DNA Profiling

DNA ProfilingDNA Profiling

(DNA fingerprinting)(DNA fingerprinting)

What is DNA Profiling?What is DNA Profiling?

A technique used by scientists to A technique used by scientists to distinguish between individuals of distinguish between individuals of

the same species using only samples the same species using only samples of their DNA of their DNA

Who Invented it?Who Invented it?

The process of DNA The process of DNA fingerprinting was fingerprinting was invented by Alec invented by Alec Jeffreys at the Jeffreys at the University of University of Leicester in 1985. Leicester in 1985.

He was knighted in He was knighted in 1994.1994.

What is a DNA fingerprint?What is a DNA fingerprint?

Every cell of an individual carries a Every cell of an individual carries a copy of the DNAcopy of the DNA– a cell collected from a person’s skin or a cell collected from a person’s skin or

hair folicle contains the same DNA as hair folicle contains the same DNA as from that persons heart tissue or white from that persons heart tissue or white blood cellsblood cells

Order of base pairs in the DNA of Order of base pairs in the DNA of every individual is different except every individual is different except identical twinsidentical twins

How do we distinguish one person’s How do we distinguish one person’s DNA from another?DNA from another?

We do not need to sequence the entire 3 billion We do not need to sequence the entire 3 billion base pairs of a person’s DNA to distinguish it from base pairs of a person’s DNA to distinguish it from another person’s DNAanother person’s DNA

Junk DNA contain sequences that are 20-100 bp in Junk DNA contain sequences that are 20-100 bp in length that are repeated at different locations (length that are repeated at different locations (lociloci) ) along the chromosome. along the chromosome.

CCGGGGCCTTAACCGGGGCCTTAACCGGGGCCTTAA (repeated 3 times at this (repeated 3 times at this location; at another location, it may be repeated 9 location; at another location, it may be repeated 9 times)times)

These sequences are called Short Tandem Repeats These sequences are called Short Tandem Repeats (STRs) or VNTRs(STRs) or VNTRs

STRsSTRs Each person has some STRs that were Each person has some STRs that were

inherited from mother and some from fatherinherited from mother and some from father No person has STRs that are identical to No person has STRs that are identical to

those of either parentthose of either parent The number of repeats at each loci on The number of repeats at each loci on

chromosome is highly variable in the chromosome is highly variable in the population, ranging from 4 to 40.population, ranging from 4 to 40.

The length of the DNA after cutting the The length of the DNA after cutting the chromosome with a restriction enzyme, and chromosome with a restriction enzyme, and its position after electrophoresis will depend its position after electrophoresis will depend on the exact number of repeats at the locuson the exact number of repeats at the locus

The uniqueness of an individual’s STRs provides the The uniqueness of an individual’s STRs provides the scientific marker of identity known as a DNA scientific marker of identity known as a DNA fingerprint.fingerprint.

In the United States the FBI has standardized a set In the United States the FBI has standardized a set of 13 STR assays (13 different locations on the of 13 STR assays (13 different locations on the chromosomes) for DNA typing, and has organized chromosomes) for DNA typing, and has organized the CODIS database for forensic identification in the CODIS database for forensic identification in criminal cases. criminal cases.

The United States maintains the largest DNA The United States maintains the largest DNA database in the world: The Combined DNA Index database in the world: The Combined DNA Index System, with over 60 million records as of 2007. System, with over 60 million records as of 2007.

Preparation of a DNA Preparation of a DNA fingerprintfingerprint

Specimen collectionSpecimen collection– blood, semen, etcblood, semen, etc– easy to contaminate a DNA sample with easy to contaminate a DNA sample with

DNA from other sources (bacteria, DNA of DNA from other sources (bacteria, DNA of person collecting sample)person collecting sample)

– DNA is not stable for very long-it degradesDNA is not stable for very long-it degradessunlightsunlightheatheatmoisturemoisture

Stages of DNA ProfilingStages of DNA Profiling

Stage 1Stage 1::

Cells are broken downCells are broken down

to release DNAto release DNA

If only a small amount If only a small amount of DNA is available it of DNA is available it can be amplified using can be amplified using the polymerase chain the polymerase chain reaction (PCR)reaction (PCR)

PCR allows you to make millions of copies of the STR region from a single copy of DNA you recovered from crime scene.

Stages of DNA Profiling Stages of DNA Profiling Step 2:Step 2: The DNA is cut into fragments using The DNA is cut into fragments using restriction restriction

enzymesenzymes..

Each restriction enzyme cuts DNA at a specific base Each restriction enzyme cuts DNA at a specific base sequence.sequence.


The sections of DNA that are cut out The sections of DNA that are cut out are called are called restriction fragments. restriction fragments.

This yields thousands of restriction This yields thousands of restriction fragments of all different sizes fragments of all different sizes because the base sequences being because the base sequences being cut may be far apart (long fragment) cut may be far apart (long fragment) or close together (short fragment).or close together (short fragment).


Stage 3:Stage 3: Fragments are Fragments are

separated on the separated on the basis of size using basis of size using a process called a process called gel electrophoresis.gel electrophoresis.

DNA fragments are DNA fragments are injected into wells injected into wells and an electric and an electric current is applied current is applied along the gel. along the gel.


DNA is negatively DNA is negatively charged so it is charged so it is attracted to the attracted to the positive end of the positive end of the gel.gel.

The shorter DNA The shorter DNA fragments move fragments move faster than the faster than the longer fragments. longer fragments.

DNA is separated on DNA is separated on basis of size.basis of size.


A radioactive A radioactive material is added material is added which combines which combines with the DNA with the DNA fragments to fragments to produce a produce a fluorescent image.fluorescent image.

A photographic A photographic copy of the DNA copy of the DNA bands is obtained.bands is obtained.


Stage 4:Stage 4: The pattern of fragment distribution The pattern of fragment distribution

is then analysed.is then analysed.

Uses of DNA ProfilingUses of DNA Profiling

DNA profiling is DNA profiling is used to solve used to solve crimes crimes and and medical medical problemsproblems

CrimeCrime

Forensic science is the use of Forensic science is the use of scientific knowledge in legal scientific knowledge in legal situations.situations.

The DNA profile of each individual is The DNA profile of each individual is highly specific.highly specific.

The chances of two people having The chances of two people having exactlyexactly the same DNA profile is the same DNA profile is 30,000 million to 1 (except for 30,000 million to 1 (except for identical twins). identical twins).

Biological materials used for DNA Biological materials used for DNA profilingprofiling

BloodBlood HairHair SalivaSaliva SemenSemen Body tissue cellsBody tissue cells DNA samples have DNA samples have

been obtained from been obtained from vaginal cells vaginal cells transferred to the transferred to the outside of a condom outside of a condom during sexual during sexual intercourse.intercourse.

DNA Profiling can solve crimesDNA Profiling can solve crimes

The pattern of the DNA profile is then The pattern of the DNA profile is then compared with those of the victim and the compared with those of the victim and the suspect.suspect.

If the profile If the profile matchesmatches the suspect it the suspect it provides strong evidence that the suspect provides strong evidence that the suspect was present at the crime scene (was present at the crime scene (NB:it NB:it does not prove they committed the does not prove they committed the crime).crime).

If the profile If the profile doesn’tdoesn’t match the suspect match the suspect then that suspect may be eliminated from then that suspect may be eliminated from the enquiry.the enquiry.

ExampleExample

A violent murder occurred. A violent murder occurred. The forensics team retrieved a blood The forensics team retrieved a blood

sample from the crime scene. sample from the crime scene. They prepared DNA profiles of the They prepared DNA profiles of the

blood sample, the victim and a blood sample, the victim and a suspect as follows:suspect as follows:

Was the suspect at the crime Was the suspect at the crime scene?scene?

Suspects Profile

Blood sample from crime scene

Victims profile

Solving Medical ProblemsSolving Medical Problems

DNA profiles can be used to determine DNA profiles can be used to determine whether a particular person is the parent whether a particular person is the parent of a child.of a child.

A childs paternity (father) and A childs paternity (father) and maternity(mother) can be determined.maternity(mother) can be determined.

This information can be used inThis information can be used in• Paternity suitsPaternity suits• Inheritance casesInheritance cases• Immigration casesImmigration cases

Example: A Paternity TestExample: A Paternity Test

By comparing the DNA profile of a By comparing the DNA profile of a

mother and her child it is possible tomother and her child it is possible to

identify DNA fragments in the child identify DNA fragments in the child

which are absent from the mother and which are absent from the mother and

must therefore have been inherited must therefore have been inherited

from the biological father.from the biological father.

Is this man the father of the child?Is this man the father of the child?

Mother Child Man

Famous casesFamous cases

In 2002 Elizabeth In 2002 Elizabeth Hurley used DNA Hurley used DNA profiling to prove profiling to prove that Steve Bing that Steve Bing was the father was the father

of her child Damienof her child Damien

Famous CasesFamous Cases

Colin Pitchfork was Colin Pitchfork was the first criminal the first criminal caught based on caught based on DNA fingerprinting DNA fingerprinting evidence. evidence.

He was arrested in He was arrested in 1986 for the rape 1986 for the rape and murder of two and murder of two girls and was girls and was sentenced in 1988. sentenced in 1988.

Simpson/Goldman MurderSimpson/Goldman Murder Pretrial hearings announced that blood collected at Pretrial hearings announced that blood collected at

crime scene matched that of O.J.scrime scene matched that of O.J.s Defense argued that contamination could have Defense argued that contamination could have

occurred during sample collection and between occurred during sample collection and between collection of different samplescollection of different samples

Technician admitted mislabeling samplesTechnician admitted mislabeling samples Possibility that evidence might be tainted was Possibility that evidence might be tainted was

obvious to both the court and the juryobvious to both the court and the jury DNA evidence was not allowed as evidenceDNA evidence was not allowed as evidence When rules of evidence are not followed, DNA When rules of evidence are not followed, DNA

samples lose their value in court.samples lose their value in court.

Documents

DNA Profiling