University of DebrecenCentre for Agricultural and Applied

Economics ScienceFaculty of Agricultural and Food

Sciences and Environmental Management

Effect of Stearoyl-COA desaturase gene polymorphism on milk production traits of Hungarian Holstein Friesian cows

By : Tegegn Gudeta, Jaleta (MSc thesis)

Debrecen , Hungary,May

2012

IntroductionMarker Assisted selection in modern dairyNumber of studies conducted in large scale on

candidate genes in dairy breedingSCD is hypothesiszed candidate gene

It catalyze Cis∆-9 desaturation Mapped to chromosome 26 in bovine SCD 1 and SCD5 Associated with milk fatty acid composition

Studies of SCD gene not conducted in HHF

Objectives of the study

To estimating allele and genotype frequencies of SCD gene polymorphism(878 C/T)

To determining the effect of SCD gene polymorphism on cows milk production traits

Materials and Methods1) Animals and Milk data Hair root samples (8-10) were collected

from 277 HHF in Tedej Dairy Farm located 15 km north of Debrecen

One lactation milk record data were collected for 277 HHF cows-305 day average milk yield (kg), fat yield (kg), fat percentage(%), protein yield (kg), protein percentage (%) and SCC (10,000 cell/ml)

2) Study MethodsMolecular Laboratory of UDDNA isolation from Hair root

3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK Water bath for 60 min at 60 0c , for 20 min at

95 oc water bath, stored at -20 oc

Spectrophotometrical Analysis-Nanodrop

RT-PCR 7300 Spectrophotometer

3) DNA Amplification and Sequencing7300 RT-PCR machine (Applied Biosystem)Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan

MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and 3.75µl dH2O.

TaqMan probe sequence:The fluorescent probe VIC:

ACTTACCCACAGCTCC The fluorescent probe FAM:

TTACCCGCAGCTCC

SCD Primers (625µl 40x mix, Warington, UK, WA37PB):Forward Primer: CCCCGAGAGAATATTCTGGTTTCCReverse primer : CCACTAGACGTGGTCTTGCT

Amplification and Sequencing protocolInitial steps: Activation at 950C for 10

minutes (AmpliTaq Gold DNA polymerase), Melting for 15 sec at 920C, Annealing/Extension at 600C for 1 minute (40 cycles).

The SNP 878 C/T was used in this study and the nucleotide substitution was identified according to Tanguichi et al., (2004).

4.) Data Analysis

a)Descriptive Statistics using R software (Version: R-2.14.2)

b)Hardy-Weinberg Equation c)Analysis of Variance (ANOVA) using R

software (Version: R-2.14.2)

Results and Discussion1. Genotypes and Allele Frequencies of SCD gene

Polymorphisms

Amplification curve for CC(left) and CT(right) genotypes

Result of amplification curve for TT genotype (Green line)

Allelic discrimination of SCD genotypes (Blue-CC, Green-CT, and Red-TT)

No of Animals (Genotype

Frequencies in %)

SCD

Allele %

P value X2

CC CT TT0.04695

3.947

Observed 94(34) 148(53) 35(13) C(0.61)

Expected 102(37) 132(48) 43(15) T(0.39)

Genotype and allele frequencyy of the SCD gene in the investigated Hungarian Holsteins cow population

2. Effects of SCD Genotypes on Recorded Milk Production Traits

Parameter Genotype

CC CT TT P value

Fat (%) 3.76±0.41 3.8±0.43 3.7±0.38 0.2272

Protein (%) 3.22±0.178 3.22±0.178 3.23±0.14 0.998

SCC(X103 cell/ml) 136±106.4 116±70.2 119±72.7 0.2264

305 MY (kg) 8277.5±1301 8468.5±1542 8463.4±1294 0.5805

305 FY (kg) 310.6±52.4 321.9±55.2 313±50.6 0.2505

305 PY (kg) 266.1±38.5 272.1±45.8 272.3±36.2 0.5315

Mean and standard deviation of milk production traits and its association with SCD genotypes.

Conclussions

Higher C allele(0.61) frequency and lower T allele (0.39) frequency was reported in this study

The SCD genotypes frequency in HHF herds under this study were not in Hardy-Weinberg equilibrium, the possible reason for this result may be small numbers of animals included in this study and indicating the herds were not in a random mating system

SCD-878 C/T locus cannot be considered as candidate gene in milk production traits

Further studies will be necessary on large number of animals to confirm the current result