.
Page 158 of 167
Laclaustra, M. et al. (2010) ‗Serum selenium and serum lipids in US adults: National Health and Nutrition Examination Survey (NHANES) 2003-2004‘, Atherosclerosis, 210(2), pp. 643–648. doi: 10.1016/j.atherosclerosis.2010.01.005. Lebovitz, H. E. (2001) ‗Insulin resistance: Definition and consequences‘, Experimental and Clinical Endocrinology and Diabetes, 109(SUPPL. 2). doi: 10.1055/s-2001-18576. Lenna, S., Han, R. and Trojanowska, M. (2014) ‗Endoplasmic reticulum stress and endothelial dysfunction‘, IUBMB Life, pp. 530–537. doi: 10.1002/iub.1292. Li, Y. et al. (2005) ‗Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-?? and interleukin-6: Model of NF-??B- and map kinase-dependent inflammation in advanced atherosclerosis‘, Journal of Biological Chemistry, 280(23), pp. 21763–21772. doi: 10.1074/jbc.M501759200. Libby, P. (2012) ‗Inflammation in atherosclerosis‘, Arteriosclerosis, Thrombosis, and Vascular Biology, 32(9), pp. 2045–2051. doi: 10.1161/ATVBAHA.108.179705. Lipinski, B. (2011) ‗Hydroxyl radical and its scavengers in health and disease‘, Oxidative Medicine and Cellular Longevity. doi: 10.1155/2011/809696. Lippman, S. M. et al. (2009) ‗Effect of selenium and vitamin E on risk of prostate cancer and other cancers: the Selenium and Vitamin E Cancer Prevention Trial (SELECT).‘, JAMA : the journal of the American Medical Association, 301(1), pp. 39–51. doi: 10.1001/jama.2008.864. Liu, N. et al. (2004) ‗Possible involvement of both endoplasmic reticulum- and mitochondria-dependent pathways in MoMuLV-ts1-induced apoptosis in astrocytes‘, JOURNAL OF NEUROVIROLOGY, 10(3), pp. 189–198. doi: 10.1080/13550280490448043. Liu, S.-H. et al. (2016) ‗Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.‘, Oncotarget, 7(16). doi: 10.18632/oncotarget.7904. Luiking, Y. C., Engelen, M. P. K. J. and Deutz, N. E. P. (2010) ‗Regulation of nitric oxide production in health and disease.‘, Current opinion in clinical nutrition and metabolic care, 13(1), pp. 97–104. doi: 10.1097/MCO.0b013e328332f99d. Ma, Y. and Hendershot, L. M. (2003) ‗Delineation of a negative feedback regulatory loop that controls protein translation during endoplasmic reticulum stress‘, Journal of Biological Chemistry, 278(37), pp. 34864–34873. doi: 10.1074/jbc.M301107200. Malhotra, J. D. and Kaufman, R. J. (2007) ‗Endoplasmic reticulum stress and oxidative stress: a vicious cycle or a double-edged sword?‘, Antioxidants & redox signaling, 9(12), pp. 2277–93. doi: 10.1089/ars.2007.1782.
Page 159 of 167
Mandavia, C. H. et al. (2013) ‗Molecular and metabolic mechanisms of cardiac dysfunction in diabetes‘, Life Sciences, pp. 601–608. doi: 10.1016/j.lfs.2012.10.028. McCarthy, M. I. (2010) ‗Genomics, type 2 diabetes, and obesity.‘, The New England journal of medicine, 363(24), pp. 2339–2350. doi: 10.1056/NEJMra0906948. McClung, J. P. et al. (2004) ‗Development of insulin resistance and obesity in mice overexpressing cellular glutathione peroxidase.‘, Proceedings of the National Academy of Sciences of the United States of America, 101(24), pp. 8852–8857. doi: 10.1073/pnas.0308096101. McCullough, K. D. et al. (2001) ‗Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state.‘, Molecular and cellular biology, 21(4), pp. 1249–59. doi: 10.1128/MCB.21.4.1249-1259.2001. Mehdi, Y. et al. (2013) ‗Selenium in the environment, metabolism and involvement in body functions‘, Molecules, pp. 3292–3311. doi: 10.3390/molecules18033292. Miniard, A. C. et al. (2010) ‗Nucleolin binds to a subset of selenoprotein mRNAs and regulates their expression‘, Nucleic Acids Research, 38(14), pp. 4807–4820. doi: 10.1093/nar/gkq247. Misu, H. et al. (2010) ‗A liver-derived secretory protein, selenoprotein P, causes insulin resistance‘, Cell Metabolism, 12(5), pp. 483–495. doi: 10.1016/j.cmet.2010.09.015. Morishima, N. et al. (2002) ‗An endoplasmic reticulum stress-specific caspase cascade in apoptosis. Cytochrome c-independent activation of caspase-9 by caspase-12‘, Journal of Biological Chemistry, 277(37), pp. 34287–34294. doi: 10.1074/jbc.M204973200. Mozaffarian, D. et al. (2015) ‗Heart disease and stroke statistics-2015 update : A report from the American Heart Association‘, Circulation, 131(4), pp. e29–e39. doi: 10.1161/CIR.0000000000000152. Mueller, A. S. et al. (2009) ‗Selenium and diabetes: an enigma?‘, Free radical research, 43(11), pp. 1029–1059. doi: 10.1080/10715760903196925. Myoishi, M. et al. (2007) ‗Increased endoplasmic reticulum stress in atherosclerotic plaques associated with acute coronary syndrome‘, Circulation, 116(11), pp. 1226–1233. doi: 10.1161/CIRCULATIONAHA.106.682054. Nguyen, N. T. et al. (2011) ‗Relationship between obesity and diabetes in a US adult population: findings from the National Health and Nutrition Examination Survey, 1999-2006.‘, Obesity surgery, 21(3), pp. 351–5. doi: 10.1007/s11695-010-0335-4.
Page 160 of 167
Olson, B. J. S. C. and Markwell, J. (2007) ‗Assays for determination of protein concentration.‘, Current protocols in protein science / editorial board, John E. Coligan ... [et al.], Chapter 3, p. Unit 3.4. doi: 10.1002/0471140864.ps0304s48. Oyadomari, S. et al. (2001) ‗Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway.‘, Proceedings of the National Academy of Sciences of the United States of America, 98(19), pp. 10845–50. doi: 10.1073/pnas.191207498. Oyadomari, S. and Mori, M. (2004) ‗Roles of CHOP/GADD153 in endoplasmic reticulum stress.‘, Cell death and differentiation, 11(4), pp. 381–389. doi: 10.1038/sj.cdd.4401373. Ozcan, L. and Tabas, I. (2012) ‗Role of Endoplasmic Reticulum Stress in Metabolic Disease and Other Disorders‘, Annual Review of Medicine, 63, pp. 317–328. doi: 10.1146/annurev-med-043010-144749. Ozcan, U. et al. (2004) ‗Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes.‘, Science (New York, N.Y.), 306(5695), pp. 457–461. doi: 10.1126/science.1103160. Ozcan, U. et al. (2006) ‗Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes.‘, Science (New York, N.Y.), 313(5790), pp. 1137–1140. doi: 10.1126/science.1128294. Papp, L. V. et al. (2007) ‗From selenium to selenoproteins: synthesis, identity, and their role in human health‘, Antioxidants & redox signaling, 9(7), pp. 775–806. doi: 10.1089/ars.2007.1528. Park, K. et al. (2012) ‗Toenail selenium and incidence of type 2 diabetes in U.S. men and women‘, Diabetes Care, 35(7), pp. 1544–1551. doi: 10.2337/dc11-2136. Park, S.-H. et al. (2012) ‗Induction of apoptosis and autophagy by sodium selenite in A549 human lung carcinoma cells through generation of reactive oxygen species‘, Toxicology Letters, 212(3), pp. 252–261. doi: 10.1016/j.toxlet.2012.06.007. Pietsch, E. C., Humbey, O. and Murphy, M. E. (2006) ‗Polymorphisms in the p53 pathway.‘, Oncogene, 25(11), pp. 1602–1611. doi: 10.1038/sj.onc.1209367. Pillai, R., Uyehara-Lock, J. H. and Bellinger, F. P. (2014) ‗Selenium and selenoprotein function in brain disorders‘, IUBMB Life, pp. 229–239. doi: 10.1002/iub.1262. Privat, C. et al. (1997) ‗Nitric oxide production by endothelial cells: Comparison of three methods of quantification‘, Life Sciences, 61(12), pp. 1193–1202. doi: 10.1016/S0024-3205(97)00661-9. Quick, Q. A. and Faison, M. O. (2012) ‗CHOP and caspase 3 induction underlie glioblastoma cell death in response to endoplasmic reticulum stress‘, Experimental and Therapeutic Medicine, 3(3), pp. 487–492. doi: 10.3892/etm.2011.422.
Page 161 of 167
Rains, J. L. and Jain, S. K. (2011) ‗Oxidative stress, insulin signaling, and diabetes‘, Free Radical Biology and Medicine, pp. 567–575. doi: 10.1016/j.freeradbiomed.2010.12.006. Rajendran, P. et al. (2013) ‗The vascular endothelium and human diseases‘, International Journal of Biological Sciences, pp. 1057–1069. doi: 10.7150/ijbs.7502. Rajpathak, S. et al. (2005) ‗Toenail selenium and cardiovascular disease in men with diabetes.‘, Journal of the American College of Nutrition, 24(4), pp. 250–6. doi: 24/4/250 [pii]. Rayman, M. P. (2005) ‗Selenium in cancer prevention: a review of the evidence and mechanism of action.‘, The Proceedings of the Nutrition Society, 64(4), pp. 527–542. doi: 10.1079/PNS2005467. Rayman, M. P. et al. (2011) ‗Effect of supplementation with high-selenium yeast on plasma lipids: A randomized trial‘, Annals of Internal Medicine, 154(10), pp. 656–665. doi: 10.7326/0003-4819-154-10-201105170-00005. Rayman, M. P. et al. (2012) ‗A Randomized Trial of Selenium Supplementation and Risk of Type-2 Diabetes, as Assessed by Plasma Adiponectin‘, PLoS ONE, 7(9). doi: 10.1371/journal.pone.0045269. Rayman, M. P. (2012) ‗Selenium and human health‘, The Lancet, pp. 1256–1268. doi: 10.1016/S0140-6736(11)61452-9. Rayman, M. P., Infante, H. G. and Sargent, M. (2008) ‗Food-chain selenium and human health: spotlight on speciation.‘, The British journal of nutrition, 100(2), pp. 238–253. doi: 10.1017/S0007114508922522. Rayman, M. P. and Stranges, S. (2013) ‗Epidemiology of selenium and type 2 diabetes: Can we make sense of it?‘, Free Radical Biology and Medicine, pp. 1557–1564. doi: 10.1016/j.freeradbiomed.2013.04.003. Rees, K. et al. (2013) ‗Selenium supplementation for the primary prevention of cardiovascular disease.‘, Cochrane database of systematic reviews (Online), 1, p. CD009671. doi: 10.1002/14651858.CD009671.pub2. Reeves, M. a, Bellinger, F. P. and Berry, M. J. (2010) ‗The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation.‘, Antioxidants & redox signaling, 12(7), pp. 809–818. doi: 10.1089/ars.2009.2883. Regina, B. F. et al. (2016) ‗Selenoprotein gene nomenclature‘, Journal of Biological Chemistry, 291(46), pp. 24036–24040. doi: 10.1074/jbc.M116.756155. Roberts, C. K. and Sindhu, K. K. (2009) ‗Oxidative stress and metabolic syndrome‘, Life Sciences, pp. 705–712. doi: 10.1016/j.lfs.2009.02.026.
Page 162 of 167
Rocourt, C. R. B. and Cheng, W. H. (2013) ‗Selenium supranutrition: Are the potential benefits of chemoprevention outweighed by the promotion of diabetes and insulin resistance?‘, Nutrients, pp. 1349–1365. doi: 10.3390/nu5041349. Roman, M., Jitaru, P. and Barbante, C. (2014) ‗Selenium biochemistry and its role for human health.‘, Metallomics : Integrated Biometal Science, 6(1), pp. 25–54. doi: 10.1039/c3mt00185g. Samuel, S. M. et al. (2010) ‗Thioredoxin-1 gene therapy enhances angiogenic signaling and reduces ventricular remodeling in infarcted myocardium of diabetic rats.‘, Circulation, 121(10), pp. 1244–1255. doi: 10.1161/CIRCULATIONAHA.109.872481. Sano, R. and Reed, J. C. (2013) ‗ER stress-induced cell death mechanisms‘, Biochimica et Biophysica Acta - Molecular Cell Research, pp. 3460–3470. doi: 10.1016/j.bbamcr.2013.06.028. Sarwar, N. et al. (2010) ‗Diabetes mellitus, fasting blood glucose concentration, and risk of vascular disease: a collaborative meta-analysis of 102 prospective studies 2‘, Lancet, 375(1474–547X (Electronic)), pp. 2215–2222. doi: 10.1016/S0140-6736(10)60484-9. Schröder, M. (2008) ‗Endoplasmic reticulum stress responses.‘, Cellular and molecular life sciences : CMLS, 65(6), pp. 862–94. doi: 10.1007/s00018-007-7383-5. Schröder, M. and Kaufman, R. J. (2005) ‗THE MAMMALIAN UNFOLDED PROTEIN RESPONSE‘, Annual Review of Biochemistry, 74(1), pp. 739–789. doi: 10.1146/annurev.biochem.73.011303.074134. Schulz, E., Gori, T. and Münzel, T. (2011) ‗Oxidative stress and endothelial dysfunction in hypertension.‘, Hypertension research : official journal of the Japanese Society of Hypertension, 34(6), pp. 665–73. doi: 10.1038/hr.2011.39. Schwarz, D. S. and Blower, M. D. (2016) ‗The endoplasmic reticulum: structure, function and response to cellular signaling.‘, Cellular and molecular life sciences : CMLS, 73(1), pp. 79–94. doi: 10.1007/s00018-015-2052-6. Scull, C. M. and Tabas, I. (2011) ‗Mechanisms of ER stress-induced apoptosis in atherosclerosis‘, Arteriosclerosis, Thrombosis, and Vascular Biology, 31(12), pp. 2792–2797. doi: 10.1161/ATVBAHA.111.224881. Shankar, R. R. et al. (2000) ‗Mice with gene disruption of both endothelial and neuronal nitric oxide synthase exhibit insulin resistance‘, Diabetes, 49(5), pp. 684–687. doi: 10.1016/j.jaad.2003.07.010. Sharma, N. K. et al. (2008) ‗Endoplasmic reticulum stress markers are associated with obesity in nondiabetic subjects‘, The Journal of clinical endocrinology and metabolism, 93(11), pp. 4532–4541. doi: 10.1210/jc.2008-1001.
Page 163 of 167
Sheikh-Ali, M. et al. (2010) ‗Effects of antioxidants on glucose-induced oxidative stress and endoplasmic reticulum stress in endothelial cells‘, Diabetes Research and Clinical Practice, 87, pp. 161–166. doi: 10.1016/j.nut.2009.08.019. Shi, K. et al. (2013) ‗Sodium selenite alters microtubule assembly and induces apoptosis in vitro and in vivo.‘, Journal of hematology & oncology, 6(1), p. 7. doi: 10.1186/1756-8722-6-7. Shibuya, M. (2006) ‗Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis‘, Journal Of Biochemistry And Molecular Biology, 39(5), pp. 469–478. doi: 10.5483/BMBRep.2006.39.5.469. Shibuya, M. (2011) ‗Vascular Endothelial Growth Factor (VEGF) and Its Receptor (VEGFR) Signaling in Angiogenesis: A Crucial Target for Anti- and Pro-Angiogenic Therapies‘, Genes & Cancer, 2(12), pp. 1097–1105. doi: 10.1177/1947601911423031. Shigemi, Z. et al. (2016) ‗Effects of ER stress on unfolded protein responses, cell survival, and viral replication in primary effusion lymphoma‘, Biochemical and Biophysical Research Communications, 469(3), pp. 565–572. doi: 10.1016/j.bbrc.2015.12.032. Spranger, J. et al. (2003) ‗Adiponectin and protection against type 2 diabetes mellitus‘, Lancet, 361(9353), pp. 226–228. doi: 10.1016/S0140-6736(03)12255-6. Squires, J. E. et al. (2007) ‗SBP2 binding affinity is a major determinant in differential selenoprotein mRNA translation and sensitivity to nonsense-mediated decay.‘, Molecular and cellular biology, 27(22), pp. 7848–7855. doi: 10.1128/MCB.00793-07. Stanley, D. E. (1999) ‗Tietz Textbook of Clinical Chemistry‘, JAMA: The Journal of the American Medical Association, 282(3), pp. 283–283. doi: 10.1001/jama.282.3.283. Stapleton, S. R. et al. (1997) ‗Selenium: Potent stimulator of tyrosyl phosphorylation and activator of MAP kinase‘, Biochimica et Biophysica Acta - Molecular Cell Research, 1355(3), pp. 259–269. doi: 10.1016/S0167-4889(96)00140-1. Stapleton, S. R. (2000) ‗Selenium: an insulin-mimetic.‘, Cellular and molecular life sciences : CMLS, 57(13–14), pp. 1874–9. doi: 10.1007/PL00000669. Steinbrenner, H. et al. (2011) ‗High selenium intake and increased diabetes risk: experimental evidence for interplay between selenium and carbohydrate metabolism.‘, Journal of clinical biochemistry and nutrition, pp. 40–5. doi: 10.3164/jcbn.11-002FR. Steinbrenner, H. (2013) ‗Interference of selenium and selenoproteins with the insulin-regulated carbohydrate and lipid metabolism‘, Free Radical Biology and Medicine, pp. 1538–1547. doi: 10.1016/j.freeradbiomed.2013.07.016.
Page 164 of 167
Stranges, S. et al. (2006) ‗Effects of selenium supplementation on cardiovascular disease incidence and mortality: Secondary analyses in a randomized clinical trial‘, American Journal of Epidemiology, 163(8), pp. 694–699. doi: 10.1093/aje/kwj097. Stranges, S. et al. (2007) ‗Effects of Long-Term Selenium Supplementation on the Incidence of Type 2 Diabetes: a randomized trial.‘, Ann Intern Med, pp. 217–224. Stranges, S. et al. (2010) ‗Higher selenium status is associated with adverse blood lipid profile in British adults.‘, The Journal of nutrition, 140(1), pp. 81–7. doi: 10.3945/jn.109.111252. Stranges, S. et al. (2010) ‗Selenium status and cardiometabolic health: State of the evidence‘, Nutrition, Metabolism and Cardiovascular Diseases, pp. 754–760. doi: 10.1016/j.numecd.2010.10.001. Stranges, S. et al. (2010) ‗Selenium status and cardiometabolic health: state of the evidence.‘, Nutrition, metabolism, and cardiovascular diseases : NMCD, 20(10), pp. 754–60. doi: 10.1016/j.numecd.2010.10.001. Stranges, S. et al. (2011) ‗Associations of selenium status with cardiometabolic risk factors: An 8-year follow-up analysis of the Olivetti Heart Study‘, Atherosclerosis, 217(1), pp. 274–278. doi: 10.1016/j.atherosclerosis.2011.03.027. Streicher, K. L. et al. (2004) ‗Thioredoxin reductase regulates angiogenesis by increasing endothelial cell-derived vascular endothelial growth factor.‘, Nutrition and cancer, 50(2), pp. 221–31. doi: 10.1207/s15327914nc5002_13. Strømblad, S. and Cheresh, D. A. (1996) ‗Cell adhesion and angiogenesis‘, Trends in Cell Biology, pp. 462–468. doi: 10.1016/0962-8924(96)84942-7. Szegezdi, E. et al. (2006) ‗Mediators of endoplasmic reticulum stress-induced apoptosis.‘, EMBO reports, 7(9), pp. 880–5. doi: 10.1038/sj.embor.7400779. Tabas, I. (2009) ‗Macrophage apoptosis in atherosclerosis: consequences on plaque progression and the role of endoplasmic reticulum stress.‘, Antioxidants & redox signaling, 11(9), pp. 2333–9. doi: 10.1089/ars.2009.2469. Tabas, I. (2010) ‗The role of endoplasmic reticulum stress in the progression of atherosclerosis‘, Circulation Research, pp. 839–850. doi: 10.1161/CIRCRESAHA.110.224766. Tabas, I. and Ron, D. (2011) ‗Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress.‘, Nature cell biology, 13(3), pp. 184–190. doi: 10.1038/ncb0311-184. Thomson, C. D. (2004) ‗Assessment of requirements for selenium and adequacy of selenium status: a review.‘, European journal of clinical nutrition, 58(3), pp. 391–402. doi: 10.1038/sj.ejcn.1601800.
Page 165 of 167
Tiganis, T. (2011) ‗Reactive oxygen species and insulin resistance: The good, the bad and the ugly‘, Trends in Pharmacological Sciences, pp. 82–89. doi: 10.1016/j.tips.2010.11.006. Triggle, C. R. and Ding, H. (2011) ‗The endothelium in compliance and resistance vessels‘, Front Biosci (Schol Ed), 3, pp. 730–744. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21196408. Uguz, A. C. and Naziroglu, M. (2012) ‗Effects of selenium on calcium signaling and apoptosis in rat dorsal root ganglion neurons induced by oxidative stress‘, Neurochem Res, 37(8), pp. 1631–1638. doi: 10.1007/s11064-012-0758-5. Urra, H. et al. (2013) ‗When ER stress reaches a dead end‘, Biochimica et Biophysica Acta - Molecular Cell Research. doi: 10.1016/j.bbamcr.2013.07.024. Urra, H. and Hetz, C. (2014) ‗A Novel ER Stress-Independent Function of the UPR in Angiogenesis‘, Molecular Cell, pp. 542–544. doi: 10.1016/j.molcel.2014.05.013. Uy, B., McGlashan, S. R. and Shaikh, S. B. (2011) ‗Measurement of reactive oxygen species in the culture media using Acridan lumigen PS-3 assay‘, Journal of Biomolecular Techniques, 22(3), pp. 95–107. doi: 10.1039/c0pp00333f. Verma, S. et al. (2011) ‗Selenoprotein K knockout mice exhibit deficient calcium flux in immune cells and impaired immune responses.‘, Journal of immunology (Baltimore, Md. : 1950), 186(4), pp. 2127–37. doi: 10.4049/jimmunol.1002878. Vistica, D. T. et al. (1991) ‗Tetrazolium-based assays for cellular viability: A critical examination of selected parameters affecting formazan production‘, Cancer Research, 51(10), pp. 2515–2520. Wallenberg, M. et al. (2014) ‗Selenium induces a multi-targeted cell death process in addition to ROS formation‘, Journal of Cellular and Molecular Medicine, 18(4), pp. 671–684. doi: 10.1111/jcmm.12214. Wang, H. et al. (2013) ‗Nitric oxide directly promotes vascular endothelial insulin transport‘, Diabetes, 62(12), pp. 4030–4042. doi: 10.2337/db13-0311. Wang, M. and Kaufman, R. J. (2016) ‗Protein misfolding in the endoplasmic reticulum as a conduit to human disease‘, Nature, 529(7586), pp. 326–335. doi: 10.1038/nature17041. Wang, S. and Kaufman, R. J. (2012) ‗The impact of the unfolded protein response on human disease‘, The Journal of Cell Biology, 197(7), pp. 857–867. doi: 10.1083/jcb.201110131. Wang, X. et al. (2014) ‗High selenium impairs hepatic insulin sensitivity through opposite regulation of ROS‘, Toxicology Letters, 224(1), pp. 16–23. doi: 10.1016/j.toxlet.2013.10.005.
Page 166 of 167
Wang, X.-C. et al. (2015) ‗ER stress mediates homocysteine-induced endothelial dysfunction: Modulation of IK<inf>Ca</inf> and SK<inf>Ca</inf> channels‘, Atherosclerosis, 242(1). doi: 10.1016/j.atherosclerosis.2015.07.021. Watanabe, Y., Nagai, Y. and Takatsu, K. (2013) ‗Activation and regulation of the pattern recognition receptors in obesity-induced adipose tissue inflammation and insulin resistance‘, Nutrients, 5(9), pp. 3757–3778. doi: 10.3390/nu5093757. WHO (2015) ‗WHO _ Cardiovascular diseases (CVDs)‘, Cardiovascular diseases (CVDs). doi: Fact sheet N°317. WHO (World Health Organization) (2013) ‗WHO obesity and overweight fact sheet no 311‘, Obesity and Oveweight Fact Sheet, (March), pp. 4–7. Available at: http://who.ubt.neduacebter.factsheet.fs311. Wu, Y. et al. (2005) ‗Endoplasmic reticulum stress signal mediators are targets of selenium action‘, Cancer Research, 65(19), pp. 9073–9079. doi: 10.1158/0008-5472.CAN-05-2016. Xiang, N., Zhao, R. and Zhong, W. (2009) ‗Sodium selenite induces apoptosis by generation of superoxide via the mitochondrial-dependent pathway in human prostate cancer cells‘, Cancer Chemotherapy and Pharmacology, 63(2), pp. 351–362. doi: 10.1007/s00280-008-0745-3. Xin-liang, W. et al. (2016) ‗Association between serum selenium level and type 2 diabetes mellitus: a non-linear dose-response meta-analysis of observational studies‘, Nutrition Journal, 15, pp. 1–9. doi: 10.1186/s12937-016-0169-6. Yam, G. H. F. et al. (2007) ‗Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis‘, Investigative Ophthalmology and Visual Science, 48(4), pp. 1683–1690. doi: 10.1167/iovs.06-0943. Yamamoto, S. et al. (2014) ‗Circulating adiponectin levels and risk of type 2 diabetes in the Japanese.‘, Nutrition & diabetes, 4, p. e130. doi: 10.1038/nutd.2014.27. Yang, S. J. et al. (2011) ‗Serum selenoprotein P levels in patients with type 2 diabetes and prediabetes: Implications for insulin resistance, inflammation, and atherosclerosis‘, Journal of Clinical Endocrinology and Metabolism, 96(8). doi: 10.1210/jc.2011-0620. Yang, X. et al. (2000) ‗Synthesis and secretion of selenoprotein P by cultured rat astrocytes‘, Biochimica et Biophysica Acta - General Subjects, 1474(3), pp. 390–396. doi: 10.1016/S0304-4165(00)00035-0. Yang, X. et al. (2007) ‗Antiproliferation in human EA.hy926 endothelial cells and inhibition of VEGF expression in PC-3 cells by topotecan‘, Pharmazie, 62(7), pp. 534–538. doi: 10.1691/ph.2007.7.6759.
Page 167 of 167
Yang, Z. et al. (2008) ‗Critical effect of VEGF in the process of endothelial cell apoptosis induced by high glucose.‘, Apoptosis : an international journal on programmed cell death, 13(11), pp. 1331–43. doi: 10.1007/s10495-008-0257-y. Zeng, M. S. et al. (2012) ‗A high-selenium diet induces insulin resistance in gestating rats and their offspring‘, Free Radical Biology and Medicine, 52(8), pp. 1335–1342. doi: 10.1016/j.freeradbiomed.2012.01.017. Zhang, C. et al. (2001) ‗Homocysteine induces programmed cell death in human vascular endothelial cells through activation of the unfolded protein response.‘, The Journal of biological chemistry, 276(38), pp. 35867–74. doi: 10.1074/jbc.M100747200. Zhang, K. and Kaufman, R. J. (2008) ‗From endoplasmic-reticulum stress to the inflammatory response‘, Nature, 454(7203), pp. 455–462. doi: 10.1038/nature07203. Zhao, H. et al. (2003) ‗Superoxide reacts with hydroethidine but forms a fluorescent product that is distinctly different from ethidium: Potential implications in intracellular fluorescence detection of superoxide‘, Free Radical Biology and Medicine, 34(11), pp. 1359–1368. doi: 10.1016/S0891-5849(03)00142-4. Zhou, J., Huang, K. and Lei, X. G. (2013) ‗Selenium and diabetes--evidence from animal studies.‘, Free radical biology & medicine, 65, pp. 1548–56. doi: 10.1016/j.freeradbiomed.2013.07.012. Zu, K. et al. (2006) ‗Enhanced selenium effect on growth arrest by BiP/GRP78 knockdown in p53-null human prostate cancer cells.‘, Oncogene, 25(4), pp. 546–54. doi: 10.1038/sj.onc.1209071. Zuo, L. et al. (2004) ‗Sodium selenite induces apoptosis in acute promyelocytic leukemia-derived NB4 cells by a caspase-3-dependent mechanism and a redox pathway different from that of arsenic trioxide‘, Annals of Hematology, 83(12), pp. 751–758. doi: 10.1007/s00277-004-0920-5.
![A vaccine targeting angiomotin induces an antibody response which alters tumor … · 2020. 1. 18. · by normal, but overexpressed by endothelial cells of tumor vessels [8] also](https://img.dokumen.tips/doc/110x75/60ff2f5ea75c100b011c893b/a-vaccine-targeting-angiomotin-induces-an-antibody-response-which-alters-tumor-2020.jpg)
