Free Radical Biology & Medicine 47 (2009) 867–879

Contents lists available at ScienceDirect

Free Radical Biology & Medicine

j ourna l homepage: www.e lsev ie r.com/ locate / f reeradb iomed

Original Contribution

Nrf2 promotes neuronal cell differentiation

Fei Zhao a, Tongde Wu a, Alexandria Lau a, Tao Jiang a, Zheping Huang a, Xiao-Jun Wang a, Weimin Chen a,Pak Kin Wong b, Donna D. Zhang a,⁎a Department of Pharmacology and Toxicology, University of Arizona, Tucson, AZ 85721, USAb Department of Aerospace and Mechanical Engineering, University of Arizona, Tucson, AZ 85721, USA

⁎ Corresponding author. Fax: +1 520 626 2466.E-mail address: dzhang@pharmacy.arizona.edu (D.D

0891-5849/$ – see front matter © 2009 Elsevier Inc. Adoi:10.1016/j.freeradbiomed.2009.06.029

a b s t r a c t

a r t i c l e i n f o

Article history:Received 7 May 2009Revised 19 June 2009Accepted 22 June 2009Available online 30 June 2009

Keywords:Nrf2Keap1Oxidative stressNeuronal differentiationSH-SY5YNQO1Free radicals

The transcription factor Nrf2 has emerged as a master regulator of the endogenous antioxidant response,which is critical in defending cells against environmental insults and in maintaining intracellular redoxbalance. However, whether Nrf2 has any role in neuronal cell differentiation is largely unknown. In thisreport, we have examined the effects of Nrf2 on cell differentiation using a neuroblastoma cell line, SH-SY5Y.Retinoic acid (RA) and 12-O-tetradecanoylphorbol 13-acetate, two well-studied inducers of neuronaldifferentiation, are able to induce Nrf2 and its target gene NAD(P)H quinone oxidoreductase 1 in a dose- andtime-dependent manner. RA-induced Nrf2 up-regulation is accompanied by neurite outgrowth and aninduction of two neuronal differentiation markers, neurofilament-M and microtubule-associated protein 2.Overexpression of Nrf2 in SH-SY5Y cells promotes neuronal differentiation, whereas inhibition ofendogenous Nrf2 expression inhibited neuronal differentiation. More remarkably, the positive role of Nrf2in neuronal differentiation was verified ex vivo in primary neuron culture. Primary neurons isolated fromNrf2-null mice showed a retarded progress in differentiation, compared to those from wild-type mice.Collectively, our data demonstrate a novel role for Nrf2 in promoting neuronal cell differentiation, which willopen new perspectives for therapeutic uses of Nrf2 activators in patients with neurodegenerative diseases.

© 2009 Elsevier Inc. All rights reserved.

SH-SY5Y, a neuroblastoma cell line that is awell-establishedmodelsystem to study the initial phases of neuronal differentiation, waschosen to evaluate the possible role of Nrf2 in neuronal celldifferentiation. This cell line was derived from a subclone of a neuralcrest tumor of a child [1,2]. Several reagents, including retinoic acid(RA) and 12-O-tetradecanoylphorbol 13-acetate (TPA), have beenreported to induce differentiation of this cell line, as assessed by aneuron-like morphological change and increased expression ofneuronal differentiation markers, including neurofilaments andmicrotubule-associated protein 2 (MAP-2) [3–6]. A robust increasein the length of neurites was readily observed and can bemeasured byphase-contrast microscopic images after 4-day treatment with RA orTPA [3–6]. Although both RA and TPA are able to induce SH-SY5Y celldifferentiation, it is believed that the mechanistic actions or pathwaysinvolved are different for each compound. For example, the length ofneurite extension induced by TPA is generally shorter than thatinduced by RA [2,4,7,8].

Neurite outgrowth requires the interplay of all threemajor types ofprotein filaments that form the cytoskeleton: actin filaments,microtubules, and intermediate filaments. Precise regulation ofcytoskeletal dynamics is important for neurite outgrowth throughreorganization of cytoskeleton components. During neuronal differ-

. Zhang).

ll rights reserved.

entiation, microtubules form a bundle, whereas actin filamentsreorganize to produce the growth cone, followed by elongation andmaintenance of neurites through stabilization of microtubules.Neurofilament proteins, members of intermediate filaments specifi-cally expressed in neuronal cells, play many roles in neuriteoutgrowth, including protein trafficking, cellular motility, and main-taining neurite structures [9–11]. Neurofilaments represent majorcytoskeleton elements of neurons for both the central and theperipheral nervous systems. There are five classes of neurofilamentsthat are heteropolymers composed of three different subunits namedneurofilament-H (NF-H), neurofilament-M (NF-M), and neurofila-ment-L (NF-L) [12]. Expression of each class of neurofilamentschanges during different developmental stages. For instance, NF-Mand NF-L subunits are expressed early during embryonic neurogen-esis, whereas NF-H appears later during the postnatal period in rats[12,13]. In cultured SH-SY5Y cells, dynamic regulation of neurofila-ment expression has also been reported. For instance, both NF-H andNF-M are expressed in naïve cells and their expression is significantlyincreased after RA treatment [6,14]. In addition, increased phosphor-ylation of NF-H in the tail regionwas observed in SH-SY5Y cells after a5-day RA treatment [6]. According to in vitro studies, phosphorylationof neurofilaments, especially NF-H, decreased degradation of neuro-filaments by calpain [15,16]. In vivo, phosphorylated NF subunits areexpressed primarily in maturing neurites within the axonodendriticstructure of neurons. Furthermore, cytoskeleton proteins other than

868 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

neurofilaments are also known to be associated with the developmentof neurites during neuronal cell differentiation. MAPs are one class ofsuch proteins. Differentiation-inducing agents are able to regulate thedynamics of microtubules through increased expression and phos-phorylation of MAPs [17,18]. In primary neurons, MAP-2 preferentiallyassociates with the somatodendritic domain.

The central role of Nrf2 in cell survival has been well establishedover a decade of research. Nrf2 is activated in response to oxidativestress to induce the expression of an array of genes whose functionsare to counteract redox imbalance and to eliminate harmful reactivespecies [19–24]. NAD(P)H quinone oxidoreductase-1 (NQO1), gluta-mate cysteine ligase, glutathione peroxidase, thioredoxin, thioredoxinreductase, peroxiredoxin, heme oxygenase-1, glutathione S-transfer-ase, and multidrug resistance-associated proteins are a few examplesof well-characterized Nrf2-target genes [25–33]. Antioxidant-response elements (AREs) have been identified in the promoters ofthese genes and are required for activation of these genes by Nrf2 [34–36]. Recently, great progress has been made in understanding howNrf2 is able to activate the expression of the ARE-bearing genes inresponse to oxidative stress or chemopreventive compounds. Keap1, anegative regulator of Nrf2, is a substrate adaptor for the Cul3–E3ubiquitin ligase that constantly targets Nrf2 for ubiquitin-mediatedproteasomal degradation under the redox-balanced conditions tomaintain low constitutive levels of Nrf2 [37–39]. In response to Nrf2activators, the Keap1-dependent ubiquitination of Nrf2 is inhibited,resulting in stabilization of Nrf2 and its translocation to the nucleuswhere it forms a heterodimer with one of the small Maf proteins [37–39]. The Nrf2–Maf heterodimer then binds the ARE to activatetranscription. This Keap1-dependent regulation has been consideredthe primary control mechanism of the Nrf2 signaling pathway,although multiple levels of regulation may exist. Meanwhile, func-tional studies with Nrf2 have generated a growing body of literaturethat supports the protective role of Nrf2 against environmentaltoxicants and carcinogens. Cell-based studies have demonstrated thatsensitivity of cells to a vast majority of toxic chemicals is modulated byintracellular levels of Nrf2. Pretreatment of cells with small doses ofNrf2 activators enhances cell resistance to subsequent challenge withtoxic chemicals [40,41]. In vivo studies with Nrf2-null mice indicatethat these mice are highly susceptible to toxicants and carcinogens,compared to wild-type mice [42–48]. These pioneering studies haveprovided strong evidence that Nrf2 is critical in the cellular defensesystem and cell survival. Furthermore, the protective role of Nrf2against neurodegenerative diseases has been demonstrated incultured cell models and in animalmodels [49–54]. However, whetherNrf2 has any role in neuronal differentiation has not been investi-gated. In this study, using both overexpression and knockdownapproaches and by assessing three neuronal differentiation indexes,neurite outgrowth, increased protein levels of NF-M, and enhancedMAP-2 immunostaining, we have provided the first evidence that Nrf2promotes neuronal cell differentiation both in SH-SY5Y cells and inprimary neurons isolated from wild-type and Nrf2-null mice.

Materials and methods

Chemicals

Most chemicals, including RA, TPA, tBHQ, (tert-butylhydroquinone)Hoechst 33258, Na2SO4, K2SO4, MgCl2, CaCl2, Hepes, cysteine, HCl,papain latex, and glucose, were from Sigma Chemical Co. (St. Louis,MO, USA).

Cell cultures and establishment of stable cell lines

SH-SY5Y cells (American Type Culture Collection, Manassas, VA,USA) were grown in minimum essential medium (MEM)/F12medium (Invitrogen, Grand Island, NY, USA) with 10% fetal bovine

serum at 37°C in a humidified incubator containing 5% CO2. Thehemagglutinin (HA)–Nrf2 cDNA was cloned into the cloning site of alentiviral vector purchased from System Biosciences (Mountain View,CA, USA) using the standard recombinant DNA technique. Forestablishment of stable cell lines harboring HA–Nrf2, the lentiviralvectors were transfected into 293TN cells alone with the packagingplasmids according to the manufacturer's instructions. Virusesproduced in the supernatant were collected and used to infect SH-SY5Y cells in the presence of 8 μg/ml Polybrene. At 48 h postinfection,cells were grown in medium containing 1.5 μg/ml puromycin forselection. Stable cell lines were established once all the cells in thenegative control plate were killed. Stable cell lines were continuouslygrown in medium containing 1.5 μg/ml puromycin.

RA treatment

All RA treatments were performed in the dark. A final concentra-tion of 10 μM RA was used to treat SH-SY5Y cells with or withoutdifferentiation. No toxicity was observed with the RA-differentiationtreatments (data not shown).

mRNA extraction and qRT-PCR

Total mRNA was extracted from cells using TRI reagent (Sigma),and equal amounts of RNA were reverse-transcribed into cDNA usingthe Transcriptor First Strand cDNA synthesis kit (Roche, Indianapolis,IN, USA). The following TaqMan probes from the universal probelibrary were used (Roche): hNrf2 (No. 70), hNQO1 (No. 87), hNF-M(No. 42), and hGAPDH (No. 25). The following primers weresynthesized by Integrated DNA Technologies (Coralville, IA, USA):hNrf2, forward (ACACGGTCCACAGCTCATC) and reverse (TGTCAAT-CAAATCCATGTCCTG); hNQO1, forward (ATGTATGACAAAG-GACCCTTCC) and reverse (TCCCTTGCAGAGAGTACATGG); hNF-M,forward (ACGACCTCAGCAGCTACCA) and reverse (GAGCCATTTCC-CACTTTGTG); and hGAPDH, forward (CTGACTTCAACAGCGACACC)and reverse (TGCTGTAGCCAAATTCGTTGT). The real-time PCR condi-tions were as follows: 1 cycle of initial denaturation (95°C for 10 min),40 cycles of amplification (95°C for 10 s and 60°C for 20 s), and acooling period (50°C for 5 s). The data presented are relative mRNAlevels normalized to GAPDH, and the value from the undifferentiatedcells was set as 1. PCR assays were performed two times and duplicatesamples were used to determine the means±SD.

Antibodies and immunoblot analysis

Antibodies for Nrf2, Keap1, and α-tubulin were purchased fromSanta Cruz Biotechnology (Santa Cruz, CA, USA), NF-M was fromCovance (Emeryville, CA, USA), andMAP-2 was from Calbiochem (SanDiego, CA, USA). Cells were lysed in sample buffer [50 mM Tris–HCl(pH 6.8), 2% SDS, 10% glycerol, 100 mM dithiothreitol, 0.1%bromophenol blue]. After sonication, cell lysates were electrophor-esed through SDS–polyacrylamide gel and subjected to immunoblotanalysis.

Protein half-life measurement

To measure the half-life of Nrf2, cells were either undifferentiatedor RA-differentiated for 24 h. Cycloheximide (50 μM) was added toblock protein synthesis. Total cell lysates were collected at varioustime points and subjected to immunoblot analysis with an anti-Nrf2antibody. The relative intensity of the bands was quantified by theChemiDoc CRS gel documentation system and Quantity One softwarefrom Bio-Rad (Hercules, CA, USA). The pulse–chase method was alsoused to measure the rate of protein synthesis and half-life. SH-SY5Ycells were either undifferentiated or RA-differentiated for 24 h. Thecells were then incubated for 15 min in labeling MEM without

869F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

methionine, cysteine, and L-glutamine, complemented with 10%dialyzed FBS. The cells were cultured for 30 min with 0.3 mCi/ml[35S]methionine and [35S]cysteine labeling medium and were washedonce with complete medium and incubated in complete medium at37°C in a humidified incubator containing 5% CO2. Total cell lysateswere collected at various time points. Immunoprecipitation wasperformed using an anti-Nrf2 antibody in RIPA buffer. Immunopre-cipitated proteins were subjected to SDS–PAGE resolution andautoradiography.

Transient transfection of siRNA and lentiviral vector

Nrf2 siRNA and control siRNA were purchased from Ambion(Austin, TX, USA). Transient transfection of siRNA was performedusing siPORT NeoFX transfection reagent according to the manufac-turer's protocol (Ambion). The cells were then treated with 10 μM RAfor 24 h and lysed in sample buffer for SDS–polyacrylamide gel andimmune blot analysis. The Keap1–chitin-binding domain (CBD) orHA–Nrf2 cDNA was cloned into the cloning sites of the lentivectorpurchased from System Biosciences. The lentivectors were transfectedinto 293TN cells with the packaging plasmids according to themanufacturer's instructions. Viruses produced in the supernatantwere collected and used to infect cancer cell lines in the presence of8 μg/ml Polybrene. At 48 h postinfection, the cells were treated with10 μM RA for 24 h. Cells were lysed in sample buffer. After sonication,cell lysates were electrophoresed through an SDS–polyacrylamide geland subjected to immunoblot analysis.

Immunofluorescence cellular staining

SH-SY5Y cells were grown on poly-D-lysine-coated (Sigma) glasscoverslips in 35-mm plates. Cells were fixed in prechilled methanol at−20°C for 1 h and incubated at room temperature for 50 min withprimary antibodies diluted 1:100 in phosphate-buffered saline (PBS)containing 10% fetal bovine serum. The glass coverslips were washedin PBS and incubated at room temperature for 50 min with secondaryantibodies, Alexa Fluor 488-conjugated anti-mouse IgG or Alexa Fluor593-conjugated anti-rabbit IgG (Invitrogen, Grand Island, NY, USA), at1:100 dilution in PBS containing 10% fetal bovine serum and 1%Hoechst. The glass coverslips were washed in PBS and mounted withProLong Gold Antifade reagent (Invitrogen) on glass slides. Cells werescored and imaged using a 3i Marianas Zeiss Observer Z1 system andSlidebook (Intelligent Imaging Innovations, Denver, CO, USA). Theimages were exported from Slidebook to Tiff files. Adobe Photoshopwas used to construct the figures. Minimal alterations were performedon the digital images.

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was done as previously reported [55]. SH-SY5Y cells(approximately 1×106) were cross-linked with formaldehyde, col-lected in PBS, resuspended in 200 μl SDS lysis buffer with PMSF and aprotease inhibitor cocktail, and sonicated on ice. The lysates were thendiluted in ChIP dilution buffer to 2 ml, precleared with protein Aagarose, and then incubated with appropriate antibodies overnight.The immune complexes were collected with 50 μl protein A agarose,washedwith low-salt buffer, high-salt buffer, LiCl buffer, and TE buffer.The complexes were eluted in 500 μl fresh elution buffer. The cross-links were reversed by heating at 65°C for 5 h after addition of 20 μl of5MNaCl. The sampleswere treatedwith RNase and proteinase K. DNAwas recovered by phenol–chloroform extraction and ethanol pre-cipitation. Relative amounts of DNA in the complex were quantified bythe real-time PCRmethod using the LightCycler 480 DNA SYBRGreen Ikit (Roche). The primers used were as follows: human NQO1 AREforward, 5′-GCAGTCACAGTGACTCAGC-3′; human NQO1 ARE reverse,5′-TGTGCCCTGAGGTGCAA-3′; tubulin promoter forward, 5′-

GTCGAGCCCTACAACTCTATC-3′; tubulin promoter reverse, 5′-CCGTCAAAGCGCAGAGAA-3′. PCR cycling was performed as follows:initial denaturation at 95°C for 5 min (1 cycle); 40 cycles ofamplification of 95°C for 10 s, 60°C for 10 s, and 72°C for 20 s; witha single fluorescence acquisition. The amplification was followed by amelting curve program (65 to 95°C with a heating rate of 0.1°C persecond and a continuous fluorescence measurement) and then acooling program at 40°C for 30 s. The mean crossing-point values andstandard deviations for NQO1 and tubulin were determined for thedifferent samples. The crossing point is defined as the point at whichthe fluorescence rises appreciably above the background fluorescence.A nontemplate control was run for each primer pair to assess theoverall specificity and to ensure that primer dimers were notinterfering with amplification detection. Amplification specificitywas checked using melting curve and agarose gel electrophoresis.Melting-curve analysis showed a single sharp peak for all samples, andagarose gel electrophoresis showed a single band at the expected size.Data are presented as n-fold change. The real-time PCR assays wereperformed two times, each with duplicate samples.

DNA affinity precipitation assay

A 39-bp ARE sequence from the human NQO1 promoter was usedas a probe. The sequence used was 5′-AATCGCAGTCACAGTGACTCAG-CAGAATCTGAGCCTAGGG-3′. Two 5′-biotinylated ssDNA oligos withcomplementary sequences were synthesized by Integrated DNATechnologies and annealed to form a dsDNA probe. The probe wasincubated with cell lysates from transfected SH-SY5Y cells in RIPAbuffer (0.1% SDS). Proteins were pulled down using streptavidinbeads (Pierce, Rockford, IL, USA) and were subjected to immunoblotanalysis.

Evaluation of neuritogenesis

The percentage of differentiated cells and the length of neuritiswas calculated according to previous methods [7]. To determine ifNrf2 promotes the differentiation of SH-SY5Y cells induced by RA, wegrew SH-SY5Y cells in poly-D-lysine-coated glass coverslips in theabsence or presence of 10 μM RA in the medium. The cells werephotographed 4 days post-treatment with RA on a phase-contrastmicroscope (3i Marianas, Intelligent Imaging Innovations). Thepercentage of differentiated cells and the length of neurites werequantified using Slidebook (Intelligent Imaging Innovations) to count500 cells in 10 randomly chosen fields (100× magnification) in eachtreatment group. Cells were considered differentiated if they had oneneurite longer than the control groupmean neurite length. The lengthof the longest neurite was measured in at least 500 cells in 10randomly chosen fields (100× magnification) for each treatmentgroup.

Isolation of primary neurons

Coverslips were coated with poly-D-lysine before experiments.Neocortex was harvested in 10 ml dissociation medium (DM; 82 mMNa2SO4, 60 mM K2SO4, 5.8 mM MgCl2, 2.5 μM CaCl2, 1 mM Hepes,10 mM glucose, pH adjusted to 7.4), rinsed twice with 10 ml DM andonce with DM/Ky/Mg (DM 45 ml, 10× Ky/Mg 5 ml) (10× Ky/Mg is10 mM kynurenic acid, 100 mM MgCl2, 5 mM Hepes, pH adjusted to7.4). Tissues were minced and washed with DM/Ky/Mg. Activatedenzyme solution (DM/Ky/Mg 9.5 ml, cysteine–HCl 0.45 mg/ml,papain latex 100 units, pH adjusted to 7.4) was added and tissueswere incubated for 30min at 37°C. Tissues were then rinsedwith DM/Ky/Mg and pipetted up and down until dispersed and then washedwith 10 ml DMEM three times. Before being plated, the cells werecounted with a hemocytometer and diluted in plating medium.Cultures were incubated at 37°C in a humidified incubator containing

870 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

5% CO2 for 24 h. The plating medium was then removed and replacedwith neuronal maintenance medium.

Statistical analysis

All statistical results were expressed as means±SEM. Statisticalsignificance between different experiment groups were evaluated byone-way analysis of variance followed by Tukey's test performed withthe SPSS software (version 16.0; SPSS, Chicago, IL, USA) A P value lessthan 0.05 was considered statistically significant.

Results

RA and TPA up-regulate expression of Nrf2 and its downstream genes

SH-SY5Y cells were treated with 10 μM RA for various timeperiods and the expression of Nrf2, NQO1, and NF-M was analyzedby immunoblot analysis. Induction of Nrf2 was observed as early as2 h and remained elevated up to 48 h, with the maximal inductionat 24 h (Fig. 1A). Elevated expression of NQO1 was observed at 24and 48 h. As expected, NF-M was also up-regulated 12 h after RAtreatment and remained elevated at 48 h, whereas the levels of

Fig. 1. RA up-regulated the expression of Nrf2 and its downstream genes. (A) Endogenous Nrtreated with 10 μM RA for the indicated times. Cells were lysed in sample buffer and total c-tubulin (Tub) antibodies. (B) RA increased the mRNA levels of Nrf2, NQO1, and NF-M iexperiments and converted into cDNA. The same amount of cDNA was used for quantificatioEndogenous Nrf2 increased in a dose-dependent manner after 24 h treatment of RA. Cellsimmunoblot analysis using the indicated antibodies. (D) mRNA levels of Nrf2, NQO1, and NqRT-PCR as described for (B). ⁎Pb0.05 versus 0 μM treatment. (E) TPA up-regulated Nrf2. Cewas measured by immunoblot analysis.

control α-tubulin remained the same (Fig. 1A). These data indicatethat there might be a positive correlation between Nrf2 activationand NF-M expression. Another parallel set of samples treated with10 μM RA was also evaluated for mRNA expression of Nrf2, NQO1,and NF-M by real-time qPCR. Whereas there was only a marginalinduction of Nrf2 at the mRNA level, expression of NQO1 and NF-MmRNA showed a significant increase (Fig. 1B). Next, the 24 h timepoint was chosen for induction of Nrf2, NQO1, and NF-M by variousdoses of RA. As shown in Fig. 1C, RA induced the protein levels ofNrf2 and NQO1 at all the doses used. Similarly, RA had no effect onNrf2 transcription, whereas NQO1 mRNA expression was up-regulated significantly (Fig. 1D). Induction of NF-M mRNA wasobserved with all treatments and reached a peak with 10 μM RA(Fig. 1D). To understand whether Nrf2 induction is due to thedifferentiation processes, or is specific to RA treatment, induction ofNrf2 by TPA, which induces neuronal differentiation through adifferent mechanism, was also determined. Similar to RA, TPAenhanced Nrf2 and NQO1 protein levels (Fig. 1E). Furthermore, TPA-induced Nrf2 activation correlated with enhanced expression ofNF-M (Fig. 1E). Collectively, these data indicate that the Nrf2signaling pathway is up-regulated during neuronal differentiationprocesses.

f2 increased in a time-dependent manner after 10 μM RA treatment. SH-SY5Y cells wereell lysates were subjected to immunoblot analysis using anti-Nrf2, -NQO1, -NF-M, andn a time-dependent manner. Total mRNA was extracted from another parallel set ofn by qRT-PCR. ⁎Pb0.05 versus 0 h of treatment. ⁎⁎Pb0.01 versus 0 h of treatment. (C)were treated with various doses of RA for 24 h and total cell lysates were subjected toF-M increased with RA treatment. Another parallel set of samples was analyzed usinglls were treated with several doses of TPA for 24 h. Expression of Nrf2, NQO1, and NF-M

871F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

RA up-regulates Nrf2 through enhancing the rate of Nrf2 proteinsynthesis

Next, the mechanism of RA-mediated up-regulation of Nrf2 wasexplored. SH-SY5Y cells were treated with two doses of tBHQ or RA orin combination as indicated, and expression of Nrf2 and NQO1mRNA was measured by qRT-PCR. Nrf2 mRNA expression was notaffected by any treatment (Fig. 2A, top). However, the mRNAexpression of NQO1 was enhanced slightly by RA treatment alone(Fig. 2A, bottom, column 2). Cotreatment with RA and tBHQ resultedin a higher induction of NQO1 (Fig. 2A, compare lane 2 to lane 4 orlane 6). To test for any change in the amount of Nrf2 bound to the ARE,parallel-treated cells were subjected to ARE affinity immunoprecipi-tation analysis. Nrf2 expression in the total lysate is shown in Fig. 2B.The mutant ARE was included as a negative control (Fig. 2B, lanes 1and 8). RA treatment alone increased Nrf2 binding to the ARE (Fig. 2B,compare lane 3 with lane 2) and combined treatment furtherenhanced the binding of Nrf2 with the ARE (Fig. 2B, lanes 4–7). Todemonstrate that there is more Nrf2 bound to the ARE after RAtreatment in vivo, we performed ChIP analysis. tBHQ induced Nrf2

Fig. 2. RA up-regulated Nrf2 by enhancing the rate of Nrf2 protein synthesis. (A) RA potenttreated with tBHQ (10 or 20 μM) and/or RA (10 μM) simultaneously for 24 h. mRNAwas extraand tBHQ up-regulated Nrf2 target genes by enhancing the Nrf2 protein level and thus bindinNQO1 ARE sequence were incubated with cell lysates from SH-SY5Y that were simultaneoubiotinylated mutant-NQO1 ARE sequence was used as a negative control. (C) RA increased Nantibodies after 24 h treatment with tBHQ or RA. Genomic DNA fragments containing thevisualized on an agarose gel. ⁎Pb0.05 versus control. ⁎⁎Pb0.01 versus control. (D) Thecycloheximide for the indicated times. Cell lysate was collected and analyzed by immunoblconducted with SH-SY5Y cells that were pulse-labeled with medium containing [35S]methitimes. Cell lysates were immunoprecipitated using an anti-Nrf2 antibody and the immunop

binding to the ARE significantly, and RA enhanced Nrf2 binding to theARE by about twofold (Fig. 2C). These data indicate that RA is able toactivate the Nrf2-mediated signaling pathway by increasing the totalprotein level of Nrf2 and, thus, facilitating more Nrf2 binding to theARE. Previously, it has been well demonstrated that most Nrf2inducers, including tBHQ and sulforaphane, up-regulate Nrf2 bysuppressing Nrf2 degradation. Therefore, the half-life of Nrf2 inresponse to RA treatment was measured using the cycloheximide/immunoblot method. To our surprise, RA did not affect the half-life ofNrf2, and the half-life was approximately 18 min in the absence orpresence of RA (Fig. 2D), whereas tBHQ increased the half-life of Nrf2to 39 min. Next, protein synthesis and degradation were measured bythe pulse–chase method (Fig. 2E). The half-life of Nrf2 measured bythe pulse–chase method was consistent with that measured by thecycloheximide/immunoblot method. Interestingly, the amount ofnewly synthesized proteins in the 30-min pulse period was higher inthe RA-treated sample, compared to that in the untreated control (Fig.2E, lane 1, compare top to bottom). These data indicate that RA is ableto up-regulate the Nrf2 signaling pathway by enhancing the rate ofNrf2 protein synthesis.

iated the effect of tBHQ on mRNA levels of Nrf2 and NQO1 in SH-SY5Y cells. Cells werected, followed by qRT-PCR. ⁎Pb0.05 versus column 1. ⁎⁎Pb0.01 versus column 1. (B) RAg to the ARE. Biotinylated double-strand oligonucleotides containing 39 bp of the humansly treated with tBHQ and/or RA. A DNA affinity precipitation assay was performed. Arf2 binding to the ARE. ChIP analysis was performed in SH-SY5Y cells with the indicatedNQO1 ARE region in the immunoprecipitates were quantified by real-time PCR andhalf-life of Nrf2 was unaffected by RA treatment. SH-SY5Y cells were treated withot analysis. (E) RA enhanced the rate of Nrf2 protein synthesis. Pulse–chase assay wasonine and [35S]cysteine for 30 min and chased with normal medium for the indicatedrecipitates were resolved by SDS–PAGE and visualized by autoradiography.

872 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

RA-induced neuronal outgrowth is accompanied by enhanced expressionand nuclear translocation of Nrf2

To test the coordinated up-regulation of Nrf2 with a neuron-likemorphological change in response to RA treatment, an indirectdouble-immunofluorescence stain with anti-Nrf2 and anti-MAP-2was performed in SH-SY5Y cells in the absence or presence of RA. Inthe undifferentiated cells, MAP-2 expression was low but increasedupon treatment with RA (Fig. 3A, compare image A with B). The celldensity was low in the RA-treated sample, compared to the untreatedsample, even though the same amount of cells was seeded for the twogroups (Fig. 3A, compare image A with B). This is due to a reducedgrowth rate after RA stimulation. In addition, neurite extension wasclearly seen after RA treatment (Fig. 3A, compare image A with B).Cellular localization of Nrf2 was switched from the whole cell to thenucleus in response to RA treatment, (Fig. 3A, compare image C withD). Furthermore, the intensity of Nrf2 was enhanced markedly,indicating an increase in the Nrf2 protein level in response to RA

Fig. 3. RA-induced neuronal outgrowth was accompanied by enhanced expression and nucleaand Nrf2. Cells were treated with 10 μM RA for 4 days, fixed in methanol, and immunostainPhase-contrast images were taken before cells were fixed for immunostaining. 500 cells indifferentiated cells and the mean length of neurites. ⁎⁎Pb0.01 versus control cells.

treatment (Fig. 3A, compare image C with D and image E with F). Fig.3B shows a phase-contrast image of the same set of samples takenbefore the immunofluorescence staining. The percentage of differ-entiated cells was calculated and the mean neurite length wasmeasured using phase-contrast images. Both parameters weresignificantly increased in the RA-treated samples (Fig. 3C). Clearly,RA induced both Nrf2 and neuronal cell differentiation.

Stable overexpression of Nrf2 promotes neuronal differentiation

Next, the possible correlation between Nrf2 up-regulation andneuronal cell differentiation was tested by stable overexpression ofNrf2. An SH-SY5Y-derived stable cell line expressing HA–Nrf2 wasestablished using a lentivirus delivery and puromycin selectionsystem. As shown in Fig. 4A, HA–Nrf2 was expressed as detected byimmunoblot analysis with an anti-HA antibody (Fig. 4A). Similarly,overall expression of Nrf2 was enhanced in this stable cell line asdetected with an anti-Nrf2 antibody (Fig. 4A). Overexpression of Nrf2

r translocation of Nrf2. (A) RA induced morphological changes and up-regulatedMAP-2ed with anti-MAP-2 and anti-Nrf2 antibodies. (B and C) RA caused neurite extension.10 randomly chosen fields for each group were counted to calculate the percentage of

Fig. 4. Stable overexpression of Nrf2 promoted neuronal differentiation. (A) An SH-SY5Y-derived stable cell line has enhanced expression of Nrf2 and its downstream gene, NQO1. SH-SY5Y cells were infected using a lentivirus delivery system to express HA–Nrf2 and were selected using puromycin. Cells were lysed under denaturing conditions and subjected toimmunoblot analysis with anti-HA, -Nrf2, -NQO1, and -β-actin antibodies. (B) Nrf2 overexpression up-regulated NF-M in the presence of RA. The vector control and HA–Nrf2 SH-SY5Y stable cell lines were undifferentiated or RA-differentiated for 24 h. Cell lysates were subjected to immunoblot analysis with anti-NF-M and -Tub antibodies. (C) OverexpressedNrf2 promotes neurite outgrowth. Cells were treated with 10 μMRA for 4 days before fixation for indirect immunofluorescence staining using an antibody to MAP-2. (D and E) Stableoverexpression of Nrf2 promoted neuronal cell differentiation. Phase-contrast images were taken before cells were fixed. Quantification of neuronal differentiation of the stable celllines was conducted as described for Fig. 3. ⁎Pb0.05 versus vector with treatment.

873F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

resulted in enhanced expression of NQO1, indicating up-regulation ofNrf2 and its downstream events (Fig. 4A). In this cell line, over-expression of Nrf2 promoted RA-induced up-regulation of NF-M,although it had no effect on the levels of NF-M in the absence of RA(Fig. 4B, compare lane 1 with lane 3, and lane 2with 4), indicating thatup-regulation of the Nrf2 signal pathway itself is insufficient to initiateneuronal differentiation processes. Morphological differences in thevector-transfected and HA–Nrf2-transfected cells in the absence or

presence of RAwere also determined. Overexpression of HA–Nrf2 hadno effect on neurite outgrowth in the absence of RA, but potentiatedneuronal differentiation in RA-treated samples as determined by theindirect immunofluorescence stain with MAP-2 (Fig. 4C, compareimage A with C and image B with D). Similarly, neurite outgrowthpromoted by Nrf2 overexpression was observed in phase-contrastimages (Fig. 4D, compare image B with D). Moreover, the conclusionthat Nrf2 positively regulates neuronal differentiation was confirmed

874 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

875F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

by quantifying the percentage of differentiated cells and the meanneurite length (Fig. 4E).

Up-regulation of endogenous Nrf2 potentiates differentiation

Next, we tested whether up-regulation of endogenous Nrf2 bytBHQ is able tomodulate neuronal differentiation. SH-SY5Y cells weretreated with tBHQ or RA or both in combination as indicated and celllysates were subjected to immunoblot analysis. Although tBHQ up-regulated Nrf2 and NQO1 (Fig. 5A, lanes 3–6), tBHQ alone had noeffect on NF-M expression (Fig. 5A, lanes 1, 3, and 5). Significantly,tBHQ enhanced the RA-mediated up-regulation of NF-M proteinlevels (Fig. 5A, compare lanes 4 and 6with lane 2), demonstrating thepositive role of Nrf2 in potentiating neuronal differentiation pro-cesses. Phase-contrast images were taken before the cells were lysed(Fig. 5B), and these images were used for quantification of thepercentage of differentiated cells and the mean neurite length(Fig. 5C). Cotreatment with tBHQ and RA increased the percentageof differentiated cells slightly and significantly increased the meanneurite length, compared with RA-only treatment (Fig. 5C). Further-more, tBHQ had no effect in the absence of RA (Fig. 5C). tBHQtreatmentenhancedNrf2 (Fig. 5D, compare imageGandHwithE andF)and MAP-2 staining (Fig. 5D, image D). Together, these data demon-strate that induction of endogenous Nrf2 facilitates RA-inducedneuronal differentiation, although Nrf2 activation itself is insufficientto induce neuronal differentiation.

Down-regulation of Nrf2 compromised neuronal differentiation

To further verify the importance of Nrf2 in neuronal differentia-tion, the possible requirement of Nrf2 in neuronal differentiation wastested. Two approaches were used to knock down the expression ofendogenous Nrf2. In one set of experiments, Nrf2 siRNA or controlsiRNA was transfected into SH-SY5Y cells and the levels of Nrf2 weremeasured. Transfection of Nrf2 siRNA for 48 h decreased the levels ofNrf2 to 50% (Fig. 6, compare lanes 1 and 2, Nrf2 row). At 48 hposttransfection, the cells were further treated with RA for anadditional 24 h and NF-M expressionwas determined by immunoblotanalysis. Knockdown of Nrf2 expression itself had no effect on NF-Mlevels (Fig. 6A, compare lane 1 with 2 and lane 3 with 5; NF-M row).However, Nrf2 siRNA blocked the induction of NF-M in response to RA(Fig. 6A, compare lane 4 with lane 6). Morphological analysis showedretarded neurite outgrowth in cells transfected with Nrf2 siRNA, butnot with the control siRNA, in response to RA treatment (Fig. 6B,compare image B with D and image Awith B). In addition, knockdownof Nrf2 expression was clearly shown by the reduced Nrf2-fluores-cence staining (Fig. 6B, compare images G and H with E and F). Thephase-contrast images of these cells were taken before the cells werefixed for immunofluorescence staining (Fig. 6C). Changes in thepercentage of differentiated cells and the mean neurite length by RAtreatment were diminished in Nrf2 siRNA-transfected cells (Fig. 6D).The fact that inhibition of Nrf2 by Nrf2 siRNA was unable tocompletely block the RA-mediated neurite outgrowth can be due totwo reasons: (i) Nrf2 is not absolutely required for the neuronaldifferentiation process or (ii) complete inhibition of Nrf2 is notachieved, and Nrf2 siRNA only reduced Nrf2 expression by 50%.Another approach was also used to inhibit the expression of Nrf2 byoverexpression of Keap1, the substrate adapter for E3 ubiquitin ligaseresponsible for Nrf2 degradation. SH-SY5Y cells were infected withlentivirus carrying HA–Nrf2 and Keap1–CBD. Transient overexpres-

Fig. 5. Up-regulation of endogenous Nrf2 potentiated differentiation. (A) tBHQ enhanceddifferentiated and/or treated with the indicated concentration of tBHQ were lysed and subjeendogenous Nrf2 by tBHQ promoted neuronal differentiation. Phase-contrast images were ta⁎Pb0.05 versus control with treatment. (D) Nrf2 activation by tBHQ potentiated the RA-meundifferentiated or RA-differentiated with RA for 24 h. The cells were fixed in methanol an

sion of Nrf2 and Keap1 was confirmed by immunoblot analysis withanti-HA and anti-CBD antibodies (data not shown). In response to RAtreatment, overexpression of Nrf2 resulted in further up-regulation ofNF-M, whereas knockdown of Nrf2 by Keap1 overexpressionsuppressed up-regulation of NF-M by RA (Fig. 6E, compare lanes 4and 6 with lane 2). Together, these data demonstrate that inhibition ofNrf2 expression compromised neuronal differentiation. Notably, up-or down-regulation of Nrf2 had no effect on the levels of NF-M in theabsence of RA treatment, indicating that Nrf2 itself neither can initiateneuronal differentiation nor is absolutely required for neuronaldifferentiation.

Primary neurons isolated from Nrf2-null mice are retarded in neuriteoutgrowth

To further verify the important function of Nrf2 in regulatingneuronal cell differentiation, primary neurons were isolated fromwild-type and Nrf2-null mice. The primary neurons were allowed togrow in culture and morphological changes were observed by takingphase-contrast images every 24 h for 5 consecutive days (Fig. 7A).The neuron mean length at days 3, 4, and 5 was measured (Fig. 7A,bar graphs). The mean neurite length was significantly reduced inprimary neurons from Nrf2-null mice, especially at day 3, demon-strating a slow differentiation process in neurons that are deficient inNrf2 expression. Primary neurons that had been growing in culturefor 3 days were subjected to immunofluorescence staining with anti-MAP-2 (Fig. 7B). Expression of MAP-2 was lower in neurons fromNrf2-null mice as shown by a reduced intensity of MAP-2 staining(Fig. 7B, compare image A with B). In addition, primary neuronsisolated from Nrf2-null mice had less neurite outgrowth (Fig. 7B,compare image A with B). Similar amounts of cells were seeded inthese two groups as shown by nuclear staining (Fig. 7B, images C andD), indicating that the difference in neurite outgrowth is not due to adifference in cell confluency, but rather, it is due to the status of Nrf2.These results clearly demonstrate the functional role of Nrf2 inpotentiating neuronal differentiation.

Discussion

The signaling mechanism controlling neuronal differentiationprocesses has not been well studied and is probably a complexprocess, requiring the interplay of many signaling events. It isconceivable that multiple pathways converge to alter expression orphosphorylation states of cytoskeletal proteins, including MAPs andneurofilaments, to accommodate neurite outgrowth [5,6,14]. Manysignaling pathways have been reported to regulate neuronaldifferentiation processes when the SH-SY5Y cell line is used as amodel. For example, the integrin signaling pathway has been shownto be up-regulated during RA-induced differentiation processes,resulting in activation of cyclin-dependent kinase 5, which isrequired for enhanced expression and phosphorylation of NF-H aswell as neurite outgrowth [6,14]. During the early stages of neuronaldifferentiation following RA or TPA treatment, IκBβ is quicklydegraded, resulting in activation of NF-κB, which is required forneuronal differentiation [4]. Similar to what was observed with Nrf2in our study, DAN, the founding member of the DAN family ofsecreted cytokines, was up-regulated in response to RA treatment[3]. Furthermore, stable overexpression of DAN was shown tofacilitate RA-induced neuronal differentiation [3]. As expected,activation of a variety of kinases has been implicated in neuronal

RA-mediated up-regulation of NF-M. SH-SY5Y cells that were undifferentiated or RA-cted to immunoblot analysis using the indicated antibodies. (B and C) Up-regulation ofken and quantification of neuronal differentiationwas conducted as described for Fig. 3.diated neurite outgrowth. SH-SY5Y cells were untreated or treated with tBHQ and/ord subjected to immunofluorescence staining with MAP-2 and Nrf2 antibodies.

Fig. 6. Down-regulation of Nrf2 compromised neuronal differentiation. (A) Nrf2 siRNA effectively decreased Nrf2 protein levels and blocked induction of NF-M in response to RA.SH-SY5Y cells were transiently transfected for 48 h with either control siRNA or Nrf2 siRNA (lanes 1 and 2). Another set of samples was transfected with siRNA for 48 h and treatedwith RA for an additional 24 h (lanes 3–6). Cells were lysed and subjected to immunoblot analysis with antibodies to NF-M, Nrf2, NQO1, and tubulin. (B) Knockdown of Nrf2 affectscell morphology and inhibits neurite outgrowth when cells are treated with RA. Cells were transfected with control siRNA or Nrf2 siRNA for 48 h followed by 10 μM RA treatmentfor 4 days. The cells were then fixed in methanol and immunofluorescence analysis was conducted using antibodies to MAP-2 and Nrf2. (C and D) Knockdown of Nrf2 by siRNAcompromised neuronal differentiation. Cells transfected with control siRNA or Nrf2 siRNA and undifferentiated or RA-differentiated with 10 μM RA for 4 days were subjected tophase-contrast microscopy. Calculation of the percentage of differentiated cells and mean length was conducted as described for Fig. 3. ⁎Pb0.05 versus control with siRNA. (E)Overexpression of Nrf2 or Keap1 in conjunction with RA treatment caused an increase or decrease in NF-M, respectively. Cells were transiently infected by lentiviruses containingeither HA–Nrf2 or Keap1–CBD. Total cell lysates were subjected to immunoblot analysis using the indicated antibodies.

876 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

differentiation processes. In one report, RA-induced neuronaldifferentiation was shown to be involved in the phosphatidylinositol3-kinase (PI3K)/Akt survival signaling pathway, providing a link

between cell survival and differentiation [8]. A tyrosine kinase,AATYK, is able to promote differentiation induced by RA, TPA, andinsulin-like growth factor-1 [7]. More significantly, overexpression of

Fig. 7. Primary neurons isolated from Nrf2-null mice were retarded in neurite outgrowth. (A) Cell morphology and neurite lengths were compromised in Nrf2-null (KO) micecompared to wild type (WT). Primary neurons were isolated from wild-type and Nrf2-null mice and grown in cell culture for 3–5 days. ⁎Pb0.05 versus wild type. (B) Neuriteoutgrowth is delayed in primary neurons fromNrf2-null mice. Immunofluorescence staining was conducted on primary neurons isolated on day 3 fromwild-type and Nrf2-null miceusing a MAP-2 antibody.

877F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

AATYK induced differentiation without stimulation from otherinducing agents [7]. A stress-associated kinase, JNK, was found tobe required for RA-induced differentiation [56]. Interestingly, proteinkinase C and extracellular regulated kinase-1/2 were demonstrated

to mediate the activation of the adenosine receptors A1 and A2A,leading to neuritogenesis and differentiation in SH-SY5Y cells andprimary neurons isolated from rats [5]. It is worth to mention thatboth adenosine receptors A1 and A2A have been demonstrated to play

878 F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

a neuroprotective role on adenosine during cerebral ischemia.Similarly, the neuroprotective role of Nrf2 has also been reportedin a number of studies [49–54]. Currently, there are data supportingour findings that RA activates Nrf2 and induces Nrf2–ARE binding inan in vivo mouse model and a liver cell model [57]. However, onepaper suggests that toxic levels of RA reduced the binding of Nrf2 tothe ARE and enhanced the formation of a complex with the retinoicacid receptor α, which inhibits the activity of Nrf2 [58]. Althoughspeculative at this time, it is plausible that the neuroprotectiveeffects of the Nrf2-dependent pathway, activation of the adenosinereceptors, the PI3K/Akt pathway, and many other signaling path-waysmay cross talk because of their functions in promoting neuronaldifferentiation. The precise interplay between neuronal survival,differentiation, and apoptosis due to activation of the Nrf2 signalingpathway remains to be answered. Thus, revealing the novel role ofNrf2 in neuronal differentiation will open new perspectives for thetherapeutic use of Nrf2 activators in patients with neurodegenerativediseases.

In this report, we have examined the effects of Nrf2 on celldifferentiation using a neuroblastoma cell line, SH-SY5Y. RA and TPA,two well-studied inducers of neuronal differentiation, are able toinduce Nrf2 and NQO1 in a dose- and time-dependent manner.Mechanistically, RA up-regulated Nrf2 by enhancing the rate of Nrf2protein synthesis. RA-induced Nrf2 up-regulation is accompanied byneurite outgrowth and the induction of two neuronal differentiationmarkers, NF-M and MAP-2. Overexpression of Nrf2 in SH-SY5Y cells,by stable incorporation of Nrf2 cDNA, by transient infection oflentivirus containing Nrf2, or by chemical induction of endogenousNrf2, promotes neuronal differentiation as measured by up-regula-tion of NF-M and MAP-2, as well as morphological changes. On theother hand, inhibition of endogenous Nrf2 expression, by transfec-tion of Nrf2 siRNA or by transient infection of lentivirus containingKeap1, a negative regulator of Nrf2, inhibited neuronal differentia-tion. More remarkably, the positive role of Nrf2 in neuronaldifferentiation was verified ex vivo in primary neuron cultures.Primary neurons isolated from Nrf2-null mice showed a retardedprogress in differentiation, compared to those from wild-type mice.The different growing rates of neurons isolated from wild-type andNrf2-null mice were prominently observed at day 3. However, theneuronal differentiation process most likely reached completion onday 4, because neurite outgrowth in the Nrf2-null neurons wassimilar to that inwild-typemice at days 4 and 5. Collectively, our datademonstrate a novel role for Nrf2 in promoting neuronal celldifferentiation, which will open up new perspectives for therapeuticuses of Nrf2 activators in patients with neurodegenerative diseases.Nevertheless, further detailed evaluation of the possible morpholo-gic differences between wild-type and Nrf2-null mice during thecourse of brain development will be valuable in verifying theimportant role of Nrf2 in promoting neuronal differentiation.Although it seems that there is no apparent developmental defectwith Nrf2-null mice, there are no studies addressing the possibledelay in neuronal differentiation. Furthermore, it is possible thatsuch experiments should be performed under stress conditions tosubstantiate phenotypic differences between wild-type and Nrf2-null mice because we live in an environment in which stress isinevitable.

Acknowledgments

We thank Dr. Qiongman Kong for her advice on isolating primaryneurons from animals. We thank Nicole Villeneuve for critical readingof the manuscript. This work was supported by research grants fromthe NIEHS (ES015010) awarded to D.D. Zhang, the American CancerSociety (RSG-07-154-CNE) awarded to D.D. Zhang, and the SouthwestEnvironmental Health Sciences Center (ES006694).

References

[1] Encinas, M.; Iglesias, M.; Liu, Y.; Wang, H.; Muhaisen, A.; Cena, V.; Gallego, C.;Comella, J. X. Sequential treatment of SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells. J. Neurochem. 75:991–1003; 2000.

[2] Pahlman, S.; Hoehner, J. C.; Nanberg, E.; Hedborg, F.; Fagerstrom, S.; Gestblom, C.;Johansson, I.; Larsson, U.; Lavenius, E.; Ortoft, E.; Söderholm, H. Differentiation andsurvival influences of growth factors in human neuroblastoma. Eur. J. Cancer 31A:453–458; 1995.

[3] Nakamura, Y.; Ozaki, T.; Ichimiya, S.; Nakagawara, A.; Sakiyama, S. Ectopicexpression of DAN enhances the retinoic acid-induced neuronal differentiationin human neuroblastoma cell lines. Biochem. Biophys. Res. Commun. 243:722–726; 1998.

[4] Feng, Z.; Porter, A. G. NF-kappaB/Rel proteins are required for neuronal differentia-tion of SH-SY5Y neuroblastoma cells. J. Biol. Chem. 274:30341–30344; 1999.

[5] Canals, M.; Angulo, E.; Casado, V.; Canela, E. I.; Mallol, J.; Vinals, F.; Staines, W.;Tinner, B.; Hillion, J.; Agnati, L.; Fuxe, K.; Ferré, S.; Lluis, C.; Franco, R. Molecularmechanisms involved in the adenosine A and A receptor-induced neuronaldifferentiation in neuroblastoma cells and striatal primary cultures. J. Neurochem.92:337–348; 2005.

[6] Li, B. S.; Zhang, L.; Gu, J.; Amin, N. D.; Pant, H. C. Integrin alpha(1) beta(1)-mediated activation of cyclin-dependent kinase 5 activity is involved in neuriteoutgrowth and human neurofilament protein H Lys-Ser-Pro tail domainphosphorylation. J. Neurosci. 20:6055–6062; 2000.

[7] Raghunath, M.; Patti, R.; Bannerman, P.; Lee, C. M.; Baker, S.; Sutton, L. N.;Phillips, P. C.; Damodar Reddy, C. A novel kinase, AATYK induces and promotesneuronal differentiation in a human neuroblastoma (SH-SY5Y) cell line. Brain Res.Mol. Brain Res. 77:151–162; 2000.

[8] Lopez-Carballo, G.; Moreno, L.; Masia, S.; Perez, P.; Barettino, D. Activation of thephosphatidylinositol 3-kinase/Akt signaling pathway by retinoic acid is requiredfor neural differentiation of SH-SY5Y human neuroblastoma cells. J. Biol. Chem.277:25297–25304; 2002.

[9] Muley, P. D.; McNeill, E. M.; Marzinke, M. A.; Knobel, K. M.; Barr, M. M.; Clagett-Dame, M. The atRA-responsive gene neuron navigator 2 functions in neuriteoutgrowth and axonal elongation. Dev. Neurobiol. 68:1441–1453; 2008.

[10] da Silva, J. S.; Dotti, C. G. Breaking the neuronal sphere: regulation of the actincytoskeleton in neuritogenesis. Nat. Rev. Neurosci. 3:694–704; 2002.

[11] Helfand, B. T.; Mendez, M. G.; Pugh, J.; Delsert, C.; Goldman, R. D. A role forintermediate filaments in determining and maintaining the shape of nerve cells.Mol. Biol. Cell 14:5069–5081; 2003.

[12] Lazarides, E. Intermediate filaments: a chemically heterogeneous, developmen-tally regulated class of proteins. Annu. Rev. Biochem. 51:219–250; 1982.

[13] Carden, M. J.; Trojanowski, J. Q.; Schlaepfer,W.W.; Lee, V. M. Two-stage expressionof neurofilament polypeptides during rat neurogenesis with early establishmentof adult phosphorylation patterns. J. Neurosci. 7:3489–3504; 1987.

[14] Sharma, M.; Sharma, P.; Pant, H. C. CDK-5-mediated neurofilament phosphorylationin SHSY5Y human neuroblastoma cells. J. Neurochem. 73:79–86; 1999.

[15] Goldstein, M. E.; Sternberger, N. H.; Sternberger, L. A. Phosphorylation protectsneurofilaments against proteolysis. J. Neuroimmunol. 14:149–160; 1987.

[16] Pant, H. C. Dephosphorylation of neurofilament proteins enhances their suscept-ibility to degradation by calpain. Biochem. J. 256:665–668; 1988.

[17] Markus, A.; Patel, T. D.; Snider, W. D. Neurotrophic factors and axonal growth.Curr. Opin. Neurobiol. 12:523–531; 2002.

[18] Heraud, C.; Hilairet, S.; Muller, J. M.; Leterrier, J. F.; Chadeneau, C. Neuritogenesisinduced by vasoactive intestinal peptide, pituitary adenylate cyclase-activatingpolypeptide, and peptide histidine methionine in SH-SY5y cells is associated withregulated expression of cytoskeleton mRNAs and proteins. J. Neurosci. Res. 75:320–329; 2004.

[19] Zhang, D. D. Mechanistic studies of the Nrf2–Keap1 signaling pathway. DrugMetab. Rev. 38:769–789; 2006.

[20] Kobayashi, M.; Yamamoto, M. Molecular mechanisms activating the Nrf2–Keap1pathway of antioxidant gene regulation. Antioxid. Redox Signaling 7:385–394;2005.

[21] Kensler, T. W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environ-mental stresses via the Keap1–Nrf2–ARE pathway. Annu. Rev. Pharmacol. Toxicol.47:89–116; 2007.

[22] Osburn, W. O.; Kensler, T. W. Nrf2 signaling: an adaptive response pathway forprotection against environmental toxic insults. Mutat. Res. 659:31–39; 2008.

[23] Surh, Y. J.; Kundu, J. K.; Na, H. K. Nrf2 as a master redox switch in turning on thecellular signaling involved in the induction of cytoprotective genes by somechemopreventive phytochemicals. Planta Med. 74:1526–1539; 2008.

[24] Owuor, E. D.; Kong, A. N. Antioxidants and oxidants regulated signal transductionpathways. Biochem. Pharmacol. 64:765–770; 2002.

[25] Lau, A.; Villeneuve, N. F.; Sun, Z.; Wong, P. K.; Zhang, D. D. Dual roles of Nrf2 incancer. Pharmacol. Res. 58:262–270; 2008.

[26] Ishii, T.; Itoh, K.; Takahashi, S.; Sato, H.; Yanagawa, T.; Katoh, Y.; Bannai, S.;Yamamoto,M. Transcription factorNrf2 coordinately regulates a groupof oxidativestress-inducible genes in macrophages. J. Biol. Chem. 275:16023–160239; 2000.

[27] Moinova, H. R.; Mulcahy, R. T. Up-regulation of the human γ-glutamylcysteinesynthetase regulatory subunit gene involves binding of Nrf-2 to an electrophileresponsive element. Biochem. Biophys. Res. Commun. 261:661–668; 1999.

[28] Banning, A.; Deubel, S.; Kluth, D.; Zhou, Z.; Brigelius-Flohe, R. The GI-GPx gene is atarget for Nrf2. Mol. Cell. Biol. 25:4914–4923; 2005.

[29] Kim, Y. C.; Masutani, H.; Yamaguchi, Y.; Itoh, K.; Yamamoto, M.; Yodoi, J. Hemin-induced activation of the thioredoxin gene by Nrf2: a differential regulation of the

879F. Zhao et al. / Free Radical Biology & Medicine 47 (2009) 867–879

antioxidant responsive element by a switch of its binding factors. J. Biol. Chem.276:18399–18406; 2001.

[30] Sakurai, A.; Nishimoto, M.; Himeno, S.; Imura, N.; Tsujimoto, M.; Kunimoto, M.;Hara, S. Transcriptional regulation of thioredoxin reductase 1 expression bycadmium in vascular endothelial cells: role of NF-E2-related factor-2. J. Cell.Physiol. 203:529–537; 2005.

[31] Vollrath, V.; Wielandt, A. M.; Iruretagoyena, M.; Chianale, J. Role of Nrf2 in theregulation of the Mrp2 (ABCC2) gene. Biochem. J. 395:599–609; 2006.

[32] Maher, J. M.; Cheng, X.; Slitt, A. L.; Dieter, M. Z.; Klaassen, C. D. Induction of themultidrug resistance-associated protein family of transporters by chemicalactivators of receptor-mediated pathways in mouse liver. Drug Metab. Dispos.33:956–962; 2005.

[33] Ishii, T.; Yanagawa, T. Stress-induced peroxiredoxins. Subcell. Biochem. 44:375–384; 2007.

[34] Rushmore, T. H.; Morton, M. R.; Pickett, C. B. The antioxidant responsive element:activation by oxidative stress and identification of the DNA consensus sequencerequired for functional activity. J. Biol. Chem. 266:11632–11639; 1991.

[35] Wasserman, W. W.; Fahl, W. E. Functional antioxidant responsive elements. Proc.Natl. Acad. Sci. USA 94:5361–5366; 1997.

[36] Nioi, P.; McMahon, M.; Itoh, K.; Yamamoto, M.; Hayes, J. D. Identification of a novelNrf2-regulated antioxidant response element (ARE) in the mouse NAD(P)H:quinone oxidoreductase 1 gene: reassessment of the ARE consensus sequence.Biochem. J. 374:337–348; 2003.

[37] Zhang, D. D.; Lo, S. C.; Cross, J. V.; Templeton, D. J.; Hannink, M. Keap1 is a redox-regulated substrate adaptor protein for a Cul3-dependent ubiquitin ligasecomplex. Mol. Cell. Biol. 24:10941–10953; 2004.

[38] McMahon, M.; Thomas, N.; Itoh, K.; Yamamoto, M.; Hayes, J. D. Dimerization ofsubstrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by aqtetheringq mechanism: a two-site interaction model for the Nrf2–Keap1complex. J. Biol. Chem. 281:24756–24768; 2006.

[39] Tong, K. I.; Padmanabhan, B.; Kobayashi, A.; Shang, C.; Hirotsu, Y.; Yokoyama, S.;Yamamoto, M. Different electrostatic potentials define ETGE and DLG motifs ashinge and latch in oxidative stress response. Mol. Cell. Biol. 27:7511–7521; 2007.

[40] Wang, X. J.; Sun, Z.; Chen, W.; Eblin, K. E.; Gandolfi, J. A.; Zhang, D. D. Nrf2 protectshuman bladder urothelial cells from arsenite and monomethylarsonous acidtoxicity. Toxicol. Appl. Pharmacol. 225:206–213; 2007.

[41] Li, W.; Kong, A. N. Molecular mechanisms of Nrf2-mediated antioxidant response.Mol. Carcinog. 48:91–104; 2009.

[42] Ramos-Gomez, M.; Kwak, M. K.; Dolan, P. M.; Itoh, K.; Yamamoto, M.; Talalay, P.;Kensler, T. W. Sensitivity to carcinogenesis is increased and chemoprotectiveefficacy of enzyme inducers is lost in Nrf2 transcription factor-deficient mice. Proc.Natl. Acad. Sci. USA 98:3410–3415; 2001.

[43] Aoki, Y.; Sato, H.; Nishimura, N.; Takahashi, S.; Itoh, K.; Yamamoto, M. AcceleratedDNA adduct formation in the lung of the Nrf2 knockout mouse exposed to dieselexhaust. Toxicol. Appl. Pharmacol. 173:154–160; 2001.

[44] Iida, K.; Itoh, K.; Kumagai, Y.; Oyasu, R.; Hattori, K.; Kawai, K.; Shimazui, T.; Akaza,H.; Yamamoto, M. Nrf2 is essential for the chemopreventive efficacy of oltiprazagainst urinary bladder carcinogenesis. Cancer Res. 64:6424–6431; 2004.

[45] Chan, K.; Han, X. D.; Kan, Y. W. An important function of Nrf2 in combatingoxidative stress: detoxification of acetaminophen. Proc. Natl. Acad. Sci. USA 98:4611–4616; 2001.

[46] Cho, H. Y.; Reddy, S. P.; Yamamoto, M.; Kleeberger, S. R. The transcription factorNRF2 protects against pulmonary fibrosis. FASEB J. 18:1258–1260; 2004.

[47] Chan, K.; Kan, Y. W. Nrf2 is essential for protection against acute pulmonary injuryin mice. Proc. Natl. Acad. Sci. USA 96:12731–12736; 1999.

[48] Rangasamy, T.; Cho, C. Y.; Thimmulappa, R. K.; Zhen, L.; Srisuma, S. S.; Kensler,T. W.; Yamamoto, M.; Petrache, I.; Tuder, R. M.; Biswal, S. Genetic ablation ofNrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J.Clin. Invest. 114:1248–1259; 2004.

[49] Siebert, A.; Desai, V.; Chandrasekaran, K.; Fiskum, G.; Jafri, M. S. Nrf2 activatorsprovide neuroprotection against 6-hydroxydopamine toxicity in rat organotypicnigrostriatal cocultures. J. Neurosci. Res. 87:1659–1669; 2009.

[50] Johnson, J. A.; Johnson, D. A.; Kraft, A. D.; Calkins, M. J.; Jakel, R. J.; Vargas, M. R.;Chen, P. C. The Nrf2–ARE pathway: an indicator and modulator of oxidative stressin neurodegeneration. Ann. N. Y. Acad. Sci. 1147:61–69; 2008.

[51] Clark, J.; Simon, D. K. Transcribe to survive: transcriptional control of antioxidantdefense programs for neuroprotection in Parkinson's disease. Antioxid. RedoxSignaling 11:509–528; 2009.

[52] Calkins, M. J.; Johnson, D. A.; Townsend, J. A.; Vargas, M. R.; Dowell, J. A.;Williamson, T. P.; Kraft, A. D.; Lee, J. M.; Li, J.; Johnson, J. A. The Nrf2/ARE pathwayas a potential therapeutic target in neurodegenerative disease. Antioxid. RedoxSignaling 11:497–508; 2009.

[53] Satoh, T.; Okamoto, S. I.; Cui, J.; Watanabe, Y.; Furuta, K.; Suzuki, M.; Tohyama,K.; Lipton, S. A. Activation of the Keap1/Nrf2 pathway for neuroprotectionby electrophillic [sic] phase II inducers. Proc. Natl. Acad. Sci. USA 103:768–773;2006.

[54] Shih, A. Y.; Imbeault, S.; Barakauskas, V.; Erb, H.; Jiang, L.; Li, P.; Murphy, T. H.Induction of the Nrf2-driven antioxidant response confers neuroprotection duringmitochondrial stress in vivo. J. Biol. Chem. 280:22925–22936; 2005.

[55] Sun, Z.; Zhang, S.; Chan, J. Y.; Zhang, D. D. Keap1 controls postinduction repressionof the Nrf2-mediated antioxidant response by escorting nuclear export of Nrf2.Mol. Cell. Biol. 27:6334–6349; 2007.

[56] Yu, Y. M.; Han, P. L.; Lee, J. K. JNK pathway is required for retinoic acid-inducedneurite outgrowth of human neuroblastoma, SH-SY5Y. Neuroreport 14:941–945;2003.

[57] Tan, K. P.; Kosuge, K.; Yang, M.; Ito, S. NRF2 as a determinant of cellular resistancein retinoic acid cytotoxicity. Free Radic. Biol. Med. 45:1663–1673; 2008.

[58] Wang, X. J.; Hayes, J. D.; Henderson, C. J.; Wolf, C. R. Identification of retinoic acidas an inhibitor of transcription factor Nrf2 through activation of retinoic acidreceptor alpha. Proc. Natl. Acad. Sci. USA 104:19589–19594; 2007.