Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
Catecholamine modulated novel surface exposed adhesin LIC20035 of Leptospira binds 1
host extracellular matrix components and is recognized by host during infection 2
Karukriti Kaushik Ghosh1, Aman Prakash
1, Vinayagamurthy Balamurugan
2, Manish Kumar
1# 3
4
1Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 5
Guwahati -781039, Assam, India 6
2Indian Council of Agricultural Research - National Institute of Veterinary Epidemiology and 7
Disease Informatics (ICAR-NIVEDI), Bengaluru, India 8
9
#Corresponding author: 10
Manish Kumar 11
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 12
Guwahati-781039, Assam, India 13
Email: [email protected] 14
Phone: +91-361-258-2230 15
Fax: +91-361-258-2249 16
17
Keywords: Leptospira, catecholamines, qRT-PCR, differential transcription, stress 18
19
Running Title: Catecholamines as chemical messenger for host-Leptospira interaction 20
AEM Accepted Manuscript Posted Online 21 December 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02360-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 21
In this study, the effect of host-stress hormone catecholamine on Leptospira gene transcripts 22
encoding outer membrane proteins was investigated. There was no impact of catecholamine 23
supplementation on the in vitro growth pattern of Leptospira interrogans, however, 7 genes 24
out of 41 were differentially transcribed and the effect of which was reversed to basal level in 25
the presence of its antagonist propranolol. Comprehensive analysis of one of the differentially 26
regulated protein LIC20035/LB047 due to catecholamine supplementation exhibited 27
immunogenic and adhesin property to host extracellular matrices. Protease-accessibility assay 28
and phase-partition of integral membrane proteins of Leptospira describes LIC20035/LB047 29
to be outer membrane surface-exposed protein. The recombinant-LIC20035 protein can be 30
serologically detected using human/bovine sera positive for leptospirosis. Moreover, the 31
recombinant-LIC20035 can bind to diverse host extracellular matrices and with a higher 32
affinity towards collagen and chondroitin sulfate. 33
Importance 34
Leptospirosis is a neglected tropical disease of global importance. This study aims at 35
identification of outer membrane proteins of pathogenic Leptospira responding to host 36
chemical signals like catecholamines with the potential to serve as virulence factors, new 37
serodiagnostic antigens, and vaccine candidates. This study mimics the plausible means by 38
which Leptospira during infection and hormonal stress intercepts host catecholamines to 39
disseminate in host tissues. 40
41
42
43
44
45
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 46
Leptospira is classified as spirochetes of pathogenic and non-pathogenic form with a variety 47
of different habitats in nature (23). However, the pathogenic Leptospira is maintained in a 48
complex enzootic cycle involving multiple host species and the variable environmental niche. 49
The host specificity of bacterial pathogens is determined by interactions between the 50
pathogens and their host factors (45). Host stress hormones is one of these host factors which 51
leads to adaptation of various pathogenic microbes in the human or animal body upon 52
infection (2, 10, 35, 63). The primary hormones synthesized under stress conditions in 53
animals and humans are the catecholamines. These are a large group of amine hormones 54
derived from tyrosine and include primarily Epinephrine (Epi) and Norepinephrine (NE). 55
Catecholamines are identified as the sympathetic neuroendocrine mediators of fight or flight 56
(acute stress) response of the host (47). The pathogenic and non-pathogenic microbes 57
intercepts host catecholamines and use it as an environmental cue to alter its growth and 58
virulence (47). In the last few years, numerous studies have been done in regard to the effect 59
catecholamines on the differential expression of outer membrane proteins (OMPs) of 60
infectious agents. In Escherichia coli, catecholamines can induce genes associated with 61
adhesion to host cells (10, 26, 36, 62), affect chemotaxis, colonization to Hela cells (2) and 62
can even enhance toxin production in them (37, 63). In the same way, in response to 63
catecholamine, Actinobacillus pleuropneumoniae (31) and Borrelia burgdorferi (54) actively 64
regulate virulence genes. Such studies have proved that the pathogens take advantage of the 65
host response on causing infection and illustrate the way in which pathogens can intercept 66
host hormonal signals to its advantage. Substantial evidence from aforementioned studies 67
conveys that bacteria have catecholamine response system(s) that possess(s) pharmacological 68
similarity to the mammalian adrenoceptors and dopamine receptors. 69
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
4
Outer membrane proteins of Leptospira are core components by which pathogenic Leptospira 70
interact with the host and play an essential role as adhesins (51), receptors for various host 71
molecules (44), and key mediators for adaptation to change in the environment (49). There 72
are three classes of outer membrane protein of Leptospira identified till date viz. outer 73
membrane lipoprotein, transmembrane protein, and the peripheral membrane protein (13). 74
Several leptospiral OMPs have been reported to have adhesion capacity with extracellular 75
matrix component of host and is an essential requisite for tissue invasion. 76
Taking consideration of above points, this study aimed at understanding modulation of OMPs 77
gene transcription in L. interrogans on exposure to catecholamines under in vitro condition. 78
We report transcript analyses using the real-time reverse transcription-PCR (qRT-PCR) 79
technique of selective genes encoding OMP of serovars Lai and Copenhageni in response to 80
Epi/NE and its antagonist propranolol (PO). It is anticipated that this approach will facilitate 81
the identification of OMPs responding to host chemical signals with the potential to serve as 82
virulence factors, new serodiagnostic antigens, and vaccine candidates. As an initial step 83
towards the comprehensive understanding of the effect of catecholamines on the transcription 84
of membrane proteins of L. interrogans, one out of seven genes viz. LIC20035/LB047 85
showing a response to catecholamines was further characterized. The coding sequence (CDS) 86
LIC20035/LB047 is a hypothetical membrane protein (50 kDa) of pathogenic Leptospira and 87
was found to be repressed in the presence of Epi, the effect of which was blocked in the 88
presence of its antagonist. Additionally, recombinant-LIC20035 (r-LIC20035) shows higher 89
affinity for host extracellular matrices like collagen and chondroitin sulfate. 90
91
92
93
94
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
5
Results 95
Effect of catecholamine supplementation on the growth of Leptospira 96
Human adrenergic agonists can affect growth of several medically important bacteria due to 97
its ability to act as siderophores providing elemental iron essential for metabolic activity (43). 98
A growth rate analysis of L. interrogans serovar Lai was performed in the presence and 99
absence of Epi/NE (500 μM) and its antagonist PO (500 μM) to examine any effect on the 100
growth of spirochetes in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium under in 101
vitro culture condition (IVCL) at 29 ºC. There was no statistical difference in the growth rate 102
of the spirochetes at any time point (0-120 hrs) in the presence of catecholamines or its 103
antagonist (Fig 1). These results show that the working concentration of catecholamines (500 104
μM) used for the experiments was not affecting the growth of the bacterium under IVCL. 105
Since, the catecholamines have also been shown to be involved in modulating bacterial 106
virulence (31, 54), it evoked interest to study their effects on the selective transcriptome of 107
the spirochetes. 108
109
Effect of catecholamines on spirochetes selective gene transcripts 110
A total of 41 genes of L. interrogans serovar Lai were chosen, which are predicted to be 111
membrane protein using program PSORT. Few genes with assigned function e.g. those 112
involved in an iron uptake were also included for analyzing the in vitro transcription pattern 113
in the presence of Epi/NE and its antagonist through qRT-PCR. Two constitutive genes flaB 114
and 16S rRNA (rrs2) of Leptospira was included in the study to select for the best gene that 115
can be implemented for normalizing gene transcription data obtained through qRT-PCR. 116
There was no significant change in the transcription of 16S rRNA (threshold cycle, Ct values) 117
in comparison to flaB in all the experimental samples analyzed by qRT-PCR. Therefore, the 118
transcripts of target genes of Leptospira grown under IVCL supplemented with 119
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
6
catecholamines were normalized with 16S rRNA transcripts using 2-∆∆Ct
method and the 120
transcripts of each normalized gene are represented as the number of gene transcripts per 121
1000 copies of 16S rRNA. It is to be noted that there are two 16S rRNA genes in Leptospira 122
and in this study rrs2 was opted as it gave higher Ct values than rrs1. 123
On statistical analyses, there were 7 genes (LB047, LB186, LB191, LA0616, LA3263, 124
LA3307, and LA3961) out of 41, that showed significant (P-value < 0.05) differential 125
transcription in the presence of Epi/NE and the effect of which was restored to the basal level 126
(control) in the presence of its antagonist (Fig 2A). Encouraged by this finding, it was 127
interesting to evaluate if the effect of catecholamine was universal to other pathogenic 128
serovars of Leptospira. A nucleotide BLAST to determine the sequence identity of the genes 129
in pathogenic serovars Lai and Copenhageni from KEGG GENES database were performed 130
(29). The genes which were significantly upregulated in serovar Lai were found to be present 131
in serovar Copenhageni with 99% gene sequence identity as shown in Table 1. Therefore, 132
under similar experimental conditions, responses of catecholamines on L. interrogans serovar 133
Copenhageni gene transcripts were analyzed. As expected, gene transcripts of these selective 134
7 genes in serovar Copenhageni also showed a similar trend of differential transcription in the 135
presence of catecholamines or its antagonist (Fig 2B). The fold changes of transcripts of 136
these 7 genes in the presence of Epi/NE were calculated with respect to basal level expression 137
(control) for both the serovars of Leptospira (Fig 2C and 2D). It was observed that the two 138
genes (Lai/Copenhageni: LB191/LIC20151, LA3307/LIC10841) differentially transcribed in 139
the presence of both Epi and NE whereas 5 genes responded either in presence of Epi 140
(LB047/LIC20035) or NE (LA0616/LIC12966, LA3961/LIC13166, LA3263/LIC10878, and 141
LB186/LIC20148). Additionally, three genes (LB047/LIC20035, LB186/LIC20148, and 142
LB191/LIC20151) in the presence of Epi/NE showed down regulation in its transcription and 143
four genes (LA0616/LIC12966, LA3961/LIC13166, LA3263/LIC10878, and 144
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
7
LA3307/LIC10841) were upregulated. The gene transcripts (normalized) data that showed 145
statistically insignificant differential transcription (32 genes) of the spirochetes were 146
segregated in three-independent clusters based on copies of gene transcripts (Fig S1A, 1B, 147
1C). Among the selected 41 genes, two genes (LB194 and LA3340) were excluded from the 148
study as they showed very high fluctuations in their Ct values. 149
The impact of gene transcription represented here was by growing spirochetes in the presence 150
of catecholamine at a concentration of 500 µM. In contrast, numerous studies on other 151
bacteria have been performed by supplementing catecholamine at physiological concentration 152
(50 µM) of host gastrointestinal tract stressful conditions (1, 20). Therefore, another 153
independent experiment was performed to analyze the effect of catecholamine at 50 µM on 154
the 7 differentially transcribed genes of spirochetes (Fig S2). The transcript results indicated a 155
similar response in L. interrogans serovar Lai, in the presence of catecholamine at 50 µM 156
concentration (Fig S2). 157
158
Molecular characterization of hypothetical protein LIC20035/LB047 159
Among the seven genes that were significantly differentially expressed in the presence of 160
catecholamine(s), LIC20035/LB047 encoding hypothetical outer membrane protein in 161
Leptospira was selected for further characterization. Protein BLAST was performed to 162
identify orthologs of LIC20035 in the pathogenic, intermediate and saprophytic strains of 163
Leptospira. As is evident from Table 2, LIC20035 is more well conserved (88 - 99 % amino 164
acid sequence identity) across pathogenic leptospires in comparison to intermediates (62 - 64 165
%) and saprophytic strains (39 - 40 %). Oligomers designed for LIC20035 was used to 166
analyze the existence of this gene by PCR in various available pathogenic (L. interrogans 167
serovars like Copenhageni, Lai, Canicola) and saprophytic (L. biflexa serovar Patoc) forms of 168
Leptospira. Using PCR, amplification of 1275 bp confirmed the existence of LIC20035 in 169
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
8
various pathogenic spirochete serovars viz. Copenhageni, Lai, and Canicola of Leptospira. 170
Interestingly no amplicon was detected in non-pathogenic serovar Patoc (Fig 3A). However, 171
amplification of flaB gene of 852 bp could be seen in all pathogenic and non-pathogenic 172
serovars of Leptospira (Fig 3A). 173
The CDS LIC20035 was cloned without its predicted signal peptide using genomic DNA of 174
L. interrogans serovar Copenhageni and over-expressed in E. coli BL21 (DE3) cells. The 175
over-expressed r-LIC20035 was purified using Ni-affinity column chromatography (Fig 3B). 176
Subsequently, the purified recombinant protein was used to generate antibodies in BALB/c 177
mice. The polyclonal antibodies generated against r-LIC20035 showed an end-point titer of 178
1:5000 (Fig 3C). The immunoblot of the L. interrogans Lai grown in the presence of 179
catecholamines and its antagonist demonstrated that the generated polyclonal anti-LIC20035 180
were able to recognize LB047 at the expected size of 50 kDa. As expected, there was a 181
repression of the LB047 in the presence of Epi in comparison to the basal expression in 182
control (Fig 3D). Interestingly, the expression of LB047 in the spirochetes grown in the 183
presence Epi and its antagonist combined was considerable of the same magnitude to that of 184
control. The antigen LipL31 consistent expression in the host and under IVCL has been 185
previously described (7). Thus, the same nitrocellulose membrane probed with anti-LipL31 186
demonstrated equal loading of all the experimental samples (Fig 3D). In the same context, the 187
relative densitometry of LB047 expression obtained from immunoblot illustrated LB047 to 188
be repressed in the presence of Epi and its expression was restored to the basal level in the 189
presence of antagonist, PO (Fig 3E). Further, to understand the function of LIC20035, the 190
secondary structure of the purified r-LIC20035 was evaluated by circular dichroism (CD). 191
The CD spectroscopy data showed maxima at 215 nm and minima at 200 nm wavelengths 192
(Fig 3F). The spectroscopic data analysis using program K2D2 (46) revealed 2% α-helix and 193
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
9
52% β-sheet. This was in agreement to the theoretical secondary structure of the r-LIC20035 194
which predicted 0% α-helix and 66% β-sheet using program PSIPRED. 195
196
LIC20035 is a predominant outer membrane surface-exposed protein 197
Cellular localization of LIC20035 was assessed by Triton X-114 detergent solubilization and 198
phase partitioning. Solubilizing Leptospira in 1% Triton X-114 yields a detergent insoluble 199
fraction known as protoplasmic cylinder (PC) fraction and a detergent soluble fraction (24). 200
The Triton X-114 soluble fraction is resolved into two phases by heating above the cloud 201
point (37 ºC) of this detergent, resulting in separation of the detergent-hydrophobic phase (D) 202
from the detergent-poor aqueous phase (A) (21). Infact, previous cellular localization studies 203
of Leptospira (21, 24) show that the outer membrane lipoproteins separates in Triton X-114 204
detergent phase, while periplasmic proteins separate into the aqueous phase of the soluble 205
fraction. The immunoblot using polyclonal anti-LIC20035 detected the LIC20035 to be 206
predominantly present in the detergent phase of the Triton X-114; however, a small amount 207
of the protein could also be traced in the aqueous phase (Fig 4A). Additionally, to validate the 208
Triton X-114 phase separation experiment, anti-LipL32 was used as a positive control to 209
detect LipL32 which was reported to be present only in detergent phase (21). A conspicuous 210
band of LipL32 observed only in the detergent phase of the Leptospira lysates by 211
immunoblot underpins experimental procedures for separating the membrane bound proteins 212
(Fig 4B). 213
To validate LB047 is a surface-exposed membrane protein; a protease-accessibility assay was 214
performed for L. interrogans serovar Lai. The integrity of the spirochete cell wall during 215
Proteinase K treatment was confirmed by performing ELISA using antiserum against LipL31, 216
a previously described cytoplasmic protein (21). Similarly, an antibody against a known 217
surface-exposed protein OmpL54 (48) was used as a positive control. After 1 to 5 h treatment 218
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
10
with Proteinase K, LB047 showed a decrease in recognition with its antiserum, similar to the 219
positive control, OmpL54 (Fig 4C). Around 50% reduction in LB047 recognition was 220
observed after 5 h of protease assay. In contrast, no significant reduction in reactivity with 221
anti-LipL31 describes the integrity of spirochete membrane was not compromised during the 222
Proteinase K assay (Fig 4C). Taken together, the cellular localization using Triton X-114 and 223
Proteinase K assay suggest LB047/LIC20035 to be a surface-exposed membrane protein. 224
225
LIC20035 is detected by antibodies of human and bovine leptospirosis serum 226
As LIC20035 is localized in the outer membrane of spirochetes, it was interesting to evaluate 227
its serological recognition using immunoglobulins of Leptospira infected hosts. The 228
recombinant proteins (Loa22 and LIC20035) were coated on microtitre plates and were 229
probed with human or bovine serum tested positive for leptospirosis (n=50) through 230
microscopic agglutination test (MAT +ve). As a control, serum samples of human (n=15) and 231
bovine (n=10) tested negative for leptospirosis (MAT -ve) were included in the serological 232
assay. The average optical density (OD) for serological detection of LIC20035 antigen in 233
humans (Fig 5A) and bovine serum (Fig 5C) were heterogeneous (0.5618 and 0.4449, 234
respectively). Moreover, the difference between the absorbance obtained for Loa22 (0.6404) 235
and LIC20035 (0.4449) for bovine infected serum samples was very high (Fig 5B and 5D). 236
The calculated sensitivity and specificity of serological detection of LIC20035 by 237
bovine/human serum was 100/98 % and 100/100 %, respectively. In contrast, Loa22 showed 238
sensitivity and specificity of 100/100 % with bovine/human serum. 239
240
LIC20035 binds to extracellular matrix components of host 241
The numerous study about the attachment of L. interrogans to extracellular matrices of host 242
gave a clue to the existence of several adhesion molecules (3). Thus, ELISA was performed 243
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
11
to study the interaction of r-LIC20035 with the ECM components. The r-LIC20035 along 244
with r-Loa22 was allowed to bind with the immobilized ECM components on a 96-well plate 245
with BSA and the highly glycosylated serum protein, fetuin, as negative controls. The r-246
LIC20035 showed significant binding (P<0.001) with all the ECM components in contrast to 247
Loa22 (Fig 6A). The highest affinity of r-LIC20035 was seen with collagen type I and 248
chondroitin sulfate. Additionally, quantitative analyses of the binding of r-LIC20035 with 249
each of these ECM components are shown in Fig 6B. A dose-dependent saturable binding 250
was observed with increasing concentration of the recombinant protein (0-8 µM) over a fixed 251
amount of the ECM components (1 µg). The r-LIC20035 protein interacts with the host 252
ligands in a dose-dependent and saturable fashion with the calculated KD of 200 nM, 250 nM 253
and 200 nM for collagen type I and chondroitin sulfate A, and chondroitin sulfate B, 254
respectively. 255
256
Discussion 257
A wide range of pathogenic bacteria like Salmonella (60), Helicobacter (16), and 258
Staphylococcus (18) have been found to be responsive to the stress hormones. However, very 259
little is known about the spirochetes response to stress hormones in mammalian host. 260
Therefore, in the present study, effects of stress hormones on the transcription of selective 261
membrane proteins of Leptospira were investigated. The typical concentration of stress 262
hormone used in various studies of microbes-hormone chemical communication was in the 263
range of 50-500 µM which is equivalent to the physiological concentration detected in the 264
host (18, 35). In this study, catecholamines or its antagonist, alone or in combination did not 265
alter the rate of growth of Leptospira under IVCL at 29 ºC. These were in agreement with the 266
growth pattern of another spirochete Borrelia borgdorferi in the presence of the 267
catecholamines and its antagonist propranolol (54). However, in numerous other bacteria, 268
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
12
growth rates is also augmented in the presence of catecholamines (52, 56). Apparently, the 269
response of bacteria to catecholamines on its growth rate is variable. 270
It is evident from the present work that the Leptospira in the presence of stress hormones can 271
modulate its gene transcripts selectively and the effect of which can be inhibited in the 272
presence of its antagonist. The mechanistic of such gene modulation in spirochetes due to 273
catecholamine is under infancy till date, however, Sperandio and his co-workers have 274
reported that the catecholamines can induce expression of virulence factors of E. coli 275
0157:H7 by mimicking the action of the autoinducer-3 (AI-3) quorum sensing (QS) system in 276
bacteria (57). AI-3 and Epi/NE are thought to be recognized by the same two- component 277
histidine kinase (HK) receptor (QseBC) of E. coli 0157:H7 (64). We speculate that similar 278
form of interaction with mammalian catecholamine and HK receptor might be playing role in 279
differential transcription of Leptospira genes. Using PSORT program, it is estimated that 280
Leptospira possesses 29 HK two-component receptors, out of which 19 are predicted to be 281
located in the inner membrane, 9 in the cytoplasm and one in periplasm of Leptospira (42). 282
Nevertheless, understanding the Leptospira mechanism of differential transcription of genes 283
in response to catecholamine is warranted for future studies. 284
285
Catecholamines have been reported to bind to the ferric iron binding proteins of host (19) and 286
facilitate in release of iron for microbial uptake. Therefore 10 genes (LA1005, LA1796, 287
LA4253, LA0634, LB194, LB187, LB191, LB183, LA2579, LB186) of Leptospira involved in 288
iron-uptake (34) were included in this study. Our results indicate that only two genes of 289
Leptospira involved in iron-uptake (LB186 and LB191) were repressed in the presence of 290
catecholamines. The possible reason for such discrepancy in gene transcription may be due to 291
difference in the availability of iron source under in vitro and in vivo condition (65). In other 292
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
13
words, the available iron in the culturing EMJH medium exists as free Fe2+
(39, 40) whereas 293
in the host it is in bound form. 294
Besides iron-uptake regulators, two genes namely LA3961/LIC13166 (OmpL36) and 295
LA0616/LIC12966 (LipL41, Omp) were upregulated in the presence of NE. Leptospires outer 296
membrane lipoprotein OmpL36 is characterized as a flagellar component of both pathogenic 297
and non-pathogenic strains of Leptospira (48). While Leptospira LipL41, the third most 298
predominant outer membrane lipoprotein (14) is absent in the saprophytic strains (6). The 299
trend of upregulation of OmpL36 transcripts in the presence of NE was possibly a token 300
towards the enhanced motility of the bacteria in the host during stress condition leading to 301
dissemination of spirochetes to various host tissues. Our findings that OMPs (LipL41 and 302
OmpL36) are differentially regulated due to host hormonal stress is in agreement with an 303
erstwhile microarray study where LipL41 and OmpL36 were highly repressed in the presence 304
of macrophages (65). 305
The molecular function of one the differential expressed rfe gene (LA3307/LIC10841) has 306
been predicted to be involved in lipopolysaccharide (LPS) synthesis (UniProtKB Q72U23). 307
This rfe gene in our experimental condition was found to be many folds (35/40 folds) 308
upregulated in the presence of Epi/NE. Therefore, understanding rfe physiological 309
requirement and mechanism of sensing such biochemicals will be an appealing subject of 310
future study. In addition, two hypothetical proteins (HP) namely LB047/LIC20035 and 311
LA3263/LIC10878 were found to be differentially regulated in the presence of Epi or NE, 312
respectively. This gene regulation was endorsed by the recent report of differentially 313
regulated genes of Leptospira grown inside dialysis membrane chamber or in the presence of 314
macrophages (7, 65) 315
316
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
14
Among the differentially regulated genes, LIC20035/LB047 was further characterized as it 317
codes for a conserved hypothetical protein in Leptospira. Additionally, LIC20035 orthologs 318
are more conserved among pathogenic leptospires than the intermediate or saprophytic 319
strains. Interestingly, many known leptospiral virulent OMPs like Loa22 have orthologs in 320
saprophytic strains of Leptospira and therefore absence or presence of orthologs in the 321
saprophytes may not be an accurate criteria for predicting a gene to be virulent (25). 322
323
The polyclonal antibodies generated against r-LIC20035 were able to recognize native-324
LIC20035 expression predominantly in the detergent phase of Triton X-114. Similarly, 325
cellular localization experiment using protease-accessibility assay describes LB047 to be 326
surface-exposed membrane protein. However, for some surface exposed proteins the 327
Proteinase K cleavage sites are inaccessible due to steric hindrance by LPS at the surface of 328
Leptospira (48). A previous study on LIC20035 (demarcated as NT03LIA0039, TIGR locus) 329
from elsewhere (41), described LIC20035 to be present in the Triton X-114 fraction of IVCL 330
and was detectable in the immunoblot using antibodies raised against Leptospira outer 331
membrane vesicles (OMV). Nevertheless, in the same study LIC20035 was not recognized in 332
the Triton X-114 fraction of spirochetes isolated from infected guinea pig liver (41). The 333
spirochetes expression of LIC20035 in guinea pig liver may be due to the multiple effects of 334
host factors; however, this is in agreement to the LIC20035 repression in the presence of Epi. 335
The Sero-reactivity of LIC20035 against MAT-positive serum samples of humans/bovine 336
demonstrates that humoral immune response was generated against LIC20035 during natural 337
infection of Leptospira in the host. Recognition of LIC20035 by the hosts during infection 338
suggests that LIC20035 could be a useful serodiagnostic antigen. As OMPs are the primary 339
bacterial components that interact with host cells, targeting newly identified OMPs for 340
development of recombinant vaccines could be rewarding. Till date several OMPs of 341
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
15
Leptospira have been reported, nevertheless, none of them have been commercialized as 342
highly effective vaccine candidate (50). Considering the wide variety of serovars of 343
Leptospira and their host specificity, it is tempting to screen more protective antigens in order 344
to develop a multi-component vaccine. Recently, LIC20035 expression was described to be 345
undetectable using serum of rat which were chronically infected with Leptospira (41). This 346
may also indicate that the expression of Leptospira LIC20035 varies depending upon host to 347
host chemical signals. The ECM components of host facilitate adhesions with different 348
microbial proteins and these interactions are essential for microbial pathogenicity (11). 349
Binding assay of r-LIC20035 with host ECM components showed preferential higher affinity 350
for collagen and chondroitin sulfate. The measured affinity of r-LIC20035 for collagen was 351
near to that of LIC13143 (TlyC) (8) but higher than LIC11352 (LipL32) (27). Additionally, r-352
LIC20035 binding to chondroitin sulfate is corroborated by the previous reports of L. 353
interrogans adhering to chondroitin sulfate (51). The chondroitin sulfate component is one of 354
the most abundant cell surface glycosaminoglycans (GAGs) that mediates bacterial 355
attachment to the host cell surface (4). As LIC20035 is found to be surface-exposed 356
membrane protein expressed during infection and its recombinant protein adhere to more than 357
one host ECM components, it is liable to participate in mediating attachment to host tissues 358
as previously reported for other proteins of spirochetes like Len (58), and Lsa63 (61). This 359
study mimics the possible means by which one of the host factors catecholamines is being 360
adapted by Leptospira to disseminate in various host tissues. Future work on host-pathogen 361
chemical signaling is warranted for development of wide-range of disease intervention 362
strategies. 363
364
Materials and methods 365
Bacterial strains, media and growth condition 366
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
16
The bacterial strains L. interrogans serovar Lai and L. interrogans serovar Copenhageni 367
Strain Fiocruz L1-130 were obtained from Indian Council of Medical Research (ICMR), 368
Regional Medical Research Centre, Port Blair, Andaman and Nicobar Island, India. 369
Spirochetes were grown in EMJH (Ellinghausen-McCullough-Johnson-Harris) medium 370
(Difco) maintained at 29 °C with 10% heat-inactivated rabbit serum (56 °C for 30 min) 371
unless stated. For growth rate and gene transcription profiling, 2×103 spirochetes were seeded 372
per mL of EMJH medium. To this, catecholamines (Epi or NE; Sigma, USA) and its 373
antagonist propranolol (PO) or an equivalent volume of vehicle (control) were added in 374
combination or alone to a final concentration of 500 µM until it reached log-phase as 375
described before (32). The spirochetes were identified and counted every 24 h for five days 376
under phase contrast microscopy (CX41, Olympus) using Petroff-Hausser cell counting 377
chamber as described elsewhere (54). 378
379
Nucleic acid isolation and real time RT-PCR 380
Total RNA of spirochetes were isolated from the log-phase of the growth curve in the 381
presence and absence of catecholamines or its antagonist, using Trizol (Invitrogen) method as 382
described elsewhere (15). After DNase (NEB) treatment of total RNA, quality and quantity of 383
RNA were determined using gel electrophoresis and spectrophotometry. A total of 1 µg RNA 384
of spirochete was converted to its complementary strand DNA (cDNA) using Verso cDNA 385
synthesis kit (Thermo Scientific). To rule out genomic DNA contamination, cDNA synthesis 386
was performed without adding the reverse transcriptase as a negative control. The 387
oligonucleotides used for qRT-PCR were designed using OligoPerfect primer design program 388
(Invitrogen) from the available L. interrogans serovar Lai genomic sequence. All qRT-PCR 389
oligonucleotide pairs were designed with a similar annealing temperature (60 ºC) and 390
amplicon size (100-300 base pairs). Each primer pair was tested for efficiency and non-391
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
17
specific amplification using SYBR Green PCR master mix (Applied Biosystems) and 392
Leptospira genomic DNA as a template in the 7500 Real Time PCR System (Applied 393
Biosystems). The real-time PCR system was programmed with 50 ºC, 2 min; 95 ºC, 10 min; 394
40 cycles of 95 ºC, 15 s; 60 ºC, 1 min followed by melt curve analyses of the PCR products. 395
The details of the genes obtained from UniProtKB database (12) and the primers used in this 396
study are listed in Table 3. Transcripts of target genes were quantified using 2-∆∆Ct
method 397
(55) and normalized with 16S rRNA gene of Leptospira (38). The expression profile of the 398
genes regulated by the catecholamines or its antagonist in comparison to the control was 399
performed in two independent experiments to achieve statistically significant results. 400
401
Protein over-expression and purification 402
Predicted CDSs of LIC20035 (1275 bp) and LIC10191 (519 bp) were amplified without the 403
signal peptide sequence by PCR from the available genomic sequence of L. interrogans 404
serovar Copenhageni strain Fiocruz L1-130. InstaTA cloning kit (Thermo Fisher scientific) 405
was used to facilitate gene cloning. Thereafter, LIC20035 was cloned in pET28a vector and 406
over-expressed in E. coli BL21 (DE3) competent cells. The restriction endonuclease site 407
(italicized and underlined) of the oligomers used in cloning of LIC20035 and LIC10191 408
genes in pET28a vector (Novagen San Diego, CA, USA) is shown in Table 1. The calculated 409
molecular weight of r-LIC20035 and r-LIC10191 (Loa22) protein is 50 and 22 kDa, 410
respectively. 411
E. coli BL21 (DE3) competent cells were induced using 0.5 mM IPTG in 1 liter of LB 412
medium at 37 ºC for 4 h. The cell pellet obtained was lysed with cold denaturing lysis buffer 413
(8 M Urea, 20 mM Na3PO4 pH-7.8, 500 mM NaCl) and thereafter sonicated for 15 min with 414
6 s on and off cycles. The resulting homogenate was centrifuged at 12,000 g for 30 min to 415
remove cellular debris. Induced recombinant proteins were purified by affinity column 416
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
18
chromatography using Ni-nitrilotriacetic acid (Ni-NTA) resins (Invitrogen) using the protocol 417
published elsewhere (30). Briefly, N-terminal 6X His-tagged recombinant proteins bound to 418
Ni-NTA resins were washed with denaturing wash buffer (8 M Urea, 20 mM Na3PO4 pH-6.0, 419
500 mM NaCl) and subsequently with native wash buffer (50 mM NaH2PO4 pH-8.0, 500 mM 420
NaCl and 20 mM Imidazole). The recombinant proteins were then eluted out using elution 421
buffer (50 mM NaH2PO4 pH-8.0, 500 mM NaCl and 250 mM Imidazole). Thereafter, the 422
purified proteins were dialyzed (Pierce protein dialyzing cassette) and concentrated (Corning 423
Centricon Spin-x-UF) to 0.4 mg/mL in dialysis buffer (50 mM Tris-Cl buffer pH-8 and 100 424
mM NaCl) before storing it at -80 ºC. 425
426
Circular dichroism (CD) spectroscopy 427
Circular dichroism (CD) spectroscopy measurements were performed for r-LIC20035 at 428
room temperature using a Jasco J-815 spectropolarimeter (Japan Spectroscopic, Tokyo) at a 429
scanning speed of 100 nm/min. Far-UV CD spectra were measured using a 5 mm-path-length 430
cell at 0.5 nm intervals. The spectra were presented as an average of 3 scans recorded from 431
190 to 260 nm and smoothed using Savitzky–Golay filter (53). The molar ellipticity (Φ) is 432
expressed in degree.cm2.dmol
-1. Spectra data were submitted to K2D2 web server (46) that 433
calculated the secondary structure content from the ellipticity experimental data. The 434
theoretical secondary structure was calculated using PSIPRED v3.3 (28). 435
436
Generation of polyclonal antibodies against purified recombinant-LIC20035 and Loa22 437
Antigen r-LIC20035 was used to immunize 4-6 weeks old female BALB/c mice 438
subcutaneously. About 10 µg per mouse of recombinant protein emulsified in Freund’s 439
complete adjuvant (FCA, Cat No. sc-3727 from Santa Cruz Biotechnology) was used for 440
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
19
primary immunization (5 mice per group). A negative control group was injected with equal 441
volume phosphate buffer saline (PBS) along with the adjuvant. Immunized mice were further 442
given two booster injections of recombinant protein emulsified in Freund’s incomplete 443
adjuvant (FIA, Cat No. 3726 from Santa Cruz Biotechnology) at 14 and 24 days of primary 444
immunization. At 10 days of second booster, blood was collected from each mouse by retro-445
orbital bleeding and then was sacrificed using atlantooccipital dislocation method as 446
described before (30). Sera obtained were pooled for antibody titre analysis by ELISA before 447
experimental use. Immunization experiments in mice were performed in Department of 448
Veterinary Microbiology, College of Veterinary Science, Assam Agriculture University 449
Guwahati, India, after approval by Institutional Animal Ethics Committee. Antibodies against 450
r-Loa22 were generated in rabbit by outsourcing the purified protein to Abgenex, 451
Bhubaneswar, India. 452
453
Enzyme linked immunosorbent assay (ELISA) for LIC20035 titre determination 454
Disposable 96-well polystyrene plate was coated with 50 µL of r-LIC20035 (400 ng/well) 455
and incubated overnight at 4 ºC. It was blocked with 100 µL of 3 % bovine serum albumin 456
(BSA) at 37 ºC for 2 h. After three times washing of wells with 200 µL of phosphate buffer 457
saline containing 0.05 % Tween 20 (PBS-T), plate was incubated with 50 µL of mouse anti-458
LIC20035 of various dilutions (1:1000; 1:5,000; and 1:10,000) at 37 ºC for 2 h. Pooled pre-459
immune serum of mice was used as a negative control. After three washing, wells were 460
probed with 50 µL of goat anti-mouse IgG HRP-conjugated (1:5000) for 1 hour at 37 ºC. The 461
plate was washed as described above and the binding was detected by adding TMB 462
(Tetramethyl Benzidine) peroxidase substrate (Thermo Fisher scientific) for 10 min at 37 ºC. 463
Final optical density (OD) was taken at 450 nm wavelength using ELISA plate reader 464
(Infinite 200 Pro, Tecan) after terminating the reaction with 1 M H2SO4. The endpoint titre 465
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
20
was determined visually, being the highest serum dilution giving a positive color 466
development. 467
468
Immunoblot assay 469
Whole cell lysates of L. interrogans serovar Lai grown in the presence and absence of 470
catecholamines were resolved onto 12 % SDS-PAGE and transferred to a nitrocellulose 471
membrane (HiMedia). Membranes were blocked with 5 % non-fat dried milk diluted in Tris-472
buffer saline (TBS, pH-8) containing 0.05 % Tween 20 (TBS-T) and probed with anti-473
LIC20035 (1:500) mouse polyclonal serum for 2 h at room temperature. After washing, the 474
membranes were incubated with HRP-conjugated goat anti-mouse IgG (1:5,000; Sigma) in 475
TBS for 1 h. The protein reactivity was revealed by adding chemiluminescence substrate 476
(Thermo scientific, Catalog no. 32209) over nitrocellulose membrane and imaged under 477
Chemidoc (Biorad XRS+). Band densitometry of the LB047 expression obtained from 478
immunoblot was quantified using Image Lab software (Biorad) as described before (59) and 479
the density values were normalized with LipL31 expression in the immunoblot. The relative 480
densitometry of LB047 expression was calculated in terms of percentage from two 481
independent immunoblot experiments. 482
483
Phase separation of integral membrane protein using Triton X-114 484
Phase separation of the integral membrane proteins of Leptospira to localize LIC20035 was 485
performed using Triton X-114 solution as described elsewhere (5). Briefly, 1×109
spirochetes 486
grown in EMJH medium were centrifuged (5,000 g) and washed 3 times with phosphate 487
buffer saline (PBS). The pellet obtained was sonicated four times with 20 s burst after 488
suspension in 800 µL of PBS. The suspension was added with 200 µL of 10% Triton X-114 489
(Sigma, Cat No. X114) and was rocked overnight at 4 °C. The insoluble debris was removed 490
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
21
by centrifugation at 13,000 g for 15 min at 4 °C and placed in 37 °C water bath for 10 min. 491
The suspension was centrifuged for 10 min at 13,000 g at room temperature to separate the 492
detergent (D) and the aqueous phase (A). The detergent phase (50 µL) was mixed with 1 ml 493
of original buffer at 0 °C, rewarmed at 37 °C and spun in a microcentrifuge as before. Later, 494
the final aqueous (A) and detergent phase (D) obtained after three times wash were 495
precipitated with 10 volumes of chilled acetone. The aqueous (A) and detergent phase (D) 496
was then resolved on 10% SDS-PAGE before transferring to nitrocellulose membrane 497
(Himedia) for immunoblot. 498
499
Protease-accessibility assay for the cellular localization of LB047 500
Proteinase K assay was performed for cellular localization of LB047 using the procedures 501
described elsewhere (17). Briefly, suspensions of 15 mL of 6 day old live L. interrogans Lai 502
(2.5 × 108
spirochetes/mL) were harvested and resuspended in 6 mL of PBS containing 25 µg 503
of Proteinase K (SRL). Tubes containing 1 mL of resuspended spirochetes were then 504
incubated for 0, 1, 3, and 5 h before the addition of 10 µl of 100 mM phenylmethylsulfonyl 505
fluoride (PMSF) to terminate the Proteinase K activity. The suspensions were subsequently 506
pelleted by centrifugation at 5000 g for 15 min, washed twice with PBS and resuspended in 1 507
mL of PBS for performing ELISA using antibodies against OmpL54, LB047 and LipL31. 508
OmpL54 and LipL31 are outer membrane and cytoplasmic leptospiral proteins that were used 509
in this experiment as positive and negative controls respectively (22, 48). The antibodies 510
against OmpL54 and LipL31 raised in rabbits were obtained from Dr. David Haake. For the 511
cellular localization of LB047 by ELISA, 100 µl of the Proteinase K treated leptospires were 512
coated onto the microtest plates and incubated for 16 h at room temperature. The primary 513
antibody against OmpL54, LIC20035, and LipL31 were used at a dilution of 1:50, 1:500 and 514
1:1000, respectively. Goat anti-Rabbit/anti-Mouse IgG HRP-conjugated secondary antibodies 515
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
22
were used at a dilution of 1:5000. The binding was detected as described in endpoint titre 516
determination. 517
518
ELISA for recognition of recombinant-LIC20035 using sera tested positive for leptospirosis 519
Serum samples of human and bovine (n=50) which had tested positive for leptospirosis 520
through Microscopic agglutination test (MAT), were used for recognition of r-LIC20035 by 521
ELISA. Another antigen r-LIC10191 (Loa22), a known surface-exposed lipoprotein of 522
leptospirosis diagnosis (9), was taken in equivalent amount to testify the ELISA results and to 523
scale the absorbance obtained for r-LIC20035. Microtitre plates were coated in duplicates 524
with equal amount (400 ng/well) of recombinant proteins (r-LIC20035 and r-Loa22) 525
overnight at 4 ºC and thereafter unbound surface was blocked with 3% BSA at 37 ºC for 2 526
hours. After 3 washing of the plate with 200 µL of phosphate buffer saline containing 0.05% 527
Tween 20 (PBS-T), wells were probed with human/bovine leptospirosis serum (1:100) at 37 528
°C for 2 hours. Microtitre wells were probed with secondary HRP-conjugated anti-human 529
IgG (Genei, Catalog No. 62114028001A) /anti-bovine IgG (Sigma, Cat No.A5295) for 1 hour 530
(1:5,000) at 37 ºC and the binding was measured as described in end-point titre 531
determination. The cut-off value for antibody reactivity was calculated as described 532
previously (9). The cut-off value for antibody reactivity was calculated as described 533
previously (9). Briefly, the average and the standard deviation (SD) were calculated from the 534
MAT negative serum groups and the cut-off value of the average + 2 SD was used for 535
analysis. All the absorbance values obtained from the ELISA assay which equaled or 536
exceeded the cut-off value was considered as positive for infection and thus sensitivity (%) of 537
the assay was calculated. The specificity (%) of the assay was calculated on the number of 538
samples of the MAT negative group below the calculated cut-off. 539
540
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
23
ELISA for binding of r-LIC20035 to host extracellular matrix (ECM) components 541
Host ligands included in the study were fibronectin (Sigma, Cat No. F4759), laminin (Sigma, 542
Cat No. L2020), bovine skin collagen type I (Sigma, Cat No. C9791), elastin (Sigma, Cat No. 543
E1625), chondroitin sulphate A & B (Sigma, Cat No.C9819/C3788), and hyaluronic acid 544
(Sigma, Catalog No. H7630). As negative controls for ligand, fetuin from fetal calf serum and 545
BSA (New England Biolabs) were used. Recombinant-Loa22 was used as a negative control 546
antigen in this assay, as it was previously shown to interact moderately with the tested ECM 547
components (3).The attachments of r-LIC20035 and r-Loa22 to these host ECM components 548
were analyzed by indirect ELISA. Briefly, ELISA plates were coated in duplicates with 1 µg 549
of the solubilized ECM components, BSA (negative control ligand) and fetuin (highly 550
glycosylated attachment negative control ligand) in 50 µL of PBS for 2 h at 37 ºC. Further 551
procedures were followed as described in endpoint titre determination. 552
553
Dose-response curves and KD values 554
ELISA plates were coated overnight with 1 µg of different ECM components. Each plate was 555
blocked and increasing concentrations of purified r-LIC20035 (0-8 µM), was added (50 µL 556
per well, in PBS) followed by incubation for 2 h at 37 ºC. The assessment of bound protein 557
was performed with polyclonal antiserum raised in mice against LIC20035 followed by HRP-558
conjugated anti-mouse IgG. The ELISA data, when reactions reached a saturation point, were 559
used to calculate the equilibrium dissociation constant (KD), according to the described 560
method (33) following the equation KD=(Amax[protein])/A)-[protein], where A is the 561
absorbance at a given protein concentration, Amax is the maximum absorbance for the ELISA 562
plate reader (equilibrium), [protein] is the protein concentration and KD is the equilibrium 563
dissociation constant for a given protein concentration (ELISA data point). 564
565
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
24
Statistical analysis 566
All results are expressed as the ± Standard error. Student’s paired t-test was used to determine 567
the significance of differences between means and P <0.05 was considered statistically 568
significant. Two independent experiments were performed, each one in duplicate or triplicate. 569
570
Acknowledgments: The authors would like to acknowledge ICMR, Port Blair India for 571
providing the Leptospira strains. The authors would like to thank the DBT program support, 572
Department of Biosciences and Bioengineering of IIT Guwahati for generating the Circular 573
Dichroism data and Department of Microbiology, College of Veterinary Science, Khanapara 574
Assam, India for raising polyclonal antibodies. The authors are also grateful to Professor 575
Rajeev Kumar Sharma and Professor Sailendra Kumar Das, College of Veterinary Science, 576
Khanapara, Guwahati Assam, India for helping us in raising polyclonal antibodies. 577
578
Funding: The present work was financially supported by Indian Council of Medical 579
Research bearing project number RCH/NER/16/2012-13 and Department of Science and 580
Technology, Government of India, Ministry of Science and Technology bearing project 581
number SB/FT/LS-354/2012. 582
Conflict of interest statement: None declared 583
584
585
586
587
588
589
590
591
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
25
References 592
1. al-Ramadi, B. K., G. Bashir, T. A. Rizvi, and M. J. Fernandez-Cabezudo. 2004. 593
Poor survival but high immunogenicity of IL-2-expressing Salmonella typhimurium 594
in inherently resistant mice. Microbes and Infection 6:350-359. 595
2. Bansal, T., D. Englert, J. Lee, M. Hegde, T. K. Wood, and A. Jayaraman. 2007. 596
Differential effects of epinephrine, norepinephrine, and indole on Escherichia coli 597
O157: H7 chemotaxis, colonization, and gene expression. Infection and immunity 598
75:4597-4607. 599
3. Barbosa, A. S., P. A. E. Abreu, F. O. Neves, M. V. Atzingen, M. M. Watanabe, 600
M. L. Vieira, Z. M. Morais, S. A. Vasconcellos, and A. L. T. O. Nascimento. 601 2006. A Newly Identified Leptospiral Adhesin Mediates Attachment to Laminin. 602
Infection and immunity 74:6356-6364. 603
4. Baron, M. J., S. L. Wong, K. Nybakken, V. J. Carey, and L. C. Madoff. 2009. 604
Host glycosaminoglycan confers susceptibility to bacterial infection in Drosophila 605
melanogaster. Infection and immunity 77:860-866. 606
5. Bordier, C. 1981. Phase separation of integral membrane proteins in Triton X-114 607
solution. Journal of Biological Chemistry 256:1604-1607. 608
6. Bulach, D. M., R. L. Zuerner, P. Wilson, T. Seemann, A. McGrath, P. A. Cullen, 609
J. Davis, M. Johnson, E. Kuczek, and D. P. Alt. 2006. Genome reduction in 610
Leptospira borgpetersenii reflects limited transmission potential. Proceedings of the 611
National Academy of Sciences 103:14560-14565. 612
7. Caimano, M. J., S. K. Sivasankaran, A. Allard, D. Hurley, K. Hokamp, A. A. 613
Grassmann, J. C. Hinton, and J. E. Nally. 2014. A model system for studying the 614
transcriptomic and physiological changes associated with mammalian host-adaptation 615
by Leptospira interrogans serovar Copenhageni. PLoS pathogens 10:e1004004. 616
8. Carvalho, E., A. S. Barbosa, R. M. Gómez, A. M. Cianciarullo, P. Hauk, P. A. 617
Abreu, L. C. Fiorini, M. L. Oliveira, E. C. Romero, and A. P. Gonçales. 2009. 618
Leptospiral TlyC is an extracellular matrix‐binding protein and does not present 619
hemolysin activity. FEBS letters 583:1381-1385. 620
9. Chalayon, P., P. Chanket, T. Boonchawalit, S. Chattanadee, P. Srimanote, and T. 621
Kalambaheti. 2011. Leptospirosis serodiagnosis by ELISA based on recombinant 622
outer membrane protein. Transactions of the Royal Society of Tropical Medicine and 623
Hygiene 105:289-297. 624
10. Chen, C., M. Lyte, M. P. Stevens, L. Vulchanova, and D. R. Brown. 2006. 625
Mucosally-directed adrenergic nerves and sympathomimetic drugs enhance non-626
intimate adherence of Escherichia coli O157: H7 to porcine cecum and colon. 627
European journal of pharmacology 539:116-124. 628
11. Chen, Y., M. Goette, J. Liu, and P. W. Park. 2008. Microbial subversion of 629
heparan sulfate proteoglycans. Molecules & Cells (Springer Science & Business 630
Media BV) 26. 631
12. Consortium, U. 2015. UniProt: a hub for protein information. Nucleic acids research 632
43:D204-D212. 633
13. Cullen, P. A., D. A. Haake, and B. Adler. 2004. Outer membrane proteins of 634
pathogenic spirochetes. FEMS Microbiology Reviews 28:291-318. 635
14. Cullen, P. A., X. Xu, J. Matsunaga, Y. Sanchez, A. I. Ko, D. A. Haake, and B. 636
Adler. 2005. Surfaceome of Leptospira spp. Infection and immunity 73:4853-4863. 637
15. Dixit, B., K. K. Ghosh, G. Fernandes, P. Kumar, P. Gogoi, and M. Kumar. 2016. 638
Dual Nuclease Activity of a Cas2 protein in CRISPR‐Cas subtype I‐B of Leptospira 639
interrogans. FEBS letters. 640
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
26
16. Doherty, N. C., A. Tobias, S. Watson, and J. C. Atherton. 2009. The Effect of the 641
Human Gut‐Signalling Hormone, Norepinephrine, on the Growth of the Gastric 642
Pathogen Helicobacter pylori. Helicobacter 14:223-230. 643
17. Domingos, R. F., M. L. Vieira, E. C. Romero, A. P. Gonçales, Z. M. de Morais, S. 644
A. Vasconcellos, and A. L. T. O. Nascimento. 2012. “Features of two proteins of 645
Leptospira interrogans with potential role in host-pathogen interactions”. BMC 646
microbiology 12:50. 647
18. Freestone, P. P., R. D. Haigh, and M. Lyte. 2008. Catecholamine inotrope 648
resuscitation of antibiotic-damaged staphylococci and its blockade by specific 649
receptor antagonists. Journal of Infectious Diseases 197:1044-1052. 650
19. Freestone, P. P., R. D. Haigh, and M. Lyte. 2007. Specificity of catecholamine-651
induced growth in Escherichia coli O157: H7, Salmonella enterica and Yersinia 652
enterocolitica. FEMS microbiology letters 269:221-228. 653
20. Freestone, P. P., R. D. Haigh, P. H. Williams, and M. Lyte. 2003. Involvement of 654
enterobactin in norepinephrine-mediated iron supply from transferrin to 655
enterohaemorrhagic Escherichia coli. FEMS microbiology letters 222:39-43. 656
21. Haake, D. A., G. Chao, R. L. Zuerner, J. K. Barnett, D. Barnett, M. Mazel, J. 657
Matsunaga, P. N. Levett, and C. A. Bolin. 2000. The leptospiral major outer 658
membrane protein LipL32 is a lipoprotein expressed during mammalian infection. 659
Infect. Immun 68. 660
22. Haake, D. A., and J. Matsunaga. 2002. Characterization of the leptospiral outer 661
membrane and description of three novel leptospiral membrane proteins. Infect. 662
Immun 70. 663
23. Haake, D. A., and J. Matsunaga. 2010. Leptospira: a spirochaete with a hybrid outer 664
membrane. Molecular microbiology 77:805-814. 665
24. Haake, D. A., E. Walker, D. Blanco, C. Bolin, M. Miller, and M. Lovett. 1991. 666
Changes in the surface of Leptospira interrogans serovar grippotyphosa during in 667
vitro cultivation. Infection and immunity 59:1131-1140. 668
25. Haake, D. A., and W. R. Zückert. 2015. The Leptospiral Outer Membrane. Current 669
topics in microbiology and immunology 387:187-221. 670
26. Hendrickson, B. A., J. Guo, R. Laughlin, Y. Chen, and J. C. Alverdy. 1999. 671
Increased type 1 fimbrial expression among commensal Escherichia coli isolates in 672
the murine cecum following catabolic stress. Infection and immunity 67:745-753. 673
27. Hoke, D. E., S. Egan, P. A. Cullen, and B. Adler. 2008. LipL32 is an extracellular 674
matrix-interacting protein of Leptospira spp. and Pseudoalteromonas tunicata. 675
Infection and immunity 76:2063-2069. 676
28. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific 677
scoring matrices. Journal of molecular biology 292:195-202. 678
29. Kanehisa, M., Y. Sato, M. Kawashima, M. Furumichi, and M. Tanabe. 2016. 679
KEGG as a reference resource for gene and protein annotation. Nucleic acids research 680
44:D457-D462. 681
30. Kumar, M., X. Yang, A. S. Coleman, and U. Pal. 2010. BBA52 facilitates Borrelia 682
burgdorferi transmission from feeding ticks to murine hosts. The Journal of infectious 683
diseases 201:1084-1095. 684
31. Li, L., Z. Xu, Y. Zhou, L. Sun, Z. Liu, H. Chen, and R. Zhou. 2012. Global effects 685
of catecholamines on Actinobacillus pleuropneumoniae gene expression. PloS one 686
7:e31121. 687
32. Li, W., M. Lyte, P. P. Freestone, A. Ajmal, J. A. Colmer-Hamood, and A. N. 688
Hamood. 2009. Norepinephrine represses the expression of toxA and the siderophore 689
genes in Pseudomonas aeruginosa. FEMS microbiology letters 299:100-109. 690
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
27
33. Lin, Y. P., D. W. Lee, S. P. McDonough, L. K. Nicholson, Y. Sharma, and Y. F. 691
Chang. 2009. Repeated domains of leptospira immunoglobulin-like proteins interact 692
with elastin and tropoelastin. J. Biol. Chem 284. 693
34. Lo, M., G. L. Murray, C. A. Khoo, D. A. Haake, R. L. Zuerner, and B. Adler. 694
2010. Transcriptional response of Leptospira interrogans to iron limitation and 695
characterization of a PerR homolog. Infection and immunity 78:4850-4859. 696
35. Lyte, M. 2004. Microbial endocrinology and infectious disease in the 21st century. 697
Trends in microbiology 12:14-20. 698
36. Lyte, M., A. K. Erickson, B. P. Arulanandam, C. D. Frank, M. A. Crawford, and 699
D. H. Francis. 1997. Norepinephrine-induced expression of the K99 pilus adhesin of 700
enterotoxigenicEscherichia coli. Biochemical and biophysical research 701
communications 232:682-686. 702
37. Lyte, M., C. D. Frank, and B. T. Green. 1996. Production of an autoinducer of 703
growth by norepinephrine cultured Escherichia coli O157: H7. FEMS microbiology 704
letters 139:155-159. 705
38. Matsui, M., M.-E. Soupé, J. Becam, and C. Goarant. 2012. Differential in vivo 706
gene expression of major Leptospira proteins in resistant or susceptible animal 707
models. Applied and environmental microbiology 78:6372-6376. 708
39. Murray, G. L., K. M. Ellis, M. Lo, and B. Adler. 2008. Leptospira interrogans 709
requires a functional heme oxygenase to scavenge iron from hemoglobin. Microbes 710
and Infection 10:791-797. 711
40. Murray, G. L., A. Srikram, R. Henry, A. Puapairoj, R. W. Sermswan, and B. 712
Adler. 2009. Leptospira interrogans requires heme oxygenase for disease 713
pathogenesis. Microbes and Infection 11:311-314. 714
41. Nally, J. E., J. P. Whitelegge, S. Bassilian, D. R. Blanco, and M. A. Lovett. 2007. 715
Characterization of the Outer Membrane Proteome of Leptospira interrogans 716
Expressed during Acute Lethal Infection. Infection and immunity 75:766-773. 717
42. Nascimento, A. L. T. O. d., S. Verjovski-Almeida, M. Van Sluys, C. Monteiro-718
Vitorello, L. Camargo, L. Digiampietri, R. Harstkeerl, P. Ho, M. Marques, and 719 M. Oliveira. 2004. Genome features of Leptospira interrogans serovar Copenhageni. 720
Brazilian Journal of Medical and Biological Research 37:459-477. 721
43. O'Donnell, P. M., H. Aviles, M. Lyte, and G. Sonnenfeld. 2006. Enhancement of In 722
Vitro Growth of Pathogenic Bacteria by Norepinephrine: Importance of Inoculum 723
Density and Role of Transferrin. Applied and environmental microbiology 72:5097-724
5099. 725
44. Oliveira, R., Z. M. de Morais, A. P. Gonçales, E. C. Romero, S. A. Vasconcellos, 726
and A. L. Nascimento. 2011. Characterization of novel OmpA-like protein of 727
Leptospira interrogans that binds extracellular matrix molecules and plasminogen. 728
PloS one 6:e21962. 729
45. Pan, X., Y. Yang, and J.-R. Zhang. 2014. Molecular basis of host specificity in 730
human pathogenic bacteria. Emerging microbes & infections 3:e23. 731
46. Perez-Iratxeta, C., and M. A. Andrade-Navarro. 2008. K2D2: estimation of 732
protein secondary structure from circular dichroism spectra. BMC structural biology 733
8:25. 734
47. Peterson, G., A. Kumar, E. Gart, and S. Narayanan. 2011. Catecholamines 735
increase conjugative gene transfer between enteric bacteria. Microbial pathogenesis 736
51:1-8. 737
48. Pinne, M., and D. A. Haake. 2009. A comprehensive approach to identification of 738
surface-exposed, outer membrane-spanning proteins of Leptospira interrogans. PloS 739
one 4:e6071. 740
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
28
49. Pinne, M., J. Matsunaga, and D. A. Haake. 2012. Leptospiral Outer Membrane 741
Protein Microarray, a Novel Approach to Identification of Host Ligand-Binding 742
Proteins. Journal of Bacteriology 194:6074-6087. 743
50. Raja, V., and K. Natarajaseenivasan. 2015. Pathogenic, diagnostic and vaccine 744
potential of leptospiral outer membrane proteins (OMPs). Critical reviews in 745
microbiology 41:1-17. 746
51. Robbins, G. T., B. L. Hahn, K. V. Evangelista, L. Padmore, P. S. Aranda, and J. 747
Coburn. 2015. Evaluation of cell binding activities of Leptospira ECM adhesins. 748
PLoS neglected tropical diseases 9:e0003712. 749
52. Sandrini, S., F. Alghofaili, P. Freestone, and H. Yesilkaya. 2014. Host stress 750
hormone norepinephrine stimulates pneumococcal growth, biofilm formation and 751
virulence gene expression. BMC microbiology 14:180. 752
53. Savitzky, A., and M. J. Golay. 1964. Smoothing and differentiation of data by 753
simplified least squares procedures. Analytical chemistry 36:1627-1639. 754
54. Scheckelhoff, M. R., S. R. Telford, M. Wesley, and L. T. Hu. 2007. Borrelia 755
burgdorferi intercepts host hormonal signals to regulate expression of outer surface 756
protein A. Proceedings of the National Academy of Sciences 104:7247-7252. 757
55. Schmittgen, T. D., and K. J. Livak. 2008. Analyzing real-time PCR data by the 758
comparative CT method. Nature protocols 3:1101-1108. 759
56. Sharaff, F., and P. Freestone. 2011. Microbial endocrinology. Open Life Sciences 760
6:685-694. 761
57. Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper. 2003. 762
Bacteria–host communication: the language of hormones. Proceedings of the National 763
Academy of Sciences 100:8951-8956. 764
58. Stevenson, B., H. A. Choy, M. Pinne, M. L. Rotondi, M. C. Miller, E. DeMoll, P. 765
Kraiczy, A. E. Cooley, T. P. Creamer, and M. A. Suchard. 2007. Leptospira 766
interrogans endostatin-like outer membrane proteins bind host fibronectin, laminin 767
and regulators of complement. PloS one 2:e1188. 768
59. Taylor, S. C., T. Berkelman, G. Yadav, and M. Hammond. 2013. A Defined 769
Methodology for Reliable Quantification of Western Blot Data. Molecular 770
Biotechnology 55:217-226. 771
60. Toscano, M., T. Stabel, S. Bearson, B. Bearson, and D. Lay. 2007. Cultivation of 772
Salmonella enterica serovar Typhimurium in a norepinephrine-containing medium 773
alters in vivo tissue prevalence in swine. Journal of Experimental Animal Science 774
43:329-338. 775
61. Vieira, M. L., Z. M. de Morais, A. P. Gonçales, E. C. Romero, S. A. Vasconcellos, 776
and A. L. Nascimento. 2010. Lsa63, a newly identified surface protein of Leptospira 777
interrogans binds laminin and collagen IV. Journal of Infection 60:52-64. 778
62. Vlisidou, I., M. Lyte, P. M. Van Diemen, P. Hawes, P. Monaghan, T. S. Wallis, 779
and M. P. Stevens. 2004. The neuroendocrine stress hormone norepinephrine 780
augments Escherichia coli O157: H7-induced enteritis and adherence in a bovine 781
ligated ileal loop model of infection. Infection and immunity 72:5446-5451. 782
63. Voigt, W., A. Fruth, H. Tschäpe, R. Reissbrodt, and P. H. Williams. 2006. 783
Enterobacterial autoinducer of growth enhances shiga toxin production by 784
enterohemorrhagic Escherichia coli. Journal of clinical microbiology 44:2247-2249. 785
64. Walters, M., M. P. Sircili, and V. Sperandio. 2006. AI-3 synthesis is not dependent 786
on luxS in Escherichia coli. Journal of Bacteriology 188:5668-5681. 787
65. Xue, F., H. Dong, J. Wu, Z. Wu, W. Hu, A. Sun, B. Troxell, X. F. Yang, and J. 788
Yan. 2010. Transcriptional responses of Leptospira interrogans to host innate 789
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
29
immunity: significant changes in metabolism, oxygen tolerance, and outer membrane. 790
PLoS Negl Trop Dis 4:e857. 791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
30
Table 1: Comparative analyses of the gene sequence identity of the differentially regulated 823
genes of serovars Lai and Copenhageni in the presence of catecholamines. 824
Leptospira
serovars Locus Gene CDS Identity (%)
Lai LA0616 lipL41
1068 1065/1068
(99%) Copenhageni LIC12966 1068
Lai LA3961 ompl36
912 910/912
(99%) Copenhageni LIC13166 921
Lai LB186 hol
678 676/678
(99%) Copenhageni LIC20148 678
Lai LB191 hbpA
2133 2131/2133
(99%) Copenhageni LIC20151 2133
Lai LA3307 rfe
1047 912/915
(99%) Copenhageni LIC10841 915
Lai LA3263 Hypothetical
1224 1221/1224
(99%) Copenhageni LIC10878 1224
Lai LB047 Hypothetical
1320 1313/1320
(99%) Copenhageni LIC20035 1323
Note: CDS stands for coding sequence. 825
826
827
828
829
830
831
832
833
834
835
836
837
838
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
31
Table 2: Comparative analyses of the protein sequence identity of LIC20035 in the different 839
strains of Leptospira. 840
Leptospira
species
Pathogenic (++),
Intermediate (+)
or Saprophyte (-)
Query
coverage
(%)
Identity
(%)
NCBI
Accession number
kirschneri ++ 99 99 WP_004765841.1
noguchii ++ 99 96 WP_061247126.1
santarosai ++ 99 90 WP_004475508.1
weilii ++ 99 90 WP_002999236.1
alexanderi ++ 99 90 WP_078124341.1
alstonii ++ 99 90 WP_020775287.1
kmetyi ++ 99 90 WP_010572225.1
mayottensis ++ 99 89 WP_002764046.1
borgpetersenii ++ 99 88 WP_011671265.1
wolffii + 99 64 WP_016545620.1
fainei + 99 64 WP_016551189.1
inadai + 99 63 WP_010410057.1
broomii + 99 63 WP_010568341.1
licerasiae + 98 62 WP_008589084.1
wolbachii - 99 40 WP_015682912.1
biflexa - 100 39 WP_012476493.1
841
842
843
844
845
846
847
848
849
850
851
852
853
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
32
Table 3: Details of the Leptospira genes selected and its oligomers in this study. 854
Gene ID of
serovars
(Lai/
Copenhageni)
Gene name/
function
Gene
size
(bp)
5’ to 3’ Forward/Reverse Sequence
LAr04/
LIC11508 rrs2, 16S rRNA 1512
TTATTGCTCGGAGATGAGCC
TTCAGGGTTCCCCCCATT
LA2019/
LIC11889 Flagellin (flaB) 852
ATGATTATCAATCACAACCTGAGTG
TCAGTATTCCTTTCCGCTTGA
LA1005/
LIC12655 Uncharacterized 459
GATTCACAGAGTTATCCTAACTTTCTG
CCTGGTATCGAAATGTCAGTTG
LA1796 Uncharacterized 546 TAGGTGAAGGATTTTCATATCCAAA T
AAATCCATCAGCATTACTTCTTAGA
LA0634/
LIC12953 dppC 762
TTCTTCTGTGTTTGTTTCCGTTC
AAGCAAGTACAAATCCACTTCCA
LB187/
LIC20149
Multidrug efflux
transporter 1209
TACTCTTTTTACTCTTTTATTTCTCCG
CTACGGCCCCTCCTAAAGAA
LB191/
LIC20151
TonB dependent
receptor 2133
CGAAGTCATTTCCCGTAAAAAG
GTCCGGAAATTCTTTCGC
LB183/
LIC20147
fur, transcription
reglator 393
TACGAACTTTCCCGAAAGAATTT
ACACGGTCGCATTGTTTACA
LA2579/
LIC11402
feoB, Ferrous
transporter 2106
TTAGTTTGGGAGGGAGCTCA
TTTCATCGTGACCGCGAC
LB186/
LIC20148 Heme oxygenase 678
TCAAGACTATGTGCAAAGAATTCG
TAGGAAATTCGTAAAAAGAAATTCCTT
LA4253/
LIC13403 fepB 774
TCGGATTTTCAGATATACAATCGG
CTTTCTTTTCCAACCTTCAATCA
LA3064/
LIC11030
Putative
lipoprotein 1035
AAACCGATACGGAGTTGTCATC
ATTTTGTGCATAAAGTCTCGTGTTT
LA0426/
LIC10373
Putative
lipoprotein 1530
ATAGTTGGAACCTCTAATGGACCA
CCGCGACATTCTTTGGGTA
LA0616/
LIC12966
lipL41, OM
lipoprotein 1068
GTGAAGGTTCCAGCTTTATCGA
CGCTCCAATCAGATTTCCG
LA2637/
LIC11352
lipL32, OM
lipoprotein 819
GTGAAGGTTCCAGCTTTATCGA
CGCTCCAATCAGATTTCCG
LA3961/
LIC13166 ompL36
921
AAGAGCAGAAGCGTCGTA
TTGGAGAGTTGGTGGAGTT
LA3778/
LIC10464 ligB 1890
ACGGTACCAGTACAACCCTAGAAG
TAGGCCGTTGTATTCTGCTTTT
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
33
LA1569/
LIC12209
Putative
lipoprotein 1416
GGAGACGAGGATTGGGTCC
GTGTTCCGATACTAGAGGGCTTATT
LA3446/
LIC10730
Putative
lipoprotein 480
AAAAACGAATCGGACTTTCTCC
ATCCATACATTGTCTTTGTTTTGC
LA3247/
LIC10889 tonB 591
TCATCCAAGAACCAAACGTTG
GGCTTCATCGGGATAGTCTG
LA3258/
LIC10881
tonB dependent
OM receptor 1674
ATTCTAAAGTGTTTTCTTTGTCGGA
GGTTACCTTTTTTGTTTTTTGTACG
LA3478/
LIC10704
Putative
lipoprotein 669
CAGACAAGGAACGAGAATCTATTG
AGATTGACCTTTCAATTCCGC
LA3444/
LIC10731
Putative
lipoprotein 1260
ACCGGAAGATGCCGATTTA
TTTTGTGACCGAATAAACGCT
LA3501/
LIC10686
Putative
lipoprotein 1272
GTATGTCTCCAGCAGATGCTCC
GGGCGTTCGATTAGAAAAATT
LA3440/
LIC10734
Putative
lipoprotein 795
TTCCGGATTTTGTACAAAATCTTC
ATGATATTCTGCCCATATACGCA
LA3371/
LIC10792
mdoC, Glucans
biosynthesis 1173
CCCTTTTTTTCTTTCTTTCGG
AGAAATTTTCGTTCCAGCTTGT
LA3294/
LIC10854
uppS, Isoprenyl
transferase 726
CATAGAGAAGGTGCCCAGG
TGAATCGTATCTAATCGAGTTTCTATA
LA3276/
LIC10868 Uncharacterized 1395
GACTTTTAGGGGTAGCGGGA
TCTTGTCCATTGTTTGTTTCCA
LA3263/
LIC10878 Uncharacterized 1224
CTTCAGCATAAAAAACCTCTTTTGA
ACGATAAATCCTCCCGCC
LA3262/
LIC10879
Putative
lipoprotein 480
GATCCTTCCTTACTCAATGCTTCT
TCTACTTTTTCAGTTTTTACACGTACA
LA3230/
LIC10906 Uncharacterized 909
TAACGTTCCTCCCGATGTC
AGTGTCCGGATCTCCCAGTA
LA3307/
LIC10841 rfe, transferase 915
GATCGTCTACGTTTTGTTTGTTGT
AGTTAAAACCTAAAAAACCGAAAACA
LA3210/
LIC10920
Putative
lipoprotein 756
AACCACTGCAGAATCTATGGTG
TTCCGCTTGGATAAACTGGA
LA3200b/
LIC10927
Putative
lipoprotein 1494
CGATTACTATTTCCGGAGCC
TCCGAAGCAGTTATATCCACTC
LA3138/
LIC10973 ompL1 963
TAAATTGATTACCCTCGATAGAACTAC
CTGCTTTTGTAATACCGCCAG
LA1691/
LIC12099 lipL53 1431
AATCAAACTTGGGTCAGACAACTT
TCACGCCGAAGTCATTTATCT
LA3017/ lemA, Putative 597 TTCACAAGCGCAAGCACAG
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
34
LIC11058 lipoprotein TCTGTTTCTGGCTACGGTAATTC
LA3434/
LIC10739
amiA, alanine
amidase 1092
CGTTATGTGCGCTTTGAAGA
TAAAGAATCGGAACGGAAATTTT
LA3394/
LIC10774
Putative
lipoprotein 1107
CAAGAATCCGAAAAATCTTCTTCA
TTGAAGGGTTGGTTTGACGT
LB194/
LIC20153
Putative
lipoprotein 579
CTACTTCCATTCAAACTCTTGTTTACG
AGTATTATAAATCAAAGGTGCATTCTC
LA3340/
LIC10821
Putative
lipoprotein 783
GCGATTCCAATGCTGGTAC
ACTGTCCCCATATAGATTGACACC
LB047/
LIC20035
Hypothetical
protein 1323
TGTAACTCCACTCCTAATGTGGAG
CGATTTTAAACCATCTAACTGTTCAG
CTAGCTAGCTGTAACTCCACTCCTAATGTGGAG
CCGCTCGAGTTATTTACAACCTTGCATTTCTCC
LA0222/
LIC10191
Loa22, OmpA
lipoprotein 588
GATAGTTACGCTCTTGAA
GATACGATTTGCTGGAAT
CTAGCTAGCGCTGAAAAAAAAGAGGAATCCG
CCGCTCGAGTTATTGTTGTGGTGCGGAAG
Note: OM stands for outer membrane. 855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
35
Legends to figures 873
874
Figure 1: Effect of catecholamines and inhibitor on growth of Leptospira. 875
L. interrogans Lai cultures were incubated and grown in the presence of Epi, NE, the β-876
antagonist propranolol (PO), or with the catecholamines and PO combined. Spirochete 877
culture was monitored daily and its number was determined by counting under 40X Phase 878
contrast microscopy. Each treatment showed similar growth to untreated control cultures, and 879
at no time point was a significant difference detected among any group. Results are indicative 880
of two independent experiments performed. 881
882
Figure 2: Effect of catecholamines and inhibitor on the selective gene transcripts of 883
Leptospira. Transcript analyses of the 7 genes encoding OMPs out of 41 by qRT-PCR of the 884
cDNA synthesized from Leptospira grown in the presence of catecholamines and inhibitors 885
(500 µM). The gene transcription were calculated based on threshold cycle (Ct) values by use 886
of 2-∆∆Ct
method and normalized against 16S rRNA values. A. The genes of L. interrogans 887
serovar Lai that showed significant differential transcription. The differential transcripts of 888
seven genes in the presence of catecholamines was restored to the basal level on addition of 889
its inhibitor propranolol (PO) describing the specific role of the catecholamines in modulating 890
gene transcription. B. The differential transcription of 7 orthologous genes of L. interrogans 891
serovar Copenhageni. The patterns of differential transcription of 7 orthologs of Copenhageni 892
to serovar Lai are very close. C and D. The fold change in gene transcription of L. 893
interrogans Lai and L. interrogans Copenhageni responding significantly to catecholamines. 894
Each gene is represented by a unique color bar along with fold change value at the apex of 895
each bar. Bars denote the mean standard deviation from 2 independent qRT-PCR analyses. 896
897
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
36
Figure 3: Characterization of hypothetical protein LIC20035/LB047. 898
A. PCR for LIC20035 gene using genomic DNA of pathogenic (Copenhageni, Lai, Canicola) 899
and non-pathogenic serovars (Patoc) of Leptospira. An amplicon size of 1,275 bp by agarose 900
gel electrophoresis confirmed the existence of LIC20035 gene in pathogenic serovars (Lane 901
1, 3 & 5). In contrast, no amplification of LIC20035 was observed in the non-pathogenic 902
serovar of Leptospira (Lane 7). Primers of constitutive flaB gene were used as a positive 903
control for determining the quality of DNA (Lane 2, 4, 6 & 8). B. Induction and purification 904
of recombinant-LIC20035. The CDS LIC20035 of L. interrogans Copenhageni L1-130 was 905
cloned without its signal peptide sequence in pET28a vector and expressed in BL21 E. coli. 906
Induction of r-LIC20035 expression was done using 0.5 mM IPTG and its purification was 907
performed using Ni-NTA column chromatography under hybrid conditions. The uninduced 908
and induced lysates of BL21 E. coli along with the purified recombinant-LIC20035 are 909
shown on 12% SDS-PAGE stained with Coomassie. C. Generated polyclonal antibody titer 910
rasied against r-LIC20035. The pooled mice immune sera obtained after 10 days of second 911
booster dose was used to calculate the titer of polyclonal antibodies generated against r-912
LIC20035 using ELISA. Serum obtained before the immunization of r-LIC20035 antigen was 913
used as a control for evaluation of antibody titer and data is represented as mean± standard 914
error mean (SEM) of two independent experiments. D. Immunoblot demonstrates the 915
differential expression of LB047 in L. interrogans serovar Lai grown in the presence of 916
catecholamines and inhibitor. There was a repression of LB047 in the presence of Epi alone 917
in comparison to control and NE, the effect of which was restored to the basal levels when 918
grown along with its inhibitor propranolol (PO). Anti-LipL31 was used as a control to 919
demonstrate equal loading of Leptospira lysates. E. Relative densitometry of the immunoblot 920
shown in fig 3D was calculated and normalized with the band intensity of LipL31 using 921
Image Lab software from two independent experiment. The repression of LB047 was evident 922
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
37
in the presence of Epi and the effect of which was restored to the basal level using its 923
inhibitor PO. F. Far-ultraviolet circular dichroism (CD) of r-LIC20035. The CD spectra are 924
depicted in the range of 190-240 nm wavelengths showing a predominant signal of β-strand. 925
CD spectra are shown as an average of 3 scans with a scanning speed of 100 nm/minute. 926
927
Figure 4: Cellular localization of LIC20035/LB047. A. Triton-X-114 phase partitioning of 928
spirochetes proteins. Spirochetes lysates were subjected to Triton X-114 phase partition of 929
aqueous (A) and detergent phase (D). The aqueous and detergent phase fraction was resolved 930
onto 12 % SDS PAGE and was immunoblotted with anti-LIC20035 serum. Major portion of 931
LIC20035 was in detergent phase and partly in aqueous phase in both serovars Lai and 932
Copenhageni. Whole cell lysates of serovar Copenhageni in lane 1 was used as a molecular 933
marker for LIC20035. B. Immunoblot to validate the Triton X-114 phase-partition analysis. 934
LipL32 is a known outer membrane lipoprotein and is exclusively present only in the 935
detergent phase of Triton X-114. Anti-LipL32 (1:500) detected LipL32 only in the detergent 936
phase (D) fraction of serovars Lai and Copenhageni. Whole cell lysates of serovar 937
Copenhageni in lane 1 was used as a molecular marker for LipL32. C. Proteinase K 938
accessibility assay of L. interrogans Lai for surface exposed LB047. Spirochetes were 939
incubated with 25 µg of Proteinase K at various time interval upto 5 h. The spirochete 940
suspensions were washed with PBS and coated onto microtitre plate. Using ELISA, drastic 941
decrease in the signal for LB047 reactivity with its antiserum was observed after 1 to 5 h 942
Proteinase K treatment similar to OmpL54, a known outer membrane protein. LipL31 was 943
used as a control to keep a check on the cellular integrity of spirochetes during treatment with 944
Proteinase K. Error bars represent the standard deviations of the three replicates. Statistical 945
analysis was performed by Student's t-test by comparing the signals obtained for 0 h and 946
other time point of treatment with Proteinase K (p<0.05). 947
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
38
Figure 5: The recombinant-LIC20035 is recognized by leptospirosis positive sera. 948
Enzyme linked immunosorbent assay (ELISA) was performed to detect r-LIC20035 or r-949
LIC10191 using the sera of humans (1:100) and bovines (1:100) tested MAT-positive (n=50) 950
and control serum tested MAT-negative for leptospirosis. The cut-off value of the assay was 951
derived from the mean (M) of the control group plus 2SD (standard deviation) for each 952
recombinant antigens (dotted black lines). The mean (M) of each group represents as black 953
horizontal lines. A. ELISA to detect r-LIC20035 (400 ng/well) using human sera tested 954
positive for leptospirosis. The sensitivity and specificity of the assay was 98 and 100, 955
respectively. B. ELISA to detect r-LIC10191 (400 ng/well) using human sera tested positive 956
for leptospirosis. Recombinant-LIC10191 (r-Loa22) of equivalent amount (400 ng/well) was 957
used to scale the recognition capacity of human sera. C. ELISA to detect r-LIC20035 (400 958
ng/well) with bovine sera tested positive for leptospirosis. The sensitivity and specificity of 959
the serological assay was 100. D. ELISA to detect r-Loa22 with bovine sera tested positive 960
for leptospirosis. Recombinant-Loa22 of equivalent amount was used to scale the recognition 961
capacity of bovine sera. 962
963
Figure 6: The recombinant-LIC20035 binds to host extracellular matrix components. 964
A. ELISA depicts r-LIC20035 interacts with extracellular matrix (ECM) components, 965
laminin, fibronectin, collagen (calf skin), hyaluronic acid, chondroitin sulfate A, chondroitin 966
sulfate B and elastin. Bovine serum albumin (BSA) and the highly glycosylated serum 967
protein, fetuin, were used as controls for non-specific binding. Loa22 was included as a 968
negative control for non-specific binding with the ECM components. Recombinant-969
LIC20035 exhibited significant binding with all ECM components as compared to fetuin or 970
BSA (P<0.001) and with a higher affinity towards chondroitin sulfate and collagen. In 971
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from
39
contrast, Loa22 showed moderate binding with all the ECM components used in this study. 972
Results are indicative of two independent experiments performed. B. Dose-dependent binding 973
of the LIC20035 to ECM components. One microgram of specific ECM coated microtiter 974
plate was incubated with increasing concentrations (0-8 µM) of r-LIC20035. Binding assay 975
of LIC20035 was measured using anti-LIC20035 serum at an appropriate dilution. The mean 976
absorbance values of r-LIC20035 binding to ECM of two experiments are shown at 450 nm. 977
on August 5, 2020 by guest
http://aem.asm
.org/D
ownloaded from