H52YCcP_JMB_2003.PDF

A Novel Heme and Peroxide-dependent Tryptophan–tyrosine Cross-link in a Mutant of Cytochrome cPeroxidase

B. Bhaskar1,2, Chad E. Immoos3, Hideaki Shimizu1,2, Filip Sulc3

Patrick J. Farmer3 and Thomas L. Poulos1,2,4*

1Department of MolecularBiology and BiochemistrySchool of Biological SciencesUniversity of California, IrvineCA 92697-3900, USA

2Program in MacromolecularStructure, University ofCalifornia, Irvine, CA92697-3900, USA

3Department of ChemistryUniversity of California, IrvineCA 92697-2025, USA

4Department of Physiology andBiophysics, University ofCalifornia, Irvine, CA92697-4560, USA

The crystal structure of a cytochrome c peroxidase mutant where thedistal catalytic His52 is converted to Tyr reveals that the tyrosine side-chain forms a covalent bond with the indole ring nitrogen atom of Trp51.We hypothesize that this novel bond results from peroxide activation bythe heme iron followed by oxidation of Trp51 and Tyr52. This hypothesishas been tested by incorporation of a redox-inactive Zn-protoporphyrininto the protein, and the resulting crystal structure shows the absence ofa Trp51–Tyr52 cross-link. Instead, the Tyr52 side-chain orients away fromthe heme active-site pocket, which requires a substantial rearrangementof residues 72–80 and 134–144. Additional experiments where heme-containing crystals of the mutant were treated with peroxide support ourhypothesis that this novel Trp–Tyr cross-link is a peroxide-dependentprocess mediated by the heme iron.

q 2003 Elsevier Science Ltd. All rights reserved

Keywords: cytochrome c peroxidase; X-ray crystal structure; Fe-containingheme; Zn-containing protoporphyrin IX; oxygen radical*Corresponding author

Introduction

Baker’s yeast (Saccharomyces cerevisiae) cyto-chrome c (cyt. c) peroxidase (CcP) (ferrocyto-chrome c: hydrogen peroxide: oxidoreductase, EC1.11.1.5) is a mitochondrial intermembrane spaceprotein of 32,240 Da,1 where it most likelyfunctions to protect the organism against high con-centrations of hydrogen peroxide.2 CcP catalyzesthe two-electron reduction of peroxide to water in

a multi-step reaction cycle as follows:

Fe3þ Trp þ H2O2 ! Fe4þ – O Trpzþ þ H2O

Resting state Compound I

Fe4þ – O Trpzþ þ cyt: c ðFe2þÞ ! Fe4þ – O Trp þ cyt: c ðFe3þÞ

Compound I Compound II

Fe4þ 2 O Trp þ cyt: cðFe2þÞ ! Fe3þTrp þ cyt: c ðFe3þÞ þ H2O

Compound II Resting state

CcP first reacts with peroxide to give a stable inter-mediate where the two oxidizing equivalents ofperoxide are stored on the iron as Fe4þ–O and asan amino acid free radical located on Trp191.3 – 6

This oxidized state, designated compound I, has ahalf-life of several hours in the absence ofreductant.7 Compound I then is reduced by cyt. c(Fe2þ) back to the resting state in two successiveone-electron transfer reactions. One remarkableaspect of this electron transfer reaction is that theheme edges of the redox partners remain separated

0022-2836/03/$ - see front matter q 2003 Elsevier Science Ltd. All rights reserved

Present addresses: C. E. Immoos, Department ofChemistry, P.M. Gross Chemical Laboratories, DukeUniversity, Durham, NC 27708, USA; H. Shimizu,Molecular Neuropathology Group, RIKEN Brain ScienceInstitute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,Japan.

E-mail address of the corresponding author:[email protected]

Abbreviations used: CcP, cytochrome c peroxidase;CcO, cytochrome c oxidase; cyt. c, reduced horse heart oryeast cytochrome c; MPD, 2-methyl-2,4-pentanediol;KPB, potassium phosphate buffer; Mr, relative molecularmass; IPTG, isopropyl-b,D-thiogalactopyranoside; RBR,rigid body refinement.

doi:10.1016/S0022-2836(03)00179-7 J. Mol. Biol. (2003) 328, 157–166

by no less than 18 A, as revealed by the crystalstructure of the non-covalent complex.8

A unique feature of the CcP reaction cycle is theformation of a stable Trp cationic radical in com-pound I.4 Trp191 lies parallel with and in contactwith the proximal heme ligand, His175, situatedjust beneath the heme. Trp191 is essential for CcPactivity and critical for long-distance electrontransfer reaction from cyt. c to CcP.9 – 12 Thus, theTrp191 radical constitutes an electron transfer gatethat allows the controlled reduction of peroxide, atwo-electron oxidant, by cyt. c, a one-electronreductant. Although details of how electrons are

transferred from reduced cyt. c to CcP are unclear,the crystal structure of CcP–cyt. c complex doesindicate that cyt. c binds near the 190–195 loopregion of CcP.8 The CcP–cyt. c co-crystal structure,8

together with a wealth of biochemical dataindicate that each electron delivered from ferrocyt.c is accepted by the Trp191 cationic radical,13,14

which explains why Trp191 is essential foractivity.15

In the present investigation, we have made amutant variant of CcP by replacing the distalHis52, a residue that functions as an acid–basecatalyst in the reaction with peroxide,16 to Tyr aspart of a project to engineer novel enzymeactivities into CcP. The crystal structure of H52Yreveals an unprecedented Trp–Tyr covalent cross-link. Structural details, a proposed mechanism ofcovalent cross-link formation, and its implicationsare the topics of this work.

Results

Overall protein fold and comparison with thewild-type CcP

The overall structure of CcP is shown in Figure 1together with key regions relevant to this studyhighlighted. The first data set analyzed usingchunky crystals, where the cross-link was firstobserved, is designated H52Y1. All essentialfeatures of the secondary structure of H52Y1resembled that of wild-type CcP. However,dramatic and unexpected changes were observedin the active site. The initial electron density mapsshowed continuous density between the Trp51indole ring NE1 atoms and CE1 of Tyr52 (Figure2(A)). When non-bonded contact restraintsbetween Trp51 and Tyr52 were not included in therefinement, the indole ring was oriented such thatits NE1 atom was located less than 1.6 A fromCE1 atom of the phenyl ring of Tyr52. This distanceis, within experimental error, what is expected for

Figure 1. Model of CcP showing key residues relevantto this study.

Figure 2. The 2Fo 2 Fc omit elec-tron density maps contoured at 1s.(A) The original structure of theH52Y mutant where the Trp51–Tyr52 cross-link forms spon-taneously. (B) The H52Y mutantcrystallized with fresh reagents.Here the cross-link does not form.(C) Same as in (B) except a crystalwas treated with peroxide and thecross-link does form. (D) This mapwas generated from plate-likecrystals and shows no cross-link.(E) Same as in (D), except thecrystal was treated with peroxide.(F) The H52Y mutant with Zn-por-phyrin. (G) The crystal used in (F)was thawed, treated with peroxide,and a second data set collected.

158 Mutant Cytochrome c Peroxidase Structure

a C–N covalent bond (1.48 A),17 and precludes anon-covalent interaction. As refinement progressed2Fo 2 Fc composite omit maps continuallyrevealed a clear connection between Trp51 andTyr52 with electron density as strong as any othercovalent bond along the main chain.

In addition to the Trp51–Tyr52 cross-link,there were other smaller changes in the activesite. The cross-linked mutant is hexa-coordinatewith a water molecule serving as the sixth hemeligand at a distance of 1.95 A from the iron.Arg48 (Figure 1), which is thought to participatein the catalytic cleavage of the peroxide O–Obond,16 occupies a single “out” conformationtowards the heme propionates, while in wild-type CcP, Arg48 occupies both the out confor-mation and “in” conformation closer to theheme iron.

Structure of Zn-porphyrin H52Y

It seemed likely that the cross-link was the resultof a redox-linked process involving the heme ironand peroxide or other contaminating oxidants. Totest this hypothesis, apo-CcP was reconstitutedwith the redox-inactive Zn-porphyrin and crystal-lized. The Zn-porphyrin crystals grew in both thechunky and plate forms. Both forms are in spacegroup P212121 with similar unit cell dimensions(Table 1). The data set used to solve the structureemploying plate crystals is designated ZnH52Y(Table 1).

As expected, the Trp51–Tyr52 cross-link did notform in ZnH52Y (Figure 2(F)). Since the cross-linkdid not form, the Tyr52 side-chain cannot remainoriented into the active site, since this would resultin steric clashes with Trp51. Therefore, the Tyr52

Table 1. Data collection and refinement statistics of various H52Y proteins

PDB Code H52Y #1 H52Y #6 H52Y C1 PLH52Y PLH52YC1 ZnH52Y ZnH52YC1Crystal dataSpace group P212121 P212121 P212121 P212121 P212121 P212121 P212121

Cell parameters(A) a ¼ b ¼ g(908)

a ¼ 106.773;b ¼ 75.527;c ¼ 51.033

a ¼ 106.598;b ¼ 75.943;c ¼ 50.987

a ¼ 106.828;b ¼ 75.223;c ¼ 51.043

a ¼ 50.480;b ¼ 50.957;c ¼ 118.884

a ¼ 50.465;b ¼ 50.991;c ¼ 118.525

a ¼ 50.487b ¼ 50.998;c ¼ 118.759

a ¼ 50.485;b ¼ 50.944;c ¼ 118.774

Data collectionResolution range

(A)100.0–1.65 100.0–1.64 100.0–1.60 100.0–1.58 100.0–1.90 100.0–1.65 100.0–1.58

Totalobservations

4,34,660 6,73,145 13,05,303 6,27,338 5,15,341 4,34,384 8,34,365

Uniquereflections

50,278 50,987 55,297 42,967 24,887 34,532 42,942

Completeness—all data (%)

99.40 97.20 97.60 94.80 89.30 91.20 89.30

Rmerge ðIÞa 0.055 0.053 0.047 0.049 0.058 0.044 0.030I=s ðIÞ 24.63 38.51 40.51 37.19 34.95 44.47 41.91Redundancy (%) 8.645 13.202 23.61 14.602 20.71 11.74 19.43Last shell

resolution (A)1.68–1.65 1.67–1.64 1.63–1.60 1.61–1.58 1.93–1.90 1.68–1.65 1.61–1.58

Completeness(%)

98.20 77.90 88.50 87.90 93.20 86.80 85.90

Rmerge (I)a 0.50 0.353 0.461 0.394 0.621 0.127 0.506I=s ðIÞ 2.275 3.165 3.20 2.72 3.13 11.36 2.71

RefinementResolution

range (A)50.0–1.65 50.0–1.64 50.0–1.60 50.0–1.58 50.0–1.90 50.0–1.65 50.0–1.58

ReflectionsðsI cutoff ¼ 0)

48,421 49,436 53,697 40,622 22,178 34,380 38,231

Rfree 0.1982 (4.8%) 0.2084 (4.9%) 0.2131 (4.9%) 0.2190 (4.8%) 0.2404 (4.3%) 0.2151 (4.6%) 0.2250 (4.5%)Rcryst

b 0.1798 0.1839 0.1926 0.1944 0.2025 0.1831 0.1960

RMS deviationc

Bond lengths (A) 0.0049 0.0051 0.0063 0.0048 0.0056 0.0048 0.0049Angle distances

(8)2.2416 2.174 2.27 2.245 2.196 1.18 1.28

Avg. proteinB-factor

15.47 18.14 19.88 19.45 31.27 15.79 20.34

Avg. hemeB-factor (A2)

11.96 13.23 15.67 13.61 22.47 11.91 16.39

Luzatti coordi-nate error (A)

0.19 0.21 0.21 0.20 0.23 0.18 0.23

Water molecules 603 500 545 428 228 506 228

a Rmerge ¼P

lI 2 kIll=P

I:b Rcryst ¼

PðlFobsl2 lFcalclÞ=

PlFobsl: The Rfree is the Rcryst calculated on the 5% reflections excluded for refinement.

c r.m.s. bond and r.m.s. angle represent the root-mean-squared deviation between the observed and ideal values.

Mutant Cytochrome c Peroxidase Structure 159

side-chain rotates <608 away from the active siteinto the “open” conformation, which leads to sub-stantial structural changes. To make room for thenew position of Tyr52 requires the disruption oftwo helices between residues 70 and 82, and anadjacent segment of polypeptide involving resi-dues 134–144 (Figure 3). In this open position, theside-chain Tyr–OH donates a 2.7 A hydrogenbond to the side-chain OD2 atom of Asp140. Theconformational change involving residues 70–82results in the phenyl ring side-chains of residues73, 77 and 89 coming together to form a hydro-phobic patch, which may, in part, balance thestability lost owing to disruption of helices. Thischange in conformation has been observed inanother mutant structure of CcP (1DSE).18 In thiscase, the proximal His175 ligand was replaced byGly, which allows free imidazole to coordinate asa proximal ligand. When phosphate is bound inthe distal pocket, His52 must move and adopts aconformation virtually identical with the open con-formation of Tyr52. Moreover, the resulting struc-

tural changes in the surrounding protein areessentially the same as we observe in the H52Ymutant.

Other changes in the active site are relativelysmall. The Zn2þ atom still coordinates with His175at a distance of 2.12 A, which is 0.07 A longer thanin wild-type CcP. Although a water molecule issituated in the distal pocket, this water moleculeis not coordinated to the Zn2þ, as indicated by thelack of continuous density with the Zn2þ and aZn–water distance of ,3.7 A. We observed a largelobe of electron density extending off the d-mesoedge of the porphyrin, indicating a covalent C–Obond (Figure 4). We suspect this modificationmight be the result of the enhanced photosensi-tivity of Zn-protoporphyrin IX leading to photo-oxidation of the relatively labile d-meso carbon.

Structure of open form H52Y

At this stage, crystals of another preparation ofH52Y were grown under similar conditions, as

Figure 3. Stereo models of the closed and open forms of the H52Y mutants. The closed is blue, while the open, whichhas undergone the conformational change, is red. The regions that undergo the most significant change in structure arehighlighted with thickened lines.

Figure 4. The 2Fo 2 Fc omitelectron density map contoured at1s of the Zn-porphyrin. The arrowindicates the extra lobe of electrondensity, which we attribute tooxidation of the d-meso carbonatom of the protoporphyrin.


mentioned in Materials and Methods, whichyielded the chunky and plate-form crystals. Crystalstructures of both (H52Y6 and PLH52Y) weresolved. Both these structures revealed the openconformation of Tyr52 very similar to the Zn-porphyrin structure without formation of thecross-link (Figure 2(B) and (D)). We then were leftwith the question of why H52Y1 showed theTrp51–Tyr52 cross-link, while both H52Y6 andPLH52Y did not have the cross-link. The maindifference is that H52Y1 was crystallized from anolder batch of 2-methyl-2,4-pentanediol (MPD). Itis well known that MPD can generate breakdownproducts, including peroxides, that could providethe oxidizing equivalents required to form thecross-link.

Structures of peroxide-treated crystals

Unfortunately, the older batch of MPD no longeris available and this hypothesis cannot be testeddirectly. Nevertheless, if peroxide is responsiblefor the cross-link, then treating H52Y crystals withperoxide should show formation of the cross-link.Crystals were soaked in mother liquor (35% (v/v)MPD in 50 mM KPB (potassium phosphate buffer,pH 6.0)) containing 10 mM hydrogen peroxide forone hour followed by washing in peroxide-freemother liquor to remove excess peroxide beforeX-ray data collection. A crystal from the samedrop used to obtain the H52Y6 structure wastreated with peroxide, data collected, and thestructure solved. This structure, designatedH52Yper, clearly showed formation of the cross-link (Figure 2(C)). Crystals containing Zn-porphyrin could withstand a freeze–thaw cycle sohere it was possible to collect a set of data, thawthe crystal, treat with peroxide, and collect asecond data set. A comparison of the ZnH52Y(peroxide-free) and ZnH52Yper (peroxide-treated)electron density maps (Figure 2(F) and (G)) clearlyshows that the cross-link does not form and thatTyr52 adopts the out conformation with or withouttreatment with peroxide. These several structuresshow that both peroxide involvement and thepresence of heme iron are required for formationof the cross-link.

Discussion

There is a growing list of novel covalent linkagesand post-translational modifications known to becritical in forming enzyme active sites. Themethionine sulfone found in the active site ofcatalase from Proteus mirabilis,19 cysteine sulfonicacid in NADH peroxidase from Streptococcusfaecalis,20 internal cyclization of the peptidebackbone with the accompanying oxidation of theCa–Cb bond of Tyr66 in the green fluorescentprotein (GFP)21,22 and pyrrolysine in Methanosarcinabarkeri23 are all recent findings. There are severalexamples of cross-links involving aromatic resi-

dues. These include the copper coordinatedHis240–Tyr244 cross-link at the O2-activatingheme Fea3 – CuB center in subunit I of cytochromec oxidase,24 – 27 a covalent bond between the Nd ofthe imidazole ring of His392 and the Cb of theessential Tyr415 in Escherichia coli catalase HPII,28

an unexpected covalent linkage between Tyr272and Cys228 in galactose oxidase of a fungus,Dactylium dendroides,29 and a 2,4,5-trihydroxy-phenylalanine quinone in amine oxidase.30 Themost recent example is a Met–Tyr–Trp cross-linkin a catalase-peroxidase.31 In this case, the Tyr–Trpcross-link is between two aromatic carbon atoms.Our present findings thus represent the secondexample of a Trp–Tyr cross-link but differ, sincethe indole ring N atom of the Trp participates inthe cross-link.

Our results show clearly that both the iron andperoxide are required to form the cross-link. How-ever, several lines of evidence indicate that thenormal compound I consisting of Fe(IV)–O andthe Trp191 cationic radical is not the intermediateresponsible for the Trp–Tyr cross-link. ChangingHis52 to other residues in CcP decreases the rateof normal compound I formation by five orders ofmagnitude.32 Indeed, addition of H2O2 to theH52Y mutant does not generate the characteristicFe(IV)–O spectrum, while the electron para-magnetic resonance (EPR) spectrum indicates only5% oxidation of Trp191 (data not shown). Drivingforce considerations do not favor sequential oneelectron oxidations by Fe(IV)–O and a neighboringorganic radical as in the normal peroxidasereaction. The CcP compound I potential is0.754 V,33 while the oxidation potentials of thedeprotonated Trp and Tyr anions are 1.01 V and0.96 V, respectively.34 As with the Trp191, thesepotentials may be altered significantly by proteinenvironments, although in native CcP there is noevidence for Trp51 oxidation by either Fe(IV)–Oor the Trp191 cationic radical.

There are fundamental difficulties in forming aTrp–Tyr cross-link by sequential one-electron oxi-dations. Aromatic radicals are inert to nucleophilicattack and coupling reactions are typically viaradical–radical combinations. While Trp and Tyrare among the residues most susceptible to radicalreactions,35 a limiting factor is the short lifetime ofsuch radicals. Thus, concurrent oxidation at bothsites is suggested, limiting the possible mechan-isms of cross-link formation.

Cross-link formation via a peroxidic intermediateis consistent with these requirements, as shown inFigure 5. In this mechanism, an Fe-bound peroxidegenerates both Trp and Tyr radicals by H-atomabstraction, avoiding the need for compound I for-mation. Modeling an Fe-bound peroxide in theactive site of the mutant shows that the Tyr52–OH group can approach close enough to the Ob

atom of peroxide for H atom abstraction givingthe phenol radical. Similarly, the indole –NHgroup of Trp51 is within H-bonding distance ofthe iron-bound Oa atom, thus enabling H-atom


abstraction and formation of the indole radical.Owing to resonance stabilization, the electron-deficient center of Tyr52 is delocalized over thephenol ring system, thus enabling reaction withthe nearby Trp51 radical.

The most unusual aspect of the Trp–Tyr mutantstructure is the cross-link C–N bond itself.Aromatic couplings of indoles most frequentlyoccur at an indolic C rather than N atom. Likewise,it would be expected that the N-alkyl bond wouldremain approximately planar to the aromatic ringin order to maintain the sp2 hybridization at theindolic N. In the Trp–Tyr covalent cross-link, theN is highly pyramidalized, with the NE1Trp –CE1Tyr bond bent <648 from the aromatic plane.Pyramidalized indolic N-alkyl bonds are

precedented, most notably in the structure ofrebeccamycin, an N-glycosylated indolocarbazole,with an indolic N to sugar bond ca 278 out of thearomatic plane,36 and bent N–C bonds are seen insynthetic analogues as well.37 To our knowledge,the Trp–Tyr mutant has by far the largest defor-mation of an alkylated indole yet observed, and isunprecedented in known protein structures.

To understand the variation of strain energywith bending of the NE1Trp –CE1Tyr linkage, a seriesof calculations were done at the semi-empiricallevel using AM1 methods on an analogouslycoupled indole-arene model (Figure 6). The gas-phase energies were calculated as the N–C bondwas varied from 08 to 608 relative to the dihedralangle of the indole and arene rings (Figure 6).

Figure 5. Proposed reactionmechanism in forming the Trp–Tyrcross-link: (a) the heme iron bothorients and activates the bound per-oxide to abstract H-atoms from thenearby Trp and Tyr side-chains;(b) radical–radical coupling resultsin N–C bond, as determined bythe limited mobility of the residuesidegroups; (c) a 1,3 proton shiftregains the aromaticity of the Tyrring.

Figure 6. (A) The indole-arene model used in calculating the strain energy due to bending of N–C cross-link bond;model shown at a dihedral angle of 608. (B) Apparent strain energy versus N–C bond deformation, as measured bythe change in calculated gas-phase energy as the angle between the indole and arene rings of the model are variedfrom 08 to 908.


Deformations up to 308, as seen in rebeccamycin,are predicted to have a small energy cost of ca2 kcal/mol (1 cal ¼ 4.184 J). The deformation inthe Trp–Tyr cross-link is about 608, which, accord-ing to Figure 6, gives a strain energy of 9.8 kcal/mol. This energy cost due to conformational con-straints in formation of the C–N bond must becounterbalanced by inherent energies within thefolded protein.

Although the Trp–Tyr cross-link is unique, it iscomparable to the His–Tyr cross-link in cyto-chrome c oxidase26 and catalase HPII,28 and theCys–Tyr cross-link in galactose oxidase.29 In thecases of cytochrome c oxidase and catalase, one ofthe cross-linked side-chains is a metal ligand,which suggests a metal-dependent redox processas part of the cross-link chemistry similar to whatwe observe in the present study. CcP thus providesan excellent model system for studying cross-linking chemistry required for critical biologicalprocesses, especially since we have shown that itis relatively easy to control formation of the cross-link. This raises the possibility that nearly anyHis–Tyr or Trp–Tyr pair that are directly con-nected along the primary sequence, especially inan a-helix, or are similarly juxtaposed in three-dimensional space, may be susceptible to cross-linking given a suitable redox environment.

Materials and Methods

Materials

Enzymes and reagents for site-directed mutagenesiswere purchased from Roche Molecular Biochemicalsand New England Biolabs Inc. (Beverly, MA). StratageneQuickchange Mutagenesis Kit (cat no. 200516) waspurchased from Stratagene Inc., La Jolla, CA. Chroma-tography columns and resins, media and Naþ/Kþ-freeTris base were purchased from Amersham-PharmaciaBiotech. Zn-protoporphyrin IX was purchased fromFrontier Scientific Porphyrin Products, Logon, Utah.IPTG was purchased from USB Corporation, Cleveland,OH. The 2-methyl-2,4-pentanediol (MPD) and ion-freephosphoric acid were purchased from Aldrich Chemi-cals. All other chemicals were molecular biology gradeor better and were purchased from Sigma or Fisher.

Site-directed mutagenesis

Oligonucleotide-directed mutagenesis experimentswere performed on pT7-7 vector that contained thewild-type CcP gene using the Stratagene QuickchangeMutagenesis Kit (cat no. 200516) with the help of appro-priate primers to obtain the desired mutation. To changethe distal His52 to Tyr, the following sense and anti-sense primers were purchased from Operon Technol-ogies Inc., Alameda, CA:

50 CGTCTTGCTTGGTACACTTCAGGGACC 30

50 GGTCCCTGAAGTGTACCAAGCAAGACG 30

Mutagenesis was carried out using Pfu Turbo DNApolymerase and a temperature cycler. The oligonucleo-

tide primers, each complementary to opposite strandsof the vector, are extended during temperature cyclingby Pfu Turbo DNA polymerase. Incorporation of oligo-nucleotide primers generates a mutated plasmid withstaggered nicks. Following temperature cycling, theproduct was subjected to digestion by endonucleaseDpn I to digest methylated and hemi-methylatedparental DNA and to select for mutation-containing syn-thesized DNA. The nicked DNA vector with desiredmutation is transformed into Epicurian XL1-Blue super-competent cells. The small amount of starting DNA tem-plate, high fidelity of Pfu Turbo DNA polymerase andlow number of thermal cycles all contribute to a high fre-quency of mutation. The mutant clones were analyzedby restriction analysis and automated DNA sequencingat the UCI DNA sequencing core facility to confirm thedesired mutation. This mutant variant protein wasdesignated H52Y.

Protein expression and purification

Mutant CcP (H52Y) protein was expressed under thecontrol of T7 promoter in Escherichia coli BL21(DE3) cellsinduced at A600 of 1.2–1.5 with 750 mM IPTG. Proteinswere purified as described by Fishel et al.38 andChoudhury et al.39 but with minor modification. Aftergel-filtration on a Sephadex G-75 column and heme(Fe3þ-protoporphyrin IX) incorporation into the apo-CcPby standard pH shift, the holo-CcP was separated byDEAE-Sephacel anion-exchange chromatography. Sincethis mutant variant did not crystallize upon dialysisagainst distilled water, protein was stored in 100 mMKPB (potassium phosphate buffer, pH 6.0). For incorpor-ating Zn2þ-protoporphyrin IX into the mutant protein,the crude lysate after gel-filtration on a Sephadex G-75column gave a mixture of apo and holo fractions of CcP.The apo CcP fraction was separated from the smallamount of holo CcP by HiTrap-Q anion-exchange chro-matography using an Amersham-Pharmacia BiotechFPLC system. Stepping the gradient first to 80 mM, thento 130 mM potassium phosphate and finally a lineargradient of 130–500 mM KPB (pH 6.0) separated apoCcP from holo CcP. Apo-CcP was dialyzed extensivelyagainst 100 mM KPB (pH 7.25) before Zn2þ-proto-porphyrin IX incorporation. After dissolving Zn2þ-proto-porphyrin IX in 0.1 M NaOH, it was diluted by theaddition of 100 mM KPB (pH 7.25). This mixture wasadded to the dialyzed apo-CcP, followed by incubationovernight in the cold on an end to end shaker. SinceZn2þ-protoporphyrin IX is photosensitive, all operationswere performed in the dark. This mixture was dialyzedextensively against 50 mM and then 20 mM KPB (pH6.0). Zn2þ-protoporphyrin incorporated CcP was thenpurified by DEAE-Sephacel anion-exchange chromato-graphy. Zn2þ-protoporphyrin containing CcP was storedin 100 mM KPB (pH 6.0) after dialysis against the samebuffer. Mutant CcP concentrations were estimated spec-trophotometrically using an extinction coefficient at408 nm (e408) of 96,000 M21 cm21.

Crystallization

Diffraction quality crystals of Fe-containing as well asZn-porphyrin H52Y were prepared in 30% (v/v) MPD,50 mM KPB (pH 6.0) or 50 mM Tris–phosphate (pH 6.0)according to Edwards & Poulos40 as later modified bySundaramoorthy et al.41 Drops containing 500 mM(,16 mg/ml) protein, 50 mM KPB (pH 6.0) or


Tris–phosphate (pH 6.0) and 18% MPD were equi-librated against 30% MPD at 4 8C. Drops were touch-seeded from previously grown CcP crystals andincubated at 4 8C until crystal growth was complete(two to four days). Crystals (0.2 mm in each dimension)from touch seeding were used for X-ray data collection.This smaller size crystal was necessary for better cryo-genic freezing and to avoid twinning during crystalgrowth. Crystals were mounted in nylon loops andfrozen directly in a cryo-stream held at 121 K. The Fe-containing H52Y crystallized in two forms, chunky(regular wild-type-like) and as plates, both of them inthe space group P212121; but with different unit celldimensions (Table 1). The Zn-porphyrin H52Y alsocrystallized in the same two forms belonging to spacegroup P212121; but both forms crystallized with similarunit cell dimensions (Table 1).

To form this Trp–Tyr cross-link in the crystal, crystalswere soaked in mother liquor (35% MPD, 50 mMTris phosphate, pH 6.0) containing 10 mM hydrogenperoxide for one hour followed by soaking in 35%MPD in 50 mM Tris–phosphate (pH 6.0) to removeexcess peroxide before using the crystal for X-ray datacollection. X-ray diffraction data of resting and per-oxide-treated crystals could be obtained from the samecrystals for Zn-porphyrin H52Y, since one form of thesecrystals could withstand a freeze–thaw cycle. Afterdata collection, crystals were thawed in mother liquor(35% MPD, 50 mM Tris–phosphate, pH 6.0) containing10 mM hydrogen peroxide for one hour followed bysoaking in 35% MPD in 50 mM Tris–phosphate (pH6.0) to remove excess peroxide followed by freezingand data collection.

X-ray data collection and reduction

All X-ray diffraction data of resting state and com-pound I of H52Y were collected at cryogenic tempera-tures in a stream of liquid nitrogen. Since CcP crystalsare grown from solutions containing MPD, there was noneed for the addition of cryo-solvents. All X-ray intensitydata of all forms of heme and Zn-porphyrin crystalswere obtained “in-house” using a Rigaku R-AXIS IVimage plate system with a Rigaku rotating anode operat-ing at 100 mA and 50 kV equipped with Osmic optics. Asingle crystal was used for each dataset. Initial imageprocessing, indexing, and integration were performedwith DENZO (version 1.9.1), and the integrated datawere averaged and scaled with SCALEPACK.42 TheX-ray intensity data from Zn-porphyrin containingH52Y crystals were processed, indexed, integrated andscaled with XENGEN.43 Statistics from data processingof all datasets are listed in Table 1.

Structure solution and refinement

The H52Y mutant crystallized in two forms: the usualchunky crystals and a new form shaped like plates. Theregular chunky crystal form of H52Y, which we havetermed H52Y1, is isomorphous with wild-type crystals.44

The structure of resting wild-type CcP refined to 1.2 Ausing data collected at the Stanford SynchrotronResearch Laboratory (SSRL; our unpublished results)was the starting model for refinement. Rigid body refine-ment (RBR) was followed by slow-cool simulatedannealing minimization with CNS (version 1.1) toremove phase bias and the remaining refinement cycleswere performed using conjugated gradient minimization

and B-factor refinement with CNS (version 1.1).45

Approximately 5% of the data was omitted from therefinement and used as a test set,46 and the same set oftest reflections was maintained throughout refinement.Individual but restrained B-factors were refined in CNS(version 1.1).45 To obtain parameters for the novel C–Nbond between the mutant Tyr52 side-chain and Trp51, asmall molecule model of the cross-link was energy mini-mized using semi-empirical calculations and the bondparameters derived from these calculations were usedas restraints in CNS. These calculations gave a C–Nbond distance of 1.45 A. 2Fo 2 Fc and Fo 2 Fc electrondensity maps were calculated in CNS (version 1.1) andused for model corrections in TOM (version 3.0), avariant of FRODO.47 Water molecules were retained inthe model if they returned in 2Fo 2 Fc and Fo 2 Fc

electron density maps and obeyed hydrogen bondingcriteria. Iterative cycles of model building in TOM(version 3.0) were followed by conjugated gradient mini-mization and B-factor refinement in CNS (version 1.1).45

Final model building was based on 2Fo 2 Fc compositeomit maps.

Since the plate-like crystals of Fe-containing H52Y andZnH52Y were not isomorphous with chunky crystals, itwas necessary to use molecular replacement, AMoRe48

with data obtained from plate crystals. The most success-ful search model consisted of a full molecule of the H52Ystructure derived from chunky crystals. The rotationsearch at 20–5 A was followed by translation searchesof all the rotation solutions at the same resolution. Thetop solution of translation search for space groupP212121 was followed by RBR at 20–5 A in AMoRe.48

The coordinates and structure factors of the top solutionafter RBR were taken through refinement in CNS(version 1.1).45 RBR in CNS (version 1.1) at 50–2.5 Awas followed by the refinement protocol describedearlier. Figures were prepared with MOLSCRIPT,49

BobScript50 and Raster3D.51

Protein Data Bank accession codes

Coordinates have been deposited in the Protein DataBank under accession codes 1MK8, 1MKQ, 1MKR and1ML2.

Acknowledgements

The authors thank Dr Andy J. Howard, IMCA-CAT, Advanced Light Source, Argonne NationalLaboratory, Argonne, IL 60439 and Dept. of Bio-logical, Chemical and Physical Sciences, IllinoisInstitute of Technology, 3101 South DearbornStreet, Chicago, IL 60616 for processing of the Zn-porphyrin data. The authors thank ProfessorDavid Van Vranken for discussions and assistancein computational modeling. This research was sup-ported by the National Science Foundation (PJFCHE-0100774) and the National Institutes ofHealth (TLP GM 42614). Chad Everet Immoosacknowledges a graduate fellowship from the UCToxic Substances Research and Teaching Program.


References

1. Yonetani, T. & Ohnishi, T. (1996). CcP, a mitochon-drial enzyme of yeast. J. Biol. Chem. 241, 2983–2984.

2. Chance, B., Devault, D., Legallais, V., Mela, L. &Yonetani, T. (1967). Kinetics of electron transferreactions in biological systems. In Fast Reactions andPrimary Processes in Chemical Kinetics (Claesson, S.,ed.), Interscience, New York.

3. Erman, J. E., Vitello, L. B., Mauro, J. M. & Kraut, J.(1989). Detection of an oxyferryl porphyrin p-cation-radical intermediate in the reaction between hydro-gen peroxide and a mutant yeast cytochrome cperoxidase. Evidence for tryptophan-191 involve-ment in the radical site of compound I. Biochemistry,28, 7992–7995.

4. Sivaraja, M., Goodin, D. B., Smith, M. & Hoffman,B. M. (1989). Identification by ENDOR of Trp191 asthe free-radical site in cytochrome c peroxidasecompound ES. Science, 245, 738–740.

5. Houseman, A. L., Doan, P. E., Goodin, D. B. &Hoffman, B. M. (1993). Comprehensive explanationof the anomalous EPR spectra of wild-type andmutant cytochrome c peroxidase compound ES.Biochemistry, 32, 4430–4443.

6. Huyett, J. E., Doan, P. E., Gurbiel, R., Houseman,A. L. P., Sivaraja, M., Goodin, D. B. & Hoffman,B. M. (1995). Compound ES of cytochrome c peroxi-dase contains a Trp p-cation radical—characteriz-ation by CW and pulsed Q-band ENDORspectroscopy. J. Am. Chem. Soc. 117, 9033–9041.

7. Erman, J. E. & Yonetani, T. (1975). The oxidation ofcytochrome c peroxidase by hydrogen peroxide.Characterization of products. Biochim. Biophys. Acta,393, 343–349.

8. Pelletier, H. & Kraut, J. (1992). Crystal structure of acomplex between electron transfer partners, cyto-chrome c peroxidase and cytochrome c. Science, 258,1748–1755.

9. Bonagura, C. A., Sundaramoorthy, M., Pappa, H. S.,Patterson, W. R. & Poulos, T. L. (1996). Anengineered cation site in cytochrome c peroxidasealters the reactivity of the redox active tryptophan.Biochemistry, 35, 6107–6115.

10. Hahm, S., Green, L., Durham, B. & Millett, F. (1993).Reaction of cytochrome c with the radical in cyto-chrome c peroxidase compond I. J. Am. Chem. Soc.115, 3372–3373.

11. Hahm, S., Miller, M. A., Geren, L., Kraut, J., Durham,B. & Millett, F. (1994). Reaction of horse cytochrome cwith the radical and the oxyferryl heme in cyto-chrome c peroxidase compound I. Biochemistry, 33,1463–1480.

12. Pappa, H. S., Tajbaksh, S., Saunders, A. J., Pielak, G. J.& Poulos, T. L. (1996). Probing the cytochrome cperoxidase-cytochrome c electron transfer reactionusing site specific cross-linking. Biochemistry, 35,4837–4845.

13. Geren, L., Hahm, S., Durham, B. & Millett, F. (1991).Photoinduced electron transfer between cytochromec peroxidase and yeast cytochrome c labeled atCys102 with 4-bromomethyl-40-methylbipyridine[bis bipyridine]ruthenium2þ. Biochemistry, 30,9450–9457.

14. Miller, M. A., Liu, R. Q., Hahm, S., Geren, L.,Hibdon, S., Kraut, J. et al. (1994). Interaction domainfor the reaction of cytochrome c with the radical andthe oxyferryl heme in cytochrome c peroxidasecompound I. Biochemistry, 33, 8686–8693.

15. Mauro, J. M., Fishel, L. A., Hazzard, J. T., Meyer, T. E.,Tollin, G., Cusanovich, M. A. & Kraut, J. (1987).Tryptophan-191 ! phenylalanine, a proximal-sidemutation in yeast cytochrome c peroxidase thatstrongly affects the kinetics of ferrocytochrome coxidation. Biochemistry, 27, 6243–6256.

16. Poulos, T. L. & Kraut, J. (1980). The stereochemistryof peroxidase catalysis. J. Biol. Chem. 255, 8199–8205.

17. MacGillavry, C. H. & Rieck, G. D. (eds) (1968).Editors of International Tables of Crystallography, vol. 3,Kynoch Press, Birmingham, UK.

18. Hirst, J., Wilcox, S. K., Williams, P. A., Blankenship,J., McRee, D. E. & Goodin, D. B. (2001). Replacementof the axial histidine ligand with imidazole incytochrome c peroxidase. 1. Effects on structure.Biochemistry, 40, 1265–1273.

19. Buzy, A., Bracchi, V., Sterjiades, R., Chroboczek, J.,Thibault, P., Gagnon, J. et al. (1995). Complete aminoacid sequence of Proteus mirabilis PR catalase. Occur-rence of a methionine sulfone in the close proximityof the active site. J. Protein Chem. 14, 59–72.

20. Stehle, T., Ahmed, S. A., Clairbone, A. & Schultz,G. E. (1991). Structure of NADH peroxidase fromStreptococcus faecalis 10C1 refined at 2.16 Aresolution. J. Mol. Biol. 221, 1325–1344.

21. Heim, R., Prasher, D. C. & Tsien, R. Y. (1994). Wave-length mutation and posttranslational autooxidationof green fluorescent protein. Proc. Natl Acad. Sci.USA, 91, 12501–12504.

22. Ormo, M., Cubitt, A. B., Kalio, K., Gross, L. A., Trien,R. Y. & Remington, S. J. (1996). Crystal structure ofthe Aequorea victoria green fluorescent protein.Science, 273, 1392–1395.

23. Hao, B., Gong, W. M., Ferguson, T. K., James, C. M.,Krzycki, J. A. & Chan, M. K. (2002). A new UAGencoded residue in the structure of a MethanogenMethyltransferase. Science, 296, 1462–1466.

24. Ostermeier, C., Harrenga, A., Ermler, U. & Michel, H.(1997). Structure of 2.7 A resolution of the Paracoccusdenitrificans two-subunit cytochrome c oxidase com-plexed with an antibody Fv fragment. Proc. NatlAcad. Sci. USA, 94, 10547–10553.

25. Yoshikawa, S., Shinzawa-Itoh, K., Nakashima, R.,Yaono, R., Yamashita, E., Inoue, N. et al. (1998).Redox-coupled crystal structural changes in bovineheart cytochrome c oxidase. Science, 280, 1723–1729.

26. Buse, G., Soulimane, T., Dewor, M., Meyer, H. E. &Bluggel, M. (1999). Evidence for a copper-coordi-nated histidine–tyrosine cross-link in the active siteof cytochrome c oxidase. Protein Sci. 8, 985–990.

27. Pinakoulaki, E., Pfitzner, U., Ludwig, B. & Varotsis,C. (2002). The role of the cross-link His-Tyr in thefunctional properties of the binuclear center in cyto-chrome c oxidase. J. Biol. Chem. 277, 13563–13568.

28. Bravo, J., Fita, I., Ferrer, J. C., Ens, W., Hillar, A.,Switla, J. & Lowlen, P. C. (1997). Identification of anovel bond between a histidine and the essentialtyrosine in catalase HPII of Escherichia coli. ProteinSci. 6, 1016–1023.

29. Ito, N., Philips, S. E. V., Yadav, K. D. S. & Knowles,Y. P. F. (1994). Crystal structure of a free radicalenzyme, galactose oxidase. J. Mol. Biol. 238, 794–814.

30. Parsons, M. R., Convery, M. A., Wilmot, C. M.,Yadav, K. D. S., Blakeley, V., Corner, A. S. et al.(1995). Crystal structure of a quinoenzyme: copperamine oxidase of Escherichia coli at 2.0 A resolution.Structure, 3, 1171–1184.

31. Yamada, Y., Fujiwara, T., Sato, T., Igarashi, N. &Tanaka, N. (2002). The 2.0 A crystal structure of


catalase-peroxidase from Haloarcula marismortui.Nature Struct. Biol. 9, 691–695.

32. Erman, J. E., Vitello, L. B., Miller, M. A., Shaw, A.,Brown, K. A. & Koraut, J. (1993). Histidine 52 is acritical residue for rapid formation of cytochrome cperoxidase compound I. Biochemistry, 32, 9798–9806.

33. Mondal, M. S., Goodin, D. B. & Armstrong, F. A.(1998). Simultaneous voltammetric comparisons ofreduction potentials, reactivities, and stabilities ofthe high-potential catalytic states of wild-type anddistal-pocket mutant (W51F) yeast cytochrome cperoxidase. J. Am. Chem. Soc. 120, 6270–6276.

34. Jovanovic, S. V., Steenken, S. & Simic, M. G. (1991).Kinetics and energetics of one-electron-transferreactions involving tryptophan neutral and cationradicals. J. Phys. Chem. 95, 684–687.

35. Davies, K. J. A., Delsignore, M. E. & Lin, S. W. (1987).Protein damage and degradation by oxygen radicalsII. Modification of amino acids. J. Biol. Chem. 262,9902–9905.

36. Long, B. H., Rose, W. C., Vyas, D. M., Matson, J. A. &Forenza, S. (2002). Discovery of antitumor indolo-carbazoles: rebeccamycin. NSC 655649, and fluoro-indolocarbazoles. Curr. Med. Chem.: Anti-cancerAgents, 2, 156–266.

37. Gilbert, E., Chisholm, J. D. & Van Vranken, D. L.(1999). Conformational control in the rebeccamycinclass of indolocarbazole glycosides. J. Org. Chem. 64,5670–5676.

38. Fishel, L. A., Villafranca, J. E., Mauro, J. M. & Kraut,J. (1987). Yeast cytochrome c peroxidase: mutagenesisand expression in Escherichia coli show tryptophan-51is not the radical site in compound I. Biochemistry, 27,351–360.

39. Choudhury, K., Sundaramoorthy, M., Hickman, A.,Yonetani, T., Woehl, E., Dunn, M. F. & Poulos, T. L.(1994). Role of the proximal ligand in peroxidasecatalysis. Crystallographic, kinetic, and spectralstudies of cytochrome c peroxidase proximal ligandmutants. J. Biol. Chem. 269, 20239–20249.

40. Edwards, S. L. & Poulos, T. L. (1990). Ligand bindingand structural perturbations in cytochrome c peroxi-

dase. A crystallographic study. J. Biol. Chem. 265,2588–2595.

41. Sundaramoorthy, M., Choudhury, K., Edwards, S. L.& Poulos, T. L. (1991). Crystal structure and pre-liminary functional analysis of the cytochrome cperoxidase His175Gln proximal ligand mutant.J. Am. Chem. Soc. 113, 7755–7757.

42. Otwinowski, Z. & Minon, V. (1997). Processing ofX-ray diffraction data collected in oscillation mode.Methods Enzymol. 276, 307–326.

43. Howard, A. J. (2000). Data processing in macro-molecular crystallography. In CrystallographicComputing 7: Proceedings from the MacromolecularCrystallographic Computing School, 1996 (Brown, P. E.& Watenpaugh, K. D., eds), Oxford University Press,Oxford.

44. Finzel, B. C., Poulos, T. L. & Kraut, J. (1984). Crystalstructure of yeast cytochrome c peroxidase refinedat 1.7 A resolution. J. Biol. Chem. 259, 13027–13036.

45. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano,W. L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998).Crystallography & NMR system: a new softwaresuite for macromolecular structure determination.Acta Crystallog. sect. D, 54, 905–921.

46. Brunger, A. T. (1992). Free R value: a novel statisticalquantity for assessing the accuracy of crystalstructures. Nature, 355, 472–475.

47. Jones, T. A. (1985). Diffraction methods for biologicalmacromolecules. Interactive computer graphics:FRODO. Methods Enzymol. 115, 157–171.

48. Navaza, J. (1994). AMoRe: an automated package formolecular replacement. Acta. Crystallog. sect. A, 50,157–163.

49. Kraulis, P. J. (1994). MOLSCRIPT: a program toproduce both detailed and schematic plots of proteinstructures. J. Appl. Crystallog. 24, 946–950.

50. Esnouf, R. M. (1997). An extensively modifiedversion of MolScript that includes greatly enhancedcoloring capabilities. J. Mol. Graph. Model. 15,132–134.

51. Merritt, E. A. & Bacon, D. J. (1997). Raster3D: photo-realistic molecular graphics. Methods Enzymol. 277,505–524.

Edited by D. Rees

(Received 18 November 2002; received in revised form 20 November 2002; accepted 27 January 2003)


Documents

H52YCcP_JMB_2003.PDF