DNA Technology and Genomics

Understanding and Manipulating Genomes

• DNA technology has launched a revolution in the area of biotechnology - The manipulation of organisms or their genetic components to make useful products

• One of the greatest achievements of modern science has been the sequencing of the human genome, which was largely completed by 2003

• DNA sequencing accomplishments have all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNA

Recombinant DNA

• Formed by joining DNA from 2 different individuals into a single molecule.

• Various natural mechanisms can combine DNA from 2 individuals of the same species

• Scientists have also developed techniques to combine DNA from any 2 individuals.

• Two key enzymes are used to make artificially recombined DNA.

• Restriction enzymes (also called restriction endonucleases) cut DNA into fragments – so called “molecular scissors”

Each one recognizes and cuts DNA only where a specific sequence of base pairs occurs.

Many do not cut straight through both strands, but make a jagged cut leaving unpaired bases at both ends. Because these unpaired bases can pair with complimentary bases, they are called “sticky ends”.

• DNA ligase is used to join DNA fragments together. This is the “molecular glue”

Recombinant DNA

Restriction Enzymes and Recombinant DNA

• Bacterial restriction enzymes cut DNA molecules at a limited number of specific DNA sequences, called restriction sites

• A restriction enzyme will usually make many cuts in a DNA molecule yielding a set of restriction fragments

• The most useful restriction enzymes cut DNA in a staggered way producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragments

• DNA ligase is an enzyme that seals the bonds between restriction fragments

Procedure for Recombining DNA

• Isolate DNA from 2 different sources

• Cut the DNA from both sources into fragments using the same restriction enzyme.

• Mix the DNA fragments together. Since they were cut with the same restriction enzyme, fragments from different sources will have the same “sticky ends” and can pair up.

• Use the enzyme DNA ligase to join the paired fragments together

Restriction site

DNA 53 5

3G A A T T CC T T A A G

Sticky end

Fragment from differentDNA molecule cut by thesame restriction enzyme

One possible combination

Recombinant DNA molecule

G

C T T A AA A T T C

G

A A T T C

C T T A AG

G

G GA A T T C A A T T C

C T T A A G C T T A A G

Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow

1

DNA fragment from another source is added. Base pairing of sticky ends produces various combinations.

2

DNA ligaseseals the strands.

3

Recombinant Plasmids

• Recombinant DNA technology can be used to create recombinant plasmids (or other agents such as viruses) used to insert foreign genes into recipient cells.

• Plasmids (or other recombinant agents) used to insert foreign DNA into recipient cells are called vectors

• Recombinant plasmids can then be used to produce multiple copies of the DNA fragment

Copying DNA Fragments

• Why produce multiple copies of a DNA fragment?

• Study its structure and function

• Compare the fragment with DNA from other sources

• If it codes for a useful protein, to produce large quantities of the protein

Two Basic Copy Methods

• Cloning – insert the gene into a living host cell and use the cell to replicate the gene along with its own DNA whenever it divides

• Polymerase Chain Reaction (PCR) – create the conditions needed for replication inside a test tube that contains a copy of the gene

DNA Cloning• DNA cloning permits

production of multiple copies of a specific gene or other DNA segment

• Most methods for cloning pieces of DNA in the laboratory involve

• Use of bacteria and their plasmids

• Restriction Enzymes

• In gene cloning, the original plasmid is called a cloning vector a DNA molecule that can carry foreign DNA into a cell and replicate there

Bacterium

Bacterialchromosome

Plasmid

Cell containing geneof interest

RecombinantDNA (plasmid)

Gene of interest

DNA ofchromosome

Recombinatebacterium

Protein harvested

Basic research on protein

Gene of interest

Copies of gene

Basic research on gene

Gene for pestresistance inserted into plants

Gene used to alterbacteria for cleaningup toxic waste

Protein dissolvesblood clots in heartattack therapy

Human growth hormone treatsstunted growth

Protein expressedby gene of interest

3

Gene inserted into plasmid

1

Plasmid put into bacterial cell

2

Host cell grown in culture,to form a clone of cellscontaining the “cloned”gene of interest

3

Basic research and various applications

4

Animal cell

DNA

Gene ofinterest

Restrictionsite

lacZ'gene

Recombinant plasmids with nonfunctional lacZ' genes

ampR

gene

E. coli

Plasmid

Stage 1: DNA from two sourcesis isolated and cleaved with thesame restriction endonuclease.

Stage 2: The twotypes of DNA canpair at their stickyends when mixedtogether; DNAligase joins thesegments.

Stickyends

Reclosed plasmid with functional lacZ' gene

Restrictionendonuclease

cut sites

Gene Cloning

Stage 3: Plasmids are inserted intobacterial cells by transformation;bacterial cells reproduce and formclones.

Clone 1 Clone 2 Clone 3

Clones with recombinant plasmids

Gene Cloning

Can be screened for the gene of interest

Amplifying DNA in Vitro

• Polymerase chain reaction (PCR)

• Can produce many copies of a specific target segment of DNA

• Uses primers that bracket the desired sequence

• Uses a heat-resistant DNA polymerase

Polymerase Chain Reaction (PCR)

1. Denaturation – a solution containing RNA primers and the DNA fragment to be amplified is heated so that the DNA dissociates into single strands.

2. Annealing of primers – the solution is cooled, and the primers bind to complementary sequences on the DNA flanking the gene to be amplified.

3. Primer extension – DNA polymerase then copies the remainder of each strand, beginning at the primer.

4. Repeat steps 1 – 3 many times, each time doubling the number of copies, until a sufficient number of copies are produced.

The Polymerase Chain Reaction (PCR)

Targetsequence

53

5

Genomic DNA

Cycle 1yields

2 molecules

Cycle 2yields

4 molecules

Cycle 3yields 8

molecules;2 molecules

(in white boxes)match target

sequence

5

3

3

5

Primers

Newnucleo-tides

3

APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro.

TECHNIQUE The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence.

RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length. After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more.

Denaturation:Heat brieflyto separate DNA strands

1

Annealing: Cool to allow primers to hydrogen-bond.

2

Extension:DNA polymeraseadds nucleotidesto the 3 end of each primer

3

Identifying Clones Carrying a Gene of Interest

• Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research

• A clone carrying the gene of interest can be identified with a radioactively labeled nucleic acid probe

• The probe has a sequence complementary to the gene

• The process is called nucleic acid probe hybridization

Film

Filter

1. Colonies of bacteria, each grown from cells taken from a white colony.

5. A comparison with the original plate identifies the colony containing the gene.

2. A replica of the plate is made by pressing a filter against the colonies. Some cells from each colony adhere to the filter.

3. The filter is washed with a solution that denatures the DNA and contains the radioactively labeled probe. The probe contains nucleotide sequences complementary to the gene of interest and binds to cells containing the gene.

4. Only those colonies containing the gene will retain the probe and emit radioactivity on film placed over the filter.

Using a Genetic Probe to Screen for the Gene of Interest

Nucleic Acid Probe Hybridization

APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest.

TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate.

RESULTS Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes.

Colonies containinggene of interest

Filter

Master plate

Solutioncontainingprobe

Filter lifted andflipped over

Radioactivesingle-strandedDNA

Hybridizationon filter

Single-strandedDNA from cell

ProbeDNA

Gene ofinterest

Film

Master plate

A special filter paper ispressed against themaster plate,transferring cells to the bottom side of thefilter.

1 The filter is treated to break open the cells and denature their DNA; the resulting single-stranded DNA molecules are treated so that they stick to the filter.

2 The filter is laid underphotographic film,allowing anyradioactive areas toexpose the film(autoradiography).

3 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest.

4

DNA Library

• A DNA library is a collection of DNA fragments representing all the DNA of an organism.

• Two Types:

• Genomic libraries

• cDNA libraries

Genomic Library• The simplest kind, the entire genome of an organism is fragmented.

• The fragments are then inserted into a vector, such as a plasmid or phage, and introduced into a host:

DNA fragments from source DNA

DNA insertedinto plasmid

vector

DNA insertedinto phage

vector

Storing Cloned Genes in DNA Libraries• A genomic library made using bacteria is a collection of recombinant vector

clones produced by cloning DNA fragments derived from an entire genome

• A genomic library made using bacteriophages is stored as a collection of phage clones

Foreign genomecut up withrestrictionenzyme

Recombinantplasmids Recombinant

phage DNA Phageclones

(b) Phage library(a) Plasmid library

or

Bacterialclones

cDNA Library

• A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell

• Includes only the DNA fragments that code for proteins, introns not included.

• To produce a cDNA library, scientists first isolate the mature mRNA from an organism.

• An enzyme called reverse transcriptase is then used to make a complementary DNA copy of each mature mRNA molecule:

Intron (noncoding region) Exon (coding region)

Eukaryotic DNA

Primary RNAtranscript

Transcription

Mature mRNA transcript

Introns are cut outand coding regions arespliced together

mRNA-cDNA hybrid

Isolation of mRNAAddition of reversetranscriptase

Addition of mRNA-degrading enzymes

DNA polymerase

Double-stranded cDNAgene without introns

Restriction Fragment Length Polymorphisms (RFLP)

• Different DNA sequences on homologous chromosomes, result in restriction fragments of different lengths

• Specific fragments can be detected and analyzed by Southern blotting

• The thousands of RFLPs present throughout eukaryotic DNA can serve as genetic markers

Restriction Fragment Analysis• Detects DNA differences

that affect restriction sites

• Can rapidly provide useful comparative information about DNA sequences

• For example comparing two alleles for a gene

• Gel electrophoresis separates DNA restriction fragments of different lengths

Normal -globin allele

Sickle-cell mutant -globin allele

175 bp 201 bp Large fragment

DdeI DdeI DdeI DdeI

DdeI DdeI DdeI

376 bp Large fragment

DdeI restriction sites in normal and sickle-cell alleles of -globin gene.

Electrophoresis of restriction fragments from normal and sickle-cell alleles.

Normalallele

Sickle-cellallele

Largefragment

201 bp175 bp

376 bp

(a)

(b)

Gel Electrophoresis and Southern Blotting

APPLICATION

1 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end.

2 When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel.

Cathode

Powersource

GelGlassplates

Anode

Mixtureof DNAmoleculesof differ-ent sizes

Longermolecules

Shortermolecules

TECHNIQUE

RESULTS After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources.

Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10).

Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length.

Southern Blotting• Specific DNA fragments can be identified by Southern blotting

• Uses labeled probes that hybridize to the DNA immobilized on a “blot” of the gel

APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA.

TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III).

DNA + restriction enzyme Restrictionfragments I II III

I Normal-globinallele

II Sickle-cellallele

III Heterozygote

Preparation of restriction fragments. Gel electrophoresis. Blotting.

Gel

Sponge

Alkalinesolution

Nitrocellulosepaper (blot)

Heavyweight

Papertowels

1 2 3

2. The gel is covered with a sheet of nitrocellulose and placed in a tray of buffer on top of a sponge. Alkaline chemicals in the buffer denature the DNA into single strands. The buffer wicks its way up through the gel and nitrocellulose into a stack of paper towels placed on top of the nitrocellulose.

Buffer

Sponge

Stack of paper towels

Nitrocellulose paper

Gel

3. Pattern on gel is copied faithfully, or “blotted,” onto the nitrocellulose.

Nitrocellulose paper nowcontains nucleic acid "print"

Gel

Southern Blotting – Labeled Probes

RESULTS Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II).

Radioactivelylabeled probefor -globingene is addedto solution ina plastic bag

Probe hydrogen-bonds to fragmentscontaining normalor mutant -globin

Fragment fromsickle-cell-globin allele

Fragment fromnormal -globinallele

Paper blot

Film overpaper blot

Hybridization with radioactive probe. Autoradiography.

I II IIII II III

1 2

5. Photographic film is laid over the paper and is exposed only in areas that contain radioactivity (autoradiography). Nitrocellulose is examined for radioactive bands, indicating hybridization of the original nucleic acids with the radioactively labeled ones.

Sizemarkers

Hybridizednucleic acids

Film

Restriction endonucleasecutting sites

Single base-pairchange

Sequence duplication

Largerfragments

Smallerfragments

– +

– +

– +

Three different DNA duplexes

Cut DNA

Gel electrophoresis ofrestriction fragments

RFLP Analysis

Genomes

• The complete set of genetic instructions for an organism is referred to as its genome.

• Genomics – the science of mapping and studying the genomes of living organisms

• Involves

• Genetic (Linkage) maps

• Physical maps

• DNA Sequencing

Genetic maps• Genetic maps are linkage maps show the relative location of genes on

a chromosome, determined by recombination frequencies.

• Distances on genetic maps are measured in centimorgans (cM). One cM represents 0.01% recombination frequency.

Mutant phenotypes

Short aristae

Black body

Cinnabareyes

Vestigialwings

Brown eyes

Long aristae(appendageson head)

Gray body

Redeyes

Normalwings

Redeyes

Wild-type phenotypes

IIY

I

X IVIII

0 48.5 57.5 67.0 104.5

Physical maps

• Show the distance between DNA landmarks, such as the recognition sites for restriction enzymes.

• Distances between landmarks on a physical map are measured in base-pairs (1000 base-pairs equals 1 kilobase kb).

• Created by cutting genomic DNA with different restriction enzymes, and then determining the size of the pieces and how they fit together, into a continuous segment of the genome

• Such a map shows the distance between the different recognition sites of the restriction enzymes:

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

1. Multiple copies of a segment ofDNA are cut with restrictionenzymes.

4. A physical map is constructed.

Molecularweightmarker

AA

A

A

BB

B14kb5kb

A A8kb 9kb2kb

9kb5kb3kb2kb

2kb

2kb

2kb 2kb3kb

6kb5kb 5kb

5kb

10kb

10kb 19kb

9kb 9kb8kb

14kb 14kb

DNA

2. The fragments produced by enzyme A only, by enzyme B only, and by enzymes A and B simultaneously are run out side-by-side on a gel, which separates them according to size, smaller fragments running faster.

3. The fragments are arranged so that the smaller ones produced by the simultaneous cut can be grouped to generate the larger ones produced by the individual enzymes

enzy

me

Aen

zym

e B

enzyme A

+ B

DNA Sequencing

• Ultimate map - organism’s DNA base-pair sequence of the entire genome.

• Sequencing an entire genome, which may contain billions of base pairs

• DNA must be cut into small fragments and automated sequencers are used to determine the base-pair sequence of DNA

• Only accurate on fragments of DNA up to about 500 base-pairs in length.

DNA Sequencing

• Starts with the sequencing of random DNA fragments

• Powerful computer programs then assemble the resulting very large number of overlapping short sequences into a single continuous sequence

1

2

3

4

Cut the DNA frommany copies of anentire chromosomeinto overlapping frag-ments short enoughfor sequencing.

Clone the fragmentsin plasmid or phagevectors

Sequence eachfragment

Order thesequences into oneoverall sequencewith computersoftware.

ACGATACTGGT

CGCCATCAGT ACGATACTGGT

AGTCCGCTATACGA

…ATCGCCATCAGTCCGCTATACGATACTGGTCAA…

DNA Sequencing• Short DNA fragments can be sequenced by the dideoxy chain-termination method

Figure 20.12

DNA(template strand)

Primer Deoxyribonucleotides Dideoxyribonucleotides(fluorescently tagged)T

GTT

3

5

DNA polymerase

CTGACTTCGACAA

P P P P P P

dATP

dCTP

dTTP

dGTP

G

OH

ddATP

ddCTP

ddTTP

ddGTP

G

H

5

3

5

3

CTGACTTCGACAA

ddCTGTT

ddGCTGTT

ddAGCTGTT

ddAAGCTGTT

ddGAAGCTGTT

ddTGAAGCTGTT

ddCTGAAGCTGTT

ddACTGAAGCTGTT

ddGACTGAAGCTGTT

3DNA (templatestrand)

Labeled strands

Directionof movementof strands

Laser Detector

APPLICATION The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length.

TECHNIQUE This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined.

RESULTS The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.)

GACTGAAGC

Human Genome Project

• Project to sequence the entire human genome is called the human genome project

• Sequencing the human genome is a major step towards improving the diagnosis and treatment of disease in humans - practical applications of this information will be enormous.

• Project has already led to some important findings:

• Human genome is surprisingly similar to other genomes

• Only about 1% of the human genome codes for proteins

Human Genome• Eukaryotes tend to have many more genes than prokaryotes.

• However -complexity of an organism is not directly related to the number of genes

• For example, the human genome has around 30,000 genes, about the same number as in mice and far fewer than in rice.

• Current estimates are that the human genome contains about 25,000 genes, but the number of human proteins is much larger

Human Genome• Humans have only about 25,000 protein-encoding genes, these

genes can code for at least 87,000 different proteins.

• How? Alternative splicing of exons can produce several different mature mRNAs from a single gene

DNA

UnmodifiedRNA

transcript

Processed RNA-in brain

Processed RNA-in muscle

ExonsIntrons

Alternative Splicing of Exons

Genomics

• Genome sequences provide clues to important biological questions

• In genomics scientists study whole sets of genes and their interactions

• Computer analysis of genome sequences helps researchers identify sequences that are likely to encode proteins

• Comparison of the sequences of “new” genes with those of known genes in other species may help identify new genes

• For a gene of unknown function experimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its function

DNA Micro-arrays

• A DNA microarray, is a small square of glass that is covered with thousands of short pieces of single-stranded DNA arranged in a grid.

• The short chains of DNA nucleotides, which are attached to the glass surface, are called oligonucleotides.

• Can be used to screen a genome for the presence of thousands of specific alleles at once.

• To screen a person’s genome, a DNA sample is obtained, cut into fragments, heated to separate the strands, and then flooded over the chip.

• Specific alleles can be determined based on which oligonucleotides bind to the chip

DNA Technology

• The practical applications of DNA technology affect our lives in many ways

• Numerous fields are benefiting from DNA technology and genetic engineering

• One obvious benefit of DNA technology is the identification of human genes whose mutation plays a role in genetic diseases

Future Directions in Genomics

• Genomics is the study of entire genomes

• Proteomics is the systematic study of all the proteins encoded by a genome

• Single nucleotide polymorphisms (SNPs) single base-pair variations that provide useful markers for studying human genetic variation

Practical Applications Of DNA

• Numerous fields are benefiting from DNA technology and genetic engineering

• One obvious benefit of DNA technology is the identification of human genes whose mutation plays a role in genetic diseases

• Medical scientists can now diagnose hundreds of human genetic disorders

• By using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease-causing mutation

Diagnosis of Diseases• Hundreds of human genetic disorders are diagnosed

• using PCR and primers corresponding to cloned disease genes

• sequencing the amplified product to look for the disease-causing mutation

• Even when a disease gene has not yet been cloned the presence of an abnormal allele can be diagnosed with reasonable accuracy if a closely linked RFLP marker has been found

RFLP markerDNA

Restrictionsites

Disease-causingallele

Normal allele

Human Gene Therapy

• Is the alteration of an afflicted individual’s genes

• Holds great potential for treating disorders traceable to a single defective gene

• Uses various vectors for delivery of genes into cells

Bonemarrowcell frompatient

Retroviruscapsid

Viral RNA

Cloned gene (normal allele, absent from patient’s cells)

2

Insert RNA version of normal allele into retrovirus.

1

Let retrovirus infect bone marrow cellsthat have been removed from thepatient and cultured.

2

Viral DNA carrying the normalallele inserts into chromosome.

3

Inject engineeredcells into patient.

4

Pharmaceutical Products• Large-scale production of human hormones and other proteins with

therapeutic uses

• Production of safer vaccines

Human immuneresponse

Gene specifyingherpes simplexsurface protein

Harmless vaccinia(cowpox) virus

1. DNA is extracted. 2. Surface proteingene is isolated.

3. Vaccinia DNAis extracted andcleaved.

4. Fragmentcontaining surfacegene combineswith cleavedvaccinia DNA.

5. Harmlessengineered virus(the vaccine) withsurface like herpessimplex is injectedinto the humanbody.

6. Antibodiesdirected againstherpes simplexviral coat aremade.

Herpes simplex virus

Construction of Vaccine for Herpes Simplex

Forensic Evidence

• A DNA fingerprint is a specific pattern of bands of RFLP markers on a gel

• DNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenes

• Can provide definitive evidence that a suspect is guilty or not

• DNA fingerprinting can also be used in establishing paternity

Defendant’sblood (D)

Blood fromdefendant’sclothes

Victim’sblood (V)

D Jeans shirt V

4 g 8 g

Manipulation of Microganisms

• Genetic engineering can be used to modify the metabolism of microorganisms

• Can be used to extract minerals from the environment

• Degrade various types of potentially toxic waste materials

• Improve agricultural productivity and food quality

Animal Husbandry and “Pharm” Animals

• Transgenic animals contain genes from other organisms

• Have been engineered to be pharmaceutical “factories”

Escherichia coli

Geneof interest

Cow DNA

Plasmid

1. Plasmid is removedand cut open withrestriction endonuclease.

2. Cowsomatotropingene is isolatedfrom cow cell. 3. Somatotropin gene is

inserted into bacterialplasmid.

4. Plasmid isreintroduced intobacterium.

5. Bacteria producingbovine somatotropinare grown infermentation tanks.

6. Somatotropin isremoved frombacteria and purified.

7. Bovinesomatotropinis administered tocow to enhancemilk production.

Production of Bovine Somatotropin

Genetic Engineering in Plants

• Agricultural scientists have already endowed a number of crop plants with genes for desirable traits

• The Ti plasmid is the most commonly used vector for introducing new genes into plant cells

APPLICATIONGenes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector.

TECHNIQUE

Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene.

RESULTS

1 The Ti plasmid is isolated from the bacterium Agrobacteriumtumefaciens. The segment of the plasmid that integrates intothe genome of host cells is called T DNA.

2 Isolated plasmids and foreign DNA containing a gene ofinterest are incubated with a restriction enzyme that cuts inthe middle of T DNA. After base pairing occurs betweenthe sticky ends of the plasmids and foreign DNAfragments, DNA ligase is added. Some of the resultingstable recombinant plasmids contain the gene of interest.

3 Recombinant plasmids can be introduced into cultured plantcells by electroporation. Or plasmids can be returned toAgrobacterium, which is then applied as a liquid suspensionto the leaves of susceptible plants, infecting them. Once aplasmid is taken into a plant cell, its T DNA integrates intothe cell‘s chromosomal DNA.

Agrobacterium tumefaciens

Tiplasmid

Site whererestrictionenzyme cuts

T DNADNA withthe geneof interest

RecombinantTi plasmid

Plant withnew trait

Daffodil

Ferritin geneis transferredinto rice frombeans.

Phytase gene istransferred intorice from afungus.

Metallothioningene istransferred intorice from wildrice.

Enzymes for-carotenesynthesis aretransferred intorice from daffodils.

Fe Pt SRicechromosome A1

Ferritin proteinincreases ironcontent of rice.

Phytate, whichinhibits ironreabsorption,is destroyed by thephytase enzyme.

Metallothioninprotein suppliesextra sulfur toincrease ironuptake.

-carotene, aprecursor tovitamin A, issynthesized.

Beans Aspergillus fungus Wild rice

A2 A3 A4

Transgenic Rice

Safety and Ethical Questions Raised by DNA Technology

• The potential benefits of genetic engineering

• Must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment

• Today, most public concern about possible hazards is focused on genetically modified (GM) organisms used as food