1

University of Manchester

School of Pharmacy and Pharmaceutical Sciences

Expression and responsiveness of cytokines and their receptors

in breast cancer

Thesis submitted for the degree of MPhil

in the Faculty of Medical and Human Sciences 2011

by Kleopatra E Andreou

Supervised by: Dr Costas Demonacos (School of Pharmacy)

Dr Marija Krstic-Demonacos (Faculty of Life Sciences)

2

CONTENTS

Abstract..........................................................................................................5

Declaration ....................................................................................................6

Copyright statement......................................................................................7

List of abbreviations ..................................................................................8-9

Chapter 1: Introduction..............................................................................10

1.1 The link between inflammation and cancer ........................10-11

1.2 Characteristics of the inflammatory response...........................11

1.2.1 General background.........................................................11-12

1.2.2 Cytokines .........................................................................13-15

1.3 Role of inflammatory mediators in cancer...............................16

1.3.1 Immune cells and cytokines.............................................16-19

1.3.2 Chemokines .....................................................................19-21

1.4 Molecular insights and mechanisms of cancer related

Inflammation......................................................................21-22

1.4.1 Role of tumour necrosis factor.........................................22-25

1.4.2 Inflammation and hypoxia................................................25-27

1.4.3 The p53 tumour suppressor in inflammation...................28-30

1.4.4 Histone acetyltransferase activity, cancer and

Inflammation....................................................................30-33

1.4.5 Histone deacetylase activity, caner and inflammation...33-35

1.5 Breast cancer.......................................................................35-37

3

1.6 Therapeutic approaches.......................................................38-39

1.7 Hypothesis and aims of the project.....................................39-40

Chapter 2: Materials and Methods............................................................41

2.1Cell culture, chemical treatments and constructs................ 41-42

2.2 Western blotting........................................................................43

2.2.1 SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel

electrophoresis…………………………………………..43-46

2.2.2 Electroblotting and detection.............................................46-48

2.3 Co-immunoprecipitation.......................................................48-50

2.4 Polymerase chain reaction ...................................................50-52

2.5 DNA electrophoresis.............................................................52-53

2.6 Quantitative reverse transcription PCR (Real time PCR)..........53

2.6.1 RNA extraction and reverse transcription..........................53-55

2.6.2 Quantitative PCR ...............................................................55-57

2.7 Chromatin immunoprecipitation...........................................58-60

2.8 Handling and isolation of plasmid DNA....................................61

2.8.1 Transformation of competent bacteria ...............................61-62

2.8.2 Mini scale preparation of plasmid DNA .................................63

2.8.3 Maxi scale preparation of plasmid DNA............................63-64

2.9 Molecular cloning and restriction analysis.................................65

2.9.1 Genomic DNA extraction........................................................66

2.9.2 TOPO cloning.....................................................................66-67

2.9.3 Analysis with restriction digestion.....................................67-68

2.9.4 pGL3 cloning......................................................................69-70

2.10 Luciferase reporter assays...................................................70-72

4

Chapter 3: Results.......................................................................................73

3.1 Identification of putative hypoxia responsive elements

within the regulatory regions of the promoters of inflamma

tory genes…..……………………………………………..73-81

3.2 CXCR-4, TNF-α and IL-10 mRNA expression pattern in

hypoxic and/or treated with agents causing DNA damage

breast cancer cells………………………………………..81-85

3.3 HIF-1α recruitment to the HRE sites located within the

regulatory region of the CXCR4 and TNF-α

promoters…………………………..……………………..85-88

3.4 Protein levels of CXCR4 in breast cancer cells………..….88-92

3.5 SRC-1 interacts with HIF-1α and p53 in MCF-7 cells…...93-94

3.6 SRC-1 and SIRT-1 affect CXCR4 gene expression in hypoxia

mimicking conditions……………………………………...95-98

3.7 Effect of SRC-1 and SIRT-1 on CXCR4 protein levels...98-101

Chapter 4: Discussion…………………………………………..…102-108

References:…………………………………………………………109-127

5

ABSTRACT

Chronic inflammation is a critical component in breast cancer progression. Pro-

inflammatory mediators along with growth/survival factors within the tumor

microenvironment potentiate enhanced expression of pro-inflammatory cytokines (IL-1,

IL-6, TNF-α), chemotactic cytokines and their receptors (CXCR4, CXCL12, CXCL8)

and angiogenic factors (VEGF) that often overcome the function of anti-inflammatory

molecules (IL-4, IL-10) eradicating the host’s anti-tumor immunity. Therefore detailed

knowledge of the regulatory mechanisms determining cytokine levels is essential to

understand the pathogenesis of several diseases including breast cancer. Activated

transcription factors such as NF-κB and HIF-1α are important players for the

establishment of a pro-inflammatory and potentially oncogenic environment. HIF-1α is

the key mediator of the cellular response to oxygen deprivation and induces the

expression of genes involved in survival and angiogenesis within solid hypoxic tumors.

The expression of these genes is often modulated by the p53 tumor suppressor protein

which induces apoptosis or cell cycle arrest in neoplastic cells. Functional crosstalk

between HIF-1α and p53 pathways mediated by co-regulators shared between the two

transcription factors such as SRC-1 and SIRT-1 differentially regulate diverse subsets of

target gene expression under variable stress conditions. In an attempt to shed light in

the complex regulatory mechanisms involved in cancer related inflammation, we

investigated the effect of the chemotherapeutic drug etoposide, which induces p53, on

the expression of inflammatory genes (CXCR4, TNF-α, IL-10) carrying hypoxia

responsive elements within the regulatory regions of their promoters in breast cancer

cells under hypoxia mimicking conditions. In addition, the role of two common p53 and

HIF-1α co-regulators, namely SRC-1 and SIRT-1, in the expression of the highly potent

metastatic chemokine receptor CXCR4 was evaluated. Both SRC-1 and SIRT-1

overexpression in DSFX treated MCF-7 cells reduced CXCR4 cellular levels implying

that both co-regulators are crucial factors in the determination of the metastatic potential

of breast cancer cells.

6

DECLARATION

No portion of the work referred to in the thesis has been submitted in support for an

application for another degree or qualification of this or any other university or other

institute of learning.

7

COPYRIGHT STATEMENT

i. The author of this thesis owns any copyright in it (the ―Copyright‖) and he has given

The University of Manchester the right to use such Copyright for any administrative,

promotional, educational and/or teaching purposes.

ii. Copies of this thesis, either in full or in extracts, may be made only in accordance

with the regulations of the John Rylands University Library of Manchester. Details of

these regulations may be obtained from the Librarian. This page must form part of any

such copies made.

iii. The ownership of any patents, designs, trade marks and any and all other intellectual

property rights except for the Copyright (the ―Intellectual Property Rights‖) and any

reproductions of copyright works, for example graphs and tables (―Reproductions‖),

which may be described in this thesis, may not be owned by the author and may be

owned by third parties. Such Intellectual Property Rights and Reproductions cannot and

must not be made available for use without the prior written permission of the owner(s)

of the relevant Intellectual Property Rights and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and

exploitation of this thesis, the Copyright and any Intellectual Property Rights and/or

Reproductions described in it may take place is available from the Head of School of

Pharmacy and Pharmaceutical Sciences and the Dean of the Faculty of Medical And

Human Sciences, for Faculty of Medical And Human Sciences’ candidates.

8

LIST OF ABBREVIATIONS

ARNT: aryl hydrocarbon receptor nuclear translocator

ATM: ataxia telangiectasia mutated

ATR: ATM and Rad3 related

bHLH: basic helix-loop-helix

CBP: CREB binding protein

ChIP: chromatin immunoprecipitation

COX2: cyclooxygenase 2

CXCR4: CXC chemokine receptor 4

DNA: deoxyribonulceic acid

dNTP’s: deoxynucleosides triphosphates

DSFX: desferrioxamine

ER: estrogen receptor

Etop: etoposide

FADD: Fas-associated death domain

FIH: factor inhibiting HIF

FOXO: forkhead factor

GM-CSF: granulocyte macrophage colony stimulating factor

HAT: histone acetyltransferase

HDAC: histone deacetyltransferase

HIC1: hypermethylated in cancer 1

HIF-1: hypoxia inducible factor 1

HRE: hypoxia responsive element

IFN: interferon

IL: interleukin

IκB: inhibitor of NF-κB

JAK: Janus kinase

MAPK: mitogen activated protein kinase

MDM2: murine double minute 2

MIF: macrophage migration inhibitory factor

9

ml: milliliter

MMP: matrix metalloprotease

mRNA: messenger ridonucleic acid

NAD: nicotinamide adenine dinucleotide

NF-κB: nuclear factor kappa B

NK: natural killer (cell)

NR: nuclear hormone receptor

PAS: Per-ARNT-Sim

PBS: phosphate buffered saline

PCAF: p300/CBP associated factor

PHD: prolyl hydroxylase

pVHL: von Hippel-Lindau protein

RIP: receptor interacting domain

ROS/RNS: reactive oxygen species/reactive nitric species

rpm: revolutions per minute

RT-PCR: real time polymerase chain reaction

SDF-1: stromal cell derived factor 1

SDS-PAGE: sodium dodecyl sulphate polyacrylamide gel electrophoresis

SIRT1: silent mating type information regulation 2 homolog

SRC-1: steroid receptor co-activator 1

STAT: signal transducers and activators of transcription

TAD: transactivation domain

TAM: tumor associated macrophage

TGF-β: transforming growth factor beta

TNF-α: tumor necrosis factor alpha

TRADD: TNF receptor-associated death domain

TRAF: TNF receptor associated factor

VEGF: vascular endothelial growth factor

10

CHAPTER 1: INTRODUCTION

1.1 The link between inflammation and cancer

Cancer is a disease which develops through mutations that occur in genes

changing their function and altering the pathways within which these genes exert

important functions (1). Uncontrolled cell proliferation is one of the characteristic

features of cancer with strong genetic background. During their life span cells constantly

encounter checkpoints where they decide to proliferate, differentiate or die. Mutations

that either accumulate during an individual’s lifetime or are inherited disrupt the balance

between proliferation and death, leading to clonal expansion of cells that have unlimited

replicative potential and evade apoptosis (2). However, sporadic alterations of the

human genome alone are not sufficient to induce carcinogenesis. Malignancies develop

through an intricate series of molecular events that concisely involve initiation, namely

genetic alterations in pre-malignant cells, and promotion, that is to say establishment of

a tumour supporting environment characterized by resistance to growth-inhibitory

signals and apoptotic death, maintenance of vascularization, tissue invasion and

metastasis (3).

Wound healing, in response to tissue assault, involves procedures related to cell

proliferation, inflammation, new blood vessel formation, rearrangement of the

extracellular matrix and invasion. In this way, cancer and wound healing show many

similarities (4). The fact that human organism initially perceives tumours as wounds

appears to be deleterious because it generates an environment favourable for

carcinogenesis.

Currently accumulating evidence support the notion that most human tumours

develop in an environment of chronic inflammatory conditions (5). Consistent with this

view several epidemiological studies have associated chronic infection, inflammation

and increased risk of cancer development (6). For example, exposure to Helicobacter

pyroli (H.pyroli) infection is a common reason for the development of gastric cancer

whereas Human Immunodeficiency Virus (HIV) infection accounts for AIDS-associated

11

malignancies, such as non-Hodgkin’s lymphoma and Kaposi’s sarcoma (5). Apart from

bacterial and viral infections, autoimmune diseases and chronic inflammatory conditions

of unknown origin can also increase cancer risk (7).

More recent studies have demonstrated that genetic alterations can trigger

inflammation in tissues where there are no underlying infectious conditions. This

intrinsic pathway that links inflammation with cancer is initiated by mutations in

oncogenes, inactivation of tumour-suppressor genes and chromosomal rearrangements.

DNA damaging agents, such as reactive oxygen and/or nitric species (ROS/RNS),

produced by chronically inflamed cells increase the transformation potential of pre-

malignant cells and tumour development may easily occur by the actions of

inflammatory cells and mediators (cytokines, growth factors) (8). Regardless of the way

inflammation is triggered both the extrinsic (inflammation due to infection) and intrinsic

(genetic event) pathways involve activation of transcription factors that ultimately

establish an inflammatory environment that promotes tumour growth and progression.

1.2. Characteristics of the inflammatory response

1.2.1 General background

Human organisms encounter different types of pathogenic stimuli, such as

environmental chemical agents, microbes and tumours (which are treated by the human

body as wounds) that have the capability to disrupt their homeostasis if not eliminated (9).

Therefore, a number of effector mechanisms have been developed to defend the human

body against all the potentially harmful antigens. These immunity mechanisms can be

either mediated by soluble molecules, cells, or both. Whenever infection or injury occurs,

the innate and subsequently the adaptive immune system become active in order to

eliminate the insulting agents and retain homeostasis.

A cellular process inextricably linked to innate immune response is inflammation.

This is the term used to describe a non-specific biological response of vascular tissues to

12

harmful stimuli, such as pathogens, irritants or damaged cells. The fundamental signs of

inflammation were first described by Aulus Cornelius Celsus the first century AD and

included calor (warmth), dolor (pain), tumour (swelling) and rubor (redness,

hyperaemia). It was, thus, well established from the early years that inflammation is a key

reaction of the primary defense system that involves extravasation of plasma and

recruitment of immune cells to the site of infection (10). Indeed, widening of the blood

vessels to increase blood flow (vasodilation), increased vascular permeability to allow

entrance of diffusible molecules, activation of cells of the immune system, directed

movement of inflammatory cells (chemotaxis) as well as metabolic changes at the site of

inflammation are the major features of the inflammatory response that ultimately results

in the destruction of the harmful stimuli.

As mentioned above, cellular and extra-cellular components participate in the

complex process of inflammation. The prominent type of cells mediating inflammation is

leukocytes. The early phase of the inflammatory response, characteristic of increased

blood flow and vascular permeability, is initiated by immune cells already present in the

tissues, mainly macrophages, neutrophils, dendritic cells and mast cells. These cells

undergo activation and release inflammatory mediators that are responsible for the

clinical signs of inflammation and also for the establishment of an inflammatory

environment where neutrophil leukocytes migrate towards and accumulate to the site of

insult. This acute response ceases once the infectious agent is successfully eliminated but

if that is not accomplishable, inflammation becomes persistent and may occur over long

period of time. The chronic phase of inflammation is characterized by specific humoral

and cellular immune responses. The adaptive immune system intervenes with

lymphocytes (B-cells, T-cells), natural killer cells (NK), macrophages and plasma cells

being the principal cellular effectors of chronic inflammation. Soluble factors that mediate

both phases include inflammatory lipid metabolites (prostaglandins), soluble proteases,

nitric oxide and cell-derived polypeptides (cytokines) (11)

13

1.2.2 Cytokines

The inflammatory response is a complex procedure involving a variety of cell-

derived mediators. The primary peptidic mediators of cellular immunity are cytokines

(12), small proteins or glycoproteins of low molecular mass (8-30 kDa) that are secreted

by cells of the immune system and carry signals between the cells. Cytokines act as

molecular messengers facilitating the intercellular communication within the immune

system either in an autocrine or paracrine mode. Once released, cytokines are able to

locate immune cells that express specific receptors onto their surface and interact with

them. The signal is transduced upon binding of the ligand with the receptor and most of

the times the janus kinase (JAK)/signal transducers and activators of transcription

(STAT) pathway of transcriptional factors is activated, although alternative pathways

also exist. The result is the induction of transcription of certain target genes, usually

related to the activation, proliferation and differentiation of immune cells (Figure 1.1).

Cytokines can be classified, according to their function and the type of cell that

produces them, to interleukins (secreted by leukocytes they facilitate the inter-

communication between these cells), chemokines (mediating chemotaxis of cells) and

lymphokines (secreted by lymphocytes).

14

Figure 1.1: Cytokine signaling. Cytokines bind to homodimeric or heterodimeric

receptors that are bound to Jaks. After a series of trans- and/or auto- phosphorylations of

Jaks and Stats, phosphorylated Stats dimerize and translocate in the nucleus where they

regulate gene expression. Cytokine signalling modulates various processes, i.e.: immune

cell proliferation, angiogenesis, embryogenesis, inflammation and oncogenesis (adapted

from 13).

Although cytokines are usually referred to as the principle regulators of the

immune response, these peptides also mediate other important cellular functions via

their cognate receptors such as embryogenesis, angiogenesis, hematopoiesis, chronic

inflammation and oncogenesis (Figure 1.1). For instance, the members of the vascular

endothelial growth factor (VEGF) family are potent stimulators of blood vessel

formation under both physiological and pathological conditions. Stem cell factor (SCF)

is a cytokine shown to be involved in survival (14) and mobility of hematopoietic stem

cells (HSCs) (15).

immune cell

proliferation,

differentiation,

activation

angiogenesis

embryogenesis

inflammation

oncogenesis

15

Cytokines regulate inflammatory responses either directly or by inducing the

production of other cytokines and/or cellular adhesion molecules in other cells (16, 17).

They are formally divided, according to their function during the inflammatory process,

into two groups: the pro-inflammatory and the anti-inflammatory cytokines. As their

name suggests, pro-inflammatory cytokines contribute to build up and accelerate an

inflammatory reaction. Main members of this group are interleukin 1 alpha (IL-1α),

interleukin 1 beta (IL-1β), interleukin 6 (IL-6) and tumour necrosis factor alpha (TNF-

α). Other pro-inflammatory mediators include interferon gamma (IFN- γ), transforming

growth factor beta (TGF-β), interleukin 8 (IL-8), interleukin 12 (IL-12), granulocyte-

macrophage colony stimulating factor (GM-CSF) and chemotactic chemokines. Anti-

inflammatory cytokines, such as interleukin 4 (IL-4), interleukin 10 (IL-10) and

interleukin 16 (IL-16), deliver information which helps to cease the inflammatory

response and initiate healing processes like vessel and tissue building (18). The influx of

cytokines is temporary during acute inflammation but in cases of chronic inflammatory

responses there exists a permanent network of overproduced cytokines. IL-1, IL-6, IL-8,

TNF-α and GM-CSF play key roles in mediating acute inflammation while IL-2, IL-3,

IL-4, IL-5, IL-6, IL-7, IL-10, TNF-α, TGF-β and IFN-γ mediate chronic inflammation.

Nevertheless, some cytokines, namely TNF-α and IL-6, are involved in both types of

inflammatory responses (17).

Over the past years and after extensive studies on cytokines and their role in

inflammation, it has been clear that these numerous multifunctional molecules compose

an extensive network of molecular messengers that interact either in a synergistic or

antagonistic way. Within the cytokine network the balance of pro- and anti-

inflammatory cytokines is of pivotal importance as it determines the progression and

effect of inflammatory reactions and its manipulation can be exploited in the therapy of

various inflammatory diseases.

16

1.3 Role of inflammatory mediators in cancer

1.3.1 Immune cells and cytokines

Experimental evidence suggesting possible link between inflammation and

cancer arose from studies showing the presence of inflammatory cells and mediators in

malignant tissues (5). Indeed, the leukocyte infiltrate around the sites of tumour consists

predominantly of tumour-associated macrophages (TAM) as well as T regulatory

lymphocytes, dendritic and mast cells in lower percentages (19). These immune cells are

potentially capable of exerting anti-tumour immunity and eliminating cancer cells but

strong experimental and clinical evidence has indicated that in most cases they instead

promote tumour development (20). TAMs generally acquire a different phenotype in the

tumour stroma rather than the M1 phenotype, which is activated upon microbial

infection. The alternative polarized M2 phenotype of TAMs is associated with their

protumoural functions. This phenotype shift is attributed to different

microenvironmental signals, such as immunosuppressants like glucocorticoids, IL-4, IL-

10, as well as hypoxia (19, 21). Macrophages programmed to the anti-inflammatory and

pro-angiogenic M2 phenotype interact with neoplastic cells and actively support tumour

survival and growth. They also contribute to tumour invasion, angiogenesis and

metastasis. Thus, TAMs are frequently used as a cancer biomarker and their increased

number is correlated with poor survival prognosis for patients with solid tumours like

breast, cervical and prostate tumours (22).

Cytokines may be secreted by inflammatory, stroma and tumour cells creating a

network of factors that diversely influences immunosuppression, angiogenesis, cancer

cell growth and invasion (Figure 1.2). Most data converge to the notion that cytokines

and inflammatory cells found in tumours more likely promote tumourigenesis rather

than host an anti-tumour response (23, 5). It appears that aberrant cytokine production,

commonly observed during chronic inflammation, permits cancer cells to exploit host

derived cytokines to promote growth, metastasis and resistance to apoptotic death. The

multifunctionality of cytokines and their interdependent interactions within the

neoplastic tissue accounts for different outcomes in different environments (23).

17

Figure 1.2: Outcomes of interactions between tumour cells and infiltrating cells.

Cytokines within the tumour microenvironment may either promote tumour

development or suppress it. Concentrations and interactions of cytokines as well as

biology of each cancer are crucial (adapted from 23).

IL-1 and TNF-α are key components of inflammation with respect to

carcinogenesis. Polymorphisms of their genes accounting for the pro-inflammatory

phenotype affect cancer risk and progression. For instance, IL-1 genotypes that produce

higher levels of the respective cytokine are associated with poor survival of patients

with pancreatic cancer and pro-inflammatory genotypes of TNF-α are predisposal

factors for developing gastric and colorectal cancer (24). IL-1 is upregulated in many

human solid tumours, including breast cancer (25), lung cancer (26) and melanomas

(27). IL-1β in particular is also known to augment metastasis (28) and promote tumour

angiogenesis and invasiveness in vivo by inducing the expression of angiogenic genes

18

(VEGF) and growth factors (29). TNF-α is a major pro-inflammatory cytokine and

potent inducer of both cancer cell apoptosis and survival. TNF-mediated chronic

inflammation contributes to cancer development by tissue remodelling and invasion

while, when locally produced TNF acts as anti-angiogenic destroying tumour blood

vessels. TNF is detected in malignant and stromal cells in human breast, ovarian,

prostate and bladder tumours as well as in leukaemias and lymphomas (5).

Among more than 300 characterized so far members of the cytokine family, IL-6 also

plays a growth-promoting role in terms of cancer associated inflammation. Elevated

levels of IL-6 are observed in multiple myelomas (MM), colon and breast cancer,

diseases for which IL-6 is a predisposition factor (30).

Generally the tumour microenvironment is characterized by increased levels of

immunomodulating IL-10 and TGF- (23). TGF-β has two opposing roles during

carcinogenesis and this is widely known as the ―TGF-β paradox‖. In many human

malignancies TGF-β contributes to immunodeficiency against cancer cells and

carcinoma progression via suppression of the functions of lymphocytes and monocytes,

caused by alterations in the TGF-β signalling pathway (20). However, it is clear that in

early stages of carcinogenesis TGF- acts as a tumour suppressor since it mediates

growth arrest of malignant cells (31).

Likewise, IL-10 [also known as human cytokine synthesis inhibitory factor

(CSIF)] exerts multiple biological roles and contradictive effects in carcinogenesis. IL-

10 is commonly regarded as immunosuppressant due to its ability to decrease the

functionality of antigen presenting cells and T helper cells during immune responses

(32). Its production by immune and malignant cells hampers key elements of innate

immune response thus facilitating cancer cells to escape immune surveillance (33). For

instance, a recent study suggests a role of IL-10 in immune suppression in human

papilloma virus (HPV) related cervical cancer which is possibly due to the high number

of regulatory T cells in cervical cancer patients accounting for the high IL-10 mRNA

levels and maintenance of immune suppression (34). However, evidence arising from

experimental animal models suggests that the role of IL-10 is not always

immunosuppressive. High levels of IL-10 enhance NK cell activity, and may induce

immune mediated tumour rejection. Moreover, IL-10 accounts for inhibition of tumour

19

angiogenesis via VEGF suppression and metastasis probably by inducing the production

of matrix metalloproteases (MMP) inhibitors (35). In addition, IL-10 exerts anti-

inflammatory effects by inhibiting the production of several pro-inflammatory

cytokines, including TNF, IL-2, IL-6, IL-8, thus acting as an inhibitor of tumour

progression within the tumour microenvironment (23).

1.3.2 Chemokines

A subset of cytokines linked to cancer and metastasis in particular are

chemokines (36). They are chemotactic cytokines that cause directed migration of

nearby responsive cells expressing appropriate chemokine receptors along a

concentration gradient. Chemokines mediate homeostasis, cell development and

angiogenesis by controlling migration of cells during physiological processes. Apart

from that, chemokines are critical mediators of leukocyte migration during immune

surveillance and inflammation (37). Successful response of the immune system depends

on chemokine networks that recruit and activate leukocytes at the right place.

Inflammatory chemokines are secreted by circulating leukocytes and other cells upon

induction by inflammatory cytokines, growth factors and pathogenic stimuli.

Chemokine signalling, upon binding of the ligand to the corresponding G- protein

coupled receptor, results in transcription of target genes involved in cell activation,

motility and interactions with the extracellular matrix. Chemokines have been classified

into four families (C, CC, CXC, and CX3C) based on the number and positions of the

N-terminally conserved cysteine residues they possess (37).

Deregulation of chemokine networks or inappropriate activation can contribute

to inflammatory diseases and malignant transformations (38, 39). Several studies on

chemokines and their receptors provide evidence of their role in development of primary

tumours and metastases (38). Furthermore, functional chemokine receptors are not only

found on leukocyte cells, but also on endothelial cells and malignant epithelial cells.

This complex network influences the recruitment and function of immune-cell infiltrate

20

as well as cancer cell growth and metastasis either in a promoting or inhibitory manner.

CXCR2, CXCR4, CCR2 and CCR7, among the approximately 20 chemokine receptors

identified to date, play vital roles in tumourigenesis and metastatic spread (37).

As already highlighted, angiogenesis is a required step for malignant

transformation of cells and subsequent formation of large tumours. Moreover, it is

established that new blood vessel networks within the tumour microenvironment

facilitate migration of cancer cells out of the tumour site and into the blood stream,

contributing this way to the formation of secondary tumours at distant sites. Signalling

via certain chemokines and their cognate receptors can regulate angiogenesis in vitro

and in vivo, by promoting both cellular proliferation and migration. CXCR2 is an

important receptor in terms of tumour angiogenesis. It is redundant and binds CXCL1,

CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 ligands, all characterized by

the presence of a peptidic ELR (glu-leu-arg) motif. It became obvious that this motif

preceding the CXC sequence is involved in the induction of angiogenesis. However, this

is not always the case as indicated by CXCR4 receptor and its ELR lacking ligand

CXCL12. It seems that a different mechanism is involved in the induction of

angiogenesis by this receptor-ligand complex (37).

Signalling via CXCR4 regulates important processes, such as cell proliferation,

homeostasis and trafficking of immune cells, migration, adhesion and angiogenesis, as

part of normal physiology (40). However, most of these events are also required for

carcinogenesis and this chemokine receptor is proven to regulate such events in a variety

of cancers. CXCR4 is the most commonly found receptor on cancer cells (41) and of

great importance in terms of cancer progression as it is involved in the metastatic spread

of many human tumours, notably breast, ovarian, prostate, colorectal, non-small cell

lung cancer and leukaemia. Its unique so far known ligand, CXCL12/SDF-1 (Stromal

cell derived factor 1), is also expressed within the tumour microenvironment as well as

at distant sites of metastasis, underlying a pivotal role of the axis CXCR4-CXCL12 in

invasion and metastasis. CXCL12 has a constitutive expression pattern in a wide range

of tissues including bone marrow, lymph nodes and liver (40). Furthermore, binding of

CXCL12 to CXCR4 induces effector molecules that favour cancer progression within

the tumour microenvironment (40). Notably, CXCR4 increases the production of MMPs

21

that facilitate invasion by degradation of extracellular matrix molecules and also induces

MAPK (mitogen activated protein kinase) pathway that promotes tumour growth in

breast cancer. Finally, CXCR4 may directly or indirectly promote angiogenesis via

upregulation of VEGF (40).

Chemokine receptor CCR2 and its ligand CCL2 have also been shown to exert

pro-angiogenic and tumour promoting effects in the cases of prostate cancer and

multiple myeloma (37). Furthermore, CCL2 is involved in the recruitment of leukocyte

cells around solid tumours and the levels of its expression are positively correlated to

the extend of macrophage and lymphocyte infilitrate (42). Indeed, chemotaxis by CC

chemokines determines the leukocyte infiltrate of many human cancers, like breast,

pancreas, cervix and oesophagus. Macrophage influx, as well as inflammatory cell

invasion in general, can subsequently trigger angiogenesis by the production of

angiogenic factors (for instance TNF-α, IL-6, IL-8).

1.4 Molecular insights and mechanisms of cancer related inflammation

It is now well established that inflammatory cytokines and chemokines secreted

by tumour cells themselves and tumour-associated immune cells contribute to malignant

progression (42, 43). The cytokine network within the tumour microenvironment

triggers signalling pathways that induce the expression of genes involved in tumour cell

growth and invasiveness, angiogenesis, metastasis and production of more cytokines

that interplay with the existent network and modulate malignant progression. Cytokines

usually transduce signals through the JAK-STAT pathway (44). Signal transducer and

activator of transcription 3 (STAT3), along with nuclear factor-kappa B (NF-κB) and

hypoxia inducible factor 1 alpha (HIF-1α) are the main regulatory transcription factors

coordinating tumour initiation and progression in tissues where cancer related

inflammation occurs (43).

Members of the NF-κB family of transcription factors [Rel (c-Rel), Rel A

22

(p65), Rel B, NF-κB1 (p105/p50) and NF-κB2 (p100/p52)] are important regulators of

immune and inflammatory responses in terms of modulating the expression of cytokines

and growth factors (45). NF-κB also plays role in carcinogenesis (46) by promoting cell

proliferation and up-regulating anti-apoptotic gene expression (47). NF-κB is expressed

in most tumour cells and disrupts the balance between proliferation and apoptotic death

in favour of malignant growth (48). Several studies confirm the presence of

constitutively active NF-κB in a range of cancers, including ovarian, breast, liver,

pancreatic, prostate, oral cancer and leukaemia. NF-κB is linked to poor survival in

patients with pancreatic, prostate and ovarian cancer, oesophageal adenocarcinomas,

hepatocellular and squamous cell carcinomas and with elevated aggressiveness of

inflammatory breast cancer. Therefore, NF-κB is considered as a tumour-promoting

molecule and is a major target for anti-cancer therapies.

Pro-inflammatory cytokines, mainly TNF-α, account for activation of the NF-κB

dependent transcriptional activity (45). In neoplastic and inflammatory cells NF-κB

induces the expression of genes encoding for inflammatory cytokines such as TNF-α

and IL-6, chemokines, MMPs, angiogenic factors such as VEGF, and cyclooxygenase 2

(COX2); all of these factors synergistically promote cancer cell proliferation and

invasion. Moreover, members of the anti-apoptotic Bcl-2 family of regulators and TNF

receptor associated factor proteins (TRAF) have been indentified as targets of NF-κΒ

that inhibit cell apoptosis upon transactivation (49). Notably, infiltrating leukocytes

(mainly TAMs) display impaired expression of NF-κB in advanced stages of cancer.

However, this probably reflects a possible change in the tumour microenvironment

during cancer progression, as evidence suggests that NF-κB is expressed at early stages

of carcinogenesis (50).

1.4.1 Role of tumour necrosis factor alpha

Tumour necrosis factor alpha is a multifunctional signalling cytokine with

important roles in acute inflammation and apoptosis. It belongs to the TNF family of

cytokines, composed of two isoforms (alpha and beta) encoded by adjacent genes

23

located within the major histocompatibility complex. TNF-α, both as a membrane-

intergrated or soluble protein, exerts its signalling potential via two cell surface

receptors, namely TNFR1 and TNFR2. In contrast to TNFR2, TNFR1 is expressed on

most types of cells and initiates the majority of soluble TNF’s signalling activities (51).

Binding of homotrimeric TNF-α to the extracellular domain of its cognate receptor

triggers the formation of a complex of adaptor proteins in the cytoplasm (Figure 1.3).

Initially TNF receptor-associated death domain (TRADD) recognizes the intercellular

domain of the transmembrane TNFR1 and then recruits the receptor-interacting protein

(RIP) and the TNFR-associated factor 2 (TRAF2). This protein complex subsequently

recruits additional key molecules, such as enzymes and kinases and initiates distinct

signalling pathways (52).

The default pathway induces genes involved in cell survival and inflammation

via NF-κB and c-Jun activation. Upon TNF-α stimulation, TRADD/RIP/TRAF2

complex recruits the TGFβ-activated kinase (TAK1) complex and the inhibitor of NF-

κB (IκB) kinase (IKK) complex that perform a series of phosphorylations leading to

selective ubiquitination and proteasomal degradation of IκB. In the absence of IκB, NF-

κB is free to translocate in the nucleus and exert its transactivation activity (53).

Alternatively, a cascade of kinases including MAPK, MEK (mitogen-activated protein

kinase/extracellular signal-regulated kinase) and JNK (c-Jun N-terminal kinase), may be

triggered by TRADD/RIP/TRAF2 complex and ultimately activate the transcriptional

factor c-Jun. Together, NF-κB and c-Jun induce expression of genes encoding for

inflammatory cytokines and chemokines, adhesion molecules and growth factors.

Initiation of the apoptotic pathway requires recruitment of Fas-associated death domain

(FADD) by the TRADD/RIP/TRAF2 complex, followed by activation of caspase-8 and

subsequent induction of other caspases and pro-apoptotic molecules (54).

TNFα is mitogenic to normal cells and regulates important functions such as

immune system responses and inflammation. However, when imbalance between the

survival and apoptotic signals occurs the apparent role of TNF-α in mediating

homeostasis can be reversed, as proven by several studies implicating TNF-α is the

pathogenesis of numerous diseases including sepsis, autoimmune diseases,

inflammatory bowel diseases and cancer (52). In fact, TNF-α was initially thought to

24

cause hemorrhagic necrosis of tumours thus preventing tumour growth and leading to

subsequent regression. This is the case when TNF-α is locally present at high levels and

induces T cell antitumour immunity. However, it was later realised that TNF is an

endogenous tumour-promoting factor within the tumour microenvironment (Figure 1.3).

Figure 1.3: Signalling upon TNF-α stimulation. Effector proteins form a complex

bound to the intercellular domain of TNFR. Signalling can either lead to NF-κB

activation or trigger the caspase cascade, dependent on the recruitment of TRAF2 or

FADD to the complex respectively. It appears that TNF favours carcinogenesis within

the tumour microenvironment by promoting the ―mitogenic‖ pathway.

Importantly, TNF-α plays paramount role in both initiating and promoting

tumourigenesis. It can be produced by macrophages, tumour and stromal cells and most

likely by all three. Sustained production of TNF-α at tumour sites causes chronic

inflammation and leads to malignant transformation via NF-κB mediated proliferation

25

of neoplastic cells and induction of pro-inflammatory mediators. Moreover, TNF-α may

directly promote malignant transformation inducing oxidative DNA damage, as

observed in a murine cancer model. In any case, TNF-α enhances tumour progression

and invasion by up-regulating cytokines, chemokines, MMPs and anti-apoptotic

molecules (51).

The mechanism by which TNF-α is constitutively produced in cancer cells

remained obscure for several years after its characterisation as a cancer promoting

cytokine. pVHL (von Hippel-Lindau) tumour suppressor has been reported to function

as TNF-α translational repressor in renal cell cancer cells (55). pVHL is often mutated in

renal cancer cells implying that cytokines acquire functional advantage in cells bearing

mutated tumour suppressor genes (55).

1.4.2 Inflammation and hypoxia

Hypoxia, a common feature of inflammatory solid tumours, is a condition of low

oxygen tension that alters the gene expression profile of genes involved in the regulation

of metabolism, angiogenesis, tissue remodelling, proliferation and apoptosis (56). The

primary mediator of transcriptional activation by hypoxia in mammals is the

transcription factor complex HIF-1 (hypoxia inducible factor 1), a heterodimeric

complex of HIF-1α and HIF-1β. HIF-1α belongs to the basic helix-loop-helix Per-

ARNT-Sim (bHLH-PAS) superfamily and is an 826 amino acid protein (57). HIF-1β

subunit, also known as aryl hydrocarbon receptor nuclear translocator (ARNT), is

constitutively expressed in the nucleus whereas the HIF-1α subunit and its isoforms

HIF-2α and HIF-3α are oxygen sensitive (58). The bHLH domain accounts for the

dimerization of α and β subunits while the PAS domain mediates specific DNA binding

of the transcription factor to its targets. Additional regulatory domains of HIF-1α are the

amino-(N) and carboxy-(C) terminal transactivation domains (N-TAD and C-TAD

respectively) that are bridged by a central inhibitory domain (ID) (59). HIF-1α is post-

translationally modified in the presence of oxygen by the Prolyl hydroxylase (PHD)

26

which hydroxylates proline 402 and 564 of HIF-1α. These modifications are required

for the interaction between HIF-1α and the pVHL tumour suppressor which mediates

HIF-1α protein degradation through its E3 ubiquitin-protein ligase activity.

Hydroxylation of HIF-1α asparagine 803 by the arginine hydroxylase FIH (Factor

inhibiting HIF-1α) regulates its transcriptional activity since this modification prevents

the interaction between HIF-1α and the transcriptional cofactor complex CBP (CREB

binding protein)/p300 (reviewed by 60). Low O2 concentration is a restrictive factor for

the activity of the afore mentioned hydroxylases, leading to protein stabilisation of the

HIF-α subunits (58) (Figure 1.4).

Figure 1.4: Structural organisation of HIF-1α (61) and mechanism of its protein

stabilisation and transcriptional activity under low oxygen concentration via the PHD

and FIH hydroxylase activity respectively.

27

The stabilized HIF-α translocates into the nucleus, dimerizes with HIF-1β

subunit, binds to hypoxia responsive elements [HRE, 5’(A/G)CGTG 3’] present within

the regulatory domains of the promoters of its target genes (62), thereby inducing their

expression (Figure 1.4). Among the genes included in the long list of HIF transcription

targets are genes encoding for metabolic enzymes, glucose transporters, growth factors,

inflammatory cytokines and chemokines (58). Hence, it is obvious that cellular

responses to hypoxia involve induction of genes regulating critical aspects of cancer

biology such as proliferation, angiogenesis, invasion, glucose metabolism and apoptosis.

HIF-1α is overexpressed in common cancers such as breast, colon, ovarian,

pancreatic and lung (63). HIF-1 promotes tumour cell growth and metastasis by

upregulating multiple growth factors such as TGF-β and VEGF (64). Tumour-derived

VEGF promotes angiogenesis and solid tumour expansion (65). Increased angiogenesis

due to VEGF production mediated by hypoxia is also reported in TAMs (66). Moreover,

HIF-1α induces the expression of CXCR4 in tumours cells and human microvascular

endothelial cells. CXCR4 is upregulated by hypoxia in renal carcinoma (67), myeloma

(68), ovarian and breast cancer cells (69).

Cytokines, primary TNF-α and IL-1β, have recently been shown to mediate

MAPK activation and ultimately result in biosynthesis and stabilization of HIF-1α in

normoxic conditions (70). IL-1β mediated upregulation of HIF-1α via the NF-κB

pathway also provides evidence for a link between inflammation and oncogenesis (71).

NF-κB, as a general stress-responsive transcriptional factor, is known to respond to

hypoxia although to a lesser extend compared to HIF-1 (56). Many genes encoding for

cytokines involved in angiogenesis (VEGF, TNF, bFGF) have NF-κB binding sites in

their promoters, underlying a link between immunity and the cellular response to

hypoxia. In vitro studies have shown that HIF-1α transcriptional activity is under NF-κB

control (72). Taken together these observations imply that chronic inflammatory

conditions activate transcription factors that induce the production of mediators

responsible for the establishment of a tumour-promoting environment and further

production of pro-inflammatory molecules.

28

1.4.3 The p53 tumour suppressor in inflammation

Two of the hallmarks of cancer cells are their capability to evade apoptosis and

replicate limitlessly (2). Deregulation of cell cycle control, DNA repair and apoptosis

are often attributed to genetic mutations in the p53 tumour suppressor gene. Such

mutations are observed in more than half of human cancers (73). p53 encodes for a

transcription factor that plays key role in inducing cell cycle arrest and apoptosis under

diverse types of genotoxic stress. The 393 amino-acid p53 protein in humans comprises

of three primary domains with well-defined functional significance. Its N-terminal

region contains the transactivation domain which exerts multiple regulatory roles by

interacting with regulatory proteins and co-activators. The central DNA binding domain

of the protein interacts with the p53 consensus DNA binding sequence [5'-Pu Pu Pu C

(A/T) (T/A) G Py Py Py-3' (Pu=A/G, Py=T/C)] present within the regulatory region

of the promoters of its target genes (74) The C-terminal region comprises the

oligomerization domain, responsible for the tetramerization of p53 molecules, and the

negative auto-regulatory domain. Numerous post translational modifications at this

domain regulate p53’s ability to bind to DNA core domain (75).

The availability of p53 is a pivotal parameter for the cellular response to a

variety of stresses. In unstressed cells, p53 levels remain low via an autoregulatory

feedback loop regulated by the oncoprotein murine double minute (MDM2). MDM2 is

induced by p53 and in turn, it suppresses p53’s transactivational activity on target genes

by binding to its transactivation domain. Moreover, MDM2 enhances p53’s degradation

rate via ubiquitination and proteasomal degradation (76). However, under DNA damage

conditions certain post translational modifications affect the formation of p53-MDM2

complex. Kinases phosphorylating both p53 and MDM2 on serine residues block the

interaction between these proteins and prevent MDM2 mediated p53 downregulation.

ATM (ataxia telangiectasia mutated) and/or ATR (ATM and Rad3 related) kinases

phosphorylate p53 at serine 15 and induce other kinases such as Chk1 (checkpoint

kinase1) and Chk2 (checkpoint kinase2) to phosphorylate p53 at serine 20 (reviewed by

77) (Figure 1.5). ATM also reinforces p53 accumulation by phosphorylating MDM2 at

29

serine 395 (78). Stabilized p53 protein is free to bind to specific DNA sequences and

modulates the expression of genes involved in cell cycle arrest (p21, GADD45) and

DNA repair (p53R2) or apoptosis (BAX, PUMA, NOXA) (79).

Figure 1.5: Depiction of p53 protein domain organisation. Residues that participate in

the regulation of p53’s activation or degradation are indicated (adapted from 80).

Mutated p53 pathway is ineffective in regulating the fidelity of cell division and

predisposes cells to tumourigenesis. Most mutations are observed in the central-DNA

binding-domain of the protein and strongly alter its function as transcription factor (75).

p53 mutants bind DNA targets in a structure-selective mode, rather than sequence

specific (81). In hypoxic tumours, wild type p53 mediates both apoptotic cell death and

anti-angiogenic effects by repressing HIF-1α, VEGF (82) and CXCR4 (83). Thus, p53

loss of function mutations can be oncogenic not only by reducing the apoptotic rate but

in a tumour-environment related mode as well. Furthermore, free radicals (ROS, NOS)

that are generated within the tumour microenvironment by pro-inflammatory mediators

(IL-1β, TNF-α) can directly modify p53 (both at gene and protein level) leading to

insufficient DNA repair and clonal expansion of pro-cancerous cells (84). The

inflammatory environment activates components of the p53 pathway (COX-2, NOS)

and at the same time produces mutations on the gene, abolishing its protective function

(85). Mutations that diminish or remove p53 pro-apoptotic ability allow inflammation

and NF-κB to exert their tumour-promoting effects (86).

30

In the absence of p53 mutations other molecular regulators suppress wild type

p53 transcriptional activity, thus leading again to cancer development. Macrophage

migration inhibitory factor (MIF), a cytokine produced by macrophages at sites of

inflammation, functionally inactivates p53 by inhibiting its transcriptional activity (87)

providing another link between inflammation and oncogenesis. Since p53 is not down-

regulated at the protein level, Petrenko and colleagues speculated that MIF might

inactivate the function of p53 by modulating the ability of the transcription factor to

form complexes with co-factors, such as p300/CBP (88). p300/CBP is a p53 co-

activator with intrinsic HAT (histone acetyltransferase) activity that acetylates lysine

residues (K372, K373, K382) of the p53 C-terminal region (Figure 1.5) thereby

enhancing its binding affinity for a particular subset of its transcription targets (89).

p300/CBP also transactivates HIF-1α, implying that conditional recruitment of

p300/CBP to either p53 or HIF-1α may differentially regulate cellular response since it

is known that hypoxia-induced MIF amplifies HIF-1 dependent transcriptional activity

in human cancer (90). Functional crosstalk between p53 and HIF-1α could similarly be

regulated by other pro-inflammatory cytokines promoting tumourigenesis.

1.4.4 Histone acetyltransferase activity, cancer and inflammation

Diverse transcription factor co-regulator (repressor/activator) complexes

participate in the modulation of gene expression in response to environmental as well as

intracellular signals (91). Gene expression is fine tuned via post translational

modifications such as acetylation, methylation, phosphorylation, ubiquitination,

occurring either on histones or on transcription factors which are mediated by these

multi-protein co-regulatory complexes (91). The p300/CBP complex is one of the

histone acetyltransferase family members (HATs) (92) and has been shown to

transactivate transcription factors involved in inflammation such as NF-κB (93), and

p53 (89). The p300/CBP associated factor (PCAF) and the steroid receptor co-activator

31

(SRC-1) both possess intrinsic histone acetylatranferase activity and have been shown to

regulate p53’s and HIF-1α mediated transcription (94, 95, 96).

Acetylation refers to the covalent post-translational modification of proteins and

is a major modulator of protein function and transcriptional regulation. Addition of

acetyl-groups (CH3-CO) on lysine residues of histones neutralizes their positive charge

resulting in a more ―relaxed‖ chromatin structure which allows access of the basal

transcription machinery to DNA and hence facilitates transcription initiation (97). Thus,

acetylation has been linked to increased transcriptional activity and deacetylation

mediated by histone deacetylases (HDACs) with transcription repression (98).

Initially it was thought that acetylation occurs only on histone substrates but it

was later realised that other proteins, including transcription factors, can also be

modified by HATs providing evidence that lysine acetylation holds a key role in gene

regulation. Epigenetic mechanisms that directly affect gene transcription at the

chromatin level or transcription complexes determine the equilibrium between

acetylation and deacetylation which controls both physiological and pathological

processes (92). Indeed, eukaryotic HATs and HDACs are involved in diverse processes

ranging from replication, DNA repair and apoptosis to metabolism and intercellular

signaling (99).

In accordance with the notion that proteins possessing HAT activity often exist

in multiprotein complexes along with other HATs and transcription factors and regulate

gene expression by acting on histone and non-histone targets, it is well established that

SRC-1, PCAF and p300/CBP interact with each other and form complexes with

additional trans-regulating factors (100). SRC-1 belongs to the p160 SRC family of

nuclear hormone receptor (NR) co-activators that induce transcription via their intrinsic

acetylatransferase activity (101). In addition to NR co-activators, all three homologous

members of this family (NCoA-1/SRC1, NCoA-2/TIF2/GRIP1 and NCoA-

3/p/CIP/ACTR/AIB) serve as co-activators of multiple transcription factors including

p53, NF-κB, HIFs, STATs and E2F1 (102). Structurally, SRCs comprise of three

domains (Figure 1.6): the bHLH-PAS domain at their N-terminal end, two

transactivation domains (AD) at their C-terminal and a central LXXLL motif (where L

is leucine and X any amino-acid). The bHLH-PAS domain is similar to the one present

32

in the HIF-1α, conserved among the p160 family members and required for the

interaction of these co-factors with other DNA-bound proteins (rather than DNA itself)

as well as for the hetero- and homo-dimerization with members of the SRC family in

response to hormonal stimuli (103). Moreover, upon hormonal stimuli the centrally

located LXXLL motifs mediate the efficient binding of SRC co-activators to nuclear

receptors on the promoters of target genes via amphiphatic α-helical structures (104).

However, the transactivation function and HAT activity of p160 co-activators are

ascribed to the C-terminal domain of the protein that contains the AD1 and AD2

domains. This region interacts with factors that possess strong HAT activity and are

essential for SRC-mediated transcription, predominantly p300/CBP (105) and PCAF,

and histone modifying enzymes such as co-activator-associated arginine

methyltransferase 1 (CARM1) and protein arginine N-methyltransferase 1 (PRMT1).

Figure 1.6: Representation of SRC-1’s structural organisation (106). The SRC-1

functional and interaction domains with the transcription factors NR, HIF, p53 and co-

factors PCAF, CBP/p300 are highlighted.

33

Aberrant expression of SRCs accompanied with any functional consequences,

has been extensively reported in human solid cancers (102). Potential interconnection

between SCR-3 and p53 pathways is highlighted by the existence of positive correlation

of high co-activator expression with p53 staining in breast and colorectal cancer

specimens (107, 108) although in such cases overexpressed SRC-3 possibly correlates

with transcriptionally compromised p53 (94).This notion combined with the observation

that its homologue SRC-1 potentiates p53-mediated transcription in the same ovarian

cancer experimental model (94) indicates the importance of the formation of temporal

differential co-factor complexes in regulation of gene transcription. In the context of

important solid cancer biological characteristics, Carrero and colleagues demonstrated

that SRC-1 and CBP synergistically stimulate HIF-1α activity in a hypoxia-dependent

manner (95). The same authors also investigated the contribution of the activity of each

one of these cofactors to HIF transactivation and concluded that both SRC-1 and CBP

are required for it. In line with these observations, interaction between CBP and HIF-1α

is essential for the recruitment of SRC-1 to the HIF complex in hypoxic cells (109).

SRC-1, as part of the macromolecular complex with CBP, has also been shown to

mediate the transcriptional regulation of some STAT factors (110). Overall, SRC-1 is

implicated in a variety of human solid cancers via its co-activator function which

regulates the expression of genes involved in proliferation and metastasis (102).

1.4.5 Histone deacetylase activity, cancer and inflammation

Lysine acetylation is a reversible procedure and perturbations of the equilibrium

between addition and removal of acetyl-groups on histone and non-histone substrates is

crucial for cell homeostasis and pathogenesis. Deacetylation mediated by HDACs has

been correlated with gene silencing and decreased protein stability/activity (97, 111).

HDACs can be categorized into two families and further classified into four classes (I-

IV) (112, 113). HDAC class I comprises of the HDACs 1, 2, 3 and 8 and its members

are closely related to the deacetylase Rpd3 found in yeast (Saccharomyces Cerevisiae).

34

HDACs 4, 5, 6, 7, 9 and 10 are similar to the yeast deacetylase Hda1 and form class II

while a more recently identified member, HDAC 11, alone forms class IV of

deacetylases. Classes I, II and IV collectively constitute the classical Zn2+

-dependent

HDAC family. The last class (class III HDACs) comprises of seven members namely

Sirtuins (SIRT1-7) and is the NAD+-dependent HDAC family. The fact that sirtuins

require NAD+ in order to exert their deacetylase activity suggests that these enzymes are

sensors of the cellular redox status and coordinators of cellular energy metabolism

(114). Indeed, yeast Sir2 which is the founding member of this highly conserved family

of proteins has been shown to promote longevity (115). SIRT-1 (silent mating type

information regulation 2 homolog) is the most extensively studied member of the

sirtuins family (115). All human SIRTs are characterised by the presence of a conserved

calatylic core domain that possesses the NAD+-dependent deacetylase activity (Figure

1.7).

Figure 1.7: Representation of SIRT-1’s structural organisation (116) and SIRT-1

mediated regulation of cell viability upon deacetylation of target transcription factors

(p53, HIF1-α, FOXO, NF-κB) by its catalytic domain.

35

In mammalian cells, SIRT-1 not only epigenetically regulates transcription via

deacetylation of histones H3 and H4, but also targets numerous key transcription factors

and regulators including p53, HIF-1α, forkhead transcription factors (FOXOs), nuclear

receptors, NF-κB and PCAF (117) (Figure 1.7). So far a wide range of SIRT-1

substrates has been identified, implicating this HDAC in the regulation of a variety of

cellular responses ranging from metabolism and inflammation to cell death. SIRT-1

dependent deacetylation of the tumor suppressor p53 hinders p53-induced apoptosis in

response to genotoxic/oxidative stress (118). SIRT-1 mediated deacetylation of FOXO3

and FOXO4 results in growth arrest and survival instead of death (119,120). In addition,

deacetylation of NF-κB by SIRT-1 represses NF-κB mediated responses and sensitizes

cells to apoptotic death upon TNF-α stimulation providing a link between SIRT-1 and

pro-inflammatory signalling (121). SIRT-1 has been shown to interact and deacetylate

HIF-1α (122) thereby suppressing HIF-1α transactivating ability. In conclusion, SIRT-1

by deacetylating a plethora of downstream effectors within cells exerts contradicting

effects in cancer (123, 124).

1.5 Breast cancer

Breast cancer accounts for the highest mortality rate in women among cancers

worldwide (125). The vast majority of breast cancer cases are caused by genetic

mutations that accumulate during an individual’s lifetime rather than are inherited.

Genes encoding for growth factors, cell cycle regulators, apoptosis mediators and

signalling molecules are commonly mutated or deregulated during carcinogenesis of

breast. Human breast carcinogenesis is characterized by abundant leukocyte infiltration.

Chronically activated B and T infiltrating lymphocytes, present at appreciable rates in

both ductal carcinoma in situ (DCIS) and invasive breast cancer, secrete factors (TNF-α,

IL-6, IL-10, IL-4, IL-13, TGF-β) that manoeuvre innate cellular responses towards

tumour proliferation (126). Furthermore, neoplastic cells themselves express cytokines

36

and their receptors, for instance IL1, IL6, TGF-β and their receptors, thus contributing

to tumour progression.

IL-2 and IFN consist the most used cytokines as therapeutic anti-tumour agents

because they stimulate cellular immunity against cancer. Clinical trials using IL-2 and

IFN alone, together or in combination with other anti-cancer molecules are in progress

and their results are being evaluated (127). IFN is widely used as treatment in breast

cancer patients because its action inhibits cancer cell proliferation and invasion and also

enhances estrogen-dependent therapy.

Estrogens, the steroid hormones that regulate reproduction and female

physiology, are widely implicated in breast carcinogenesis. Two complementary

mechanisms have been proposed for the carcinogenicity of estrogens in the mammary

gland: genotoxic intermediates of estrogen metabolism and ER signalling pathways can

potentially affect cell proliferation and apoptosis, contributing to cancer development

and progression (128). The ER-independent mechanism involves generation of

oxidative stress (ROS) and induces DNA damage and altered gene expression that may

trigger cancer initiation (129). Clinically, ER positive breast tumours correlate with

favourable prognosis and responsiveness to hormone therapy, despite the fact that

estrogens exert mitogenic activity on breast cells (130). ER signalling could possibly be

involved in pathways that inhibit cancer development. The role of cytokines is still

elusive in ER mediated tumour promotion. Chavey and colleagues postulated a down-

regulation of cytokines by ER, since high levels of multiple cytokines including IL-6,

IL-8, IL-10, TNFα, CCL2 were detected in ER negative breast carcinomas (25).

However, positive regulatory crosstalk between CXCR4-CXCL12 and ER (both α and β

isoforms) signalling pathways has been reported (131) and is of great biological

significance if taken into consideration with the well established role of the CXCR4-

CXCL12 axis in metastasis. Notably, SRC-1 participates in the afore-mentioned ER-

dependent CXCL12 transactivation, fact that implicates ER signalling in invasion of

breast cancer as well as early steps of breast tumourigenesis.

The SRC-1 co-activator along with other transcriptional co-factors, including

p300/CBP, activates ER transcriptional activity. In fact, recruitment of p300/CBP by

37

SRCs to the chromatin is essential for SRC induced transcriptional activity (102). In

vitro studies indicate that overexpression of SRC-1 in breast cancer cells stimulates

estrogen-mediated cell proliferation (132). Upregulated SRC-1 in breast cancer and its

subsequent transactivating activity is also linked to mammary tumour metastasis and

increased macrophage recruitment at the tumour site (133). SRCs are also co-activators

for other transcritpion factors, apart from nuclear receptors (102). Functional interplay

between SRC-1, NF-κB, HIF-1α and p53 regulate many different aspects of

tumourigenesis. For instance, CXCR4 is found to be up-regulated by HIF-1α (69) and

indirectly repressed by p53 (83). Thus, crosstalk between co-factors has paramount

importance for the gene expression profile in tumour associated inflammatory

environments and the promotion or repression of tumour progression. Pro-inflammatory

cytokines and mediators may alter the levels and recruitment of transcription factors in

favour or against breast carcinogenesis.

SIRT-1, the firstly discovered member of the NAD+ dependent deacetylase

family, was recently proposed to play a role in estrogen-mediated mammary

carcinogenesis via the attenuation of estrogen-IGF-1-signalling observed in SIRT-1

deficient mice (134). Although the contribution of SIRT-1 to breast tumorigenesis is

still ambiguous, there are indications that SIRT-1 exerts an oncogenic effect in breast

cells via silencing of tumour suppressive genes (135). Moreover, in human breast cancer

MCF-7 cells SIRT-1 expression affects the apoptosis-related factors NOXA and Bcl-2

in an apoptosis favouring mode (136). Being a transcription factor regulator, SIRT-1 has

been also implicated in inflammatory signalling. However, to our knowledge there are

only reports connecting cytokine expression with SIRT-1 in non-cancerous cells. MMP9

is negatively regulated by SIRT-1 in macrophage-like cells (137) while microarray data

show compromised CXCR4 and MMP14 expression in SIRT1 silenced human

endothelial cells (138).

38

1.6 Therapeutic approaches

Over the past years, the hypoxic nature of solid tumours has been implicated in

the reduced efficiency of the conventional chemotherapies (64). Oxygen deprivation

dramatically reduces the cytotoxic effects of the therapeutic agents, contributing to

chemotherapy resistance of cancer cells. The perspective of alternative therapeutic anti-

cancer strategies has orientated towards HIF-1 and components of the hypoxic pathway

in general. HIF-1α is a primary target for cancer therapy because activation of HIF-1α is

a key event in the process of carcinogenesis that influences a great variety of cellular

functions. Targeting HIF-1α directly, using molecular inhibitors, or targeting upstream

cellular events and/or molecules that activate HIF-1α have been extensively used for

clinical trials. However, use of HIF-1 inhibitors has been linked to elevated toxicity, due

to inhibition of HIF’s activity in physiological processes, so research has focused on

chemoprevention strategies that target pathways aberrantly activated by hypoxia, such

as glycolysis and angiogenesis (139).

Lately, emphasis has been given on therapeutic approaches that target the

tumour microenvironment and some of its components that support tumour growth; not

the cancer cells. Anti-angiogenic, anti-vascular and immune therapies are novel

strategies to battle cancer and involve inhibition of expression of cytokines, chemokines

and growth factors secreted by infiltrating and stromal cells. The anti-tumour function of

certain cytokines, such as IL-2 and IFN, has been successfully applied in patients with

various types of cancer. TNF has also shown anti-cancer/anti-vascular activity at certain

level when locally expressed, but yet systemic toxicity remains a major side effect.

Instead, due to increasing data pleading for TNF’s role in tumourigenesis, anti-TNF

therapies are being used against cancer. Furthermore, novel strategies using cytokine

derivatives that specifically target cancer cells are under investigation (140).

Long term use of non-steroidal anti-inflammatory drugs (NSAIDs) such as

aspirin have a chemopreventive effect and reduce the risk of certain cancers (colorectal,

lymphomas, lung, gastrointestinal) (141). However, reduction of breast cancer risk

associated with use of non-steroidal anti-inflammatory drugs is still ambiguous (142).

39

These drugs exert their biological activity by both COX-2 dependent and independent

mechanisms: inhibition of COX-2 as well as donwregulation of NF-κB activity may

induce apoptosis and inhibit angiogenesis (141, 143). It has become obvious that

targeting the inflammatory microenvironment of tumours can improve the clinical

outcome for cancer patients and furthermore, appropriate combination of these therapies

may provide highly efficacious therapeutic effects.

1.7 Hypothesis and aims of the project

The cellular levels of cytokines and cytokine receptors are rate limiting factors in

the outcome of several chronic inflammatory diseases including cancer and therefore the

study of the mechanisms regulating their levels is the centre of several investigations, since

the need to balance cytokine cellular levels is very important for the prognosis and cure of

chronic inflammatory diseases (23). Knowing that many cytokines involved in chronic

inflammatory conditions both promote oncogenesis and prevent cellular growth (43) we

were interested to monitor the expression pattern of pro- and anti-inflammatory cytokines

and their receptors in breast cancer cells, study how their levels correlate with diverse types

of stress conditions (DNA damage/ hypoxia mimicking) and dissect the molecular

mechanisms involved in the determination of their cellular levels.

The presence of multiple putative HREs in the regulatory region of the promoters of

IL-10, TNF-α and CXCR4 was identified using bioinformatic analysis and implies that

hypoxia responsive transcription factors may be implicated in their transcriptional control.

It has been shown that all three inflammatory factors are overexpressed in various types of

cancer including breast cancer (25, 36, 127, 42). Hypoxia has been reported to favour

cancer progression by up regulating CXCR4 and TNF-α expression in cancer and tumor

infiltrating cells (69,144). Moreover, within stressed cells p53 induces anti-metastatic

pathways by modulating CXCR4 (83) and its apoptotic potential is modified by TNF-α (84).

The regulation of IL-10 by hypoxia and DNA-damage in cancer cells is less clear. In

40

particular although hypoxia upregulates IL-10 levels in macrophages (145) an inverse

correlation between IL-10 and p53 expression has been documented in breast cancer

patients (146).

To shed light on the molecular mechanisms governing cytokines expression, the

contribution to the regulation of CXCR4 cellular levels of two modulators targeting both

HIF-1α and p53 with opposing functions, namely SRC-1 and SIRT-1, was investigated.

SRC-1 has intrinsic HAT activity whereas SIRT-1 is a NAD+ dependent deacetylase and

both modulators are involved in breast carcinogenesis. The role of SCR-1 and SIRT-1 in the

determination of the CXCR4 cellular levels was assessed in breast cancer cells treated with

etoposide and/or DSFX with the aim to evaluate the effects of these modulators in cancer

progression and identify possible signalling pathways that could be exploited in anti-cancer

therapy.

41

CHAPTER 2: MATERIALS AND METHODS

All chemicals were purchased from SIGMA (Sigma-Aldrich, Dorset UK) except for

TEMED (Biorad, Hertfordshire UK), acrylamide (National Diagnostics, Hull UK), APS

(Flowgen, Leicestershire UK), low EEO agarose (MELFORD, Ipswich UK), Nonident P40

(BDH Merck, Dorset UK), glycerol (BDH Merck, Dorset UK), LB broth Lennox L

(Invitrogen, Paisley UK), SDS (Fisher, Leicestershire UK), glycine (Fisher, Leicestershire

UK), Tris base (Fisher, Leicestershire UK), NaH2PO4 2H2O (Fisher, Leicestershire UK).

For tissue culture, DMEM medium and trypsin-EDTA solution were obtained from Sigma-

Aldrich (Dorset UK), FBS and penicillin/streptomycin from Gibco (Paisley UK). Western

blotting was performed using Mini-Protean system (Biorad, Hertfordshire UK). DNA

electrophoresis was performed using Mupid ex-u appliance (Takara). Reagents for PCR

were supplied from NEB (Ipswich UK) and primers from Eurofins MWG (London UK).

Reagents for restriction digestion and ligation reactions were supplied from Roche

Diagnostics (GmbH Germany).

2.1 Cell culture, chemical treatments and constructs

The human breast carcinoma cell lines MCF-7 (p53+/+) and MDA-MB-231 (p53-/-)

(obtained from ECACC) were routinely maintained in Dulbecco’s modified Eagle’s

medium (DMEM), supplemented with 10% foetal bovine serum (FBS) and 1%

penicillin/streptomycin (10 U/ml) at 37˚C and 5% CO2. Both cell lines are adherent, so

subculturing them involved trypsinization (enzymatic method) using trypsin-EDTA

solution (2mls per T75 flask), incubation for 2-3 minutes at 37 C and resuspension of the

cells in fresh medium.

42

In order to investigate the effect of HIF-1α and p53 transcription factors on the

expression of inflammatory genes, we treated the cells with chemical compounds known to

induce the transcriptional activity of these factors within the cells (147, 148). Etoposide

(Etop) is widely used in research as a DNA damage mimicking agent. Etoposide is

classified as a topoisomerase II inhibitor that binds to the respective enzyme and inhibits its

function in ligating DNA molecules. Its action results in accumulation of single- and

double-strand DNA breaks, inhibition of DNA replication and cell death. Etoposide

stabilizes p53 protein via a mechanism that involves inhibition of the p53-MDM2

autoregularory feedback loop (149). Etoposide was used at final concentration 10μM. For

hypoxia mimicking conditions, cells were treated with the chelator desferrioxamine

(DSFX). DSFX is involved in iron metabolism and acts as a chelating agent that binds to

free iron (trivalent iron) and forms a stable complex. DSFX is widely used as a hypoxia

mimicking agent due to its ability to prevent the cells to use the oxygen present in the

environment and hence inhibit the degradation of HIF-1α and induce its accumulation in the

cell. In terms of the mechanism that allows HIF-1α stabilisation, DSFX attenuates the

enzymatic activity of hydroxylases (PHD, FIH) due to the fact that iron is an essential

component of hydroxylation reactions (150). DSFX was used at final concentration of

250μM. In all experiments where the use of these compounds is mentioned cells were

treated with 10μM etoposide and 250μM DSFX for 16 hours, unless otherwise stated.

In experiments requiring expression of exogenous DNA, cells were transiently

transfected using the Polyfect transfecting reagent (QIAGEN, Sussex UK), according to the

manufacturer’s instructions. Constructs used for exogenous expression included the control

pcDNA3 vector (96), β-galactosidase expressing vector (96), HA-SRC-1 (151) and Flag-

SIRT-1 (Addgene, Cambridge MA) tagged expressing vector.

43

2.2 Western blotting

Western blot, also termed protein immunoblot, is an analytical method used for the

identification and/or quantification of specific proteins from the crude cellular extract (152).

Several alternative protocols exist for a range of applications, all of them including 3 steps:

separation of proteins according to their molecular size by electrophoresis on a

polyacrylamide gel (SDS-PAGE), transfer of proteins on to a polyvinylidene difluoride

(PVDF) or nitrocellulose membrane and detection of the protein of interest using

appropriate antibodies.

2.2.1 SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel

electrophoresis)

This technique is used for the electrophoretic separation of proteins from the whole

cellular extracts according to their molecular size. A polyacrylamide gel acts as molecular

sieve allowing proteins from the same sample to migrate under the application of electric

current. Proteins that are purified from the cellular extracts are mixed with sample buffer

that contains the anionic detergent sodium dodecyl sulfate (SDS). SDS acts by disrupting

the non-covalent bonds of the proteins, thus denaturing them and leaving them void their

native conformation. Proteins in their primary structure are coated uniformly by the

negative charges of SDS with an approximate ratio of 1.4g SDS per 1g protein which gives

all SDS-bound proteins roughly the same charge to mass ratio and hence equal mobility in

an electric field. Under these conditions, small proteins migrate faster through the pores of

the gel and larger proteins slower, since their migration during electrophoresis is solely

determined by their molecular weight. A sample containing a mixture of proteins of known

44

molecular weights (protein marker/ladder) allows comparison of the molecular weight of

these proteins with those present in the cellular extract resolved by electrophoresis.

Polyacrylamide gel is a good matrix for electrophoresis of proteins due to its tight-

pore properties, comparatively to agarose gels. Acrylamide is a chemical compound with

formula CH2=CHCONH2 whose chemical polymerisation forms linear polyacrylamide

molecules. The formation of the gel requires a mixture of acrylamide with the cross-linking

agent bisacrylamide that introduces links between poluacrylamide chains. The total amount

of acrylamide as well as the ratio bisacrylamide/acrylamide determine the size of the pores

of the gel. Thus, those two factors should be taken into consideration in respect of the size

of the protein to be analyzed. Generally, the amount of acrylamide correlates inversely with

the size of the pores of the gel. This means that gels with high percentage of acrylamide are

suitable for resolution of small proteins while low pecentage gels give better resolution of

large proteins. Polymerisation is initiated by the addition of ammonium pesulphate (APS)

and N-N-N’-N’ tetramethylenediamene (TEMED), with the latter acting as a catalyst by

promoting the production of free radicals by APS. Acrylamide mixtures are poored between

two glass plates placed on the casting stand of the electrophoretic apparatus so as to form a

thin gel at the top of which a comb, that helps form the wells for sample and marker loading

after polymerisation, is placed. Discontinuous SDS-PAGE is the commonest protocol

(classical Laemmli protocol) where the gel is cast between the glass as two gels of different

acrylamide and buffer concentrations: the resolving gel (high concentration), serving the

proper resolution of the proteins, topped by the stacking gel (low concentration) that is

important for the concentration of the proteins in a thin stack so they can smoothly enter the

resolving gel. Tracking of the electrophoresis is achevied by adding a dye (usually

bromophenol blue) to the samlpe buffer.

Total protein was extracted from cells treated/transfected appropriately. Initially

cells were washed twice in ice-cold phosphate buffered saline (PBS). Cells were then

scraped on ice in high salt lysis buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM

EDTA pH 8, 0.5% NP-40, 1% Triton X-100, 1 mM) containing 1μg/ml protease inhibitor

cocktail (pepstatin, aprotinin, and leupeptin) and 1 mM phenylmethylsulphonyl fluoride

(PMSF). Cell lysates were transferred to sterile tubes, rotated at 4˚C for 30 minutes and

insoluble material was pelleted by centrifugation at 4˚C for 20 minutes. The supernatant of

45

each sample containing the proteins was transferred to fresh tube. The relative

concentration of each protein sample was estimated based on the colorimetric Bradford

assay: 200μls Bradford reagent (Bio-Rad protein assay) were diluted 1:5 in ddH2O in a

cuvette and 2μls of protein sample were added. Reactions were mixed and left 2-5 minutes

at room temperature before the absorbance at 595 nm wavelength was measured using a

spectrophotometer (Beckman DU640). Equal amounts of protein for each sample were

transferred to fresh tubes and 3xSDS sample buffer (62.5 mM Tris-HCl pH 6.95, 2% SDS,

10% glycerol, 5% β-ME, bromophenol blue) was added to a final concentration of 1x.

Samples were boiled at 95˚C for 5 minutes and were either used for SDS-PAGE

immediately or stored at -20˚C for several days.

For electrophoresis, 7.5% polyacrylamide gels were prepared as described in Table

2.1:

RESOLVING GEL STACKING GEL

Acrylamide 4.43 ml 2.24 ml

ddH2O 2.33 ml 0.556 ml

1.5 M Tris-HCl (pH 8.95) 2.33 ml —

1 M Tris-HCl (pH 6.95) — 0.416 ml

0.2M EDTA 93 μl 33.3 μl

10% SDS 93 μl 33.3 μl

10% APS 52.3 μl 33.3 μl

TEMED 5.66 μl 3.33 μl

Table 2.1:Reagents and volumes used for preparing one 7.5% polyacrylamide gel

(resolving and stacking).

Mixtures were poured between the glass plates casted on the stand and left to

polymerasize. After 20-30 minutes, the stacking gel was prepared and poured on top of the

resolving, with the comp being fitted immediately on top of it. After gels had set, the stands

were placed in the tank filled with SDS running buffer (25 mM Tris base, 191 mM glycine,

0.1% SDS) and the boiled protein samples were loaded on the wells along with the

prestained protein marker (NEB, Ipswich UK). The gels run at 80 volts for approximately

46

20 minutes (until proteins passed the stacking gel) and then at 110 volts for another 50-80

minutes (depending on the desired resolution).

2.2.2 Electroblotting and detection

After being separated by electrophoresis, proteins were transferred on to membranes

(electroblotting) by the following assembly: the polyacrylamide gel was placed up against

the membrane in between the cassette assembly (Figure 2.1), which when placed in the tank

should have the following order from the cathode(-) to the anode(+): blotting sponge, filter

paper, gel, membrane, filter paper, blotting sponge. The tank was filled with the appropriate

buffer (transfer buffer) and application of electric current of specific volts and for specific

period of time to allow complete transfer of the negative charge coated proteins on to the

membrane.

Figure 2.1: Schematic assembly of the western blot apparatus depicting the proper

orientation of the blotting sandwich cassette in the tank for protein transfer (153).

47

After electroblotting, proteins are transferred on to a membrane with the exact order

they were resolved on the gel. Membranes were blocked in a bovine serum albumin

(BSA)/non-fat dry milk 5% solution for reducing the non-specific binding of the antibodies

that were used to identify the proteins of interest. After blocking, the incubation with the

primary and secondary antibodies took place using the appropriate dilution of the primary

and secondary antibodies (Table 2.2) in 2.5% non fat milk solution in 20% Tween-20.

Proteins were transferred to Millipore PVDF membrane (Fisher Scientific, Leicestershire

UK) by assembling the cassette as described in Figure 2.1. The cassette was placed in the

tank filled with transfer buffer (20% v/v methanol, 27 mM Tris base, 150 mM glycine) and

transfer was conducted at 0.4 amps for two hours. PVDF membranes were blocked in 5%

w/v non-fat dry milk in PBS solution for 1 hour at room temperature, rocking on a platform.

Membranes were incubated in primary antibody solution (2.5% w/v milk in 0.1% Tween-20

PBS) overnight at 4˚C rocking and next day they were washed three times in 0.1% PBS

Tween-20 for 10 minutes. Appropriate horseradish peroxidase-conjugated secondary

antibody solution (raised in the same species as primary) (2.5% w/v milk in 0.1% Tween-20

PBS) was applied on the membranes for 1 hour at room temperature and membranes were

washed three times in 0.1% Tween-20 PBS for 10 minutes. For the detection of horseradish

peroxidise (HRP) on the immunoblots, and thus the proteins of interest, SuperSignal West

Pico enhanced chemiluminescent substrate was used (Thermo-Scientific). This is a highly

sensitive non-radioactive chemiluminescent substrate that allows detection of HRP when

blots are exposed to X-rays. Exposure time of SuperRX X-rays films (FUJIFILM) varied

from a few seconds to several minutes, according to the desired optical result.

48

Antibody Clonality Supplier Dilution

HIF-1α Monoclonal Calbiochem (H1α67) 1:5000

p53 (DO-1) Monoclonal Santa Cruz (sc-126) 1:10000

CXCR4 Monoclonal R&D (MAB 721) 1:10000

SRC-1 Monoclonal Abcam (84) 1:5000

β-actin Polyclonal Abcam (8227) 1:10000

HA-11 Monoclonal Babco (Covance) 1:5000

Flag Monoclonal Sigma (M-20) 1:5000

Table 2.2: List of antibodies used in this study

2.3 Co-immunoprecipitation

Protein-protein interactions are of paramount importance in cell biology because

they are implicated in various intracellular signaling processes. Co-immunoprecipitation is

a widely used in vitro method for analysis of protein interactions. Immunoprecipitation

involves the precipitation of a specific antigen from a solution (usually the crude cellular

extract) using the respective antibody and a means of isolation of the complex from the

lysate, commonly a solid-phase support such as agarose beads. The proteins that stably

interact with the antigen of interest can be co-precipitated if the complex antibody-antigen-

interacting protein is captured on the solid support (Figure 2.2). Proteins that are not bound

to the solid support are washed away and those that interact with the antigen of interest are

eluted from the support and can by analyzed by SDS-PAGE and WB, as previously

described in chapter 2.2. Porous agarose beads are commonly used in immunoprecipitation

experiments due to their high capacity to bind antibodies. Moreover, beads are often coated

with bacterial protein A or protein G, which also have a high binding capacity for

immunoglobulins.

49

Figure 2.2: Schematic representation of co-immunoprecipitation assay. A sample

containing proteins (usually cell lysate) is incubated with an antigen-specific antibody, that

is also coupled with A or G proteins. The formed immunocomplexes consist of the protein

of interest as well as any interacting macromolecules and can be precipitated on a beaded

support to which protein A/G are immobilized. All proteins not precipitated are washed

away and the complexes of interest are eluted form the beaded support for further analysis

(154)

For immunoprecipitation experiments, MCF-7 cells were grown in 3-4 100mm

culture plates per treatment, treated appropriately and harvested in TNN buffer (50 mM Tris

pH 7.5, 120 mM/240 mM NaCl, 5 mM EDTA, 0.5% Ipegal, 1 µg/ml protease inhibitors

cocktail and 1 mM PMSF). TNN buffer is more appropriate for protein-protein interaction

studies due to its mild denaturating properties. 1/10 of the protein extract was kept for use

as input sample while the rest was subjected to immunoprecipitation with 1-2 μg of the

desired antibody and 20 μl pre-blocked (in BSA ) agarose A beads (Sigma-Aldrich, Dorset

UK) overnight. Next morning, beads were washed three times in 300 μl TNN buffer and

once in 500 μl PBS. Each wash consisted of rotation for 2-3 minutes at 4˚C and

centrifugation at 13000 rpm for 4 minutes at 4˚C. Finally, 30μl SDS loading buffer (3x)

50

were added to the beads and the proteins were eluted by boiling the samples for 5 minutes

at 95˚C. Input and IP samples were analysed by western blot, as previously described in

chapter 2.2.

2.4 Polymerase chain reaction

Polymerase chain reaction (PCR) is a simple, yet powerful and flexible, method that

allows exponential amplification of a specific DNA fragment within long, double stranded

DNA molecules. The enzymatic in vitro amplification of a specific sequence requires a pair

of synthetic oligonoucleotides (referred to as primers) designed to flank the sequence to be

replicated, a thermostable DNA polymerase that catalyzes DNA synthesis in a template-

dependent fashion (due to complementary base pairing), mixture of deoxynucleotide

triphosphates (dNTP’s) and a reaction buffer that contains Mg2+

, among others, which

favour the enzymatic reaction. The most common polymerase used for PCR is the heat-

resistant Taq polymerase, a 94 kDa protein isolated from the thermophilic bacterium

Thermus aquaticus that possesses 5’→3’ polymerase activity.

PCR is an experimental procedure based on three elements: denaturation of the

template, annealing of the primers to the complementary target sequence and primer

extension by the polymerase. Initial heating of the reaction mixture at 95˚C leads to

denaturation of the DNA molecules, permitting primers to anneal to the complementary

sequences on the single strands (usually on the 3’ ends of the target) when the temperature

decreases to 40-60˚C. Subsequent adjustment of the temperature (commonly to 72˚C for

Taq polymerase) is required for attachment of the polymerase to each priming site and

synthesis of complementary DNA using the 3’ -OH of the primers as starting point and

dNTP's. Elongation of the primers with 5’→3’ direction on both strands ensures that the

sequence they bracket will be copied. In each extension step, both the original as well as the

newly synthesized strands serve as template for the polymerase. Hence, repeated cycles of

denaturation, annealing and elongation lead to exponential amplification of the target

sequence.

51

PCR reactions were performed according to the following general protocol: 50-500

ng of template DNA were added to a mix that consisted of 0.25 mM dNTP's, 1x PCR

reaction buffer (ThermoPol buffer), 1.25 mM MgCl2, 0.3 μΜ forward primer (Table 2.3),

0.3 μM reverse primer (Table 2.3), 1 unit of Taq polymerase and ddH20 up to a total

reaction volume of 40μl.

Primer name Sequence (5’→3’) Tm (˚C) Assay used for

CXCR4 (F) ChIP CATGTGTCTCCCCCTTGAGT 59.4 ChIP

CXCR4 (R) ChIP TCCGCCTCTAAATTCAGACAA 55.9 ChIP

TNFα (F) ChIP CTGCCCAAGAAAGAAACCAA 55.3 ChIP

TNFα (R) ChIP AAAAAGGGAAGGCAAGAAGG 55.3 ChIP

IL10 (F) ChIP GGGTGGTCTCAATCTCCTGA 59.4 ChIP

IL10 (R) ChIP CCCTTΤGTATGGGAGCTCTG 59.4 ChIP

CXCR4 (F) CAGCAGGTAGCAAAGTGACG 59.4 qPCR

CXCR4 (R) ATAGTCCCCTGAGCCCATTT 57.3 qPCR

TNFα (F) AGCCCATGTTGTAGCAAACC 57.3 qPCR

TNFα (R) ATGAGGTACAGGCCCTCTGA 59.4 qPCR

IL10 (F) TTACCTGGAGGAGGTGATGC 59.4 qPCR

IL10 (R) GGCCTTGCTCTTGTTTTCAC 57.3 qPCR

Rpl19 (F) ATGTATCACAGCCTGTACCTG 57.9 qPCR

Rpl19 (R) TTCTTGGTCTCTTCCTCCTTG 57.9 qPCR

CXCR4 (F) LUC GGTACCGTGCACAAGTGCAGAGAAG

G

68 Construction of the

luciferase reporter

CXCR4 (R) LUC GAGCTCAAGAGGGGAGAAGGGAGGA

T

68 Construction of the

luciferase reporter

TNF (F) LUC GGTACCAGGGAAAGTCCCAAACCAAC 66.4 Construction of the

luciferase reporter

TNF (R) LUC GAGCTCGACATGGGAGCCTTCAGAAA 66.4 Construction of the

luciferase reporter

52

Table 2.3: Table summarizing the names and properties of all the primers used in PCR

reactions. Sequence, melting temperature and related experiment are indicated for each

primer.

Primers were designed using the Primer 3 input (version 0.4.0) program.

OligoAnanlyzer 3.1 IDT (Integrated DNA Technologies) was used to check for potential

hairpin, self-dimer and hetero-dimer formation. Primer pairs were also blasted against the

human genome using the NCBI blast tool to confirm their complementarity to the gene of

interest only.

In some cases, the denaturing agent dimethyl sulfoxide (DMSO) was added in PCR

reactions in order to increase the specificity of the products. DMSO has an inhibitory effect

on the self-complementarity of DNA, thus preventing formation of secondary structures in

the template or the primers. DMSO was added in the PCR mixture at a final concentration

of 3%, when indicated.

In general, the PCR program is designed based on the length and the percentage of

GC content of a given pair of primers and the length of the expected product. Thus, any

variations on the PCR program are mainly observed in the annealing temperature and the

extension time. A typical PCR program included the following incubation steps: 95˚C for 4-

5 minutes for initial denaturation of template, 95˚C for 30 seconds for denaturation, 50-

58˚C for 30seconds for primer annealing, 72˚C for 30-60 seconds for primer extension. The

process of denaturation-annealing-extension was repeated approximately 35 times before a

final extension step at 72˚C.

2.5 DNA electrophoresis

Analysis of PCR products was performed by electrophoresis on agarose gels.

Electrophoresis is based on the principle of separating the negatively charged (due to their

phosphate backbone) DNA molecules according to their molecular size after loading them

on an agarose gel and under the application of electric current. Agarose is a linear

polysaccharide that, after being boiled in a buffered solution, can form an inert porous

matrix (gel) which acts as a molecular sieve. Under the application of an electric current,

53

linear DNA molecules migrate throughout the gel towards the anode with speed that is

inversely correlated to their molecular size. Small molecules fit easier into the pores of the

gel and thus migrate faster throughout it than longer molecules. Visualization of DNA is

performed using an ultraviolet (UV) trans-illuminator, provided that agarose is stained with

ethidium bromide (EtBr) before/after electrophoresis. EtBr is a fluorescent dye that

intercalates double stranded DNA and emits orange light when exposed to UV light,

allowing visualization of the DNA-dye complexes. This type of analysis is satisfactory for

qualitative data and for further manipulation of the products but does not provide accurate

quantification of the template DNA.

Agarose gels were prepared as following: depending on the desired concentration of

the gel (1-2% gel), 1-2gr of agarose were added to a conical flask containing 100 μl of

0.5xTAE buffer (20 mM Tris-acetate, 0.5 mM EDTA, pH 8) and boiled for 1-2 minutes in a

microwave until agarose was completely dissolved. The solution was left to cool down to

approximately 50˚C and 10μg of ethidium bromide were added. The solution was poured

slowly into the tank, the comb was fitted immediately and the solution was left to solidify.

The tank was filled with 0.5xTAE buffer, DNA samples mixed with loading buffer (30%

v/v glycerol, 0.25%w/v β-bromophenol blue, β-ME) were loaded on the gel and run at 100

Volts for approximately 40 minutes before visualization.

2.6 Quantitative reverse transcription PCR (Real time PCR)

2.6.1 RNA extraction and reverse transcription

One of the most useful applications of PCR involves the study of gene expression.

Within the cells, gene expression is determined by the presence and abundance of the

gene’s transcripts, the mRNA molecules. Thus, studies of gene expression patterns require

isolation of total RNA from the initial material (cultured cells) and reverse transcription of

mRNA to complementary DNA (cDNA) which can subsequently be used as template in

54

PCR reactions. Reverse transcription refers to the enzymatic conversion of RNA to DNA

by a RNA-dependent DNA polymerase (reverse transcriptase). This class of enzymes is

encoded by reverse-transcribing viruses and is vital for the replication of their genome.

Reverse transcriptases are also widely applicable in eukaryotic gene expression studies

since the genetic information needs to be in the form of DNA if to be subjected to PCR

analysis. Two of the most used reverse transcriptases are those encoded by the Moloney

murine leukemia virus (MMLV) and the avian myeloblastosis virus (AMV).

Total RNA was extracted using the RNeasy kit (QIAGEN, Sussex UK), according

to the manufacturer’s instructions. Briefly, cells were seeded in 6mm culture plates, treated

appropriately for 6h, washed twice in PBS and harvested in 350 μl RLT buffer (containing

β-ΜΕ). The lysate was placed into QIAshredder spin column and homogenized by

centrifugation at 13000 rpm for 2 minutes at room temperature. The homogenized lysate

was transferred to a gDNA eliminator column and the flow-through was collected after

centrifugation at 13000rpm for 1 minute. 350 μl of 70% ethanol were added to the lysate

and the sample was well mixed before being loaded to the RNeasy spin column.

Centrifugation at 13000 rpm for 30 seconds resulted in binding of total RNA to the column

and the flow through was discarded. The column was then washed once in 700 μl RW1

buffer and twice in 500 μl RPE buffer (The contents of RW and RPE buffers have not been

released from the supplier QIAGEN). Each wash consisted of centrifugation at 13000 rpm

for 1 minute and discard of the flow-though. RNA was finally eluted from the column by

addition of 50 μl of RNase-free water and centrifugation at 13000 rpm for 1 minute.

The concentration of the extracted RNA was measured with Nanodrop ND 1000 UV-Vis

spectrophotometer and subsequently reverse transcribed into cDNA. For this purpose,

500ng of anchored oligo-dT primer (Thermo-scientific, Leicestershire UK) were added to

1μg of total RNA template and the mixture was incubated at 70˚C for 5 minutes. Extension

of annealed primers was achieved by addition of the reaction mixture consisting of 0.5 mM

dNTP's, 1x reaction buffer, 1 unit BioScript reverse transcriptase (Bioline, London UK)

(final concentrations), and the reaction was incubated at 47˚ C for 1 hour. Finally, reverse

transcriptase was inactivated by heating at 75˚C for 10 minutes. Concentrations of cDNA

samples were measured with Nanodrop ND 1000 UV-Vis spectrophotometer and

standardized before being used as templates in real time PCR.

55

The Nanodrop technology allows determination of both concentration and purity of

the DNA sample of interest taking advantage of the ability of nucleic acids to absorb UV

light. Concentration of a DNA sample can be estimated by measuring the absorbance at

260nm, where DNA absorbs light maximally. The ratio of absorbance at 260nm and 280nm

(260/280 ratio) is representative of the purity of the DNA sample, which can be affected by

contaminating proteins and/or excess salt. Ratio of 1.8 is generally indicative of pure DNA.

2.6.2 Quantitative PCR

Reverse transcription PCR provides only qualitative rather than quantitative analysis

of gene expression, as mentioned before; in other words, it can be useful for verifying the

presence or absence of specific mRNA transcripts but it does not provide accurate

quantification of them.

Combining fluorescent probes/dyes with the conventional PCR reaction enables a

highly quantitative analysis of gene expression because the amplification of the product can

be monitored in real time. The most widely applicable version of real time PCR involves

the use of the fluorescent dye SYBR green. This stain intercalates only double stranded

DNA with high affinity and in a non sequence-specific mode, providing thus rigorous

monitoring of the accumulation of PCR products at the end of each cycle, as the reaction

proceeds. Real time PCR cyclers measure the kinetics of the reaction at its early stages,

when the amplification is at the exponential phase. This is a distinct advantage over

conventional PCR that only detects amplification rate at the end-point of the reaction, when

it has reached the plateau phase. As the reaction proceeds and more amplicons are

produced, data of fluorescent signal are plotted against the number of cycles and ultimately

give a graph similar to the one presented in Figure 2.3 A. The fluorescent signal is very low

at the early cycles, but as product accumulates over time fluorescence increases and rises

dramatically beyond a threshold (Ct). Thus, cycle threshold represents the cycle at which

fluorescence is detectable over background fluorescence and associated to exponential

amplification of reaction product. Beyond Ct, data obtained are very important for

quantification because fluorescence measured at the end of each cycle can provide

56

information for the initial template quantity by plotting a standard curve (using dilution

factor for known reactions).

Figure 2.3: qPCR amplification data (A) and melting curve (B). Amplification data

showing positive samples (blue curves) having an early cycle threshold (12-14 cycles), in

comparison with the negative control (red curve) that exhibits a very late and weak

threshold cycle number. The threshold value (Ct) is set at the exponential phase of the

reaction, when detectable increase of fluorescence (product) takes place, and before the

reaction reaches its plateau phase. The melting curve (B) shows a single peak (temperature

82˚C), indicative of amplification of a specific product as well as no primer dimers in PCR

57

reaction. The negative control (red curve) has low dissociation temperature (modified from

155)

However, SYBR green intercalates DNA non-specifically and therefore lacks the

specificity level introduced by fluorescent sequence specific probes. Caution should be

taken when analyzing the data in order to exclude fluorescence that potentially corresponds

to non specific products and/or primer dimmers. A Ct triggered by the correct amplification

product can be confirmed by the melting curve of the reactions (Figure 2.3 B), since all

reactions containing the same pair of primers will have the same melting temperature.

Regarding the protocol of qPCR, there were two main differences compared to the

conventional PCR protocol (chapter 2.4). The first was, presumably, the addition of SYBR

green dye in the reaction mix to a final concentration of 1x and the second concerned the

concentration of primers. After performing a series of optimization reactions, the final

concentration of each primer (Table 2.3) in the PCR mixtures was established to the range

of 30-45 nM. Apart from those two points, PCR was performed as previously described,

using 1μg of cDNA as template. Mastercycler® ep realplex (Eppendorf) was used for qPCR

reactions and data were analyzed using realplex software. The PCR program consisted of

the following steps:

1. 95˚C for 5 minutes

2. 95˚C for 15 seconds, 53-55˚C for 15 seconds, 72 ˚C for 20 seconds (repeated

40-44 times)

3. 72 ˚C for 5 minutes

4. (melting curve step) 95˚C for 15 seconds, 60 for 15 seconds, resolution set at

1˚C, 95˚C for 15 seconds

Primer pairs for RT-PCR were designed to bridge an exon-exon junction (splicing site) of

the specific gene to be studied, to eliminate the possibility of amplification from genomic

DNA in case of contamination. The expression of Rpl19, a gene that encodes for a

ribosomal protein and whose expression is unaffected by etoposide and/or DSFX treatment

(96), served as an internal control for normalization of mRNA levels of CXCR4, IL-10 and

TNF-α.

58

2.7 Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) is a powerful technique that allows

identification of interaction between proteins and DNA in the cell. Specific transcription

factors bind to genomic regions, usually consensus DNA binding sequences on the

promoters of genes, and regulate gene expression. Thus, ChIP can reveal potential

recruitment of transcription factors on to promoters of their target genes and provide insight

in the molecular pathways that regulate the expression pattern of genes. Briefly, the ChIP

method (Figure 2.4) involves temporary cross-linking of proteins with chromatin in live

cells using formaldehyde, extraction of cell lysates and subsequent shearing of chromatin,

immunoprecipitation of the protein of interest along with cross-linked DNA using the

respective antibody, reverse cross linking of the DNA and finally purification of DNA and

amplification of the genomic sequence of interest with PCR. PCR analysis can verify

whether the protein of interest is recruited to the genomic area amplified or not.

The experimental protocol used for ChIP was the following: MCF-7 cells were

grown in 3-4 10 cm tissue culture plates (per treatment) at 80-90% confluency and treated

appropriately. Cells were cross-linked by addition of formaldehyde in the culture medium at

a final concentration of 1.42% and incubation for 15 minutes at room temperature. Cross-

linking was quenched by addition of 125 mM glycine and incubation for 5 minutes at room

temperature. Cells were subsequently washed twice in ice cold PBS and scraped in PBS

containing protease inhibitors. Cells from each treatment were pulled together and collected

after centrifugation at 4700 rpm for 5minutes at 4˚C. Lysis of the cells was accomplished

with addition of 1ml IP buffer 150mM [150 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM

EDTA pH 8, 0.5% NP-40, 1% Triton X-100, 1 mM PMSF, 1 μg/ml protease inhibitor

cocktail (pepstatin, aprotinin, and leupeptin), 20 mM β-glycerol phosphate, and 2 mM

sodium orthovanadate] and resuspension of the cell pellet. Nuclear extracts were collected

after centrifugation at 11400 rpm for 5minutes at 4˚C and were washed with 1ml IP buffer

59

150 mM (containing inhibitors) followed by centrifugation at 11400 rpm for 5minutes at

4˚C and removal of the supernatant.

Figure 2.4: Principle of ChIP assay. In living cells, formadelhyde crosslinking locks in the

DNA-protein complexes, trapping these unstable and sometimes transient interactions. Cell

harvesting followed by sonication of cell lysates results in shearing of chromatin into small

DNA fragments, each bound onto various proteins. Incubation with an antibody, conjugated

to protein A/G agarose beads, targeting the protein of interest, results in precipitation of the

DNA fragments bound onto the factor of interest while the rest are washed away. The

precipitated complexes are reverse crosslinked so that DNA can be purified and subjected

to PCR analysis.

60

To shear the chromatin, nuclear pellets were resuspended in IP buffer (containing

inhibitors) and sonicated using Bioruptor sonicator for 2.5-5 minutes on high power setting,

30 seconds on and 30 seconds off at 4˚C. Lysates were cleared by centrifugation at 11400

rpm for 10 minutes at 4˚C and supernatants containing the chromatin were transferred to

sterile tubes. At this point, 1/10 of each lysate was stored at -80˚C for later use as input

sample and the rest of the lysate was subjected to immunoprecipitation. Specifically, 1-2 μg

of the desired antibody were added to each sample and incubated overnight on a rotator at

4˚C. The next morning, protein A agarose beads were prepared for co-incubation with the

chromatin-antibody complex. First, 20μl beads per IP sample were washed three times in

1ml IP buffer (150 mM) by rotation and centrifugation at 4500rpm for a few seconds; then

beads were blocked with 2% BSA and 40 μg salmon sperm DNA for 1 hour at 4˚C to avoid

non-specific binding of proteins. Beads were washed again 3 times in 1ml IP buffer (150

mM) and transferred to the tube containing the chromatin. Samples were rotated for 2-3

hours at 4˚C, then beads were washed 3 times in 1ml IP buffer (150 mM), 3 times in 1ml

500 mM IP buffer (500 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM EDTA pH 8, 0.5% NP-

40, 1% Triton X-100, 1 mM) followed by 2 more washes in 1ml IP buffer (150mM). 100μl

10% Chelex 100 (Biorad, Hertfordshire UK) resin slurry were added to the washed beads

and samples were boiled at 95˚C for 10 minutes. After samples cooled down, 30 μg of

proteinase K (Roche Diagnostics, GmbH Germany) were added and samples were

incubated at 55˚C for 30 minutes before being boiled again for 10 minutes. Proteinase K is

essential at this stage in order to digest chromatin aggregates that might interfere with the

DNA in subsequent steps. Samples were then centrifuged at 11400 rpm for 1 minute and

supernatants containing DNA were transferred to sterile tubes. Input samples were initially

subjected to ethanol precipitation (3 volumes of 100% ethanol, incubation at -80˚C for 30

minutes and wash in 70% ethanol), then 100 μl 10% Chelex 100 were added to the pellet

and samples were treated the same way as IP samples. Both inputs and IP samples were

used as templates in PCR analysis.

61

2.8 Handling and isolation of plasmid DNA

2.8.1 Transformation of competent bacteria

Transformation refers to the procedure of uptake and expression of foreign,

exogenous DNA by recipient bacteria. It can occur naturally, in certain species, or

artificially. Regarding the latter case, recipient cells are chemically or electrically ―forced‖

to uptake exogenous DNA through their cell membranes. This type of transformation is

widely used in experiments of genetic engineering. Bacteria that have the capability of

being transformed are called competent and are commercially available.

Escherichia coli bacterial DH5α cells, a derivative from Hanahan’s strain DH5, can

become chemically competent using CaCl2 treatment and subsequent heat shock. This

method involves chilling the cells in the presence of chloride ions that are permeable

through the bacterial membrane and cause swelling of the cells upon their entrance in the

cell. This step is necessary for the uptake of foreign DNA, which is considered to be

facilitated by interaction of the negatively charged phosphate backbone of the latter with the

divalent cations of calcium and heat shock.

DH5α cells (Invitrogen, Paisley UK) from the glycerol stock (-80˚C) were allowed

to grow with good agitation in Luria Bertani (LB) broth at 37˚C overnight (12-18 hours),

until they reach the stationary growth phase (Figure 2.5). Next day, the bacterial suspension

was diluted to 1 litre with supplementation of fresh broth and incubated at 37˚C until it

reached a desirable concentration corresponding to absorbance 0.5 measured at 500nm.

Following centrifugation at 5000 rpm 4˚C for 10 minutes, bacterial cells were resuspended

in 500 ml sterile, iced cold 100 mM CaCl2 and incubated on ice for 30 minutes with

occasional swirling. CaCl2 was discarded following centrifugation at 5000 rpm 4˚C for 10

minutes and cell pellet was resuspended in 50 ml of iced cold 100 mM CaCl2 in 15%

glycerol. After aliquoting the bacterial cell suspension appropriately, cells were kept on ice

for 12-24 hours before their storage at -80˚C. Plasmid DNA from ligation and/or cloning

reactions (will be discussed later) was transformed into chemically competent DH5α. DH5α

cells from the glycerol stock (1:1 in 50% LB/glycerol) in -80˚C were left to thaw on ice and

62

2μl of each reaction were added to 80-100 μl of competent cells. The mixtures were gently

agitated and incubated on ice for 30 minutes. Bacterial suspension was subsequently

subjected to heat-sock at 42˚C for 1minute and immediately placed on ice for 2minutes.

500-600 μl of LB broth were added to each mixture and incubated at 37˚C for 1 hour

shaking (~200 rpm). 180 μl of each transformation reaction were spread on selective LB

agar plates containing 50 μg/ml ampicillin or kanamycin, depending on the antibiotic

resistance properties of the vector introduced in the cells. Plates were incubated at 37˚C

overnight and bacterial colonies were analyzed next day for the expression of the inserted

DNA.

Figure 2.5: Representation of bacterial growth phases. For production of competent cells,

DH5α were collected during the stationary phase.

63

2.8.2 Mini scale preparation of plasmid DNA

Isolation of plasmid DNA from small volume bacterial cultures was performed

using QIAprep® miniprep kit (QIAGEN, Sussex UK). Briefly, each colony was inoculated

in 2mls of sterile LB broth and incubated overnight (16 hours approximately) on a shaker at

37˚C. Next day, 500 μl of the bacterial culture were removed and stored at -80˚C as

glycerol stock (1:1 in 50% LB/glycerol) for later use, while the rest were used for isolation

of pure plasmid DNA according to the manufacturer’s instructions. Cells were harvested by

centrifugation at 8000 rpm for 3 minutes at room temperature and aspiration of supernatant

medium. Cells were then resuspended in 250 μl buffer P1 (supplemented with RNase A)

and 250μl of buffer P2 were added. The suspension was mixed thoroughly by inversion of

the tube and lysis proceeded for 3-5 minutes at room temperature. 350μl of buffer N3 were

added to the lysate and after being well mixed, until formation of a homogenous cloudy

suspension, it was centrifuged at 13000 rpm for 10 minutes at room temperature. The

supernatant from this centrifugation step was applied onto the miniprep column and

plasmid DNA was bound while the flow through was discarded after centrifugation at

13000 rpm for 1 minute at room temperature. DNA was washed once with 750μl buffer PE

and finally eluted in 50μl of elution buffer EB (The composition of the N3, PE and EB have

not been released form the supplier QIAGEN). Plasmid DNA was stored at -20˚C for later

use.

2.8.3 Maxi scale preparation of plasmid DNA

Large scale isolation of plasmid DNA was performed using the PureLink™ HiPure

Maxi prep kit (Invitrogen, Paisley UK). Using a sterile pipette tip, a small portion of the

glycerol stock (-80˚C) was scraped and placed into a flask containing 200ml LB broth,

supplemented with the appropriate antibiotic (50μg/ml final concentration). Bacteria were

left to grow overnight for approximately 16 hours (stationary phase of growth) shaking at

37˚C. The overnight culture was centrifuged at 4000xg for 10 minutes and supernatant

64

medium was removed. Bacterial cells were resuspended in 10ml resuspension buffer (R3)

containing RNase A and transferred to a falcon tube. 10ml of lysis buffer (L7) were added

to the resuspended cells, gently mixed with the lysate by inversion of the tube and lysis was

allowed to proceed for 5 minutes at room temperature. 10ml of precipitation buffer (N3)

were subsequently added to the lysate which was mixed thoroughly before being loaded to

the HiPure Filter Maxi column; the column was previously equilibrated by addition of 30ml

EQ1 buffer to the inner filtration cartridge that was fitted into the Maxi column. The lysate

was left to run through the filter column by gravity flow until the flow became very slow.

The filtration cartridge was discarded and the filter column was washed with 50ml of wash

buffer (W8). After the washing step, plasmid DNA was eluted from the column by adding

15ml elution buffer (E4) and collected in a fresh tube (the composition of the baffers L7,

N3, EQ1, and W8 have not been released by the supplier Invitrogen). DNA was precipitated

with 10.5ml isopropanol and centrifugation at 12000xg for 30 minutes at 4 C. The

precipitated DNA pellet was resuspended in 5ml of 70% ethanol and pelleted again by

centrifugation at 12000xg for 5 minutes at 4 C. The pellet was air-dried for 10 minutes at

room temperature and dissolved in 500μl of TE buffer. The concentration of the extracted

DNA was measured with Nanodrop ND 1000 UV-Vis spectrophotometer and DNA was

stored at -20˚C for further use.

65

2.9 Molecular cloning and restriction analysis

Genomic sequences within the promoter regions of inflammatory genes that carry

multiple putative transcription factor binding sites (Figure 2.6) were cloned initially into

TOPO (Invitrogen, Paisley UK) and subsequently into pGL3 (Promega, Madison USA)

vectors.

Figure 2.6: Schematic depiction of the promoter regions of CXCR4 and TNF-α to be cloned

into pGL3 luciferase vector. Putative binding sites identified on each promoter are

highlighted in boxes, their position with reference point the translation start site (ATG) are

indicated below them and the positions of the forward and reverse primers is also indicated

with arrows.

66

2.9.1 Genomic DNA extraction

Genomic DNA from breast cancer cells was extracted using the GFX gemonic

blood DNA purification kit (Amersham Biosciences, Sweden). Up to 4 x 106

cells were

washed twice with PBS, harvested in PBS and pelleted by centrifugation at 13000 rpm for

30 seconds. Supernatant PBS was aspirated and cells were immediately resuspended by

vortexing in 500 μl of extraction buffer. Following a 5-minute incubation at room

temperature, the extraction mixture was transferred to a GFX column which was

centrifuged at 8000 rpm for 1 minute. The flow-through was discarded and the column was

washed once in 500 μl of extraction buffer at 8000 rpm for 1 minute and once in 500 μl of

wash buffer at 13000rpm for 3 minutes. Genomic DNA was eluted from the column by

addition of 200 μl of elution buffer/distilled water and centrifugation at 8000 rpm for 1

minute. Purified genomic DNA was stored at -20˚C.

2.9.2 TOPO cloning

TOPO plasmid vector (pCR-Blunt II-TOPO) provides a robust and efficient way of

optimizing the overall cloning procedure by allowing reproduction of the desired DNA-

insert at high quantities. TOPO cloning is based on the action of Vaccinia virus

topoisomerase I which binds double stranded DNA and cleaves the phosphodiester

backbone of one strand after 5’ CCCTT. At the linearized vector, topoisomerase I is bound

on the 3’ends and permits cloning of a PCR product due to the dominance of the bond

between the 5’ hydroxyl ends of the DNA product and the vector over the phospho-tyrosyl

bond between the vector and the enzyme.

Gemonic sequences of interest were amplified by PCR using high fidelity Phusion

polymerase, a thermostable polymerase that generates products with high accuracy and

speed. PCR reaction was set up as following: ~500 ng genomic DNA, 1x HF reaction

67

buffer, 0.2 mM dNTP's, 0.4 μM forward primer, 0.4 μM forward primer, DMSO to a final

concentration of 3%, 1 unit of Phusion polymerase, supplemented with ddH2O up to 50 μl

final reaction volume. The conditions for the PCR program used were 98˚C for 30 seconds,

30 cycles of 98˚C for 15 seconds followed by 66 ˚C for 30 seconds and 72˚C for 1 minute

and finally 72˚C for 10 minutes. Primers were designed to flank the region to be cloned

(Figure 2.6, Table 2.3), while 6-nucleotide tails that comprise the recognition sites for

restriction enzymes were added to their 5’ ends. KpnΙ and SacΙ restriction sites were chosen

because they form non-compatible ends after digestion. The PCR product was analysed on

low melting agarose gel and the band of the right size was excised and purified from salts,

enzymes etc. using the QIAquick gel extraction kit (QIAGEN, Sussex UK). DNA was

finally eluted in 40μl ddH2O.

Subsequently, the purified blunt-end products were ligated to TOPO vector (Zero

Blunt TOPO PCR Cloning Kit). 4μl of PCR product were mixed with 1μl of linear TOPO

vector, the reaction was supplemented with 1μl salt solution (as recommended by the

manufacturer) and incubated at room temperature for 15 minutes. The construct was

transformed into chemically competent E.coli cells (strain DH5a). Few colonies were

selected for isolation of plasmid DNA by minipreparation using QIAprep miniprep kit

(QIAGEN, Sussex UK). 20μl were used in restriction digestions to verify successful

cloning of the insert into TOPO vector.

2.9.3 Analysis with restriction digestions

Restriction analysis involves the use of restriction endonoucleases, enzymes that

cleave double stranded DNA at specific residues within a recognition sequence (restriction

site). KpnI, isolated from Klebsiella pneumoniae, recognizes the site 5’ -- GGTACC -- 3’

and cuts DNA between C residues, generating fragments with 3’ cohesive ends. Similarly,

SacI whose genomic source is Streptomyces achromogenes, recognizes the site 5’ –

GAGCTC – 3’ and cuts DNA after T residue.

A typical restriction digestion consisted of DNA (plasmid or amplification product)

up to 1 μg, 1x SuRE/Cut buffer (recommended for optimal activity of the enzyme is buffer

68

L for KpnI and buffer A for SacI), 1 unit of enzyme and distilled water. KpnI also required

addition of BSA at a final concentration of 100 μg/ml for enzymatic activity. Reactions

were incubated at 37 ˚C for 3 hours. Double digestions were performed either

simultaneously (both enzymes at the same reaction with the buffer L) or sequentially.

Restriction products were agarose gel purified using the QIAquick gel extraction kit.

Successful cloning of the insert (promoter region) into TOPO vector was verified by

restriction analysis, as shown in Figure 2.7, after mini preparation of plasmid DNA and the

indicated digestions.

Figure 2.7: Agarose gel (1%) showing the restriction analysis reactions that confirmed that

the cloning of the desired insert into TOPO vector was successful. Lane 1 represents the

DNA marker (HyperLadder™ Ι). The 1.4 kb fragment of CXCR4 promoter cut off TOPO

vector following single digestion with KpnI (lane 2), also indicative of reverse orientation

of the insert. Similarly, 1.4 kb fragment of TNF-α promoter after double digestion with

KpnI and SacI (lane 3)

69

2.9.4 pGL3 cloning

pGL3 is a luciferase reporter vector that allows the quantitative analysis of factors

regulating gene expression, for instance promoters and transcription factors. The pGL3

promoter vector which contains an SV40 promoter upstream of the luciferase gene was

used. The multiple cloning site of the vector (Figure 2.6) allows easy insertion of the

desired DNA fragment after appropriate restriction digestions of both the vector and the

fragment. KpnΙ and SacΙ restriction sites were chosen because they form non-compatible

ends after digestion. Restriction digestions were performed as previously described (chapter

2.9.3) and products were agarose gel purified before being ligated. Digested pGL3 vector

and DNA insert were ligated using T4 DNA ligase, an enzyme that catalyzes the formation

of phosphodiester bonds between neighbouring 3´-hydroxyl- and 5´-phosphate ends in

double-stranded DNA. The ligation reaction contained up to 1 μg DNA (vector and insert at

molecular ratios 1:2, 1:5), 1:10 of ligation buffer (10x), 3 units of T4 DNA ligase and

distilled water if needed. Ligations were incubated overnight at 4˚C or room temperature

and transformed into DH5α bacteria as previously described (chapter 2.8.1).

Different combinations of restriction enzyme digestions (single with KpnI or double

with both KpnI and SacI), molecular ratios (1:2, 1:5) and incubation temperature (4˚C or

room temperature) were tested and successful cloning was verified by restriction analysis

after minipreparation of plasmid DNA (Figure 2.8).

70

Figure 2.8: Agarose gel (1%) showing results for colony screening for CXCR4-pGL3

cloning. Lanes represent: (1) DNA ladder (HyperLadder), (2) 1:5 ratio, KpnI-SacI

digestion at 4°C (colony 1), (3) 1:5 ratio, KpnI-SacI digestion at 4°C (colony 2), (4) 1:5

ratio, KpnI-SacI digestion at RT (colony 1), (5) 1:5 ratio, KpnI-SacI digestion at RT

(colony 2), (6) 1:5 ratio, KpnI-SacI digestion at RT (colony 3), (7) 1:5 ratio, KpnI digestion

at 4°C (colony 1), (8) 1:5 ratio, KpnI digestion at 4°C (colony 2), (9) 1:2 ratio, KpnI

digestion at RT (colony 1); ratio refers to the molecular ratio vector:insert, temperature to

the ligation conditions. Successful cloning of the insert DNA (approximately 1.4 kb) is

shown in lanes (3) and (6) after restriction digestion of mini prep plasmid DNA.

2.10 Luciferase reporter assays

Luciferase reporter assays are commonly used in gene expression and function

studies. Their principle is based on the ability to assess the transcriptional

activity/regulatory potential of a genomic sequence of interest by linking it to a reporter

gene whose functionality is easily detectable (e.g: luciferase, beta-galactosidase,

chloramphenicol acetyltransferase). Coding regions, promoters as well as enhancer

71

elements may be used for constructing plasmids that also contain a reporter gene whose

expression can be measured by luminescence, fluorescence or absorbance.

The luciferase/luciferin system is a highly sensitive reporter assay system which linearly

correlates luciferase expression, and thus regulatory potential of the DNA insert, with

bioluminescence (light output). Firefly luciferase (Photinus pyralis) is an enzyme that

catalyzes the oxidation of D-luciferin (substrate) to oxyluciferin in the presence of

magnesium and ATP. The reaction also results in light emission that can be measured using

a luminometer.

The pGL3 luciferase reporter vector is a useful tool for quantifying the

transcriptional activity of genomic sequences via luciferase reporter assay. In our study, the

CXCR4 promoter region that carries potential responsive elements was inserted into the

pGL3 promoter vector as previously described (chapter 2.9.4). pGL3 promoter vector

contains the viral SV40 promoter upstream of the coding region for firefly luciferase and

allows easy insertion of the desired double stranded DNA sequence within its multiple

cloning region after restrictive digestions. Transfection of the construct to mammalian cells,

that lack endogenous luciferase activity, allows monitoring the expression levels/ regulatory

potential of the DNA of interest.

An important issue regarding reporter assays is the variability between samples

caused by factors other than those to be tested, for instance transfection efficiency, cell

toxicity, experimental errors. Normalization using a control allows diminishing such

variabilities and increases the validity of the data. A vector that encodes for a reporter

protein different from the one used in the construct and unaffected by the experimental

conditions can be co-transfected to the cells and used as a control. Beta galactosidase (β-

gal) is frequently used as control in luciferase reporter assays. Like luciferase, β-

galactosidase is an enzyme that catalyzes the hydrolysis of various β-galactosides including

ortho-Nitrophenyl-β-galactoside (ΟNPG). One of the hydrolysis products of ONPG, ortho-

nitrophenol, produces yellow color and can thus be used as a means of measuring β-

galactosidase activity by measuring the absorbance at 420nm (colorimetric assay). Once

both luciferase and β-galactosidase data are obtained, relative promoter activity of each

sample can be calculated by normalizing the luciferase (test) reporter activity to β-

galactosidase activity.

72

MCF-7 cells were split in 6-well plates the day before transfection so they would be

40-70% confluent on the day of transfection. Transfection was performed using Polyfect

(QIAGEN, Sussex UK) transfection reagent. 1.5μg of total plasmid DNA per well

(combination of pGL3 construct, β-galactosidase vector and other expressing vectors as

indicated) were mixed with DMEM medium containing no antibiotics/serum in a sterile

eppendorf tube, up to a final volume of 100μl. 8μl of Polyfect reagent were added to the

DNA solution, mixed well by vortexing for a few seconds and incubated at RT for 5-10

minutes for formation of complexes. 600μl of medium containing penicillin/streptomycin

and FBS were added to the complexes, mixed well and transferred to the cells in the well

that contains 2mls of medium. Plates were gently swirled to ensure uniform distribution of

the DNA comlpexes before being placed in the incubator for overnight incubation at 37 C,

5% CO2. Next day cells were treated with 250μM DSFX and incubated for 16 hours to

ensure gene expression under hypoxia mimicking conditions before being harvested for the

luciferase/beta-galactosidase assays.

Transfected MCF-7 cells and treated as indicated were washed twice in PBS and

PBS was aspirated before the addition of 100μl of 1x reporter lysis buffer (Promega) to

each well. Plates were left rocking for 30 minutes at RT before being scraped and cell

lysates were transferred in sterile eppendorf tubes. Insoluble material was removed by

centrifugation at 13000 rpm for 15 minutes at 4˚C. For the luciferase assay, 10μl of each

cellular lysate were transferred to luminometer tubes (Promega). 50μl of room temperature

luciferin were added to each tube, lysate and luciferin were well mixed by vortexing for a

few seconds and tubes were placed on the luminometer and the readings were recorded. For

each lysate, readings were performed in duplicates and consecutively. For the β-

galactosidase reading, 15-20μl of lysate were mixed with 300μl of assay buffer (200mM

sodium phosphate pH 7.3, 2 mM MgCl2, 100 mM β-mercaptoethanol, 4.415 mM ΟNPG)

and incubated at 37˚C for 30 minutes (or until the colour of the samples turned yellow).

500μl of distilled water were added to each sample and their absorbance was measured at

420nm using a spectrophotometer (Beckman DU640).

73

CHAPTER 3: RESULTS

3.1 Identification of putative hypoxia responsive elements within the

regulatory regions of the promoters of inflammatory genes

Given the fact that chronic inflammation and transcription factors such as p53 and

HIF-1α, the key mediator of the hypoxic response, are greatly implicated in cancer biology,

bioinformatics analysis was performed towards identifying putative DNA binding motifs

for various transcription factors within the regulatory regions of the promoters of multiple

cytokines and cytokine receptors in human. The genomic regions to be probed were defined

by first determining the translation start site (TSS) of each gene, as provided by NCBI

(www.ncbi.nlm.nih.gov) (protein and mRNA entries). Up to 10.000bp upstream of the site

that corresponds to the TSS were probed for the presence of putative responsive elements,

which revealed the presence of hypoxia responsive elements (HREs) within the CXCR4,

TNF-α and IL-10 promoters and some of them were conserved among species. The

identified DNA binding sites using this approach are indicated for each one of the above

mentioned genes in Figure 3.1. All numbers referring to putative responsive elements

throughout the thesis have been counted from the start codon which is not the same with the

trasnscription start site.

74

(A)

75

76

77

(B)

78

79

(C)

80

81

Figure 3.1: Identification of putative HREs within the regulatory regions of the promoters

of CXCR4 (A), TNF-α (B) and IL-10 (C). HREs are highlighted in blue, translation start site

ATG in red. NF-κB binding sites are highlighted in green, one AP-1 binding site in orange,

one YY1 binding site in light blue and one FOXO3α binding site in bold black.

3.2 CXCR-4, TNF-α and IL-10 mRNA expression pattern in DSFX and

etoposide treated breast cancer cells

HIF-1α plays a pivotal role in the transcriptional modulation within neoplastic cells,

thus regulating many cellular processes related to tumorigenesis including inflammation.

The presence of putative HREs within the promoters of the above mentioned genes

prompted us to study their expression under hypoxia mimicking conditions and explore

82

whether any variations occurred under these conditions in the presence or absence of

activated p53. In order to study the expression levels of CXCR4, TNF-α and IL10

quantitative real time PCR experiments (qRT-PCR) were performed as previously

described (chapter 2.6) using MCF-7 breast cancer cells treated with etoposide, DSFX or

combination of both chemicals for 6 hours.

CXCR4 gene expression is upregulated by hypoxia in breast cancer cells (69) and

suppressed in a p53 dependent manner (83). Solid tumors, such as breast cancers, bear

hypoxic fractions and are often treated with chemotherapeutics that cause DNA damage,

such as etoposide and other topoisomerase II inhibitors. The therapeutic effect of these

compounds is based on their ability to stimulate the p53 mediated apoptotic pathway. A

previous report from our laboratory along with published observations from other groups,

indicate that p53’s function differs significantly in a hypoxic compared to normoxic

environment (96, 156). In these terms, the expression pattern of CXCR4, a gene that is

targeted by both HIF-1α (69) and p53 (83) was followed in order to delineate the molecular

mechanisms involved in the regulation of the expression of this gene in conditions where

both p53 and HIF-1α were transcriptionally active. Quantitative real time PCR data showed

that CXCR4 expression level, measured and normalized as previously described (chapter

2.6), was averagely reduced by 50% in MCF-7 cells treated with etoposide compared to

untreated cells (Figure 3.2, compare bar 2 with bar 1 respectively). In agreement with the

observations reported by Schioppa et al.(69) indicating that CXCR4 is induced by hypoxia,

cells treated with the hypoxia mimicking agent DSFX exhibited approximately 1.7fold

higher CXCR4 gene expression compared to that in normoxic untreated cells (Figure 3.2,

compare bar 3 with bar 1 respectively). In MCF-7 cells treated with both etoposide and

DSFX, CXCR4 mRNA level was reduced compared to untreated cells by 30% (Figure 3.2,

compare bar 4 with bar 1), but was approximately 1.7 fold higher than in cells treated with

etoposide only (Figure 3.2, compare bar 4 with bar 2 respectively). Given that MCF-7 cells

bear wild type p53, the reduced CXCR4 levels observed in cells subjected to the combined

treatment relatively to the CXCR4 levels of DSFX treated cells (Figure 3.2, compare bar 4

with bar 3 respectively) imply a dominant p53 suppressive action over HIF-1α.

83

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

1 2 3 4

Re

lati

ve m

RN

A le

vels

Control Etop DSFX Etop+DSFX

CXCR4 expression (MCF-7)

Figure 3.2: CXCR4 mRNA levels in DSFX, etoposide and combination of etoposide and

DSFX treated MCF-7 cells. Graph shows CXCR4 mRNA levels measured in untreated,

etoposide, DSFX and both etoposide and DSFX treated cells normalized to Rpl19. The

relative CXCR4/Rpl19 mRNA level in the untreated cells was arbitrarily set to 1. Values

represent the mean of three independent experiments (95% CI) in which each point was

performed in duplicate.

Quantitative PCR was also performed in order to study IL-10’s expression pattern

under hypoxia mimicking conditions and DNA-damage stress in breast cancer cells. Our

data showed increased IL-10 expression level by almost 30% in etoposide treated MCF-7

cells compared to the expression level of untreated cells (Figure 3.3, compare bar 2 with bar

1 respectively). In DSFX treated MCF-7 cells, IL-10 mRNA level was also induced

compared to the expression level of untreated cells (Figure 3.3, compare bar 3 with bar 1

respectively) with the average induction ranging from almost 30% up to more than 2-fold

between different sets of experiments. In contrast, combination of etoposide and DSFX

treatment repressed IL-10 expression by approximately 40% comparatively to the basal

expression levels (Figure 3.3, compare bar 4 with bar 1 respectively).

84

Control Etop DSFX Etop+DSFX

IL-10 expression (MCF-7)

0

0.5

1

1.5

2

2.5

3

1 2 3 4

Re

lati

ve m

RN

A le

vels

Figure 3.3: IL-10 mRNA levels in DSFX, etoposide and combination of etoposide and

DSFX treated MCF-7 cells. Graph shows IL-10 mRNA levels estimated in untreated,

etoposide, DSFX and both etoposide and DSFX treated MCF-7 cells normalized to Rpl19

mRNA level. The relative IL-10/Rpl19 mRNA level in the untreated cells was arbitrarily set

to 1. Values represent the mean of two independent experiments (95% CI) in which each

point was performed in duplicate and the expression pattern amongst the applied treatments

is representative of three independent experiments.

Regarding TNF-α levels under hypoxia mimicking and DNA-damage mimicking

conditions in breast cancer cells, we observed that TNF-α expression was induced under all

stresses applied to MCF-7 cells compared to unstressed cells. Etoposide, DSFX and

combination of etoposide and DSFX treatment resulted in a 5 fold, 8 fold and 5.5 fold

induction of TNF-α mRNA levels respectively, compared to the expression levels of

untreated cells (Figure 3.4, compare bar 2 with bar 1, bar 3 with bar 1 and bar 4 with bar 1

respectively). Data obtained from a series of qRT-PCR experiments lacked consistency due

to insufficient amplification of the 10-fold diluted cDNA template of the standard reactions

and thus, inaccurate standard melting curves (discussed in chapter 2.6), hence the results

obtained from a single valid experiment are presented (Figure 3.4).

85

0

0.5

1

1.5

2

2.5

1 2 3 4

Re

lati

ve m

RN

A le

vels

Control Etop DSFX Etop+DSFX

TNF-α expression (MCF-7)

Figure 3.4: TNF-α levels in DSFX, etoposide and combination of etoposide and DSFX

treated MCF-7 cells. Graph shows TNF-α mRNA levels measured in untreated, etoposide,

DSFX and both etoposide and DSFX treated MCF-7 cells normalized to Rpl19 mRNA

level. The relative TNF-α/Rpl19 mRNA level in the untreated cells was arbitrarily set to 1.

Values represent the mean of a single experiment (95% CI) in which each point was

performed in duplicate.

3.3 HIF-1α recruitment to the HRE sites located within the regulatory

region of the CXCR4 and TNF-α promoters

CXCR4 and TNF-α mRNA levels followed by quantitative PCR experiments

suggested that gene expression in hypoxia mimicking conditions was under the control of a

hypoxia inducible factor. To investigate the possibility that this factor was HIF-1α as well

as to explore whether the HREs identified within the promoters of these genes (Figure 3.1)

86

were functional we performed ChIP assays (as previously described in chapter 2.7) using

HIF-1α antibody to precipitate HIF-1α chromatin immunocomplexes and primers flanking

the conserved putative HREs identified by bioinformatics analysis.

CXCR4 has been reported to be HIF-1α transcription target. In particular, HIF-1α

induces CXCR4 gene expression in cancer cells via its recruitment to CXCR4 promoter in

hypoxic conditions (69). However, given that etoposide treated MCF-7 cells in hypoxia

mimicking conditions exhibited lower CXCR4 mRNA levels compared to those observed in

cells treated with DSFX only (Figure 3.2, compare bar 4 with bar 3 respectively) and that

HIF-1α and p53 interfere with each other’s transcriptional activity (157, 158), we reasoned

that there should be a distinct mechanism coordinating the recruitment of HIF-1α to the

CXCR4 promoter in differentially treated MCF-7 cells. To test this hypothesis, we

performed ChIP experiments in MCF-7 cells treated with etoposide, DSFX or combination

of both and explored HIF-1α recruitment to a different HRE (Figure 3.1 A, comment k5)

from that assessed by Schioppa et al. and has already been reported to be functional in

hypoxic cells (69). Interestingly, we observed that this responsive element was functional

only in MCF-7 cells treated with both DSFX and etoposide as the anticipated 185bp PCR

product flanking the HRE of interest was present only in the cells subjected to combined

treatment (Figure 3.5 A, lane 8) whereas HIF-1α did not bind to this HRE in MCF-7 cells

treated with DSFX only (Figure 3.5 A, lane 7). Evidence for the specificity of the HIF-1α

antibody was provided by the fact that there was no 185bp PCR product present in the

mock IP (non-specific IgG antibody) samples (Figure 3.5 A, lanes 9-12). These findings

support the notion that the HIF-1α transcriptional complex recruited to the CXCR4

promoter in DSFX and etoposide treated MCF-7 cells was different from that present in

these cells treated only with DSFX. Moreover, the recruitment of HIF-1α within the

promoter of particular genes might be determined by the composition of the HIF-1α

transcription complex and in the case of genes such as CXCR4, that are transcriptional

targets of both HIF-1α and p53, transcriptional co-factors shared between HIF-1α and p53

[for instance SRC-1 (94, 95), p300 (159, 160) or PCAF (96)] might regulate the activity of

these transcription factors by preferential binding to one or the other transcription factor

under certain environmental conditions.

87

Figure 3.5: Functional analysis of the HREs present within CXCR4 and TNF-α promoters.

Chromatin immuno-complexes from untreated, etoposide, DSFX, or etoposide and DSFX

treated MCF-7 cells were precipitated using a specific HIF-1α (lanes 5 to 8) or an irrelevant

non specific antibody (lanes 9 to 12) as negative control. The pulled down DNA was

amplified with specific primers flanking the regions containing the HREs present in CXCR4

(A) and TNF-α (B) promoter. The resultant PCR products were then submitted to 2%

agarose gel electrophoresis.

Since TNF-α gene expression was induced in MCF-7 cells under hypoxia

mimicking conditions (Figure 3.4) ChIP experiments were carried out in these cells treated

with etoposide, DSFX or both to assess the functionality of the putative HRE located

6923bp upstream the translation start site of the TNF-α promoter (Figure 3.1 B, comment

k2). HIF-1α was recruited to the putative HRE site within the TNF-a promoter in DSFX

88

treated MCF-7 cells (Figure 3.5 B, lane 7) providing evidence that TNF-a induction in

hypoxia mimicking conditions was a result of direct HIF-1α mediated trans-activation.

Moreover, HIF-1α was recruited to the TNF-α promoter in MCF-7 cells treated with

combination of DSFX and etoposide (Figure 3.5 B lane 8) with higher binding affinity than

that exhibited in DSFX only treated MCF-7 cells (Figure 3.5 B, compare lane 8 with lane 7

respectively). These data provide evidence that both p53 and HIF-1α participate in the

regulation of TNF-α gene expression.

Finally, ChIP experiments performed to evaluate the functionality of the putative

HRE located 4537bp upstream of the translation start site within the IL-10 promoter (Figure

3.1 C, comment k4) in MCF-7 cells treated the same way as described in Figure 3.5 using

specific antibody against HIF-1α did not provide clear evidence for the involvement of

HIF-1α in the regulation of IL-10 gene expression (data not shown). Further investigation is

required to validate the role of HIF-1α in the induction of IL-10 gene expression in hypoxia

mimicking conditions (Figure 3.3).

3.4 Protein levels of CXCR4 in breast cancer cells

Based on the fact that the mRNA levels do not always match the protein levels in

eukaryotes (161) western blot analysis was performed to investigate whether CXCR4

protein levels followed the same pattern as that of mRNA levels under conditions of DNA-

damage, hypoxia mimicking and combination of the two stresses. Two breast cancer cell

lines (MCF-7 and MDA-MB-231) were used for this analysis as these two cell lines differ

in terms of p53 status (MCF-7 is p53+/+

while MDA-MB-231 is p53+/-

) and would provide

clearer picture of the effect of hypoxia mimicking and DNA-damage on CXCR4

expression.

Western blot analysis of the levels of chemokine receptor CXCR4 in wild type p53

MCF-7 cells revealed a different pattern of CXCR4 protein expression compared to that of

mRNA levels in DSFX and etoposide treated MCF-7 cells. Specifically, elevated CXCR4

protein levels were observed under all stresses (DNA-damage, hypoxia mimicking and

89

combination of the two) compared to non treated cells (Figure 3.6 A, compare CXCR4

lanes 2, 3, 4 to lane 1). Contrary to the trans-repressing mode of action of the DNA-

damaging agent etoposide observed for the CXCR4 mRNA levels (Figure 3.2), etoposide

upregulated CXCR4 at the protein level (Figure 3.6 A,compare lane 2 with lane 1).

Elevated CXCR4 protein levels were also evident in DSFX treated MCF-7 cells (Figure 3.6

A, compare lane 3 with lane 1). Notably, combination of DSFX and etoposide treatment

resulted in higher CXCR4 protein levels compared to those observed in cells treated

individually with either etoposide or DSFX (Figure 3.6 A compare lane 4 with lanes 2 or 3

respectively). HIF-1α was detectable only in the cellular extracts of the DSFX treated

samples (Figure 3.6 A lanes 3 and 4) while no HIF-1α protein was detected in the extracts

of normoxic MCF-7 cells (Figure 3.6 A lanes 1 and 2). p53 was detected in the extracts of

all four experimental conditions, and as expected it was induced in MCF-7 cells treated

with etoposide, DSFX and both (Figure 3.6 A lanes 2, 3, 4 respectively).

Densitometric analysis showed 1.75 fold, 2.7 fold and 3.6 fold increase of CXCR4

protein levels in etoposide, DSFX and both etoposide and DSFX treated MCF-7 cells

respectively compared to untreated cells (Figure 3.6 B compare bar 2 with bar 1, bar 3 with

bar 1 and bar 4 with bar 1 respectively).

90

Figure 3.6: Etoposide, DSFX and combination of etoposide and DSFX increased CXCR4

protein levels MCF-7 cells. Cellular extracts from cells treated with etoposide, DSFX or

both etoposide and DSFX were subjected to Western blot analysis (A). Data are

representative of three independent experiments. Relative protein levels of CXCR4 for each

treatment, normalized to endogenous β-actin levels, were analyzed by densitometry (B).

The intensity of the CXCR4 protein band normalized to that of β-actin in untreated cells

(control) was arbitrarily set to 1. Values represent the mean of three independent

experiments.

To further investigate the effect of DNA-damage and hypoxia-mimicking agents on

CXCR4 protein levels, we performed the same western blot analysis in breast cancer cells

that express high levels of mutated (280 G→A) p53 (MDA-MB-231) (162). MDA-MB-231

91

cells did not respond to etoposide the same way as the wild type p53 MCF-7 cells did

(compare Figure 3.7 A with Figure 3.6 A blots for 53), which is in accord with recently

published observations (163). Elevated CXCR4 protein levels were observed in etoposide

and DSFX treated MDA-MB-231 cells (Figure 3.7 A compare lanes 2 and 3 with 1

respectively) whereas combined etoposide and DSFX treatment of these cells resulted in

downregulation of the CXCR4 protein levels (Figure 3.7 A compare lane 4 with 1).

However, the fluctuations of the CXCR4 protein levels observed in MDA-MB-231 cells

were of smaller scale compared to those observed in MCF-7 cells. Densitometric analysis

revealed an average 1.25-fold and 1.5-fold increase of CXCR4 protein in etoposide and

DSFX treated MDA-MB-231 cells respectively compared to untreated cells (Figure 3.7 B,

compare bar 2 and 3 with bar 1 respectively) and an approximate 40% reduction of CXCR4

protein in cells subjected to the combined treatment compared to untreated cells (Figure 3.7

B, compare bar 4 with bar 1).

92

Figure 3.7: Etoposide and DSFX treatment increased CXCR4 protein levels whereas

combination of treatments reduced CXCR4 protein levels in MDA-MB-231 cells. Cellular

extracts from cells treated with etoposide, DSFX or both etoposide and DSFX were

subjected to Western blot analysis (A). Data are representative of three independent

experiments. Relative protein levels of CXCR4 for each treatment, normalized to

endogenous β-actin levels, were analyzed by densitometry (B). The intensity of the CXCR4

protein band normalized to that of β-actin in untreated cells (control) was arbitrarily set to

1. Values represent the mean of three independent experiments.

93

3.5 SRC-1 interacts with HIF-1α and p53 in MCF-7 cells

Eukaryotic gene transcription is a process orchestrated by an enormous number of

proteins that have the ability to form multi sub-unit complexes and tightly regulate

transcription in co-operation with the basal transcriptional machinery (164). Transcription

co-regulators, both activators and repressors, have emerged as important effectors in

transcriptional regulation by facilitating the connection between sequence-specific DNA

binding factors and the transcriptional machinery. Transcriptional regulation is largely

dependent on multiprotein complex formation between factors and co-regulators, such as in

the case of HIF-1α/p53 trans-activation by p300 (159, 160), recruitment of the p160/SRC-1

co-activator to the ARNT transcription complex (165) and coordination of HIF-1α-

mediated signaling by the complex HIF-1α/ARNT/CBP/SRC-1 (109). Steroid receptor co-

activators have gained significant attention in the context of breast cancer since their

interaction with estrogen receptors is implicated in tumor development and resistance to

therapy (102). Given that transcription factors usually require co-factors to act upon target

genes, we were interested to study the role of transcription co-factors in the regulation of

inflammatory genes and in particular the role of SRC-1 co-activator, which is

overexpressed in breast cancer and has been recently characterized as a strong, independent

predictor of cancer recurrence (166).

Initially, we aimed to confirm the physical interaction between SCR-1, HIF-1α and

p53 in the cell line we worked with. For this purpose immunoprecipitation experiments

were carried out in MCF-7 breast cancer cells treated with etoposide or DSFX. HIF-1α was

precipitated from cellular extracts using the specific antibody and the co-precipitated

proteins were analyzed by western blot. Probing for SRC-1 signified interaction between

HIF-1α and SRC-1 in DSFX treated MCF-7 cells (Figure 3.8 A, SRC-1, lane 4). The fainter

band appearing at the molecular size of SRC-1 for the IP sample in untreated cells (Figure

3.8 A lane 3) is non-specific as HIF-1α was not detected in the input of untreated normoxic

cells (Figure 3.8 A lane 1).

In a similar way as for HIF-1α, p53 was precipitated from cellular extracts of

untreated, etoposide or DSFX treated MCF-7 using a specific antibody against this

transcription factor. SRC-1 coprecipitated with p53 under all three experimental conditions

94

applied: no stress, DNA-damage and hypoxia mimicking (Figure 3.8 B, SRC-1, lanes 4, 5,

6 respectively). The affinity of the interaction between SRC-1 and p53 appeared to be

higher in unstressed cells compared to those treated with etoposide or DSFX as well higher

in those cells treated with etoposide compared to the DSFX treated (Figure 3.8 B, compare

p53 lanes 5, and 6 to the respective SRC-1 lanes 5 and 6).

Interaction between HIF-1α and p53 in MCF-7 cells has been previously reported

(158) and was verified for the experimental conditions used in this study. In particular,

endogenous p53 coprecipitated with HIF-1α in DSFX treated MCF-7 cells (Figure 3.8 A,

p53, lane 4) and HIF-1α was found in complex with p53 in immunoprecipitation

experiments performed in DSFX treated MCF-7 cells using specific antibody against p53

(Figure 3.8 B, HIF-1α, lane 6).

Figure 3.8: Western blot analysis of anti-HIF-1α (A) and anti-p53 immunoprecipitated

complexes (B) carried out in untreated (A, lane 3 and B, lane 4) etoposide (B, lane 5) and

DSFX treated (A, lane 4 and B, lane 6) MCF-7 breast cancer cells.

95

3.6 SRC-1 and SIRT-1 affect CXCR4 gene expression in hypoxia

mimicking conditions

SRC-1 is a HIF-1 transcriptional coactivator in normoxic and hypoxic cells

(95,109). SIRT-1 deacetylase, has been proposed to exert opposing to SRC-1 effects in

androgen receptor signaling in prostate cancer cells (167), and has also been linked to

hypoxia-mediated transcription; resveratrol, a well estbalished SIRT-1 activator (168) was

shown to inhibit hypoxia-mediated induction of HIF-1α and VEGF (169). Given the

functional and physical interplay of SRC-1 and SIRT -1 with HIF-1α (95, 109, 122), the

identification of multiple putative HREs in the regulatory region of the CXCR4 promoter

triggered our interest to investigate the effect of those two factors on the activity of CXCR4

promoter in hypoxic breast cancer cells. To assess the role of SRC-1 and SIRT-1 on CXCR4

promoter activity under hypoxia mimicking conditions, we performed luciferase reporter

assays in MCF-7 cells transfected with the CXCR4-luc reporter construct (chapter 2.9

region of CXCR4 promoter that carries five HREs) and exogenously expressing either SRC-

1 or SIRT-1 under normoxic or hypoxia mimicking conditions.

Normoxic untreated MCF-7 breast cancer cells transfected with SIRT-1 exhibited a

repressive effect of CXCR4 luciferase reporter activity compared to cells transfected with

the empty vector pcDNA3 (Figure 3.9 , compare bar 1 with bars 2, 3, 4). Increasing

amounts of exogenously expressed SIRT-1 gradualy increased the reduction of CXCR4

luciferase reporter activity, providing evidence that SIRT-1 deacetylase modulates the

activity of CXCR4 luciferase reporter. Specifically, exogenous expression of 0.25 μg, 0.5

μg and 0.75 μg led to an average reduction of 30%, 43% and 54% of the reporter activity in

normoxic MCF-7 cells respectively compared to the activity of the reporter in pcDNA3

transfected cells (Figure 3.9 compare bars 2, 3, 4 to 1 respectively).

In order to assess the role of hypoxia on the effect of SIRT-1 on CXCR4 luciferase

reporter activity, we conducted the same experiments in MCF-7 cells treated with the

hypoxia mimicking agent DSFX. DSFX treatment of MCF-7 breast cancer cells exerted the

same pattern of reduced CXCR4 luciferase reporter activity that was observed in their

untreated counterparts. Similarly, increasing amounts of exogenously expressed SIRT-1

gradually reduced the CXCR4 luciferase reporter activity. 0.25 μg, 0.5 μg and 0.75 μg of

96

exogenously expressed SIRT-1 resulted in 27%, 34% and 47% reduction of reporter

activity, respectively (Figure 3.9 compare bars 6, 7, 8 with bar 5 respectively). However,

CXCR4 luciferase reporter avtivity of cells transfected with either SIRT-1 or empty vector

(pcDNA3) was notably lower under hypoxia mimicking conditions compared to normoxia

(Figure 3.9 compare bars 5-8 with 1-4 for hypoxia mimicking and normoxia respectively).

This finding might reflect the existence of a hypoxia responsive factor that exarcebates the

repressive effect of SIRT-1 on CXCR4 luciferase reporter activity in hypoxia mimicking

conditions.

Figure 3.9: SIRT-1 has a repressive effect on CXCR4 luciferase reporter activity in

untreated or DSFX treated MCF-7 cells. Relative luciferase activity of CXCR4–luc reporter

(5 HREs) is reduced in MCF-7 cells transfected with increasing amounts of Flag-SIRT-1

expression vector compared to cells transfected with the empty (pcDNA3) vector. Values

represent the means of three independent experiments. The relative luciferase activity of the

CXCR4–luc reporter in untreated cells transfected with pcDNA3 was arbitrarily set to 100

units after normalization to β-galactosidase activity.

97

In an attempt to shed light on the effect of SRC-1 on CXCR4 gene expression,

luciferase reporter assays were performed in MCF-7 cells transfected with the CXCR4

luciferase reporter together with an SRC-1 expression vector. Exogenously expressed SRC-

1 reduced the CXCR4 luciferase reporter activity in untreated MCF-7 cells (Figure 3.10

compare bars 2, 3, 4 with bar 1). However, the suppression trend due to SRC-1 transfection

in normoxic untreated cells was reverse compared to SIRT-1’s suppression trend;

increasing amounts of exogenous SRC-1 relieved the suppression on CXCR4 luciferase

reporter activity. Overall, an average reduction of 20%, 16% and 4% reporter activity

compared to pcDNA3 transfected cells’ reporter activity was observed when 0.25 μg, 0.5

μg and 0.75 μg SRC-1 were exogenously expressed, respectively (Figure 3.10 compare bars

2, 3, 4with bar 1).

An overall decrease of CXCR4 luciferase reporter’s activity of pcDNA3 and SRC-1

transfected cells was also observed under hypoxia mimicking conditions (Figure 3.10

compare bars 1-4 with bars 5-8). Within the DSFX treated samples, we observed an average

9% and 5% reduction of reporter activity when 0.25 μg and 0.5 μg SRC-1 were

exogenously expressed respectively compared to the reporter avtivity of pcDNA3

transfected cells (Figure 3.10 compare bars 6, 7 with bar 5). On the contrary, 0.75 μg of

exogenously expressed SRC-1 enhanced CXCR4 luciferase reporter activity by 15%

compared to the reporter activity of cells transfected with the empty vector pcDNA3

(Figure 3.10 compare bar 5 with bar 8). Thus, it appears that increasing amounts of SRC-1

tend to reverse the suppressive effect of DSFX on the CXCR4 luciferase reporter activity.

It is worth mentioning that internal normalization is paramount when performing

transient expression experiments. Although in the present study the increasing amounts of

exogenously expressing constructs were verified by WB analysis in most cases (e.g: figure

3.9, blot for Flag SIRT-1), a more definite evaluation of the role of both SIRT-1 and SRC-1

in CXCR4 luciferase reporter expression would arise from luciferase experiments where the

expression of transfected expression vectors is quantified using real time PCR. Such

improvements would potentially allow us to define the dose-dependent effect of the afore-

mentioned transcriptional regulators in the activity of the CXCR4 promoter region under

study.

98

Figure 3.10: SRC-1 has a mild repressive effect on CXCR4 luciferase reporter activity in

untreated MCF-7 cells which tends to reverse in DSFX treated MCF-7 cells. Relative

luciferase activity of CXCR4–luc reporter (5 HREs) is reduced in MCF-7 cells transfected

with increasing amounts of HA-SRC-1 expression vector compared to cells transfected with

the empty (pcDNA3) vector.Values represent the means of three independent experiments.

Relative luciferase activity of the CXCR4–luc reporter in untreated cells transfected with

pcDNA3 was arbitrarily set to 100 units after normalization to β-galactosidase activity.

3.7 Effect of SRC-1 and SIRT-1 on CXCR4 protein levels

Having observed the effect of SRC-1 and SIRT-1 on a specific CXCR4 promoter

region activity and in order to have a better perception of the involvement of SIRT-1 and

SRC-1 in the modulation of CXCR4 expression, we assessed CXCR4 protein levels in

99

untreated, etoposide and DSFX treated cells exogenously expressing those regulators.

Western blot analysis was performed for MCF-7 breast cancer cells transfected with the

SIRT-1/SRC-1 expression vector under hypoxia mimicking conditions, DNA-damage

mimicking conditions and combination of two treatments. CXCR4 protein expression of

each sample was compared to that of reference samples (lysates from cells transfected with

the empty vector pcDNA3).

Our data indicate that exogenously expressed SRC-1 altered the CXCR4 protein

levels in MCF-7 cells (Figure 3.11 A and B). SRC-1 caused an average 50% increase of

CXCR4 protein in untreated normoxic cells (Figure 3.11 B, compare blue bar 1 to grey bar

1). In a similar way, etoposide treatment increased the CXCR4 protein levels by 40% in

SRC-1 exogenously expressing cells compared to pcDNA3-transfected cells (Figure 3.11 B,

compare blue bar 2 to grey bar 2). In contrast, decreased by 29% CXCR4 protein levels

were observed in DSFX treated MCF-7 cells over-expressing SRC-1 compared to non-

transfected cells (Figure 3.11 B, compare blue bar 3 with grey bar 3). Combination of

etoposide and DSFX treatment in SRC-1 exogenously expressing cells reduced CXCR4

protein levels by 16% compared to cells transfected with pcDNA3 under the same

conditions (Figure 3.11 B compare blue bar 4 with grey bar 4).

100

Figure 3.11: SRC-1 reduces CXCR4 protein levels in DSFX treated MCF-7 cells. Western

blot analysis (A) of SRC-1-HA tagged transfected MCF-7 cells showing the levels of

endogenous CXCR4 in unstressed and stressed cells, endogenous β-actin levels as a protein

loading reference and levels of HA-tag as a verification of transfection. The expression

pattern is more obvious after densitometric analysis (B) of independent experiments (bar 1

is the mean value of three experiments, while bars 2, 3, 4 are mean values of two

experiments).

.

Transfection of MCF-7 cells with SIRT-1 increased CXCR4 protein levels in

untreated cells but reduced CXCR4 protein levels in cells treated with etoposide, DSFX and

combination of them compared to untransfected cells. Exogenously expressed SIRT-1

conferred an almost 2-fold increase in unstressed breast cancer cells compared to pcDNA3

transfected cells (Figure 3.12 B compare blue bar 1 with grey bar 1). However in etoposide,

DSXF and etoposide and DSFX treated cells, SIRT-1 decreased CXCR4 protein levels by

19%, 34% and 43% respectively, compared to pcDNA3 transfected MCF-7 cells (Figure

3.12 B compare blue bar 2 with grey bar 2, blue bar 3 with grey bar 3 and blue bar 4 with

grey bar 4 respectively). Densitometric analysis of a single representative experiment

(corresponding to Figure 3.12 A) is presented in Figure 3.12 B. Transfection of SIRT-1 was

confirmed by detection of the exogenously expressed protein with the Flag antibody (Figure

3.12 A).

101

Figure 3.12: SIRT-1 reduces CXCR4 protein levels in etoposide and DSFX treated MCF-7

cells. Western blot analysis (A) of SIRT-1-Flag tagged transfected MCF-7 cells showing

the levels of endogenous CXCR4 in unstressed and stressed cells, endogenous β-actin

levels as a protein loading reference and levels of Flag-tag as a verification of tranfection.

The expression pattern is more obvious after densitometric analysis (B) of a single

experiment representative of two independent experiments exhibiting the same expression

pattern but significant deviations of the induction/repression percentages.

102

CHAPTER 4: DISCUSSION

Inflammation is the protective innate immune response to infection, injury, or tissue

damage. Although the purpose of the inflammatory reaction is to allow cells of the immune

system to accumulate in the area of infection, defend the body from the invasion of

pathogens and initiate the process of tissue repair, various inflammatory factors associated

with chronic inflammation could lead to a range of pathological conditions including cancer

(5). Several studies have indicated that perturbations of the inflammatory response increase

the likelihood of pathogenesis in diseases related to metabolism, auto-immunity, and

malignant transformation (43, 51, 170, 171,172). Accumulated evidence supports the

important role of the pro-inflammatory cytokines such as IL-1β in obesity, diabetes and

atherosclerosis (170, 173), as well as (TNF)-α and interleukin (IL)-6 in tumorigenesis (51,

30). Therefore the regulation of the cytokine levels is essential for these diseases as aberrant

activation of pro-inflammatory or compromised function of anti-inflammatory cytokines is

a crucial parameter for pathogenesis. In these terms signaling pathways mediated by

inflammation responsive transcription factors such as NF-κB, HIF-1α and p53 play

important role in linking inflammation and disease.

Numerous studies have established a fundamental connection between chronic

inflammation and predisposition to certain types of cancer. For example breast cancer is

characterized by increased recruitment of TAMs within the tumor and elevated secretion of

pro-inflammatory (IL-1, TNF-α, IL-6) or anti-inflammatory cytokines (IL-10) chemokines

and chemokine receptors (CXCL8, CXCR4) and angiogenic molecules (VEGF)

(36, 50). This network of pro-inflammatory components rivals the inhibitory effect of the

anti-inflammatory cytokines (IL-4) on the growth of breast cancer cells (174) and promotes

cell proliferation, tumorigenesis and metastasis (36). Thus, it is clear that studying the

regulation of the expression levels and activity of cytokines and cytokine receptors is

important for understanding the pathways that promote cancer progression.

103

Key mediators of cancer related inflammation are several transcription factors such

as HIF-1α, the principal mediator of the cellular adaptation to hypoxia which is a common

feature of solid tumors (69), and the potent tumor promoter NF-κB whose transcriptional

activity accounts for the expression of multiple cytokines thereby establishing a pro-

inflammatory environment (46). HIF-1 and NF-κB act synergistically promoting the

expression of pro-inflammatory, pro-angiogenic and pro-survival molecules thus converting

pro-inflammatory into oncogenic signals by transactivating gene expression of genes

involved in angiogenesis, metastasis and metabolic switch (VEGF, GLUT-1, Epo) (43,

175). On the other hand, the stress responsive tumor suppresor protein p53 restrains

neoplastic transformation via its pro-apoptotic and anti-proliferative function (66, 69, 86).

HIF-1α induces CXCR1 and CXCR2 gene expression in prostate cancer cells (176)

and CXCR4 in breast and ovarian cancer cells (69). Upregulation of CXCR4 enhances

metastasis and its overexpression is a poor prognostic indicator in breast cancer patients

(40). HIF-1α is recruited on the CXCR4 promoter region and upregulates the levels of this

highly potent metastatic chemokine receptor in cancer cells (69). In line with these studies,

a 1.7 fold induction of CXCR4 mRNA levels were observed in DSFX treated MCF-7 breast

cancer cells compared to those determined in normoxic conditions (Figure 3.2).

Furthermore, the inflammatory genes IL-10 and TNF-α were upregulated in hypoxia

mimicking conditions (Figure 3.3 and 3.4). In particular, a 2- and 8-fold induction of IL-10

and TNF-α mRNA levels respectively were detected in DSFX treated versus untreated

normoxic cells. HIF-1α and NK-κB mediated pathways upregulating the pro-inflammatory

TNF-α levels has been documented in hypoxic macrophages (144) but the finding that TNF-

α is upregulated in epithelial cancer cells via the same signaling pathways provides an

additional indication that inflammation and cancer are closely linked (71, 177).

The p53 tumor suppressor is defective in the majority of human malignancies (73)

and this in combination with the chronic infammatory environment present in tumor tissues

exacerbates the oncogenic outcome (178, 179, 180). Komarova and colleagues observed

upregulation of several pro-inflammatory cytokines and chemokines in p53 null mice (181).

In agreement with these observations reduced CXCR4 and IL-10 gene expression was

detected in MCF-7 breast cancer cells treated with combination of the chemotherapeutic

drug etoposide and the hypoxia mimicking agent DSFX compared to those measured in

104

untreated cells (Figures 3.2 and 3.3). These results are in accord with previously published

reports (157) indicating that etoposide treatment counteracts hypoxia’s transactivating

effect on the expression of inflammatory genes (Figures 3.2, 3.3 and 3.4 compare bars 3 to

bars 4).

HIF-1α and p53 transcription factors functionally crosstalk at various levels. In

particular HIF-1α has been shown to protect p53 protein from degradation (158, 182), while

p53 promotes HIF-1α degradation in hypoxic cells (157, 183) providing a possible

explanation for the clonal selection and expansion of neoplastic cells bearing mutated p53

(184). Results presented in Figures 3.2, 3.3 and 3.4 showing CXCR4, IL-10 and TNF-α

downregulation in etoposide and DSFX treated compared to DSFX only treated cells

(Figure 3.2, 3.3 and 3.4 compare bars 4 to bars 3) prompted us to investigate the HIF-1α

recruitment to the regulatory regions of the promoters of these genes. We observed that

HIF-1α exhibited higher binding affinity for the TNF-α and CXCR4 promoter HREs in cells

treated with combination of DSFX and etoposide compared to those treated with DSFX

alone (Figure 3.5 A and B compare lanes 8 to lanes 7). Notably, the hypoxia responsive

element within CXCR4 promoter occupied by HIF-1α in DSFX and etoposide and not

DSFX only treated breast cancer cells is different from the one reported in human ovarian

cancer cells CAOV3 by Schioppa et al. (69). One possible explanation for the selective

recruitment of HIF-1α to the CXCR4 promoter only in cells treated with both DSFX and

etoposide is the differential recruitment of co-factors to HIF-1α and/or HIF-1α post-

translational modifications. In addition, since CXCR4 repression is mediated via a p53-

repressible AP-1 element present within its promoter (83) next to the HRE (Figure 3.1 A),

p53 might release p300 from the AP-1 element as part of the transrepresion process and

increase the availability of this co-activator for HIF-1α. Nevertheless, further quantitation

of the observed selective recruitment of HIF-1α by qPCR is required in order to solidify our

data and gain a better understanding of HIF-1α's recruitment on the promoters of

inflammatory genes under the applied stresses.

The CXCR4 mRNA levels observed in etoposide and DSFX treated MCF-7 cells

are in line with previously published reports indicating CXCR4 induction in p53 defective

(83) and hypoxic breast cancer cells (69) (Figure 3.2). We further assessed the role of

etoposide treatment on the CXCR4 protein levels in DSFX treated cells and observed that

105

there was a weak correlation between CXCR4 mRNA and protein levels. In wild type p53

MCF-7 cells combination of DSFX with etoposide treatment enhanced the CXCR4 protein

levels (Figure 3.6 B compare bar 4 with bar 1) whereas in contrast in MDA-MB-231 cells

submitted to the same treatment CXCR4 protein levels were reduced to half (Figure 3.7 B

compare bar 4 to bar 1). This reduction in CXCR4 protein levels in MDA-MB-231 cells

might reflect the ability of mutated p53 to block HIF-mediated transactivation (157).

Although the homozygous p53 mutation present in MDA-MB-231 is not expected to affect

p53’s involvement in CXCR4 regulation as suggested by the luciferase reporter assays (83),

high levels of mutated p53 (Figure 3.7 blot for p53) interfered with HIF-1α's contribution to

CXCR4 protein upregulation in DSFX treated MDA-MB-231. HIF-1α and p53 are

components of the same transcription complexes (Figure 3.8 B, 158) and p53 mutations in

MDA-MB-231 cells or post-translational modifications of either p53 or HIF-1α

differentially regulate the transcriptional activity of each other under diverse types of stress

thereby determining the CXCR4 protein levels in DSFX treated breast cancer cells.

Several lines of evidence highlight the importance of co-factors’ function in

regulating HIF-1α's and p53’s responses in hypoxic cells. Previous work from our

laboratory has shed light into the molecular mechanisms underlying the regulation of action

of both p53 and HIF-1α by co-factors in cancer cells by identifying PCAF as a crucial

mediator of p53’s activity in hypoxic cancer cells (96). PCAF, p300 and SCR-1 are

transcription co-factors harboring HAT activity that modulate the transcriptional activity of

both HIF-1α and p53 individually or co-operatively (100, 96, 109). SRC-1 plays a crucial

role in breast oncogenesis as transcriptional co-activator of estrogen receptor (102). SRC-1

was also found to interact with both p53 and HIF-1α in MCF-7 breast cancer cells (Figure

3.8).

To investigate the potential role of common transcriptional cofactors for HIF-1α and

p53 in the TNF-α and CXCR4 gene expression in breast cancer, the SRC-1 binding affinity

for p53 was followed under DNA-damage and hypoxia mimicking conditions. As it is

evident in Figure 3.8 higher binding affinity of SRC-1 for p53 was observed in cells treated

with DSFX than in those treated with etoposide. Post-translational modifications may

account for this effect. SRC-1 and p300/CBP interact with the animo-terminal domain of

p53 (94,159) which is phosphorylated at Ser 15 in response to etoposide treatment (156).

106

This modification might preferentially enhance the binding of p300/CBP to p53 and at the

same time displace SRC-1 from the complex with p53. In DSFX treated cells, p53 localizes

both in the cytoplasm and the nucleus (185) suggesting that the weak interaction observed

between SRC-1 and p53 in DSFX-treated MCF-7 cells (Figure 3.8) might be due to the

nuclear localisation of SRC-1 in hypoxic conditions (109).

SRC-1 has been shown to induce breast cancer cell proliferation and metastasis by

regulating the CXCR4 ligand expression (186). To further investigate the role of the SRC-1

in the differential regulation of the CXCR4 gene expression mediated by HIF-1α and p53 in

diverse types of cellular stress, a luciferase reporter containing a region of the CXCR4

promoter bearing five HREs was constructed (Figure 2.9). Although exogenously expressed

SRC-1 exerted a modest trans-repressive effect on CXCR4 luciferase reporter activity in

both untreated and DSFX treated MCF-7 cells (Figure 3.10, compare bar 1 with bar 2 and

bar 5 with bar 6), increasing amounts of SRC-1 tended to reverse this repression (Figure

3.10, compare bars 1 and 4 with bars 5 and 8 respectively). The presence of binding sites

for the transcription factors AP-1 and YY1 within the CXCR4 reporter (Figure 3.1 A) might

affect the activity of CXCR4 luciferase reporter. Although the role of YY1 in the regulation

of CXCR4 expression is still ambigious (187, 188), this factor could play a role in the

marginal suppression of CXCR4 reporter activity (188). In cells expessing high levels of

SRC-1, this cofactor either directly or in co-operation with HIF-1α (Figure 3.10, bar 8)

transcactivates AP-1 (189, 190) reversing the repression observed in untreated cells.

More solid indications concerning the role of SRC-1 in CXCR4 regulation arose

from studies of its protein levels in MCF-7 cells. We observed that although exogenous

SRC-1 induced CXCR4 protein levels in normoxic and etoposide treated MCF-7 cells, it

exerted a repressive effect in the MCF-7 cells treated with DSFX (Figure 3.11). Although

SRC-1 is widely accepted as a transcriptional co-activator in some cases co-repressive

potential has been reported (191). Therefore the modulatory effect of SRC-1 might depend

on environmental conditions or cellular needs. Interestingly SRC-1 and hypoxia induce the

CXCR4 ligand, SDF-1α, gene expression in human solid cancer cells (186, 192), suggesting

that in hypoxia mimicking conditions the negative regulation of the CXCR4 protein levels

might indicate the existence of an autoregulatory loop (193), a hypothesis requiring further

investigation.

107

To gain further insight in the regulation of the CXCR4 expression in MCF-7 cells,

we were interested to assess the role of a transcriptional regulator that usually exerts the

opposite functions of those of SRC-1. To this direction we studied the role of the NAD+

dependent deacetylase SIRT-1 which through its intrinsic HDAC activity represses the

transcriptional activity of both HIF-1α and p53 (122, 194). In agreement with the known

pattern of SIRT-1 activity, exogenously expressed SIRT-1 reduced CXCR4 protein levels

and CXCR4 luciferase reporter activity in DSFX treated MCF-7 cells (Figure 3.12 and 3.9

respectively). The presence of a FOXO3α responsive element within the CXCR4 luciferase

reporter region (Figure 3.1 A comment k10) suggests that a potential interplay between

SIRT-1 and FOXO3a enhanced the repressive effect of the former on the CXCR4 reporter

activity in DFSX treated cells, since both SIRT-1 and FOXO3a modulate HIF-mediated

transcription (122, 195). Moreover, in MCF-7 cells treated with either etoposide alone or

with combination of etoposide and DSFX, SIRT-1 overexpression reduced CXCR4 protein

levels compared to non transfected cells in the same conditions (Figures 3.12, 3.9). In these

terms it appears that SIRT-1 acts as an anti-cancer agent since it decreases CXCR4 aberrant

expression in MCF-7 cells under hypoxia mimicking and DNA-damage conditions allowing

the hypothesis that SIRT-1 inhibitors used as anti-cancer therapeutics (116) in this context

would probably not prove beneficial in targeting CXCR4 in breast cancer cells.

To conclude, in an attempt to provide additional mechanistic insights of molecular

pathways that contribute to breast cancer progression via cancer-related inflammation we

evaluated the roles of HIF-1α and p53 transcription factors in the regulation of the

expression of inflammatory cytokines. We observed that the chemotherapeutic drug

etoposide, whose function is based on p53-dependent transactivation, compromises the

inductive effect of hypoxic stress on CXCR4, TNF-α and IL-10. As part of a larger

transcriptional protein comlpex, p53 functionally interplays with HIF-1α in hypoxic cells

and we speculate that this is also the case for CXCR4 and TNF-α since stabilized p53

(Figure 3.6, blot for p53) promotes recruitment of HIF-1α to the promoters of those genes

in DSFX treated MCF-7 cells (Figure 3.5). In addition we observed that wt p53 also

mediates CXCR4 protein induction in hypoxic breast cancer cells despite its opposite role at

the mRNA level. Further investigation of the role of the common HIF-1α and p53

transcriptional co-factor SRC-1 would elucidate the contribution of this cofactor in CXCR4

108

expression under diverse stress conditions. The expression pattern of the highly potent

metastatic chemokine receptor CXCR4 should be also investigated in other breast cancer

cells lines with higher metastatic potential than MCF-7 cells (196).

109

REFERENCES

1. Vogelstein B. and Kinzler K.W. (2004). Cancer genes and the pathways they

control. Nature Medicine 10, 789 – 799

2. Hanahan D. and Weinberg R.A. (2000). The hallmarks of cancer. Cell 100, 57–70

3. Rakoff-Nahoum S. (2006). Why cancer and inflammation? Yale Journal of

Biology and Medicine 79, 123-130

4. Dvorak H.F.(1986). Tumours: wounds that do not heal. Similarities between

tumour stroma generation and wound healing. N Engl J Med. 315, 1650-1659.

5. Balkwill F. & Mantovani, A. (2001). Inflammation and cancer: back to Virchow?

Lancet 357,539–545

6. Thun M.J., Henley S.J., Gansler T. (2004). Inflammation and cancer: an

epidemiological perspective. Novartis Found Symp. 256:6-21, discussion 22-

8,49-52, 266-9

7. Kuper H., Adami H.O. and Trichopoulos D. (2000). Infections as a major

preventable cause of human cancer. Journal of Internal Medicine 248, 171-183.

8. Allavena P., Garlanda C., Borrello M.G., Sica A. and Mantovani A. (2008).

Pathways connecting inflammation and cancer. Curr Opin Genet Dev. 18, 3-10.

9. Yoshimura A. (2006). Signal transduction of inflammatory cytokines and

tumour development. Cancer Science 97, 439-447.

10. Linnemeyer P.A. The immune system- An overview. 2008

11. Ferrero-Miliani L., Nielsen O.H., Andersen P.S. and Girardin S.E. (2007).

Chronic inflammation: importance of NOD2 and NALP3 in interleukin-1β

generation. Clin Exp Immunol 147, 227-235.

12. Lowry S.F. (1993). Cytokine Mediators of Immunity and Inflammation. Arch

Surg. 128, 1235-1241.

13. Yamaoka K., Saharinen P., Pesu M., Holt Vance E.T III, Silvennoinen O. and

O’Shea J.J. (2004). The Janus kinases (Jaks). Genome Biol. 5, 253

110

14. Hassan H.T., Zander A. (1996). Stem cell factor as a survival and growth factor

in human normal and malignant hematopoiesis. Acta Haematol. 95, 257–262

15. Kollet O., Dar A., Shivtiel S. et al (2006). Osteoclasts degrade endosteal

components and promote mobilization of hematopoietic progenitor cells. Nat

Med. 12,657–664.

16. http://www.copewithcytokines.de/: Cytokines & Cells Online Pathfinder

Encyclopedia, by Prof Dr H Ibelgaufts (2010)

17. Feghali C.A. and Wright T.M.(1997).Cytokines in acute and chronic

inflammation. Frontiers in Bioscience 2, 12-26.

18. Hanada T. and Yoshimura A. (2002). Regulation of cytokine signaling and

inflammation. Cytokine Growth Factor Rev. 13, 413-21.

19. Mantovani A., Sozzani S., Locati M., Allavena P., Sica A. (2002). Macrophage

polarization: tumour-associated macrophages as a paradigm for polarized M2

mononuclear phagocytes. Trends Immunol, 23, 549-555

20. Hadden J.W.(2003). Immunodeficiency and cancer: prospects for correction.

Int Immunopharmacol 3, 1061-1071.

21. Weigert A., Tzieply N., von Knethen A., Johann A.M., Schmidt H., Geisslinger

G. and Brüne B.(2007 ). Tumour Cell Apoptosis Polarizes Macrophages—Role

of Sphingosine-1-Phosphate. Mol Biol Cell 18, 3810-3819.

22. Bingle L., Brown N.J. and Lewis C.E. (2002).The role of tumour-associated

macrophages in tumour progression: implications for new anticancer therapies.

J. Pathol. 196, 254-265.

23. Lin W.W. and Karin M. (2007). A cytokine-mediated link between innate

immunity, inflammation, and cancer. J Clin Invest. 117,1175–1183.

24. Allavena P., Garlanda C., Borrello M.G., Sica A. and Mantovani A. (2008).

Pathways connecting inflammation and cancer. Current opinion in genetics and

development 18, 3-10.

25. Chavey C., Bibeau F. , Gourgou-Bourgade S., Burlinchon S., Boissière F.,

Laune D., Roques S. and Lazennec G.(2007). Estrogen-receptor negative breast

cancers exhibit a high cytokine content. Breast Cancer Res 9, R15.

111

26. Gemma A., Takenaka K., Hosoya Y., Matuda K., Seike M., Kurimoto F., Ono

Y., Uematsu K., Takeda Y., Hibino S., Yoshimura A., Shibuya M. and Kudoh S.

(2001). Altered expression of several genes in highly metastatic subpopulations

of a human pulmonary adenocarcinoma cell line. Eur. J. Cancer 37, 1554–1561.

27. Kock A., Schwarz T., Urbanski A., Peng Z., Vetterlein M., Micksche M., Ansel

J.C., Kung H.F. and Luger T.A. (1989). Expression and release of interleukin-1

by different human melanoma cell lines. J. Natl. Cancer Inst. 81, 36–42.

28. Giavazzi R., Garofalo A., Bani M.R., Abbate M., Ghezzi P., Boraschi

D.,Mantovani A., Dejana E. (1990). Interleukin 1-induced augmentation

ofexperimental metastases from a human melanoma in nudemice. Cancer Res,

50, 4771-4775.

29. Voronov E., Shouval D.S., Krelin Y., Cagnano E., Benharroch D., Iwakura Y.,

Dinarello C.A. and. Apte R.N

(2003). IL-1 is required for tumour invasiveness

and angiogenesis. Proc Natl Acad Sci USA 100, 2654-2650.

30. Germano G., Allavena P., Mantovani A.(2008). Cytokines as a key component

of cancer-related inflammation. Cytokine 43, 374–379.

31. Reiss M. (1999). TGF-β and cancer. Microbes and infection 1,1327-1347.

32. Moore K.W., O'Garra A., de Waal Malefyt R., Vieira P., Mosmann T.R.(1993)

Interleukin-10. Annu Rev Immunol.11:165-90.

33. Mocellin S., Marincola F.M. and Young H.A. (2005).Interleukin-10 and the

immune response against cancer: a counterpoint. Journal of Leukocyte Biology.

78, 1043-1051.

34. Bhairavabhotla R.K., Verm V., Tongaonkar H., Shastri S., Dinshaw K.,

Chiplunkar S. (2007). Role of IL-10 in immune suppression in cervical cancer.

Indian J Biochem Biophys., 44, 350-356.

35. Mocellin, S., Panelli, M. C., Wang, E., Nagorsen, D., Marincola, F. M. (2003)

The dual role of IL-10. Trends Immunol. 24,36-43.

36. Ali S. and Lazennec G. (2007). Chemokines: novel targets for breast cancer

metastasis. Cancer Metastasis Rev. 26,401-420.

112

37. Raman D., Baugher P.J., Thu Y.M., Richmond A. (2007). Role of chemokines in

tumour growth. Cancer Letters 256,137–165.

38. Balkwill F (2003). Chemokine biology in cancer. Semin Immunol. 15(1):49-55.

39. Allavena P, Germano G, Marchesi F, Mantovani A.(2011). Chemokines in

cancer related inflammation. Exp Cell Res. 317(5):664-73.

40. Luker K. E, Luker G.D. (2006). Functions of CXCL12 and CXCR4 in breast

cancer, Cancer Lett. 238, 30-41.

41. Balkwill F. (2004). The significance of cancer cell expression of the chemokine

receptor CXCR4. Seminars in Cancer Biology 14, 171-179.

42. Balkwill F. (2004). Cancer and the chemokine network. Nat Rev Cancer, 4, 540-

550.

43. Mantovani A., Allavena P., Sica A. and Balkwill F. (2008). Cancer related

inflammation. Nature 454, 436-444.

44. Heim M.H. (1999). The Jak-STAT pathway: cytokine signalling from the

receptor to the nucleus. J Recept Signal Transduct Res. 1999, 19(1-4):75-120.

45. Ghosh S., May, M.J., and Kopp, E.B. (1998). NF-κB and Rel proteins:

Evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol.

16, 225-260.

46. Pikarsky E. et al.(2004). NF-kB functions as a tumour promoter in inflammation

associated cancer. Nature 431, 461–466

47. Karin M. and Lin A. (2002). NF-kappaB at the crossroads of life and death. Nat

Immunol 3(3):221-7

48. Lin, A. and Karin, M.(2003), NF-kB in cancer: a marked target. Semin. Cancer

Biol. 13, 107–114

49. Chen S., Guttridge D.C., Tang E., Shi S., Guan K. and Wang C.Y. (2001).

Suppression of Tumour Necrosis Factor-mediated apoptosis by Nuclear Factor

κB-independent Bone Morphogenetic Protein/Smad Signaling. The Journal of

Biological Chemistry 276, 39259-63

50. Mantovani A., Marchesi F., Porta F., Sica A. and Allavena P. (2007).

Inflammation and cancer: Breast cancer as a prototype. The Breast 16, 27–33.

113

51. Balkwill F. (2006). TNF-α in promotion and progression of cancer. Cancer

Metastasis Rev 25, 409-416.

52. Chen G. and Goeddel D.V.(2002). TNF-R1 signaling: a beautiful pathway.

Science 296, 1634-1635.

53. Karin M and Ben-Neriah Y (2000). Phosphorylation meets ubiquitination: the

control of NF-κB activity. Annu Rev Immunol 18:621-63

54. Kataoka T. (2009). Chemical biology of inflammatory cytokine signalling. The

Journal of Antibiotics 62, 655–667.

55. Galban S., Fan J., Martindale J.L., Cheadle C., Hoffman B., Woods M.P. et al.

(2003). Von Hippel-Lindau protein-mediated repression of tumour necrosis

factor alpha translation revealed through use of cDNA arrays. Molecular &

Cellular Biology 23, 2316-2328.

56. Denko N.C., Fontana L.A., Hudson

K.M., Sutphin

P.D., Raychaudhuri

S., Altman R. and Giaccia A.J. (2003). Investigating hypoxic tumour physiology

through gene expression patterns. Oncogene 22, 5907–5914.

57. Wang G.L., Jiang B.H., Rue E.A., and Semenza G.L. (1995). Hypoxia-inducible

factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular 02

tension. Proc. Natl. Acad. Sci. USA 92(12): 5510-5514

58. Semenza G.L. (2004). Hydroxylation of HIF-1: Oxygen Sensing at the

Molecular Level. Physiology 19,176-182.

59. Jiang B.H., Zheng J.Z., Leung S.W., Roe R., Semenza G.L.(1997).

Transactivation and inhibitory domains of hypoxia-inducible factor 1alpha and

modulation of transcriptional activity by oxygen tension. J Biol Chem

272(31):19253-60

60. Semenza GL (2007). Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE.

9(407):cm8

61. Poon E., Harris A.L., Ashcroft M.(2009). Targeting the hypoxia-inducible factor

(HIF) pathway in cancer. Expert Rev Mol Med. 11:e26.

62. Semenza G.L., Jiang B.H., Leung S.W., Passantino R., Concordet J.P., Maire P.,

Giallongo A. (1996). Hypoxia response elements in the aldolase A, enolase 1,

114

and lactate dehydrogenase A gene promoters contain essential binding sites for

hypoxia-inducible factor 1. J Biol Chem. 271(51):32529-37.

63. Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D,

Buechler P, Isaacs WB, Semenza GL, Simons JW. (1999). Overexpression

of hypoxia-inducible factor 1alpha in common human cancers and their

metastasis. Cancer Res 59, 5830–5835.

64. Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nat. Rev. Cancer 3,

721–732

65. Grunstein J., Roberts W.G., Mathieu-Costello O., Hanahan D. and Johnson R.S.

(1999). Tumour-derived Expression of Vascular Endothelial Growth Factor Is a

Critical Factor in Tumour Expansion and Vascular Function. Cancer Research

59, 1592-1598.

66. Lewis, J. S., Landers, R. J., Underwood, J. C.,Harris, A. L., and Lewis, C. E.

(2000). Expression of vascular endothelial growth factor by macrophagesis up-

regulated in poorly vascularized areas of breast carcinomas. J Pathol, 192, 150-

158.

67. Staller P., Sulitkova J., Lisztwan J., Moch H., Oakeley E.J., Krek W. (2003).

Chemokine receptor CXCR4 downregulated by von Hippel-Lindau tumour

suppressor pVHL. Nature, 425, 307-311.

68. Kim S.W., Kim H.Y., Lee H.J., Yun H.J., Kim S., Jo D.Y.. (2009).

Dexamethasone and hypoxia upregulate CXCR4 expression in myeloma cells.

Leuk Lymphoma. 50, 1163-73.

69. Schioppa T., Uranchimeg B., Saccani A.,.Biswas S.K., Doni A., Rapisarda A.,

Bernasconi S., Saccani S., Nebuloni M. , Vago L., Mantovani A., Melillo G. and

Sica A. (2003). Regulation of the Chemokine Receptor CXCR4 by Hypoxia. The

Journal of Experimental Medicine 198, 1391-1402.

70. Haddad J.J. and Harb H.L. (2005). Cytokines and the regulation of hypoxia-

inducible factor (HIF)-1a. International Immunopharmacology 5, 461–483.

71. Jung Y.J., Isaacs J.S., Lee S., Trepel J., Neckers L. (2003). IL-1hmediated

up-regulation of Hif-1α via an NF-nB/COX-2 pathway identifies HIF-1 as a

critical link between inflammation and oncogenesis. FASEB J 17, 2115–2117.

115

72. Rius J., Guma M., Schachtrup C., Akassoglou K., Zinkernage A.S., Nizet V.,

Johnson R.S., Haddad G.G. and Karin M. (2008). NF-kB links innate immunity

to the hypoxic response through transcriptional regulation of Hif-1α. Nature

453, 807-811.

73. Nigro J.M., Baker S.J., Preisinger A.C., Jessup J.M., Hostetter R., Cleary K.,

Bigner S.H., Davidson N., Baylin S., Devilee P., Glover T., Collins F.S., Weston

A., Modali R., Harris C.C., Vogelstein B. (1989). Mutations in the p53 gene

occur in diverse human tumour types. Nature 342, 705-708.

74. El-Deiry, W. S., S. E. Kern, J. A. Pietenpol, K. W. Kinzler, and B. Vogelstein

(1992). Human genomic DNA sequences define a consensus DNA binding site

for p53. Nat Genet. 1:45–49

75. Joerger A.C. and Fersht

A.R. (2007). Structure–function–rescue: the diverse

nature of common p53 cancer mutants. Oncogene 26, 2226–2242.

76. Momand J., Wu H.H., Dasgupta G. (2000). MDM2 – master regulator of the p53

tumour suppressor protein. Gene 242, 15-29.

77. Abraham R.T. (2001). Cell cycle checkpoint signaling through the ATM and

ATR kinases. Genes Dev. 15, 2177-2196.

78. Maya R., Balass M., Kim S.-T., Shkedy D., Leal J.-F.M., ShifmanO., Moas M.,

Buschmann T., Ronai Z., Shiloh Y., etal. (2001). ATM-dependent

phosphorylation of MDM2 on serine 395: Role in p53 activation by DNA

damage. Genes & Dev. 15: 1067–1077

79. Giono L.E. and Manfredi J.J. (2006).The p53 tumor suppressor participates in

multiple cell cycle checkpoints. Journal of Cellular Physiology 209, 13-20.

80. O’Morgan D. (2007). The cell cycle: principles of control. New Science Press.

81. Göhler T., Jäger

S., Warnecke

G., Yasuda

H., Kim

E. and Deppert

W. (2005).

Mutant p53 proteins bind DNA in a DNA structure-selective mode. Nucleic

Acids Research 33:1087-1100.

116

82. Yang J., Ahmed A., Poon E., Perusinghe N., de Haven Brandon A., Box G.,

Valenti M., Eccles S., Rouschop K., Wouters B. and Ashcroft M. (2009). Small

Molecule Activation of p53 Blocks HIF-1α and VEGF Expression In Vivo and

Leads to Tumour Cell Apoptosis in Normoxia and Hypoxia. Mol. Cell. Biol. 29,

2243-2253.

83. Mehta S.A., Christopherson K.W., Bhat-Nakshatri P., Goulet Jr R.J..,

Broxmeyer H.E., Kopelovich L. and Nakshatri H. (2007). Negative regulation of

chemokine receptor CXCR4 by tumour suppressor p53 in breast cancer cells:

implications of p53 mutation or isoform expression on breast cancer cell

invasion. Oncogene, 26:3329-3337

84. Hussain S.P., Hofseth

L.J. and Harris C.C. (2003). Radical causes of cancer.

Nature Reviews Cancer 3, 276-285.

85. Staib F., Robles

A.I., Varticovski

L., Wang

X.W., Zeeberg

B.R., Sirotin

M.,

Zhurkin V.B., Hofseth

L.J., Hussain

S.P., Weinstein

J.N., Galle

P.R. and Harris

C.C. (2005). The p53 Tumour Suppressor Network Is a Key Responder to

Microenvironmental Components of Chronic Inflammatory Stress. Cancer

Research 65, 10255-10264

86. Webster G.A. and Perkins N.D. (1999). Transcriptional Cross Talk between NF-

κB and p53. Mol Cell Biol 19(5): 3485–3495

87. Hudson J.D., Shoaibi M.A., Maestro R., Carnero A., Hannon G.J. and Beach

D.H.(1999) A proinflammatory cytokine inhibits p53 tumour suppressor activity.

J. Exp. Med. 190, 1375–1382

88. Petrenko O., Fingerle-Rowson G., Peng T., Mitchell R.A. and Metz

C.N.(2003). Macrophage Migration Inhibitory Factor Deficiency Is Associated

with Altered Cell Growth and Reduced Susceptibility to Ras-mediated

Transformation. The Journal of Biological Chemistry 278, 11078-11085.

89. Liu L., Scolnick D.M., Trievel R.C., Zhang H.B., Marmorstein R., Halazonetis

T., et al.(1999). p53 sites acetylated in vitro by PCAF and p300 are acetylated in

vivo in response to DNA damage. Mol Cell Biol. 19, 1202–1209.

117

90. Winner M., Koong

A.C., Rendon

B.E., Zundel

W. and Mitchell

R.A. (2007).

Amplification of Tumour Hypoxic Responses by Macrophage Migration

Inhibitory Factor–Dependent Hypoxia-Inducible Factor Stabilization. Cancer

Research 67, 186-193.

91. Rosenfeld M.G., Lunyak V.V. and Glass C.K. (2006). Sensors and signals: a

coactivator/corepressor/epigenetic code for integrating signal-dependent

programs of transcriptional response. Genes Dev 20:1405-1428

92. Peserico A. and Simone C. (2011). Physical and functional HAT/HDAC

interplay regulates protein acetylation balance. J Biomed Biotechnol.

2011:371832

93. Sheppard K.A., Rose D.W., Haque Z.K., Kurokawa R., McInerney E., Westin

S, Thanos D., Rosenfeld M.G., Glass C.K., Collins T (1999) Transcriptional

activation by NF-kappaB requires multiple coactivators. Mol Cell Biol.

19(9):6367-78.

94. Lee S.K., Kim H.J., Kim J.W., Lee J.W. (1999). Steroid receptor coactivator-1

and its family members differentially regulate transactivation by the tumor

suppressor protein p53. Mol Endocrinol. 13(11):1924-33

95. Carrero P., Okamoto K., Coumailleau P.,

O'Brien S.,

Tanaka H. and Poellinger

L.

(2000). Redox-regulated recruitment of the transcriptional coactivators CREB-

binding protein and SRC-1 to hypoxia-inducible factor 1α Mol Cell Biol 20(1):

402–415

96. Xenaki G., Ontikatze T., Rajendran R., Stratford I.J., Dive C., Krstic-

Demonacos M. and Demonacos C. (2008). PCAF is an HIF-1α cofactor that

regulates p53 transcriptional activity in hypoxia. Oncogene 27:5785–5796

97. Glozak M.A., Sengupta N., Zhang X., Seto E. (2005). Acetylation and

deacetylation of non-histone proteins. Gene 363:15-23.

98. Shahbazian M.D. and Grunstein M. (2007). Functions of site-specific histone

acetylation and deacetylation. Annu Rev Biochem, 76:75-100.

118

99. Yang X.J. and Seto E.(2007). HATs and HDACs: from structure, function and

regulation to novelstrategies for therapy and prevention. Oncogene 26, 5310–

5318

100. Kuo M.H. and Allis C.D. (1998). Roles of histone acetyltransferases and

deacetylases in gene regulation. Bioessays. 20(8):615-26

101. Spencer T.E., Jenster G., Burcin M.M., Allis C.D., Zhou J., Mizzen

C.A., McKenna N.J., Onate S.A., Tsai S.Y., Tsai M.J., O'Malley B.W. (1997).

Steroid receptor coactivator-1 is a histone acetyltransferase.

Nature 389(6647):194-8

102. Xu J., Wu R.C., O’Malley (2009). Normal and cancer-related functions of the

p160 steroid receptor co-activator (SRC) family. Nature reviews 9, 615-630.

103. Partch C.L. and Gardner K.H. (2010). Coactivator recruitment: a new role for

PAS domains in transcriptional regulation by the bHLH-PAS family. J Cell

Physiol. 223(3):553-7.

104. Heery D.M., Kalkhoven E., Hoare S., Parker M.G. (1997). A signature motif in

transcriptional co-activators mediates binding to nuclear receptors. Nature

387(6634):733-6.

105. Torchia J., Rose D.W., Inostroza J., Kamei Y., Westin S., Glass

C.K., Rosenfeld M.G. (1997). The transcriptional co-activator p/CIP binds CBP

and mediates nuclear-receptor function. Nature.387(6634):677-84

106. Moore J.M. and Guy R.K. (2005) Coregulator interactions with the thyroid

hormone receptor. Mol Cell Proteomics. 4(4):475-82

107. Bouras T., Southey M.C., Venter D.J. (2001). Overexpression of the steroid

receptor coactivator AIB1 in breast cancer correlates with the absence of

estrogen and progesterone receptors and positivity for p53 and HER2/neu.

Cancer Res.61(3):903-7.

119

108. Xie D., Sham J.S., Zeng W.F., Lin H.L., Bi J., Che L.H., Hu L., Zeng

Y.X., Guan X.Y.(2005). Correlation of AIB1 overexpression with advanced

clinical stage of human colorectal carcinoma Hum Pathol. 36(7):777-83.

109. Ruas J.L., Poellinger L., Pereira T. (2005). Role of CBP in regulating HIF-1-

mediated activation of transcription. J Cell Sci.118(Pt 2):301-11

110. Cvijic H., Bauer K., Löffler D., Pfeifer G., Blumert C., Kretzschmar

A.K., Henze C., Brocke-Heidrich K., Horn F. (2009). Co-activator SRC-1 is

dispensable for transcriptional control by STAT3. Biochem J. 420(1):123-32.

111. Glozak M.A. and Seto E. (2007). Histone deacetylases and cancer. Oncogene.

26(37):5420-32.

112. de Ruijter A.J., van Gennip A.H., Caron H.N., Kemp S., van Kuilenburg A.B.

(2003). Histone deacetylases (HDACs): characterization of the

classical HDAC family. Biochem J. 370(Pt 3):737-49.

113. Voelter-Mahlknecht S., Ho A.D. and Mahlknecht U. (2005) Chromosomal

organization and localization of the novel class IV human histone deacetylase 11

gene. Int J Mol Med, 16, 589-98.

114. Michan, S. and Sinclair D. (2007) Sirtuins in mammals: insights into their

biological function. Biochem J, 404, 1-13

115. Haigis, M.C. and Guarente, L.P. (2006) Mammalian sirtuins--emerging roles in

physiology, aging, and calorie restriction. Genes Dev., 20, 2913-21.

116. Liu T., Liu P.Y., Marshall G.M. (2009). The critical role of the class III histone

deacetylase SIRT1 in cancer. Cancer Res. 69(5):1702-5

117. Rajendran R., Garva R., Krstic-Demonacos M., Demonacos C. (2011). Sirtuins:

molecular traffic lights in the crossroad of oxidative stress, chromatin

remodelling and transcription. Journal of Biomedicine and Biotechnology (in

press).

118. Langley E., Pearson M., Faretta M., Bauer U.-M., Frye R.A., Minucci S.,

Pelicci P.G. and Kouzarides T. (2002) Human SIR2 deacetylates p53 and

antagonizes PML/p53-induced cellular senescence. EMBO J. 21:2383-2396.

120

119. Giannakou M.E., Partridge L. (2004). The interaction between FOXO

and SIRT1: tipping the balance towards survival. Trends Cell Biol. 14(8):408-

412

120. Brunet A., Sweeney L.B., Sturgill J.F., Chua K.F., Greer P.L., Lin Y., Tran

H., Ross S.E., Mostoslavsky R., Cohen H.Y., Hu L.S., Cheng

H.L., Jedrychowski M.P., Gygi S.P., Sinclair D.A., Alt F.W.,Greenberg M.E.

(2004). Stress-dependent regulation of FOXO transcription factors by

the SIRT1 deacetylase. Science. 303(5666):2011-5.

121. Yeung F., Hoberg J.E., Ramsey C.S., Keller M.D., Jones D.R., Frye

R.A., Mayo M.W. (2004). Modulation of NF-kappaB-dependent transcription

and cell survival by the SIRT1 deacetylase. EMBO J. 23(12):2369-80

122. Lim J.H., Lee Y.M., Chun Y.S., Chen J, Kim J.E., Park J.W. (2010). Sirtuin 1

modulates cellular responses to hypoxia by deacetylating hypoxia-inducible

factor 1alpha. Mol Cell. 38(6):864-78

123. Sung J.Y., Kim R., Kim J.E., Lee J. (2010). Balance between SIRT1 and DBC1

expression is lost in breast cancer. Cancer Sci. 101(7):1738-44

124. Feige J.N., Auwerx J. (2008). Transcriptional targets of sirtuins in the

coordination of mammalian physiology. Curr Opin Cell Biol. 20(3):303-9

125. http://www.who.int/en/ (2010)

126. DeNardo D.G. and Coussens L.M. (2007). Inflammation and breast cancer.

Balancing immune response: crosstalk between adaptive and innate immune

cells during breast cancer progression. Breast Cancer Research 2007 9, 212.

127. Nicolini A., Carpi A., Rossi G. (2006). Cytokines in breast cancer. Cytokine &

Growth Factor Reviews 17, 325–337.

128. Yager J.D. and Davidson N.E. (2006). Estrogen Carcinogenesis in Breast

Cancer. N Engl J Med 354. 270-282.

129. Bhat H.K., Calaf G., Hei T.K., Loya T., Vadgama J.V. (2003). Critical role of

oxidative stress in estrogen-induced carcinogenesis. Proc Natl Acad Sci USA

100, 3913-3918.

121

130. Platet N., Cathiard A.M., Gleizes M., Garcia M. (2004). Estrogens and their

receptors in breast cancer progression: a dual role in cancer proliferation and

invasion. Crit Rev Oncol Hematol. 51(1):55-67.

131. Sauvé K., Lepage J., Sanchez M., Heveker N. and Tremblay A. (2009).

Positive feedback activation of estrogen receptors by the CXCL12-CXCR4

pathway. Cancer Research 69, 5793-5800.

132. Tai H., Kubota N., Kato S. (2000). Involvement of nuclear receptor coactivator

SRC-1 in estrogen-dependent cell growth of MCF-7 cells. Biochem. Biophys.

Res. Commun. 267, 311-316.

133. Wang S., Yuan Y., Liao L., Kuang S.Q., Tien J.C.Y., O’Malley B.W. and Xu J.

(2008). Disruption of the SRC-1 gene in mice suppresses breast cancer

metastasis without affecting primary tumour formation. The National Academy

of Sciences of the USA 106, 151-156.

134. Li H., Rajendran G.K., Liu N., Ware C., Rubin B.P., Gu Y. (2007). SirT1

modulates the estrogen-insulin-like growth factor-1 signaling for postnatal

development of mammary gland in mice. Breast Cancer Res. 9(1):R1.

135. Pruitt K., Zinn R.L., Ohm J.E., McGarvey K.M., Kang S.H., Watkins

D.N., Herman J.G., Baylin S.B. (2006). Inhibition of SIRT1 reactivates

silenced cancer genes without loss of promoter DNA hypermethylation. PLoS

Genet. 2(3):e40

136. Chen W.Y., Wang D.H., Yen R.C., Luo J., Gu W., Baylin S.B. (2005). Tumor

suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent DNA-

damage responses. Cell. 123(3):437-48.

137. Nakamaru Y., Vuppusetty C., Wada H., Milne J.C., Ito M., Rossios C., Elliot

M., Hogg J., Kharitonov S., Goto H., Bemis J.E., Elliott P., Barnes P.J., Ito K.

(2009). A protein deacetylase SIRT1 is a negative regulator of

metalloproteinase-9. FASEB J. 23(9):2810-9

138. Potente M., Ghaeni L., Baldessari D., Mostoslavsky R., Rossig L., Dequiedt

F., Haendeler J., Mione M., Dejana E., Alt F.W., Zeiher A.M., Dimmeler S.

(2007). SIRT1 controls endothelial angiogenic functions during vascular growth.

Genes Dev. 21(20):2644-58.

122

139. López-Lázaro M. (2006). Hypoxia-inducible factor 1 as a possible target for

cancer chemoprevention. Cancer Epidemiol Biomarkers Prev 15, 2332-2335

140. Burton E.R. and Libutti S.K. (2009). Targeting TNF-α for cancer therapy.

Journal of Biology 8, 85

141. Jana N.R. (2008). NSAIDS and apoptosis. Cell. Mol. Life. Sci 65, 1295-1301.

142. Gierach G.L., Lacey J.V., Schatzkin A., Leitzmann M.F., Richesson D.,

Hollenbeck A.R. and Brinton L.A. (2008). Nonsteroidal anti-inflammatory drugs

and breast cancer risk in the National Institutes of Health–AARP Diet and

Health Study. Breast Cancer Research 10, R38.

143. D'Acquisto F.,May M.J., Ghosh S. (2002). Inhibition of nuclear factor kappa B

(NF-κB): an emerging theme in anti-inflammatory therapies. Molec Interv 2, 22-

35.

144. Murdoch C., Lewis C.E. (2005). Macrophage migration and gene expression in

response to tumor hypoxia. Int J Cancer. 117(5):701-8.

145. Murata Y., Ohteki T., Koyasu S., Hamuro J..(2002). IFN-gamma and pro-

inflammatory cytokine production by antigen-presenting cells is dictated by

intracellular thiol redox status regulated by oxygen tension. Eur J Immunol.

32(10):2866-73

146. Llanes-Fernández L., Alvarez-Goyanes R.I., Arango-Prado Mdel C., Alcocer-

González J.M., Mojarrieta J.C., Pérez X.E., López M.O., Odio S.F., Camacho-

Rodríguez R., Guerra-Yi M.E.,Madrid-Marina V., Tamez-Guerra R., Rodríguez-

Padilla C. (2006). Relationship between IL-10 and tumor markers in breast

cancer patients. Breast. 15(4):482-9

147. Chresta C.M., Masters J R.W. and Hickman J.A. (1996). Hypersensitivity of

human testicular tumors to etoposide-induced apoptosis is associated with

functional p53 and a high Bax:Bcl-2 ratio. Cancer Res 56:1834-1841.

148. Jiang B.H., Zheng J.Z., Leung S.W., Roe R., and Semenza G.L.

(1997).Transactivation and inhibitory domains of hypoxia-inducible factor 1α:

modulation of transcriptional activity by oxygen tension. J Biol Chem 272

(31):19253–19260

123

149. Arriola E.L., Lopez A.R. and Chresta C.M. (1999). Differential regulation of

p21waf-1/cip-1

and MDM2 by etoposide: etoposide inhibits the p53-MDM2

autoregulatory feedback loop. Oncogene 18, 1081-91

150. Lando D., Gorman J.J., Whitelaw M.L., Peet D.J. (2003). Oxygen-

dependent regulation of hypoxia-inducible factors by prolyl and asparagynil

hydroxylation. Eur J Biochem. 270(5):781-90

151. Onate S.A., Tsai S.Y., Tsai M.J., O'Malley B.W.(1995). Sequence and

characterization of a coactivator for the steroid hormone receptor superfamily.

Science. 270(5240):1354-7

152. Towbin H., Staehelin T., Gordon J. (1979): Electrophoretic transfer of proteins

from polyacrylamide gels to nitrocellulose sheets: procedure and some

applications. Proc Natl Acad Sci USA, 76(9):4350-4354.

153. www.mitosciences.com (2011)

154. http://www.piercenet.com/(2010)

155. www.norgenbiotek.com(2011)

156. Koumenis C., Alarcon R., Hammond E., Sutphin P., Hoffman W., Murphy

M., Derr J., Taya Y., Lowe S.W., Kastan M., Giaccia A. (2001). Regulation of

p53 by hypoxia: dissociation of transcriptional repression and apoptosis from

p53-dependent transactivation. Mol Cell Biol. 21(4):1297-310.

157. Blagosklonny M.V., An W.G., Romanova L.Y., Trepel J., Fojo T., Neckers L.

(1998). p53 inhibits hypoxia-inducible factor-stimulated transcription. J Biol

Chem 273(20):11995-8.

158. Chen D., Li M., Luo J., Gu W.(2003). Direct interactions between HIF-1 alpha

and MDM2 modulate p53 function. J Biol Chem. 278(16):13595-8

159. Scolnick D.M., Chehab N.H., Stavridi E.S., Lien M.C., Caruso L., Moran

E., Berger S.L., Halazonetis T.D. (1997). CREB-binding protein and p300/CBP-

associated factor are transcriptional coactivators of the p53 tumor suppressor

protein. Cancer Res. 57(17):3693-6

160. Kallio P.J., Okamoto K., O'Brien S., Carrero P., Makino Y., Tanaka

H., Poellinger L. (1998). Signal transduction in hypoxic cells: inducible nuclear

124

translocation and recruitment of the CBP/p300 coactivator by the hypoxia-

inducible factor-1alpha. EMBO J. 17(22):6573-86.

161. Pradet-Balade B., Boulmé F., Beug H., Müllner E.W., Garcia-Sanz J.A. (2001).

Translation control: bridging the gap between genomics and proteomics? Trends

Biochem Sci. 26(4):225-9.

162. Keimling M., Wiesmüller L. (2009). DNA double-strand break repair activities

in mammary epithelial cells--influence of endogenous p53 variants.

Carcinogenesis. 30(7):1260-8

163. Bug M., Dobbelstein M. (2011). Anthracyclines induce the accumulation of

mutant p53 through E2F1-dependent and -independent mechanisms. Oncogene,

1-13

164. Lemon B., Tjian R. (2000). Orchestrated response: a symphony of transcription

factors for gene control. Genes Dev. 14(20):2551-69.

165. Beischlag T.V., Wang S., Rose D.W., Torchia J., Reisz-Porszasz

S., Muhammad K., Nelson W.E., Probst M.R., Rosenfeld M.G., Hankinson

O.(2002). Recruitment of the NCoA/SRC-1/p160 family of transcriptional

coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear

translocator complex. Mol Cell Biol. 22(12):4319-33

166. Redmond A.M., Bane F.T., Stafford A.T., McIlroy M., Dillon M.F., Crotty

T.B., Hill A.D., Young L.S. (2009). Coassociation of estrogen receptor and p160

proteins predicts resistance to endocrine treatment; SRC-1 is an independent

predictor of breast cancer recurrence. Clin Cancer Res.15(6):2098-106

167. Lavery D.N., Bevan C.L. (2011). Androgen receptor signalling in prostate

cancer: the functional consequences of acetylation. J Biomed Biotechnol.

2011:862125

168. Borra M.T., Smith B.C., Denu J.M. (2005). Mechanism of human SIRT1

activation by resveratrol. J Biol Chem. 280(17):17187-95

169. Zhang Q., Tang X., Lu Q.Y., Zhang Z.F., Brown J., Le A.D. (2005).

Resveratrol inhibits hypoxia-induced accumulation of hypoxia-inducible factor-

1alpha and VEGF expression in human tongue squamous cell carcinoma and

hepatoma cells. Mol Cancer Ther. 4(10):1465-74.

125

170. De Nardo D. and Latz E. (2011). NLRP3 inflammasomes link inflammation

and metabolic disease. Trends Immunol

171. Strober W., Fuss I.J. (2011). Proinflammatory cytokines in the pathogenesis of

inflammatory bowel diseases. Gastroenterology. 140(6):1756-67.

172. Papadakis K.A., Targan S.R. (2000). Role of cytokines in the pathogenesis of

inflammatory bowel disease. Annu Rev Med. 51:289-98.

173. Mor A., Aizman E., George J., Kloog Y.(2011). Ras inhibition induces insulin

sensitivity and glucose uptake. PLoS One.6(6):e21712.

174. Toi M., Bicknell R., Harris A.L. (1992). Inhibition of colon and breast

carcinoma cell growth by interleukin-4. Cancer Res. 52(2):275-9.

175. Aggarwal B.B., Shishodia S., Sandur S.K., Pandey M.K., Sethi G. (2006).

Inflammation and cancer: how hot is the link? Biochem

Pharmacol. 72(11):1605-21

176. Maxwell P.J., Gallagher R., Seaton A., Wilson C., Scullin P., Pettigrew

J., Stratford I.J., Williams K.J., Johnston P.G., Waugh D.J. (2007). HIF-1 and

NF-kappaB-mediated upregulation of CXCR1 and CXCR2 expression promotes

cell survival in hypoxic prostate cancer cells. Oncogene. 26(52):7333-45

177. Hussain S.P., Harris C.C. (2007). Inflammation and cancer: an ancient link with

novel potentials. Int J Cancer.121(11):2373-80.

178. Riou G., Lê M.G., Travagli J.P., Levine A.J., Moll U.M.(1993).

Poor prognosis of p53 gene mutation and nuclear overexpression of p53 protein i

n inflammatory breast carcinoma. J Natl Cancer Inst. 85(21):1765-7.

179. Aziz S.A., Pervez S., Khan S., Kayani N., Azam S.I., Rahbar M.H.(2001). Case

control study of prognostic markers and disease outcome in inflammatory

carcinoma breast: a unique clinical experience. Breast J. 7(6):398-404.

180. Schetter A.J., Heegaard N.H., Harris C.C..(2010). Inflammation and cancer:

interweaving microRNA, free radical, cytokine and p53 pathways.

Carcinogenesis. 31(1):37-49

181. Komarova E.A., Krivokrysenko V., Wang K., Neznanov N., Chernov

MV., Komarov P.G., Brennan M.L., Golovkina T.V., Rokhlin O.W., Kuprash

126

D.V., Nedospasov S.A., Hazen S.L., Feinstein E.,Gudkov A.V.(2005). p53 is a

suppressor of inflammatory response in mice. FASEB J. 19(8):1030-2

182. An W.G., Kanekal M., Simon M.C., Maltepe E., Blagosklonny M.V.,

Neckers L.M. (1998). Stabilization of wild-type p53 by hypoxiainducible factor

1a. Nature 392: 405–408

183. Ravi R., Mookerjee B., Bhujwalla Z.M., Sutter C.H., Artemov D., Zeng Q. et

al. (2000). Regulation of tumor angiogenesis by p53-induced degradation of

hypoxia-inducible factor 1a. Genes Dev 14: 34–44.

184. Graeber T.G., Osmanian C., Jacks T., Housman D.E., Koch C.J., Lowe

S.W., Giaccia A.J. (1996). Hypoxia-mediated selection of cells with diminished

apoptotic potential in solid tumours. Nature. 379(6560):88-91.

185. Ashcroft M., Taya Y., Vousden K.H. (2000). Stress signals utilize multiple

pathways to stabilize p53. Mol Cell Biol. 20(9):3224-33

186. Kishimoto H., Wang Z., Bhat-Nakshatri P., Chang D., Clarke R., Nakshatri

H.(2005). The p160 family coactivators regulate breast cancer cell proliferation

and invasion through autocrine/paracrine activity of SDF-1alpha/CXCL12.

Carcinogenesis 26(10):1706-15

187. de Nigris F., Rossiello R., Schiano C., Arra C., Williams-Ignarro S., Barbieri

A., Lanza A., Balestrieri A., Giuliano M.T., Ignarro L.J., Napoli C.(2008).

Deletion of Yin Yang 1 protein in osteosarcoma cells on cell invasion and

CXCR4/angiogenesis and metastasis. Cancer Res. 68(6):1797-808.

188. Moriuchi M., Moriuchi H., Margolis D.M., Fauci A.S. (1999). USF/c-Myc

enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a

coreceptor for HIV-1 entry. J Immunol. 162(10):5986-92

189. Lee S.K., Kim H.J., Na S.Y., Kim T.S., Choi H.S., Im S.Y., Lee J.W.(1998).

Steroid receptor coactivator-1 coactivates activating protein-1-mediated

transactivations through interaction with the c-Jun and c-Fos subunits. J Biol

Chem. 273(27):16651-4.

190. Laderoute K.R., Calaoagan J.M., Gustafson-Brown C., Knapp A.M., Li G.C,

Mendonca H.L., Ryan H.E., Wang Z., Johnson R.S. (2002). The response of c-

127

Jun/AP-1 to chronic hypoxia is hypoxia-inducible factor 1α dependent. Mol Cell

Biol. 22(8): 2515–2523

191. Weiss R.E., Xu J., Ning G., Pohlenz J., O'Malley B.W. and Refetoff S. (1999).

Mice deficient in the steroid receptor co-activator 1 (SRC-1) are resistant to

thyroid hormone. EMBO J. 18(7): 1900–1904

192. Zagzag D., Krishnamachary B., Yee H., Okuyama H., Chiriboga L., Ali M.A.,

Melamed J., Semenza G.L.(2005). Stromal cell-derived factor-1alpha and

CXCR4 expression in hemangioblastoma and clear cell-renal cell carcinoma:

von Hippel-Lindau loss-of-function induces expression of a ligand and its

receptor. Cancer Res.65(14):6178-88

193. Geminder H., Sagi-Assif O., Goldberg L., Meshel T., Rechavi G., Witz I.P.,

Ben-Baruch A. (2001). A possible role for CXCR4 and its ligand, the CXC

chemokine stromal cell-derived factor-1, in the development of bone marrow

metastases in neuroblastoma. J Immunol. 167(8):4747-57.

194. Vaziri H., Dessain S.K., Eaton E.N., Imai S.-I., Frye R.A., Pandita T.K.,

Guarente L. and Weinberg R.A. (2001) hSIR2SIRT1 functions as an NAD-

dependent p53 deacetylase. Cell,107, 149-159.

195. Bakker W.J., Harris I.S., Mak T.W..(2007). FOXO3a is activated in response to

hypoxic stress and inhibits HIF1-induced apoptosis via regulation of CITED2.

Mol Cell 28(6):941-53.

196. De Larco J.E., Wuertz B.R.K., Yee D., Rickert B.L., and Furcht L.T. (2003).

Atypical methylation of the interleukin-8 gene correlates strongly with the

metastatic potential of breast carcinoma cells. PNAS. 100 (24): 13988-13993

128