Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli

Michael A. Olson,a Timothy W. Siebach,a Joel S. Griffitts,a Eric Wilson,a David L. Ericksona

aDepartment of Microbiology and Molecular Biology, Brigham Young University, Provo, Utah, USA

ABSTRACT Virulence factors of mammary pathogenic Escherichia coli (MPEC) havenot been identified, and it is not known how bacterial gene content influences theseverity of mastitis. Here, we report a genome-wide identification of genes that con-tribute to fitness of MPEC under conditions relevant to the natural history of the dis-ease. A highly virulent clinical isolate (M12) was identified that killed Galleria mello-nella at low infectious doses and that replicated to high numbers in mousemammary glands and spread to spleens. Genome sequencing was combined withtransposon insertion site sequencing to identify MPEC genes that contribute togrowth in unpasteurized whole milk, as well as during G. mellonella and mouse mas-titis infections. These analyses show that strain M12 possesses a unique genomic is-land encoding a group III polysaccharide capsule that greatly enhances virulence inG. mellonella. Several genes appear critical for MPEC survival in both G. mellonellaand in mice, including those for nutrient-scavenging systems and resistance to cellu-lar stress. Insertions in the ferric dicitrate receptor gene fecA caused significant fit-ness defects under all conditions (in milk, G. mellonella, and mice). This gene washighly expressed during growth in milk. Targeted deletion of fecA from strain M12caused attenuation in G. mellonella larvae and reduced growth in unpasteurizedcow’s milk and lactating mouse mammary glands. Our results confirm that iron scav-enging by the ferric dicitrate receptor, which is strongly associated with MPECstrains, is required for MPEC growth and may influence disease severity in mastitisinfections.

IMPORTANCE Mastitis caused by E. coli inflicts substantial burdens on the healthand productivity of dairy animals. Strains causing mastitis may express genes thatdistinguish them from other E. coli strains and promote infection of mammaryglands, but these have not been identified. Using a highly virulent strain, we em-ployed genome-wide mutagenesis and sequencing to discover genes that contributeto mastitis. This extensive data set represents a screen for mastitis-associated E. colifitness factors and provides the following contributions to the field: (i) global com-parison of genes required for different aspects of mastitis infection, (ii) discovery of aunique capsule that contributes to virulence, and (iii) conclusive evidence for thecrucial role of iron-scavenging systems in mastitis, particularly the ferric dicitratetransport system. Similar approaches applied to other mastitis-associated strains willuncover conserved targets for prevention or treatment and provide a better under-standing of their relationship to other E. coli pathogens.

KEYWORDS Escherichia coli, ExPEC, Galleria mellonella, MPEC, capsule, fecA, ferricdicitrate, mammary gland, mastitis, milk

Escherichia coli is a diverse species, encompassing a wide variety of strains thatoriginate through frequent genetic exchange. While many E. coli strains are com-

mensals that form part of the normal intestinal flora, there are several pathotypes thatcause intestinal or extraintestinal illness. Extraintestinal pathogenic E. coli (ExPEC)

Received 3 October 2017 Accepted 27October 2017

Accepted manuscript posted online 3November 2017

Citation Olson MA, Siebach TW, Griffitts JS,Wilson E, Erickson DL. 2018. Genome-wideidentification of fitness factors in mastitis-associated Escherichia coli. Appl EnvironMicrobiol 84:e02190-17. https://doi.org/10.1128/AEM.02190-17.

Editor Harold L. Drake, University of Bayreuth

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to David L. Erickson,david_erickson@byu.edu.

GENETICS AND MOLECULAR BIOLOGY

crossm

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 1Applied and Environmental Microbiology

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

strains include those that cause urinary tract infections, neonatal meningitis, pneumo-nia, and sepsis in humans, those that cause airway infections and septicemia in birds,and those that infect mammary glands and cause mastitis in lactating mammals. Ofthese strains, we understand the least about mastitis-associated E. coli, despite itscritical impact on the dairy industry, where it causes annual losses totaling nearly $2billion and endangers animal health (1, 2).

A mammary pathogenic E. coli (MPEC) pathotype has been proposed (3), but thedefining characteristics of this group have not been identified. While virulence geneshave been functionally associated with the intestinal E. coli pathotypes (e.g., Shigatoxin, translocated intimin receptor, etc.), we lack a similar understanding of the basisfor virulence in the unique environment of the lactating mammary gland despite manyyears of investigation (4–10). This has led to the conclusion that strains causing mastitisdo not have specific virulence factors and that it is merely their introduction into themammary gland and the subsequent inflammatory response that result in mastitissymptoms (10, 11). In this model, disease severity is primarily dependent on hostfactors. However, it is unlikely that E. coli strains causing mastitis are random since notall E. coli strains are pathogenic in experimental models of the disease (12). Additionally,mastitis-associated strains are less genotypically diverse than environmental strains,indicating selective pressure for specific virulence or fitness factors. Nevertheless,several recent genome comparison studies have failed to consistently identify genespresent more often in strains associated with mastitis than in nonpathogenic strains(13–17), and functional genomic studies aimed at identifying genes required by MPECto colonize the mammary gland have not been reported.

In order to cause mastitis, bacteria must gain access through the teat canal andovercome the immune defenses constitutively present in the mammary gland. Themammary gland is a transiently mucosal tissue, producing mucosal secretions onlyduring lactation. Mammary gland epithelial cells secrete numerous soluble antimicro-bial defenses to impede bacterial growth, and these are amplified by an influx ofinflammatory cells during infection. Milk contains components of innate immunity suchas antimicrobial peptides, lysozyme, lactoferrin, and complement. Milk also provides aunique nutritional environment for bacteria, being high in fats and sugars and withlimited availability of free amino acids and iron (18–20). Shortly after infection, bacteriaare usually eliminated by the inflammatory response that follows, resulting in transientmastitis. However, some MPEC strains cause severe, acute disease resulting in perma-nent mammary gland dysfunction, sepsis, or death. Other strains may cause persistentsubclinical infection. MPEC strains that cause transient or persistent mastitis may havedistinct in vitro phenotypes such as motility, suggesting that subtypes defined bycarriage or differential expression of specific genes may exist (21, 22). It is also possiblethat some MPEC strains could cause disease in other tissues, but as yet the genesassociated with virulence in multiple hosts or colonization sites are unknown.

We hypothesize that, in addition to differences in host immune factors, variability inthe colonizing strains plays a significant role in determining the severity or nature of themastitis that develops in individual cases. Targeted interference of bacterial virulencefactors as well as a better understanding of the most effective host defenses could leadto improved treatment options. However, we currently do not know enough aboutMPEC virulence factors to develop these approaches in an informed way. There isclearly a need for an unbiased, broad-scale approach to identify genes required byMPEC for colonization and dissemination. In this study, we demonstrated the utility ofthe lepidopteran host Galleria mellonella for predicting MPEC virulence. G. mellonellahas been used to measure the virulence of several bacterial and fungal pathogens(23–25). We then used massively parallel transposon insertion sequencing (Tn-seq)(26–28) to identify genes that allow MPEC to survive in whole unpasteurized milk, in G.mellonella, and in murine mammary glands and spleens. We confirmed the relevance ofthe Tn-seq data through targeted deletion mutations. Our results reveal a large numberof genes important for MPEC survival under these distinct conditions. We confirmed the

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 2

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

essential role of the MPEC ferric dicitrate transport system in obtaining iron andcounteracting host nutritional immunity.

RESULTSVirulence of MPEC isolates in Galleria mellonella. G. mellonella has been used

previously to measure infectivity of ExPEC clinical isolates (23, 24). To determinewhether these insects would be applicable to studying MPEC pathogenesis, wescreened 20 MPEC strains that were isolated from clinical cases of bovine mastitis fortheir ability to kill G. mellonella. The MPEC strains, which were primarily of phylogroupA, exhibited a broad range of virulence levels in these assays (Table 1). The mostvirulent strain (M12) killed all the larvae at the lowest inoculum (103 CFU). In subse-quent experiments with lower infectious doses, we determined that the 50% lethaldose (LD50) for this strain is between 500 and 1,000 CFU. Conversely, none of the larvaewere killed by several of the strains (such as isolate M6) even at the highest dose (105

CFU). Additional infections with less virulent isolates showed that both M6 and M11were able to kill some of the larvae at later time points but were still attenuated invirulence compared to that of strain M12 (Fig. 1A).

We next sought to determine if the results of the G. mellonella infection assay couldbe predictive of the virulence of MPEC isolates in mammary gland infections. Becauseof the sharp contrast in their virulence levels in G. mellonella, strains M6 and M12 wereselected and injected into the mammary glands of lactating mice. The M12 strain grewto significantly higher numbers in mammary glands than strain M6. In addition, strainM12 spread and replicated in the spleens whereas M6 did not (Fig. 1B). These resultssuggest that the G. mellonella infection assay may be capable of predicting thevirulence potential of MPEC strains in a mouse model of mastitis, but testing a largernumber of strains is required to fully determine this relationship. Our results furthersuggest that G. mellonella could also be used to identify virulence factors relevant tomastitis or disease in other host environments.

Genome sequencing and annotation of MPEC strain M12. The ability of M12 toinfect G. mellonella and grow to high numbers in mouse mammary glands anddisseminate to the spleen suggested that this strain would be particularly useful indiscovering genes that are needed for multiple aspects of MPEC infection. We thereforesequenced and partially assembled the genome of strain M12 (see Table S1 in thesupplemental material). Annotation of the assembled sequence revealed that, in com-mon with most other MPEC isolates, M12 possesses genes for type VI secretion systems,long polar fimbriae, and iron scavenging (13, 14, 17, 29). Unlike most MPEC strains, M12

TABLE 1 Mortality of G. mellonella larvae infected with MPEC strainsa

aPercentage of dead larvae determined 24 h after infection (n � 10). Virulence for each strain was classifiedas low (green), moderate (orange), or red (high). Highly virulent strains killed �50% of larvae at the lowestinfectious dose. Moderately virulent strains killed �50% of larvae at the highest dose.

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 3

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

belongs to phylogroup D and to the multilocus sequence type 69 (ST69) complex.Some ST69 strains have been associated with fecal contamination of surface waters andwith human ExPEC infections (30). They have also been isolated from cattle andlivestock attendants and have shown enhanced ability to colonize, persist, and adapt todifferent hosts (23, 31–33).

Genome-wide identification of genes required for MPEC growth in milk, G.mellonella, and mice. We sought to make a comprehensive comparison of genesrequired for M12 growth in unpasteurized cow’s milk, G. mellonella larvae, and mousemammary glands and spleens. A Tn-seq approach was used to measure the contribu-tion of each gene to the relative fitness in these environments. A library consisting of�400,000 unique M12 transposon insertion mutants derived from 40 independentlyderived pools was created and passaged through the four experimental conditions(milk, G. mellonella larvae, and mouse mammary glands and spleens) (see Materials andMethods), followed by recovery in Luria-Bertani (LB) broth cultures. The mutant pop-ulations were then collected and sequenced in parallel with the control population.

Between 17.8 and 34.8 million reads were generated for each sample, with 88.8 to93.7% of the reads mapping to single locations in the M12 genome. In total, there were89,747 unique insertion sites which were detected across the different conditions,which corresponded to an average density ranging from 70 to 158 nucleotides be-tween transposon insertion sites in the libraries. The transposon insertion sites werethen tabulated for each condition (Data Set S1). Reproducibility between the replicatesamples for each condition was very high, with R2 values between 0.90 and 0.98(Fig. S1).

To identify genes that may contribute to the fitness of M12 under each of theconditions, input (LB medium) and output libraries were compared using the DESeqpackage (34, 35). Genes that had a log2 fitness score of �2 or lower (i.e., at least 4-foldfewer insertions in the output pool compared to the input pool) and a P value of 0.05or lower were identified as candidate genes (Data Set S1). We compared the candidatefitness genes for each of the test conditions according to their functional categories(Fig. 2). The 25 genes wherein insertions caused the greatest decreases in fitness undereach of the four conditions are listed in Table S2.

It appears that there is general consistency in the proportions of genes that fallwithin each functional category (with some exceptions discussed below), but theindividual genes within the categories varied. However, fewer genes are required forgrowth in milk than under the in vivo conditions (Fig. 2). The nucleotide and amino acidbiosynthesis categories contained a large proportion of the putative fitness genes

FIG 1 Virulence of MPEC strains in G. mellonella predicts virulence potential in a mouse mastitis model.(A) G. mellonella larvae were infected with 103 CFU of MPEC strains M6, M11, M12, and the control strainE. coli DH5�. Mortality of infected larvae was determined over a 72-h period. M12 virulence wassignificantly greater than that of the MPEC strains M6 (P � 0.0001) and M11 (P � 0.0003) (log rank[Mantel-Cox] test). (B) Infection of mouse mammary glands (MG) with strains M6 and M12. Bacteria (250CFU) were inoculated directly into the teat canal of lactating mice. After 24 h, strain M12 grew tosignificantly higher numbers in the mammary glands (*, P � 0.029, by Mann-Whitney test) than strain M6.Strain M12 also colonized the spleens of the infected mice whereas strain M6 was not detected.

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 4

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

(Fig. 2) and were prominent among those with the greatest effects on fitness (Table S2).Many of those required for growth in milk or in mice are predicted to be involved inpurine metabolism and the biosynthesis of phenylalanine, histidine, and serine. Genesinvolved in nucleotide metabolism have previously been shown to be required for E.coli growth in blood and spleens (36, 37). Our results indicate they are also requiredfor growth in milk, a further indication that de novo synthesis pathways are crucialvirulence factors in mammals.

The virulence, disease, and defense category represented a larger proportion of thetotal genes under in vivo conditions than during growth in milk (Fig. 2). These genesprimarily encode membrane transport functions, including metal resistance and effluxgenes, and are listed in Table S3. Genes required for resistance to cellular stresses werealso prominent, especially under the in vivo conditions. M12, like other E. coli strains,encodes three superoxide dismutase (SOD) enzymes that utilize different metals ascofactors. The sodA (encoding Mn-SOD), sodB (Fe-SOD), and sodC (Cu/Zn-SOD) geneswere each predicted to enhance M12 fitness in G. mellonella (Fig. S2). In addition to SODenzymes, the Dps protein helps bacteria survive oxidative stress by binding to DNA andiron to prevent damage from iron-catalyzed Fenton reactions (38). Insertions in the dpsgene reduced M12 fitness under each of the in vivo conditions but not in milk (Fig. S2).The HtrA-family protein DegP removes misfolded periplasmic proteins during oxidativeor heat stress (39) and has been shown to be required for E. coli survival during mousebladder infections (40). DegP is activated by the sigma factor RpoE, which our Tn-seqdata indicate is essential for viability in M12. RpoE is repressed by the anti-sigma factorRseA (41). The degP and rseA genes also appeared to be required by M12 in the in vivoenvironments but not in milk.

In addition to oxidative stress resistance, the transcriptional regulatory protein NsrRand the nitric oxide reductase flavorubredoxin are required for E. coli responses to nitricoxide (42). Insertions in the nsrR gene reduced M12 fitness in mice and G. mellonella,and insertions in the norV gene reduced fitness in mice but not in G. mellonella (Fig. S2).The requirement for several oxidative and nitrosative stress resistance genes particu-larly in vivo but not in whole milk may be attributed to the initiation of inflammatoryresponses. Influx of neutrophils or hemocytes, activation of prophenoloxidase ordegranulation cascades, and upregulation of the oxidative or nitric oxide burst occuronly in the presence of living phagocytic cells, and thus bacterial defense mechanismsare most critical under these conditions. Many of these genes are known to be virulence

FIG 2 Functional classification of genes required for M12 fitness in milk, G. mellonella, and mouse mammary glands andspleens. Genes with a log2 fitness score of �2 or lower (i.e., at least a 4-fold reduction in insertions in the output poolrelative to the input pool) and a P value of 0.05 or lower were identified as candidate genes and grouped according to theirannotated function.

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 5

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

factors for ExPEC in other environments, and these results suggest they may also beimportant for MPEC mastitis.

Genes encoding a type III polysaccharide capsule are required for virulence inG. mellonella. We were interested in identifying genes encoding bacterial surfacestructures that have direct interactions with host cells or surveillance proteins. Onecluster of genes which appeared to contribute significantly to fitness only in G.mellonella was predicted to encode the synthesis and transport of a polysaccharidecapsule (Fig. 3A). Examination of the assembled M12 contigs showed that these genesare found on a putative genomic island in M12 not previously associated with MPECstrains. Within the 33-kb island are kpsS, kpsC, and kpsDEMT genes ordered accordingto group III capsule synthesis and export systems (43). The island also containsnucleotide sugar biosynthesis, glycosyltransferase, and modification genes in thisregion in an arrangement that does not appear in any other publicly available bacterialgenome sequence, suggesting lateral gene transfer and/or extensive recombination,possibly resulting in a novel capsule type.

The Tn-seq data indicated that the capsule genes were particularly important forG. mellonella infection but were detrimental to fitness during colonization of mouse

FIG 3 A unique genomic island in MPEC strain M12 encodes a type III capsule that contributes to virulence. (A) Genetic organization of the 33-kb islandcontaining capsule biosynthesis genes, including kpsS and kpsC which were deleted in the ΔkpsCS mutant strain. (B) Tn-seq determination of fitness costs (log2

fitness score) associated with disruptions to M12 kpsC and kpsS genes in milk, G. mellonella, or during mouse infections (***, P � 0.001). (C) Gel electrophoresisand Alcian blue staining of capsular material shows that the mutant strain fails to produce capsule that is detectable in the wild-type strain and complement(pMO1). (D) The ΔkpsCS mutant strain is avirulent in G. mellonella, with no lethality evident in larvae injected with up to 30,000 bacteria in contrast to completekilling by the wild-type and complemented strains (**, P � 0.0043; ****, P � 0.0001, by log rank test). (E) Competition between the M12 wild-type strain andΔkpsCS mutant (500 CFU) was measured during mammary gland infection in lactating mice. After 24 h, mice were sacrificed, and the competition index(means � standard errors of the means) was determined (*, P � 0.0002, by one-sample t test). ns, not significant.

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 6

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

mammary glands (Fig. 3B). To confirm the validity of these Tn-seq results, the contri-bution of this putative capsule to survival in G. mellonella and mouse mastitis wasassessed. A mutant strain with a deletion of the kpsCS genes predicted to be necessaryfor initiation of capsule synthesis was generated (44). The production of capsule in thewild-type M12 bacteria was examined using SDS-PAGE and alcian blue staining(Fig. 3C). In contrast to the abundant capsule produced by the wild-type strain, asexpected, the mutant strain failed to produce detectable capsule, and replacement ofthe kpsCS genes on a multicopy plasmid partially restored capsule production. In G.mellonella infections, the ΔkpsCS mutant strain was much less virulent than thewild-type strain (Fig. 3D), consistent with the Tn-seq result. Complementation restoredvirulence to nearly wild-type levels, correlating with capsule production. Fitness of theΔkpsCS mutant during mouse mammary gland infections was then tested in competitionassays with the wild-type strain. Unlike the Tn-seq results which predicted that the mutantwould have enhanced fitness, the ΔkpsCS mutant had a slight but statistically significantdecrease in survival after a 24-h infection in the mammary glands of mice (Fig. 3E).

Nutrient-scavenging genes. The genome sequence of strain M12 and the Tn-seqresults together suggest a critical role for nutrient scavenging in mastitis pathogenesis.M12 encodes multiple iron acquisition systems, including receptors for the enterobac-tin (fepA) and yersiniabactin (fyuA) siderophores. It also encodes the sitABCD and mntHuptake systems for iron and manganese, as well as a high-affinity zinc uptake transportsystem (znuABC). The Tn-seq results indicate that genes encoding the enterobactinreceptor and uptake system are necessary for bacterial growth in G. mellonella and inspleens (Fig. 4A). While other siderophores have been previously shown to contributeto ExPEC virulence, a role for enterobactin has not been identified (45). Conversely, theyersiniabactin receptor genes do not appear important for survival in G. mellonella orin mammary glands but do appear to be important for survival in spleens (Fig. 4A). Thetransport systems for zinc (znuABC) and iron/manganese (sitABCD) also appear to berequired for fitness in G. mellonella and in mice (Fig. 4A).

Transposon insertions in the fecA gene also resulted in significantly less growth inmilk, G. mellonella, and mouse mammary glands (Fig. 4A). The fecABCDE operonencodes an uptake transport system for ferric dicitrate (46). This chelated form of ironeffectively reduces the iron availability in environments such as milk and insecthemolymph. Thus, citrate can be considered an iron sequestration factor that mayprevent bacterial growth in these environments (47–49). The ferric dicitrate receptorFecA, along with its accessory proteins FecB and FecC, enables bacteria to transfer ferricdicitrate across the outer membrane and to incorporate essential iron (50, 51). Inser-tions in the fecA, fecB, and fecC structural genes, as well as the sigma factor fecI whichactivates transcription of the operon in response to ferric dicitrate, decreased fitness inmilk and under the in vivo conditions.

FIG 4 Nutrient-scavenging genes are required for fitness in G. mellonella, mice, and growth in milk andare highly expressed during growth in milk. (A) Fitness costs (log2 fitness score) associated withdisruptions to M12 nutrient-scavenging genes in milk, G. mellonella, or during mouse infections asmeasured by Tn-seq (*, P � 0.05; **, P � 0.01; ***, P � 0.001). (B) The change in transcription levels ofiron receptors fecA, fepA, fhuE, and sitA was determined 4 h after transfer to whole unpasteurized milk.The change in gene expression levels was determined relative to that of control cultures in LB medium(*, P � 0.0273; **, P � 0.0092; ***, P � 0.0019, by one-sample t test).

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 7

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

The requirement for iron scavenging systems for growth in milk indicates theiron-limited nature of this environment. To further investigate which of the ironacquisition systems might be important for growth, we measured expression of fouriron-scavenging genes following transfer of actively growing M12 culture into wholeunpasteurized cow’s milk (Fig. 4B). These genes are all known to be regulated by theavailability of iron at least partially through the ferric uptake regulator protein Fur(52–55). Three of four genes (fecA, fepA, and sitA) were strongly upregulated 1 h aftertransfer to cow’s milk. These results confirm that iron availability is severely limited inmilk, likely as a consequence of its sequestration by lactoferrin and citrate, and that theferric dicitrate system is especially highly expressed.

Ferric dicitrate transporter (fecA) enhances M12 growth and virulence. Previousgenome sequencing and PCR-based screens of MPEC strains have found that thesestrains are more likely than other pathotypes to carry genes for type VI secretionsystems, long polar fimbriae, and the ferric dicitrate uptake system (fecABCDE). Accord-ing to our Tn-seq results, the type VI secretion system and long polar fimbriae are notrequired for fitness under any of the experimental conditions. The Tn-seq data indi-cated a strong fitness defect when the fecA operon was disrupted (Fig. 4A), and the fecAgene was highly upregulated during growth in milk (Fig. 4B), which suggested animportant role for this system.

To verify the role of the ferric dicitrate iron-scavenging system in overcoming ironlimitation, we created a deletion mutant of the outer membrane receptor fecA gene instrain M12. Compared to the wild-type strain, the ΔfecA mutant grew significantly lesswell in bovine or mouse milk in single-culture experiments (Fig. 5A). The growth defectof the mutant strain was much more pronounced during growth in cow’s milk than inthe mouse milk, which may be due to the higher abundance of citrate in cow’s milk (16,56, 57). We then complemented the mutation by replacing the fecABCDE genes on amulticopy plasmid and tested the fitness of the mutant and complemented strains in1:1 competition assays with the wild-type strain in cow’s milk (Fig. 5B). The mutant hadan approximately 3-log reduction in fitness, and the competitive fitness was restored towild-type levels in the complemented strain.

We then tested the virulence of the ΔfecA mutant in G. mellonella and in mousemastitis infections. Virulence of the mutant was severely attenuated in the larvaecompared to that of the wild-type strain over a range of inoculum concentrations (500to 50,000 CFU) (Fig. 5C). The virulence of the mutant was restored by complementationwith the fecABCDE plasmid. In mouse mammary gland infections, numbers of themutant strain bacteria were 10- to 100-fold lower than those of the wild-type strain24 h after infection (Fig. 5D). However, the mutant and wild-type strains achieved similarconcentrations in the spleens of the infected mice. This suggested that the ΔfecA mutationprevents the acquisition of iron from citrate complexes in milk but does not impact ironacquisition from other sources. To more fully test this hypothesis, we compared the fitnessof the ΔfecA mutant strain in competition with the wild-type strain in lactating and innonlactating mouse mammary glands (Fig. 5E). As with the single-infection experiments,the mutant was less fit in lactating mice in the competition experiments. In contrast, thegrowth of the mutant strain was not significantly different from that of the wild typeduring infection of nonlactating mice. Therefore, in environments where citrate ispresent (in vitro in milk, lactating mouse mammary glands, and insect hemolymph),fecA enables significantly more bacterial growth but is dispensable in environmentswhere citrate is not present (nonlactating mammary glands and spleens).

DISCUSSION

In this study, we utilized Tn-seq to identify genes required by MPEC in environmentsthat are relevant to its natural history, including growth in milk, exposure to an effectiveinnate immune system, and colonization of mammary tissues. We showed that aG. mellonella larva model was able to discriminate between strains with high and lowvirulence potentials in mammary glands, providing a relevant, convenient method toinvestigate the molecular pathogenesis of MPEC strains. The variability in virulence

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 8

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

levels toward G. mellonella among this relatively small set of MPEC strains was unex-pectedly high, as mastitis-associated E. coli bacteria are commonly perceived as genericinducers of inflammation. Most previous studies investigating the nature of mastitis-associated strains concluded that they are commensals belonging mainly to phylo-groups A and B1 (5, 9). While mastitis-associated strains show increased growth in milkrelative to that of other strains (4, 13), they are thought to possess few known virulencefactors that would be predicted to influence the severity of disease in mammary glandsor to allow them to cause disease in other contexts (10, 11). Our results challenge thisinterpretation. Instead, they support the idea that some mastitis-associated strains mayshare features in common with other phenotypic groups of E. coli and that moredetailed studies are required to elucidate virulence genes that may be strain specific(58). This is reminiscent of other recent findings where strains classified as nonpatho-genic have been isolated from the bloodstream of immunocompromised patients (59),and intestinal pathogenic O157:H7 strains have been recovered from urinary tractinfections (60). It is possible that the variation among MPEC strains in their ability toinfect and kill G. mellonella correlates with virulence in mammary gland infections only.Alternatively, this variation may reflect a previously unappreciated ability of somemastitis-associated strains to cause disease in other contexts, which is deserving offurther investigation.

Similar to milk, G. mellonella hemolymph contains iron-sequestering proteins andcitrate, which severely limit free iron available to invading pathogens (47, 61). It also

FIG 5 The fecA gene is required for optimal M12 growth in whole milk and for virulence in G. mellonella and in murinemammary glands. (A) Growth of the M12 wild-type or ΔfecA mutant strain was measured in whole unpasteurized milk (cowor mouse) after 4 h. The mutant strain had significantly decreased growth in both cow and mouse milk (*, P � 0.033; **, P �0.0046, by Student’s t test). (B) Competitive fitness of the M12 wild-type strain, ΔfecA mutant, or complemented (pMO2) strainwas determined by competition assays in cow’s milk. The mutant strain was significantly less fit (*, P � 0.0001, by one-samplet test) than the wild-type strain whereas the complemented strain was not. (C) Virulence of M12 wild-type or ΔfecA mutantbacteria measured in G. mellonella infections. Groups of larvae were infected with the indicated number of bacteria, andsurvival was measured 24 h after infection. The ΔfecA mutant strain was significantly less virulent in the larvae (**, P � 0.01;***, P � 0.001, by log rank test). (D) Virulence of M12 wild-type or ΔfecA mutant bacteria during mouse infections. Lactatingmice were infected with �300 CFU of either the wild-type or ΔfecA mutant strain, and bacterial numbers in mammary glandsor spleens were determined after 24 h. Growth of the mutant strain was significantly different from that of the wild type inmammary glands (**, P � 0.0022, by Mann-Whitney test) but not in spleens. (E) Competitive fitness levels of the ΔfecA mutantstrain were compared during infection of lactating and nonlactating mice. Mice were infected with mixtures of mutant andwild-type M12 strains, and bacterial growth in the mammary glands was measured after 24 h. The fitness of the ΔfecA mutantstrain was significantly lower during infection of lactating mice (*, P � 0.0001, by one sample t test) but not in nonlactatingmice. ns, not significant.

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 9

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

contains lysozyme and antimicrobial peptides that inhibit or kill bacteria (62). Theirhemocytes phagocytize and kill bacteria in a similar fashion as neutrophils (63). Theyalso activate a proteolytic phenoloxidase cascade functionally similar to complement atthe surface of bacteria, leading to engulfment and deposition of toxic reactive oxygenmolecules (64). It is not surprising, then, that a large number of genes important forsurvival in mouse mammary glands, including genes related to stress resistance anddetoxification as well as nutrient acquisition functions, were also required in G.mellonella. For instance, the inner membrane zinc uptake genes znuABC, which are alsorequired for Acinetobacter baumannii virulence in G. mellonella (65), appear importantfor M12 survival in mice and G. mellonella. High-affinity transport by bacteria cancombat the effects of the zinc- and manganese-chelating protein calprotectin, which isabundant in neutrophils and is released as a component of extracellular traps (66–68).Neutrophil influx, degranulation, and extracellular trap formation are early criticalevents in the mammary gland immune response to mastitis (69, 70), and mammaryepithelial cells may also release calprotectin (71). Zinc and manganese are cofactors forthe superoxide dismutases sodA and sodC, which our data suggest are required forMPEC virulence. Additional experiments need to be carried out to determine if G.mellonella has a calprotectin-like protein and to clarify the role of znuABC in dealingwith oxidative stress in the context of mammary gland infections.

The mastitis-associated strain M12 was particularly virulent in the G. mellonellamodel and grew prolifically in mouse mammary glands. We found that a significantportion of its virulence in G. mellonella can be attributed to production of a type IIIcapsule encoded on a genomic island. A mutant unable to produce capsule wasavirulent in the larvae and slightly attenuated in mouse mammary gland infections.Some group II or III capsules have been shown to contribute to urinary tract orbloodstream ExPEC survival (72–75). However, capsule production has not been pre-viously shown to affect virulence of E. coli in mastitis. Microscopically visible productionof capsule material by mastitis isolates has been observed (76), but phage or PCR-basedscreens for capsule genes has generally shown only sporadic carriage by mastitis-associated strains (6, 9, 15). Capsule production could provide a slight advantage tostrain M12 in the mammary gland by masking bacterium-associated molecular patternsand delaying initial detection, enhancing complement resistance, or providing protec-tion against neutrophils and macrophages. The much larger reduction in fitness of theΔkpsCS mutant in the G. mellonella infections suggests that there may be environmentsoutside the mammary gland where this group III capsule confers a more significantadvantage. The reason for the dramatically reduced virulence of the mutant during G.mellonella infections requires further investigation, but it suggests that this capsule mayhave a more prominent role in enhancing survival of the bacteria in their intestinalreservoir or during infections in other extraintestinal niches (58).

Our study confirms the role of the ferric dicitrate transport system encoded by thefecA operon, at least for one mastitis-associated E. coli strain. The fecA gene has beenone of very few that consistently appears in screens of MPEC strains, which has led tospeculation that it confers a key advantage for growth in mammary glands. Based onits antigenic consistency among mastitis-causing strains, Lin et al. proposed vaccinatingcattle with recombinant FecA protein in order to elicit anti-FecA antibodies that couldlimit bacterial growth (56). However, they found that vaccinated cattle producedantibody that was insufficient to affect bacterial growth in mammary glands of thevaccinated animals (77). It is unclear whether the antibodies in their study were able tocompletely block FecA function or if the bacteria were able to acquire iron via othermethods (78). Our Tn-seq data suggest that the ferric dicitrate and enterobactinsiderophore iron acquisition systems are nonredundant, at least for the M12 strain inmouse mammary gland infections.

Our results clearly demonstrate that a mutation eliminating FecA function has astrong detrimental effect on bacterial replication in environments that contain citrate,including cow’s milk and mouse mammary glands. Citrate is an iron chelator, andbacteria with the ability to utilize this iron source have a growth advantage. In addition

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 10

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

to ferric dicitrate, ferric-lactoferrin is the other major iron source potentially available tobacteria in milk. Siderophores such as enterobactin or yersiniabactin could remove ironfrom lactoferrin, enabling bacterial acquisition through ferric-siderophore receptors.However, production of siderophores is an energetically expensive process and issusceptible to interference by other bacteria. Therefore, strains may achieve fastergrowth by fecA-mediated iron acquisition than by siderophore-mediated acquisition.Levels of citrate and lactoferrin in the milk of dairy cattle vary depending on the timeof lactation (49). Citrate levels are highest relative to those of lactoferrin early inlactation, a time at which cattle are most susceptible to severe mastitis. Later inlactation the levels of citrate fall, and typically mastitis is less severe. It is possible thatutilization of ferric citrate as an iron source contributes to the propensity for severemastitis early in lactation, but the increased energy costs associated with using lacto-ferrin reduce bacterial growth rates later in the lactation cycle, tipping the balancetoward resolution of infection and milder disease.

While the majority of mastitis-associated strains may be fitter in the mammary glandenvironment because they express FecA, it is clearly not a universal requirement.Substantial variation exists among ExPEC isolates even within the same niche, and theemergence of tropism for mammary glands has likely evolved among many separatelineages. Epidemiological and experimental approaches aimed at identifying genes thatexplain the properties of MPEC are unlikely to identify any single ubiquitous locus (15).Rather, like other ExPEC types (79, 80), there may exist a spectrum of overlappingvirulence gene requirements. The necessity of any single gene for survival in mammaryglands may depend on the genetic background of the individual strain. Such variabilityshould be considered in the development of therapeutic strategies that will be broadlyeffective in the treatment of E. coli mastitis.

MATERIALS AND METHODSBacterial strains and growth conditions. E. coli strains (Table 1) were generously supplied by Paolo

Moroni (Cornell University Animal Health Diagnostic Center, Ithaca, NY). They were isolated fromindividual quarter milk samples from cattle with clinical mastitis. Putative E. coli bacteria were identifiedbased on colony morphology on blood and MacConkey agar plates, followed by potassium hydroxide,cytochrome oxidase, citrate, ornithine decarboxylase, lysine, motility, and indole biochemical tests. E. colistrains were routinely grown in Luria-Bertani (LB) medium at 37°C. To select for mutant strains or carriageof plasmids, growth medium was supplemented with kanamycin (50 �g/ml), chloramphenicol (10�g/ml), or ampicillin (100 �g/ml) as appropriate. For milk cultures, whole, unpasteurized cow’s milk wasobtained from a local supplier and used immediately or stored at �80°C until use. Mouse milk wasobtained as described previously (81) and used immediately after collection.

Phylogroup analysis of the isolated E. coli strains was performed as described by Clermont et al. (82).Multiplex PCR products were separated on agarose gels, and carriage of the genes chuA and yjaA and theDNA fragment TspE4 was determined. Primer sequences used in this study are given in Table 2.

G. mellonella infections. G. mellonella larvae were purchased from Best Bet, Inc. (Blackduck, MN),stored at 15°C in the dark, and used within 2 weeks. An overnight culture of bacteria was subculturedand grown to an absorbance of 1.0 at 600 nm and diluted in phosphate-buffered saline (PBS). Theconcentration of each inoculum was determined by serial dilution and colony counting after 24 h ofgrowth on LB agar plates. Larvae without any evidence of melanization were selected and injectedthrough the left hindmost proleg with 10 �l of the inoculum (containing between 102 and 105 CFU) usinga Hamilton 701RN syringe and a 30-gauge needle. Control larvae were injected with 10 �l of sterile PBS.The larvae were incubated at 37°C, and survival was monitored at the end of a 12-h period or at intervalsover 72-h period.

Ethics statement. Mouse experiments were performed in accordance with the recommendationsfound in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (83). Theprotocol was reviewed and approved by the Institutional Animal Care and Use Committee of BrighamYoung University (protocol no. 160302).

Mouse infections. Lactating BALB/c mice between 9 and 12 weeks of age were used in allexperiments. Lactating mothers 10 to 11 days postpartum were chosen for all experiments. Mice wereinfected based on the method described by Brouillette and Malouin (84) with slight modifications. Briefly,mice were anesthetized using 75 to 100 �l of a ketamine-xylazine solution. An overnight culture ofbacteria was subcultured and grown to an absorbance of 1.0 at 600 nm and diluted in PBS. Theconcentration of each inoculum was determined by serial dilution and colony counting after 24 h growthon LB agar plates. A 50-�l volume of bacteria (250 CFU) in PBS was then injected directly through theteat canal into the ductal network of the L4 and R4 (fourth on the left and fourth on the right,respectively) mammary glands using a Hamilton model 1705TLL syringe and a 33-gauge needle with abeveled end. Pups were removed for 1 to 2 h after injections and then were returned. Control glandswere inoculated with 50 �l of sterile PBS in both the L4 and R4 glands. Mice were monitored for 24 h,

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 11

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

and tissue was subsequently harvested. Bacterial load in the mammary gland and spleen was determinedby homogenizing the tissue in 1 ml of PBS and performing serial dilutions and colony counting after24 h growth on LB agar plates.

M12 genome sequencing, assembly, and annotation. Total DNA from strain M12 was isolatedusing a ZR Fungal/Bacterial DNA MiniPrep kit (Zymoresearch). The DNA was sheared and sequenced atthe University of Southern California NextGen Sequencing Core. Illumina paired-end reads of 250 bpwere generated on MiSeq, version 2, sequencer. Contigs were built from these reads using the Velvetshort read sequence assembler (85). The contigs were then ordered with Mauve using the E. coli K-12sequence as a reference (86). The partially assembled genome was annotated using a RAST onlineautomated annotation service (87, 88).

Gene deletions and complementation. Gene deletions of kpsCS and fecA were generated vialambda Red recombination in strain M12 carrying the plasmid pKD46 (89). Gene replacement constructswere created by PCR using pRE112 as a template to amplify the chloramphenicol resistance gene, cat,with 50 bp of homology to the target genomic sites. Bacteria expressing the recombinase enzymes wereelectroporated with 200 to 500 ng of purified DNA, and potential mutants were selected by plating onLB medium containing chloramphenicol. Potential mutants were then screened by PCR using primersflanking the recombination site and also with primers internal to the kpsCS or fecA genes. To complement

TABLE 2 Primers and plasmids used in this study

Name Sequence (5=–3=) or descriptiona Purpose

PrimersTspE4C2.2 CGCGCCAACAAAGTATTACG Phylogroup analysisTspE4C2.1 GAGTAATGTCGGGGCATTCAYjaA.2 TGGAGAATGCGTTCCTCAACYjaA.1 TGAAGTGTCAGGAGACGCTGChuA.2 TGCCGCCAGTACCAAAGACAChuA.1 GACGAACCAACGGTCAGGATfecA-Cm F TTCTCGTTCGACTCATAGCTGAACACAACAAAAATGATGATGGGGAAGGTGTTGATCGGCACGTAAGAGG Knockout of fecAfecA-Cm R CAACATAATCACATTCCAGCTAAAAGCCCGGCAAGCCGGGCGTTAACACAAAAATTACGCCCCGCCCTGfecA F ATGACGCCGTTACGCGTTTT Complementation of fecAfecA R TCAGAACTTCAACGACCCCTkps-Cm R GTTCACAGAGACAACATGTATTTATATACGGGATCGAAAGGGATTCTTGCCAAAATTACGCCCCGCCCTG Knockout of kpsCSkps-Cm F TCGCTGCGGTTGTTGGCTGATTGAGTAACCTGAAACGCCCATGAAAACCAGTTGATCGGCACGTAAGAGGkps R TTTTGTAACACTGACTGAATCGGC Complementation of kpsCSkps F CACATTCTGGCTGTACGAAAAAGTrssA 3 F CGAAGCGACGGGAACAATTT qPCR of housekeeping generssA 3 R GATGGATCTCTCCTGGCAGChcaT 2 F CTTTTCCGCCGTTGTAGTGChcaT 2 R ACCACTATCAACCACGGCAAfecA qF GACACCTACGGCAATCTGGTA qPCR of target genefecA qR CTGGACTGGAAATCGCTGTTCfepA F CTACAGTAAAGGTCAGGGCTGfepA R CAAGGAGATTGGTCTGGAGTTCfhuE F ATAGAGGTATAGCTGGCGTAGGfhuE R GTAAGTCAGCGTATCAACCCGsitA F CATATCCCGGCAGTCTTTAGCsitA R GCTCTATGTCGATTCCCTGAG1TN CTGACCCGGTCGAC Binds slightly back from the transposon end1OLIGOG CAGACGTGTGCTCTTCCGATCGGGGGGGGGGG Binds the C tail, adds part of the index primer

binding site2TNAnn AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNTCGAGAT

GTGTATAAGAGACAGAdds Illumina adapter and variable numbers of

random (N) bases to increase read diversityamong clusters in Illumina sequencing

2TNBnn AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNTCGAGATGTGTATAAGAGACAG

2TNCnn AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNTCGAGATGTGTATAAGAGACAG

2TNDnn AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNTCGAGATGTGTATAAGAGACAG

BAR01 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Adds Illumina adapter and incorporates barcode toidentify samples on multiplexed lanes

BAR02 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGBAR03 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGBAR04 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGBAR05 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGBAR06 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGBAR07 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGBAR08 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGBAR09 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGBAR10 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG

PlasmidspRE112 Source of chloramphenicol resistance gene for creating knockout strainspKD46 Lambda Red recombination plasmidpJET1.2 Cloning vector for creating complemented strainspJG714 Tn5 delivery plasmid for creating transposon mutant librariespMO1 Complementation plasmid containing kpsSC genespMO2 Complementation plasmid containing fecABCDE genes

aItalicized sequences are complementary to the chloramphenicol resistance gene from pRE112.

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 12

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

the mutations, the fecABCDE or kpsCS genes were PCR amplified and cloned into the multicopy plasmidpJET2.1. The resulting plasmids were then used to transform the mutant strains.

Tn-seq screens. The experimental workflow for the Tn-seq screens is outlined in Fig. S3 in thesupplemental material. The M12 mutant library was created by biparental mating with the diamin-opimelic acid (DAP) auxotroph E. coli MFDpir harboring plasmid pJG714, which contains a Tn5 trans-poson cassette in which the kanamycin resistance gene points out one side and the Salmonella Ptrp

promoter points out the other. Donor and recipient bacteria were spotted on LB agar supplemented withDAP for 2 h, after which the mixture was spread onto extra-large plates of LB agar containing kanamycin(50 �g/ml) without DAP. Separate colonies from 40 plates containing 10,000 independent colonies werethen pooled to create a library of strain M12 consisting of �400,000 unique transposon insertionmutants. The library was frozen in 1-ml aliquots of LB broth with 15% glycerol for Tn-seq screens.

The transposon library was subcultured 1:10 into fresh LB broth and allowed to recover for 1 h beforeTn-seq screens in LB broth, milk, G. mellonella, mammary gland, and spleens. For in vitro conditions, 4 �108 CFU were inoculated into 100 ml of unpasteurized cow’s milk or LB broth in duplicates and grownfor 12 h and then diluted 1:10 into fresh LB broth and grown for an additional 8 h. Bacteria were thenharvested and frozen in LB broth–15% glycerol. For in vivo conditions, 5,000 CFU were injected into 2,000larvae, and 106 CFU were injected into the L4 and R5 mammary glands of six mice and incubated for 24h. The larvae, mammary glands, and spleens were harvested, divided equally into biological duplicates,and homogenized in PBS. The homogenates were inoculated into LB broth containing kanamycin andgrown for 8 h, harvested, and frozen in LB broth containing 15% glycerol.

DNA preparation and Illumina sequencing. Cells from the input pool (LB broth) and output pools(milk, larvae, mammary glands, and spleen) were pelleted, and genomic DNA was extracted using a ZRFungal/Bacterial DNA MiniPrep kit (Zymoresearch). Genomic DNA (150 ng) was digested using double-stranded DNA (dsDNA) Fragmentase (NEB) for exactly 12 min to create fragments that were between 500bp and 3,000 bp. Genomic DNA fragments were isolated and cleaned using a QIAprep Spin Miniprep kit(Qiagen). To facilitate the PCR amplification of transposon insertion junctions, cytosine was added to theends of the fragments using terminal transferase (NEB). C-tailed transposon junctions were PCR amplified(Phusion) for 15 cycles, and Illumina adapters with barcodes were added by an additional 20 cycles withan extension time of 20 s to generate products between 150 and 700 bp. The PCR products were columnpurified prior to sequencing. Primers used to amplify transposon junction sites and add Illuminasequencing adapters with barcodes are listed in Table 2. The 10 DNA samples with their unique barcodeswere pooled with the same concentrations based on measurements from a NanoDrop spectrophotom-eter (ThermoFisher).

Tn-seq data analysis. Data analysis was performed using the sequence alignment tool TnSeqPipeline (90) and consisted of mapping the transposon back to the M12 reference genome usingBowtie2, read normalization, and the removal of reads located at the edges of genes to ensure thatfunctional genes are not included in downstream analyses (91). Raw count tables for each genegenerated by TnSeq Pipeline were analyzed by the DESeq package in R. The fold change (i.e., ratio ofinput/output read counts) values were log2 transformed, and a P value was calculated using a negativebinomial distribution performed by DESeq. Candidate genes identified to have a fitness cost underexperimental conditions needed to pass two criteria: a log2-fold change of �2 or less and a P value of0.05 or less. Additionally, genes that were normalized for length that had few or no insertions werecategorized as putative essential genes.

RNA isolation and qPCR. Bacteria were grown overnight in LB broth and then subcultured toexponential phase (A600 of 1.0). Washed bacterial cells were then transferred to either unpasteurizedwhole cow’s milk or mouse milk or into LB broth at a concentration of 108 CFU/ml and incubated for 30min at 37°C. Milk samples were diluted 5-fold into cold PBS, pelleted, and resuspended in cold PBS. Thesamples were then diluted 5-fold in RNAlater (ThermoFisher) and stored at �80°C. RNA was isolatedusing an rBAC Mini total RNA kit (IBI Scientific) according to the manufacturer’s instructions. The integrityof the isolated RNA was verified by gel electrophoresis. The RNA was used to make cDNA using aProtoScript II First Strand cDNA synthesis kit (NEB). Quantitative PCR (qPCR) primers specific for eachgene were designed to give 100- to 150-bp products (Table 2). Reaction mixtures for qPCR consisted of2� Sybr Green master mix and High ROX master mix (Genesee Scientific) with 3 �M (each) forward andreverse primers, and reactions were performed using a StepOne real-time PCR system. The cyclingconditions were as follows: 95°C for 15 min followed by 40 cycles of 95°C for 15 s and then 60°C for 1min. A melt curve analysis was performed to confirm the specificity of the PCR amplification. Theresulting threshold cycle (CT) values were normalized as described by Vandesompele et al. (92) to thestably expressed genes rssA and hcaT. The fold change in expression levels of the iron genes in milkrelative to those in the LB cultures was determined using the comparative ΔΔCT values.

Capsule isolation and staining. Capsule production was visualized as previously described (93).Briefly, bacteria were pelleted from 5 ml of saturated overnight cultures grown in LB broth. Thebacterial cells were then resuspended in 1 ml of PBS and heated to 55°C for 1 h. The bacteria wereremoved by centrifugation, and the supernatants were treated with proteinase K for 1 h at 59°C. Thesamples were concentrated using 20-kDa-molecular-mass-cutoff Millipore filters, followed by elec-trophoresis on 10% SDS-polyacrylamide gels and staining with 0.125% alcian blue dye in 40%ethanol–5% acetic acid.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02190-17.

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 13

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

SUPPLEMENTAL FILE 1, PDF file, 0.8 MB.SUPPLEMENTAL FILE 2, XLSX file, 1.2 MB.SUPPLEMENTAL FILE 3, XLSX file, 0.1 MB.SUPPLEMENTAL FILE 4, XLSX file, 0.1 MB.

ACKNOWLEDGMENTSWe gratefully acknowledge the assistance provided by DNA sequencing facility

experts (Charles Nicolet, University of Southern California, and Ed Wilcox, BrighamYoung University) with sample preparation. We thank Paolo Moroni (Cornell) forproviding strains. We also thank members of the Wilson and Erickson laboratoriesfor their helpful discussions.

REFERENCES1. Blum SE, Heller ED, Leitner G. 2014. Long-term effects of Escherichia coli

mastitis. Vet J 201:72–77. https://doi.org/10.1016/j.tvjl.2014.04.008.2. Barbieri NL, de Oliveira AL, Tejkowski TM, Pavanelo DB, Rocha DA, Matter LB,

Callegari-Jacques SM, de Brito BG, Horn F. 2013. Genotypes and pathoge-nicity of cellulitis isolates reveal traits that modulate APEC virulence. PLoSOne 8:e72322. https://doi.org/10.1371/journal.pone.0072322.

3. Shpigel NY, Elazar S, Rosenshine I. 2008. Mammary pathogenic Esche-richia coli. Curr Opin Microbiol 11:60 – 65. https://doi.org/10.1016/j.mib.2008.01.004.

4. Blum S, Heller ED, Krifucks O, Sela S, Hammer-Muntz O, Leitner G. 2008.Identification of a bovine mastitis Escherichia coli subset. Vet Microbiol132:135–148. https://doi.org/10.1016/j.vetmic.2008.05.012.

5. Blum SE, Leitner G. 2013. Genotyping and virulence factors assessmentof bovine mastitis Escherichia coli. Vet Microbiol 163:305–312. https://doi.org/10.1016/j.vetmic.2012.12.037.

6. Fernandes JB, Zanardo LG, Galvao NN, Carvalho IA, Nero LA, Moreira MA.2011. Escherichia coli from clinical mastitis: serotypes and virulence factors.J Vet Diagn Invest 23:1146–1152. https://doi.org/10.1177/1040638711425581.

7. Liu Y, Liu G, Liu W, Liu Y, Ali T, Chen W, Yin J, Han B. 2014. Phylogeneticgroup, virulence factors and antimicrobial resistance of Escherichia coliassociated with bovine mastitis. Res Microbiol 165:273–277. https://doi.org/10.1016/j.resmic.2014.03.007.

8. Srinivasan V, Gillespie BE, Lewis MJ, Nguyen LT, Headrick SI, SchukkenYH, Oliver SP. 2007. Phenotypic and genotypic antimicrobial resistancepatterns of Escherichia coli isolated from dairy cows with mastitis. VetMicrobiol 124:319 –328. https://doi.org/10.1016/j.vetmic.2007.04.040.

9. Suojala L, Pohjanvirta T, Simojoki H, Myllyniemi AL, Pitkala A, PelkonenS, Pyorala S. 2011. Phylogeny, virulence factors and antimicrobial sus-ceptibility of Escherichia coli isolated in clinical bovine mastitis. VetMicrobiol 147:383–388. https://doi.org/10.1016/j.vetmic.2010.07.011.

10. Wenz JR, Barrington GM, Garry FB, Ellis RP, Magnuson RJ. 2006. Esche-richia coli isolates’ serotypes, genotypes, and virulence genes and clin-ical coliform mastitis severity. J Dairy Sci 89:3408 –3412. https://doi.org/10.3168/jds.S0022-0302(06)72377-3.

11. Burvenich C, Van Merris V, Mehrzad J, Diez-Fraile A, Duchateau L. 2003.Severity of E. coli mastitis is mainly determined by cow factors. Vet Res34:521–564. https://doi.org/10.1051/vetres:2003023.

12. Blum SE, Heller ED, Jacoby S, Krifucks O, Leitner G. 2017. Comparison ofthe immune responses associated with experimental bovine mastitiscaused by different strains of Escherichia coli. J Dairy Res 84:190 –197.https://doi.org/10.1017/S0022029917000206.

13. Blum SE, Heller ED, Sela S, Elad D, Edery N, Leitner G. 2015. Genomic andphenomic study of mammary pathogenic Escherichia coli. PLoS One10:e0136387. https://doi.org/10.1371/journal.pone.0136387.

14. Richards VP, Lefebure T, Pavinski Bitar PD, Dogan B, Simpson KW, SchukkenYH, Stanhope MJ. 2015. Genome based phylogeny and comparativegenomic analysis of intra-mammary pathogenic Escherichia coli. PLoS One10:e0119799. https://doi.org/10.1371/journal.pone.0119799.

15. Leimbach A, Poehlein A, Vollmers J, Gorlich D, Daniel R, Dobrindt U.2017. No evidence for a bovine mastitis Escherichia coli pathotype. BMCGenomics 18:359. https://doi.org/10.1186/s12864-017-3739-x.

16. Goldstone RJ, Harris S, Smith DG. 2016. Genomic content typifying aprevalent clade of bovine mastitis-associated Escherichia coli. Sci Rep6:30115. https://doi.org/10.1038/srep30115.

17. Kempf F, Slugocki C, Blum SE, Leitner G, Germon P. 2016. Genomic

comparative study of bovine mastitis Escherichia coli. PLoS One 11:e0147954. https://doi.org/10.1371/journal.pone.0147954.

18. Hettinga K, van Valenberg H, de Vries S, Boeren S, van Hooijdonk T, vanArendonk J, Vervoort J. 2011. The host defense proteome of human andbovine milk. PLoS One 6:e19433. https://doi.org/10.1371/journal.pone.0019433.

19. Mansson HL. 2008. Fatty acids in bovine milk fat. Food Nutr Res 52:10.3402/fnr.v52i0.1821.

20. McDermott A, De Marchi M, Berry DP, Visentin G, Fenelon MA, Lopez-Villalobos N, McParland S. 2017. Cow and environmental factors associ-ated with protein fractions and free amino acids predicted using mid-infrared spectroscopy in bovine milk. J Dairy Sci 100:6272– 6284. https://doi.org/10.3168/jds.2016-12410.

21. Lippolis JD, Brunelle BW, Reinhardt TA, Sacco RE, Nonnecke BJ, Dogan B,Simpson K, Schukken YH. 2014. Proteomic analysis reveals protein ex-pression differences in Escherichia coli strains associated with persistentversus transient mastitis. J Proteomics 108:373–381. https://doi.org/10.1016/j.jprot.2014.06.008.

22. Lippolis JD, Brunelle BW, Reinhardt TA, Sacco RE, Thacker TC, Looft TP,Casey TA. 2016. Differential gene expression of three mastitis-causingEscherichia coli strains grown under planktonic, swimming, and swarm-ing culture conditions. mSystems 1:e00064-16. https://doi.org/10.1128/mSystems.00064-16.

23. Alghoribi M, Gibreel TM, Dodgson AR, Beatson SA, Upton M. 2014.Galleria mellonella infection model demonstrates high lethality of ST69and ST127 uropathogenic E. coli. PLoS One 9:e101547. https://doi.org/10.1371/journal.pone.0101547.

24. Leuko S, Raivio TL. 2012. Mutations that impact the enteropathogenicEscherichia coli Cpx envelope stress response attenuate virulence inGalleria mellonella. Infect Immun 80:3077–3085. https://doi.org/10.1128/IAI.00081-12.

25. Erickson DL, Russell CW, Johnson KL, Hileman T, Stewart RM. 2011. PhoPand OxyR transcriptional regulators contribute to Yersinia pestis viru-lence and survival within Galleria mellonella. Microb Pathog 51:389 –395.https://doi.org/10.1016/j.micpath.2011.08.008.

26. van Opijnen T, Camilli A. 2013. Transposon insertion sequencing: a newtool for systems-level analysis of microorganisms. Nat Rev Microbiol11:435–552. https://doi.org/10.1038/nrmicro3033.

27. Fu Y, Waldor MK, Mekalanos JJ. 2013. Tn-Seq analysis of Vibrio choleraeintestinal colonization reveals a role for T6SS-mediated antibacterialactivity in the host. Cell Host Microbe 14:652– 663. https://doi.org/10.1016/j.chom.2013.11.001.

28. Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ. 2013. Identification ofT6SS-dependent effector and immunity proteins by Tn-seq in Vibriocholerae. Proc Natl Acad Sci U S A 110:2623–2628. https://doi.org/10.1073/pnas.1222783110.

29. Dogan B, Rishniw M, Bruant G, Harel J, Schukken YH, Simpson KW. 2012.Phylogroup and lpfA influence epithelial invasion by mastitis associatedEscherichia coli. Vet Microbiol 159:163–170. https://doi.org/10.1016/j.vetmic.2012.03.033.

30. Gomi R, Matsuda T, Matsumura Y, Yamamoto M, Tanaka M, Ichiyama S,Yoneda M. 2017. Whole-genome analysis of antimicrobial-resistant andextraintestinal pathogenic Escherichia coli in river water. Appl EnvironMicrobiol 83:e02703-16. https://doi.org/10.1128/AEM.02703-16.

31. Gibreel TM, Dodgson AR, Cheesbrough J, Fox AJ, Bolton FJ, Upton M.2012. Population structure, virulence potential and antibiotic suscepti-

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 14

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

bility of uropathogenic Escherichia coli from northwest England. J An-timicrob Chemother 67:346 –356. https://doi.org/10.1093/jac/dkr451.

32. Bert F, Johnson JR, Ouattara B, Leflon-Guibout V, Johnston B, Marcon E,Valla D, Moreau R, Nicolas-Chanoine MH. 2010. Genetic diversity andvirulence profiles of Escherichia coli isolates causing spontaneous bac-terial peritonitis and bacteremia in patients with cirrhosis. J Clin Micro-biol 48:2709 –2714. https://doi.org/10.1128/JCM.00516-10.

33. Blanco J, Mora A, Mamani R, Lopez C, Blanco M, Dahbi G, Herrera A,Blanco JE, Alonso MP, Garcia-Garrote F, Chaves F, Orellana MA, Martinez-Martinez L, Calvo J, Prats G, Larrosa MN, Gonzalez-Lopez JJ, Lopez-CereroL, Rodriguez-Bano J, Pascual A. 2011. National survey of Escherichia colicausing extraintestinal infections reveals the spread of drug-resistantclonal groups O25b:H4-B2-ST131, O15:H1-D-ST393 and CGA-D-ST69with high virulence gene content in Spain. J Antimicrob Chemother66:2011–2021. https://doi.org/10.1093/jac/dkr235.

34. Robinson DG, Chen W, Storey JD, Gresham D. 2014. Design and analysis ofBar-seq experiments. G3 4:11–18. https://doi.org/10.1534/g3.113.008565.

35. Anders S, Huber W. 2010. Differential expression analysis for sequencecount data. Genome Biol 11:R106. https://doi.org/10.1186/gb-2010-11-10-r106.

36. Subashchandrabose S, Smith SN, Spurbeck RR, Kole MM, Mobley HL.2013. Genome-wide detection of fitness genes in uropathogenic Esch-erichia coli during systemic infection. PLoS Pathog 9:e1003788. https://doi.org/10.1371/journal.ppat.1003788.

37. Samant S, Lee H, Ghassemi M, Chen J, Cook JL, Mankin AS, Neyfakh AA.2008. Nucleotide biosynthesis is critical for growth of bacteria in humanblood. PLoS Pathog 4:e37. https://doi.org/10.1371/journal.ppat.0040037.

38. Zhao G, Ceci P, Ilari A, Giangiacomo L, Laue TM, Chiancone E, ChasteenND. 2002. Iron and hydrogen peroxide detoxification properties ofDNA-binding protein from starved cells. A ferritin-like DNA-bindingprotein of Escherichia coli. J Biol Chem 277:27689 –27696.

39. Skorko-Glonek J, Zurawa-Janicka D, Koper T, Jarzab M, Figaj D, Glaza P,Lipinska B. 2013. HtrA protease family as therapeutic targets. Curr PharmDes 19:977–1009. https://doi.org/10.2174/1381612811319060003.

40. Redford P, Welch RA. 2006. Role of sigma E-regulated genes in Esche-richia coli uropathogenesis. Infect Immun 74:4030 – 4038. https://doi.org/10.1128/IAI.01984-05.

41. Akiyama Y, Kanehara K, Ito K. 2004. RseP (YaeL), an Escherichia coli RIPprotease, cleaves transmembrane sequences. EMBO J 23:4434 – 4442.https://doi.org/10.1038/sj.emboj.7600449.

42. Mehta HH, Liu Y, Zhang MQ, Spiro S. 2015. Genome-wide analysis of theresponse to nitric oxide in uropathogenic Escherichia coli CFT073. Mi-crob Genom 1:e000031. https://doi.org/10.1099/mgen.0.000031.

43. Willis LM, Whitfield C. 2013. Structure, biosynthesis, and function of bacterialcapsular polysaccharides synthesized by ABC transporter-dependent path-ways. Carbohydr Res 378:35–44. https://doi.org/10.1016/j.carres.2013.05.007.

44. Willis LM, Whitfield C. 2013. KpsC and KpsS are retaining 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) transferases involved in synthesis ofbacterial capsules. Proc Natl Acad Sci U S A 110:20753–20758. https://doi.org/10.1073/pnas.1312637110.

45. Garenaux A, Caza M, Dozois CM. 2011. The ins and outs of siderophoremediated iron uptake by extra-intestinal pathogenic Escherichia coli. VetMicrobiol 153:89 –98. https://doi.org/10.1016/j.vetmic.2011.05.023.

46. Staudenmaier H, Van Hove B, Yaraghi Z, Braun V. 1989. Nucleotidesequences of the fecBCDE genes and locations of the proteins suggest aperiplasmic-binding-protein-dependent transport mechanism for iro-n(III) dicitrate in Escherichia coli. J Bacteriol 171:2626 –2633. https://doi.org/10.1128/jb.171.5.2626-2633.1989.

47. Wyatt GR. 1961. The biochemistry of insect hemolymph. Annu Rev Entomol6:75–102. https://doi.org/10.1146/annurev.en.06.010161.000451.

48. Supplee GC, Bellis B. 1921. Citric acid content of milk and milk products.J Biol Chem 48:453– 461.

49. Hyvonen P, Haarahiltunen T, Lehtolainen T, Heikkinen J, Isomaki R, PyoralaS. 2010. Concentrations of bovine lactoferrin and citrate in milk duringexperimental endotoxin mastitis in early- versus late-lactating dairy cows. JDairy Res 77:474–480. https://doi.org/10.1017/S0022029910000579.

50. Wagegg W, Braun V. 1981. Ferric citrate transport in Escherichia coli requiresouter membrane receptor protein FecA. J Bacteriol 145:156–163.

51. Yue WW, Grizot S, Buchanan SK. 2003. Structural evidence for iron-freecitrate and ferric citrate binding to the TonB-dependent outer mem-brane transporter FecA. J Mol Biol 332:353–368. https://doi.org/10.1016/S0022-2836(03)00855-6.

52. Enz S, Braun V, Crosa JH. 1995. Transcription of the region encoding the

ferric dicitrate-transport system in Escherichia coli: similarity betweenpromoters for fecA and for extracytoplasmic function sigma factors.Gene 163:13–18. https://doi.org/10.1016/0378-1119(95)00380-O.

53. Angerer A, Braun V. 1998. Iron regulates transcription of the Escherichiacoli ferric citrate transport genes directly and through the transcriptioninitiation proteins. Arch Microbiol 169:483– 490. https://doi.org/10.1007/s002030050600.

54. Escolar L, Perez-Martin J, de Lorenzo V. 1998. Coordinated repression invitro of the divergent fepA-fes promoters of Escherichia coli by the ironuptake regulation (Fur) protein. J Bacteriol 180:2579 –2582.

55. Runyen-Janecky L, Dazenski E, Hawkins S, Warner L. 2006. Role andregulation of the Shigella flexneri Sit and MntH systems. Infect Immun74:4666 – 4672. https://doi.org/10.1128/IAI.00562-06.

56. Lin J, Hogan JS, Smith KL. 1999. Antigenic homology of the inducibleferric citrate receptor (FecA) of coliform bacteria isolated from herdswith naturally occurring bovine intramammary infections. Clin DiagnLab Immunol 6:966 –969.

57. Faulkner A, Peaker M. 1982. Reviews of the progress of dairy science:secretion of citrate into milk. J Dairy Res 49:159 –169. https://doi.org/10.1017/S002202990002224X.

58. Tourret J, Willing BP, Croxen MA, Dufour N, Dion S, Wachtel S, DenamurE, Finlay BB. 2016. Small intestine early innate immunity response duringintestinal colonization by Escherichia coli depends on its extra-intestinalvirulence Status. PLoS One 11:e0153034. https://doi.org/10.1371/journal.pone.0153034.

59. Lefort A, Panhard X, Clermont O, Woerther PL, Branger C, Mentre F,Fantin B, Wolff M, Denamur E, COLIBAFI Group. 2011. Host factors andportal of entry outweigh bacterial determinants to predict the severity ofEscherichia coli bacteremia. J Clin Microbiol 49:777–783. https://doi.org/10.1128/JCM.01902-10.

60. Gadea Mdel P, Deza N, Mota MI, Carbonari C, Robatto M, D’Astek B,Balseiro V, Bazet C, Rugnitz E, Livrelli V, Schelotto F, Rivas M, Varela G.2012. Two cases of urinary tract infection caused by Shiga toxin-producing Escherichia coli O157:H7 strains. Rev Argent Microbiol 44:94 –96.

61. Kim BS, Lee CS, Yun CY, Yeo SM, Park WM, Kim HR. 2001. Characteriza-tion and immunological analysis of ferritin from the hemolymph ofGalleria mellonella. Comp Biochem Physiol A Mol Integr Physiol 129:501–509. https://doi.org/10.1016/S1095-6433(01)00287-2.

62. Brown SE, Howard A, Kasprzak AB, Gordon KH, East PD. 2009. A pep-tidomics study reveals the impressive antimicrobial peptide arsenal ofthe wax moth Galleria mellonella. Insect Biochem Mol Biol 39:792– 800.https://doi.org/10.1016/j.ibmb.2009.09.004.

63. Wu G, Liu Y, Ding Y, Yi Y. 2016. Ultrastructural and functional character-ization of circulating hemocytes from Galleria mellonella larva: Cell typesand their role in the innate immunity. Tissue Cell 48:297–304. https://doi.org/10.1016/j.tice.2016.06.007.

64. Zdybicka-Barabas A, Mak P, Jakubowicz T, Cytrynska M. 2014. Lysozymeand defense peptides as suppressors of phenoloxidase activity in Gal-leria mellonella. Arch Insect Biochem Physiol 87:1–12. https://doi.org/10.1002/arch.21175.

65. Gebhardt MJ, Gallagher LA, Jacobson RK, Usacheva EA, Peterson LR,Zurawski DV, Shuman HA. 2015. Joint transcriptional control of virulenceand resistance to antibiotic and environmental stress in Acinetobacterbaumannii. mBio 6:e01660-15. https://doi.org/10.1128/mBio.01660-15.

66. Mortensen BL, Rathi S, Chazin WJ, Skaar EP. 2014. Acinetobacter bau-mannii response to host-mediated zinc limitation requires the transcrip-tional regulator Zur. J Bacteriol 196:2616 –2626. https://doi.org/10.1128/JB.01650-14.

67. Liu JZ, Jellbauer S, Poe AJ, Ton V, Pesciaroli M, Kehl-Fie TE, Restrepo NA,Hosking MP, Edwards RA, Battistoni A, Pasquali P, Lane TE, Chazin WJ,Vogl T, Roth J, Skaar EP, Raffatellu M. 2012. Zinc sequestration by theneutrophil protein calprotectin enhances Salmonella growth in the in-flamed gut. Cell Host Microbe 11:227–239. https://doi.org/10.1016/j.chom.2012.01.017.

68. Urban CF, Ermert D, Schmid M, Abu-Abed U, Goosmann C, Nacken W,Brinkmann V, Jungblut PR, Zychlinsky A. 2009. Neutrophil extracellulartraps contain calprotectin, a cytosolic protein complex involved in hostdefense against Candida albicans. PLoS Pathog 5:e1000639. https://doi.org/10.1371/journal.ppat.1000639.

69. Elazar S, Gonen E, Livneh-Kol A, Rosenshine I, Shpigel NY. 2010. Essentialrole of neutrophils but not mammary alveolar macrophages in a murinemodel of acute Escherichia coli mastitis. Vet Res 41:53. https://doi.org/10.1051/vetres/2010025.

Fitness Factors of Mastitis-Associated E. coli Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 15

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from

70. Lippolis JD, Reinhardt TA, Goff JP, Horst RL. 2006. Neutrophil extracel-lular trap formation by bovine neutrophils is not inhibited by milk. VetImmunol Immunopathol 113:248 –255. https://doi.org/10.1016/j.vetimm.2006.05.004.

71. Addis MF, Pisanu S, Marogna G, Cubeddu T, Pagnozzi D, Cacciotto C,Campesi F, Schianchi G, Rocca S, Uzzau S. 2013. Production and releaseof antimicrobial and immune defense proteins by mammary epithelialcells following Streptococcus uberis infection of sheep. Infect Immun81:3182–3197. https://doi.org/10.1128/IAI.00291-13.

72. Russo TA, Liang Y, Cross AS. 1994. The presence of K54 capsular poly-saccharide increases the pathogenicity of Escherichia coli in vivo. J InfectDis 169:112–118. https://doi.org/10.1093/infdis/169.1.112.

73. Schneider G, Dobrindt U, Bruggemann H, Nagy G, Janke B, Blum-OehlerG, Buchrieser C, Gottschalk G, Emody L, Hacker J. 2004. The pathoge-nicity island-associated K15 capsule determinant exhibits a novel ge-netic structure and correlates with virulence in uropathogenic Esche-richia coli strain 536. Infect Immun 72:5993– 6001. https://doi.org/10.1128/IAI.72.10.5993-6001.2004.

74. Buckles EL, Wang X, Lane MC, Lockatell CV, Johnson DE, Rasko DA,Mobley HL, Donnenberg MS. 2009. Role of the K2 capsule in Escherichiacoli urinary tract infection and serum resistance. J Infect Dis 199:1689 –1697. https://doi.org/10.1086/598524.

75. Sarkar S, Ulett GC, Totsika M, Phan MD, Schembri MA. 2014. Role ofcapsule and O antigen in the virulence of uropathogenic Escherichiacoli. PLoS One 9:e94786. https://doi.org/10.1371/journal.pone.0094786.

76. Barrow PA, Hill AW. 1989. The virulence characteristics of strains of Esche-richia coli isolated from cases of bovine mastitis in England and Wales. VetMicrobiol 20:35–48. https://doi.org/10.1016/0378-1135(89)90005-9.

77. Takemura K, Hogan JS, Lin J, Smith KL. 2002. Efficacy of immunizationwith ferric citrate receptor FecA from Escherichia coli on induced coli-form mastitis. J Dairy Sci 85:774 –781. https://doi.org/10.3168/jds.S0022-0302(02)74135-0.

78. Takemura K, Hogan JS, Smith KL. 2003. Effect of immunoglobulin G fromcows immunized with ferric citrate receptor (FecA) on iron uptake byEscherichia coli. J Dairy Sci 86:133–137. https://doi.org/10.3168/jds.S0022-0302(03)73592-9.

79. Salipante SJ, Roach DJ, Kitzman JO, Snyder MW, Stackhouse B, Butler-WuSM, Lee C, Cookson BT, Shendure J. 2015. Large-scale genomic sequenc-ing of extraintestinal pathogenic Escherichia coli strains. Genome Res25:119 –128. https://doi.org/10.1101/gr.180190.114.

80. Wiles TJ, Norton JP, Smith SN, Lewis AJ, Mobley HL, Casjens SR, MulveyMA. 2013. A phyletically rare gene promotes the niche-specific fitness ofan E. coli pathogen during bacteremia. PLoS Pathog 9:e1003175. https://doi.org/10.1371/journal.ppat.1003175.

81. Wilson E, Butcher EC. 2004. CCL28 controls immunoglobulin (Ig)Aplasma cell accumulation in the lactating mammary gland and IgA

antibody transfer to the neonate. J Exp Med 200:805– 809. https://doi.org/10.1084/jem.20041069.

82. Clermont O, Bonacorsi S, Bingen E. 2000. Rapid and simple determina-tion of the Escherichia coli phylogenetic group. Appl Environ Microbiol66:4555– 4558. https://doi.org/10.1128/AEM.66.10.4555-4558.2000.

83. National Research Council. 2011. Guide for the care and use of labora-tory animals, 8th ed. National Academies Press, Washington, DC.

84. Brouillette E, Malouin F. 2005. The pathogenesis and control of Staph-ylococcus aureus-induced mastitis: study models in the mouse. MicrobesInfect 7:560 –568. https://doi.org/10.1016/j.micinf.2004.11.008.

85. Zerbino DR, Birney E. 2008. Velvet: algorithms for de novo short readassembly using de Bruijn graphs. Genome Res 18:821– 829. https://doi.org/10.1101/gr.074492.107.

86. Darling ACE, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple align-ment of conserved genomic sequence with rearrangements. GenomeRes 14:1394 –1403. https://doi.org/10.1101/gr.2289704.

87. Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, Olson R,Overbeek R, Parrello B, Pusch GD, Shukla M, Thomason JA, Stevens R,Vonstein V, Wattam AR, Xia FF. 2015. RASTtk: a modular and extensibleimplementation of the RAST algorithm for building custom annotationpipelines and annotating batches of genomes. Sci Rep 5:8365. https://doi.org/10.1038/srep08365.

88. Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards RA,Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia FF, Stevens R.2014. The SEED and the Rapid Annotation of microbial genomes usingSubsystems Technology (RAST). Nucleic Acids Res 42:D206 –D214.https://doi.org/10.1093/nar/gkt1226.

89. Murphy KC, Campellone KG. 2003. Lambda Red-mediated recombino-genic engineering of enterohemorrhagic and enteropathogenic E coli.BMC Mol Biol 4:11. https://doi.org/10.1186/1471-2199-4-11.

90. Arnold MFF, Shabab M, Penterman J, Boehme KL, Griffitts JS, Walker GC.2017. Genome-wide sensitivity analysis of the microsymbiont Sinorhizo-bium meliloti to symbiotically important, defensin-like host peptides.mBio 8:e01060-17. https://doi.org/10.1128/mBio.01060-17.

91. Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast andmemory-efficient alignment of short DNA sequences to the humangenome. Genome Biol 10:R25. https://doi.org/10.1186/gb-2009-10-3-r25.

92. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A,Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.Genome Biol 3:research0034.1-research0034.11. https://doi.org/10.1186/gb-2002-3-7-research0034.

93. Starr KF, Porsch EA, Heiss C, Black I, Azadi P, St Geme JW, 3rd. 2013.Characterization of the Kingella kingae polysaccharide capsule and ex-opolysaccharide. PLoS One 8:e75409. https://doi.org/10.1371/journal.pone.0075409.

Olson et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e02190-17 aem.asm.org 16

on August 6, 2020 by guest

http://aem.asm

.org/D

ownloaded from