Computing Life

8/3/2019 Computing Life

1/24

computing life

2 searching or genetic treasures

7 the next top protein model

10 movie mania

12 sim sicknessU.S. Department OF 16 integrating biologyHeaLtH anD HUman SerVICeSniol Isius o Hlhniol Isiu o Gl mdicl Scics 18 made possible by


2/24

What is NIGMS? th niol Isiu o Gl mdiclScics (nIGmS) suos bsic sch o gs, ois d

clls. I lso uds sudis o udl ocsss such s how

clls couic, how ou bodis us gy d how w

sod o dicis. th suls o his sch ics ou

udsdig o li d ly h oudio o dvcs i h

digosis, d vio o diss. th Isius

sch iig ogs oduc h x gio o

sciiss, d nIGmS hs ogs o ics h divsiy o h

biodicl d bhviol sch wokoc. nIGmS suod

h sch o os o h sciiss iod i his bookl.

poducd by h Oc o Couicios d public Liiso

niol Isiu o Gl mdicl Scics

niol Isius o Hlh

U.S. D o Hlh d Hu Svics


3/24

From text messaging riends to navigat

ing city streets with GPS technology,

were all living the computing lie. But

as weve upgraded rom snail mail and

compasses, so too have scientists.

Computer advances now let re

searchers quickly search through DNA

sequences to nd gene variations that

could lead to disease, simulate how fu

might spread through your school and

design three dimensional animations

o molecules that rival any video game.

By teaming computers and biology,

scientists can answer new and old

questions that could oer insights into

the undamental processes that keep

us alive and make us sick.

This booklet introduces you tojust some o the ways that physicists,

biologists and even artists are com

puting lie. Each section ocuses on

a dierent research problem, oers

examples o current scientic projects

and acquaints you with the people

conducting the work. You can ollow

the links or online extras and other

opportunities to learn aboutand get

involved inthis exciting new interdis

ciplinary eld.


4/24

We share:

70%of our genes withfruit flies and

98%with chimpanzees and

99.9%with each other.

Imagine finding a treasure chest that contains all of the precious gems and

metals ever mined, but you can only lift the lid far enough

see the glint of gold and the sparle of diamonds.

Thats how some biologists felt not too long ago.

Advances in computer technology have opened the

genetic treasure chest all the way, revealing thehuman genome and answering questions about

diseases, drug treatments and even crimes.

to

searching for genetic treasures

National Institute of General Medical Sciences


5/24

?In 2005, the U.S. Food

and Drug Administrationapproved a heart

ailure drug specically

targeted to Arican

Americans. Why do

you think some people

raised ethical concerns?

c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s

MEDICINES that wor wonders

for you can be ineffective or

even harmful to others. Why?

Age, weight, lifestyle and other

medicines each play a role, but

so do GENES.

Sciiss us cous o d h

scic gic viios h c h

wy w sod o dugs. this ld osch is clld hcogics,

d is gol is o di h y

d dos o dici bs suid o

ch idividul.

Gicis Gy plz roch plo

alo i Clioi lds o sch

wokig i his ld. His gou hs

lookd o iy dics h chg

how ic ocss, o boliz, h

dug wi.

nly 2 illio aics, scilly

hos who hv h diss o

covig o jo sugy, k

wi o v ddly blood clos.

Bu wi is icky o scib. too

uch cuss xcssiv bldig d oo

lil could llow clos o o. Docos

us cul, il-d-o och o

d h igh ou o ch so.

th Clioi schs ioid

h g h ks zy h ic

d o boliz wi. Schig

wih cous, hy h oud sligh

viios i h gs Dna h could

ifuc how quickly h ils

liid h dug o hi bodis.

th sciiss w bl o us h

ics gic ols o dic how

h ic would ocss h dug. Siil

sudis i hus could ulily hl

docos o quickly d cisly

scib h igh dos o wi.

>side effects: genes and medicinesBy Susan Gaidos


6/24

>answers from africaBy Alisa Zapp Machalek

Geneticist Sarah Tishoff splits

her time between her LABORATORYat the University of Pennsylvania

in Philadelphia and remote parts

of AFRICA.

Sh woks wih d collcs Dna o

ol s divs s hu-ghs

i h jugls o cl aic; gi-

gowig s i souh aic;

d odic, cl-isig wios

i s aic.

By dsigig cou odls o

co h Dna o hs di

oulios, sh hos o ck dow

g viios h k so ol

lss suscibl o li o o

h wolds ldig cuss o dh.

pol i ci aic ibs h

hv b xosd o li o

housds o ys c coc h

diss d suviv i. ths ibs-

ol dvlod gic dios

h gv h ul sisc o

li, which hy ssd o o hi


Tishko enlists Arican

tribespeople in her project

to understand how human

genomes have responded

to malaria. > Sarah Tishko

dscds. though h gios,

h sisc gs hv bco ocoo i h oulio.

tishko clls his ocss h oois

o ul slcio. Followig h il

c ld sciiss o h gic bsis o

i sisc d ossibly o uu

his o li d oh disss

So , h il hs k tishko o

d idicig h i sisc o

li is cusd by vi i h g

o scic zy ickd G6pD.

pol wih his gic vi k

lss o h zy, which is dd osvl io chicl cios

isid clls.

U o o-qu o h ol livig

i li-isd gios o aic hv

his vi. evywh ls, w h

5 c hv i.

Udsdig how h G6pD gic

vi ocs ol o li

could vully hl d v

h sd o h diss. th wok,

tishko dds, is lso hlig o uvl

h hisoy o od hus i aic

d byod.

http://publications.nigms.nih.gov/computinglie/searching.htmweb exclusives @


7/24

c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s

>word gamesIf youre hooed on SUDOkU, you

should try the letter game called

GENETIC CODE. Heres an

easy example: Put the following

words in a sequence so that each

one differs from the previous word

by just one letter.

FAN BIT BAT BAN FUN

now igi wokig wih wods

h coi housds o ls. ad,

isd o shufig oud cogizbl

wods, you hv log, sigly do

sigs o as, ts, Gs d Cs h ls

o h Dna cod.

ths wh sciiss c wh hy

y o ck d lyz chgs wihi

ogiss gic il, ogo. th sk y soud ough,

bu is sy wih h hl o cous.

Sciiss yiclly s wih

collcio o g squcs o

di ol o ogiss. ths

squcs could co o blood,

bodily issus o v ci bos.

to gu ou wh h viios

occud, schs us cou

iol ools o u h g squcs

i choologicl od. I his wy,

cous vlig h gic

chgs, cobiios d quiks h

c h ehs kbl biologicl

divsiy. AZM

>mutiny against antibioticsWhat can dirty DIAPERS teach us

about MEDICINE? That infectious

bugs are cagey.

Wh sciiss dsigd h s

ibioics o h 50 ys go,

hy clld h dicl vls. th

dugs cud coo icios cusd

by bci i jus dys, slshig dh

s d soig dicl c.

Bu hough iy gic chgs,

od i by ou ow ovus d

isus o ibioics, su bugs ow

ous ou oc su dugs. Ci

bcil sis hv dvlod sisc o ibioics h oc killd h

d ssd his biliy o hi dsc

ds. tody, w o hs sis c

v ovco vy xisig ibioic.

Sciiss hough h y

gios wihou xosu o i

bioics, h bci would vully

succub o h dugs oc gi.

Uouly, h dos s o b

h cs, sys Buc Lvi, oulio

gicis eoy Uivsiy i

al, Gogi.

Lvi lyzdE. colibci hhlss kid i ou colos oud i

70 diy dis o dy c c.

O-qu o h bci i h usd

dis w sis o soyci,

ibioic ly scibd i h

vious 30 ys.

Lvis di discovy ws buoyd

by sch ld by richd Lski,

icobiologis michig S

Uivsiy i es Lsig who id

i Lvis lb.

Sic 1988, Lski hs oiod

fsks o soyci-sisE. coli.

a 10 ys d 20,000 bcil

gios, h foodd h bugs wih

soyci o h s i. thy

id uzd by h dug.

Lvi d ohs hv u housds

o cou siulios o co u

wih sgis h slow h dvlo

d sd o sisc.

mae up

your own3-letter series, and

as your friendsto arrange them.

!

hesweris:BIt,Bat,Ban,Fan,FUn.

!blow

your nose.Theres a good chance

that your tissue contains

Staphylococcus aureus, or

staph bacteria. Normally,

this common bug doesntcause sickness, but it

occasionally can be lie

threatening. Computer

models can help identiy

strategies or keeping the

spread o these inections

at bay, especially in

hospitals, where they can

be the most dangerous.

Bcus dug-sis bci will

coiu o lgu us, Lvi joks h

sch o ibioic sisc os

h c c oouiy. H sys,

W us coiully discov w wys

o dl wih bcil icios. I ll

suds h wh you gdu o

school, h ly o higs o

you o do! AZM


8/24

In 1995, a Louisiana nurse accused

her ex-boyfriend, a doctor, of attempt

ed MURDER. She claimed he gave her

the AIDS virus by injecting her with

blood from an HIV-positive patient.

Lawyers from both sides recruited

scientists to analyze viral DNA fromthe nurse.

to ov is cs, h oscuio

hd o covic h juy h h vius

o h us d h vius o h

i w clos livs. So, sci

iss dusd o Dna gis!

th ivsigiv , ld by

couiol biologis Dvid Hillis

h Uivsiy o txs ausi d

viologis michl mzk Bylo

Collg o mdici i Houso, txs,

usd chiqu clld Dna gi

ig o co h Dna squcs o

h wo vil sls. th lso

usd ub o di cou

ogs o ic ogh how h vil

squcs os likly chgd bw

h llgd ijcio i 1994 d h il

i 1998.

th suls showd h ci

gic squcs o h uss vius

w idicl o hos o h is

>csd: crime scene dna

vius. th doco ws covicd o

d scod-dg ud d

scd o 50 ys i iso. Lwys

ld his cs ll h wy u o h

U.S. Su Cou, which l h

covicio sd i 2002.

th cs ks h s i h

such gic lysis, clld hylo

gics, ws usd s vidc i

U.S. ciil cou. AZM

By 2010, the Innocence Project,

which oers legal assistance to

people who claim theyve been

wrongully accused, says that

DNA fngerprinting had led to the

reeing o more than 240 people.

?whodo youthin is guilty?Evidence rom a crime scene

leads police to ve suspects.Compare DNA rom the perpetr

tors blood let at the crime sce

with the suspects DNA below.

DNA sequence from perpetrators

blood found at the crime scene:

AGGCTGCCTACGCGGTTAGG

DNA sequences from suspects:

#1 AGGATGGCTACCCGGTTAGG

#2 AGGCTGCCTCAGCGGATAGG

#3 AGGCTGCCTACGCGGTTAGG

#4 CGGCAGCCTACTCGGTTAGG

#5 AGGCTGGATACGCGGCTAGG

In the Louisiana murder trial,

scientists compared more than

2,000 letters o HIV rom about 3

people. Computers did most o

the work!

Computational biologists

helped prove that a doctor

tried to murder his ex

girlriend using a syringe

lled with the AIDS virus.


eris:#3.


9/24

c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l

Baker used his computer program

to design a small protein not ound

in nature. > Bi Kuhl, Gu Ds, Dvid Bk

the next top protein model

From building muscles to healing wounds, our bodies rely on proteins chainsof small molecules called amino acids that fold into unique shapes. Incorrectly

folded proteins can cause disorders lie sicle cell disease or cystic fibrosis.

Ever-improving computer power is maing it easier for researchers to

predict how proteins fold and interact with other molecules, possibly leading

to new treatments for protein-related disorders.

>tailor-made proteinsBy Emily Carlson

Scientists can easily determine h h-disiol sh

a proteins amino acid sequence, o his d-u olcul.

but they cant reliably PREDICT Bk usd h squc o

build cul oi h wshow this sequence will fold into

sbl d qui siil i suca three-dimensional STRUCTURE.

u o h o h hd dw,So couiol biologis Dvid

vlidig his och.Bk h Uivsiy o Wshigo

Wih h biliy o whi u wi Sl ook di och. H

ois, Bks sch y ksd by skchig oi sucu

i ossibl o cusoiz ois hh obody hd v s. nx, h

could b usd s dugs o iy biologicl

lid o cou odlig og chis o ci disss.h dvlod clld ros o ll hi

wh io cid squc would o

http://publications.nigms.nih.gov/computinglie/topprotein.htmweb exclusives @


10/24


>modeling@home

In high school, Johnathon Tinsleyhad MIXED feelings about MATH and

SCIENCE. Math was very challeng

ing, he recalls. I enjoyed some

parts of biology, but not physics.

this Biish g hld

sch o cus o disss lik

aIDS d alzhis jus by

lig schs us

his cou wh h

ws. You c g

ivolvd, oo!tisly is o

ch d clld

disibud couig

h lis o h ublic

o hl dvc hlh

d dici. though his

och, schs hss

h ow o sol cous o

WARNING!Beore you download

distributed computing

sotware onto a public

computer, like the ones at

school or work, ask i its

OK. I you dont, you could

get into serious trouble!

DC Distributed computing

@home Most likely a distributed computing project

Credit Points received or solving a calculation

Work Unit Problem sent to a donated computer

BOINC The Berkeley Open Inrastructure or NetworkComputing, or the ree sotware program usedby many DC projects

PC Personal computer

Server Computer that sends inormation to othercomputers in a network

Wanna Volunteer?

Folding@Home: http://olding.stanord.edu

Rosetta@home: http://boinc.bakerlab.org/rosetta

FightAIDS@Home: http://fghtaidsathome.scripps.edu

I you visit the Web sites o distributedcomputing projects, youll likely ndcomputerese. Heres a brie glossary.

While youre sleeping, your

computer could be doingscientifc research.

sw io qusios bou biology.th yicl cous i sciiss lb

c o ll o h quid ub

cuchig, bu wok o hudds d

v housds o sol cous c.

How It WorksYou joi disibud couig wok

by dowlodig sow.

Wh you cou is busy,

i sds ssg o sv

i h schs lb

bsiclly syig, Hy, Ivilbl. C I hl? th

sv ssigs chuk o

lg clculio h i kows

h ho cou c solv.

th dod cou y

sd svl dys wokig ou

h obl. Wh is do, i hds

i h sw. Jus lik chs, ol

i h lb chck h sul, lso kigsu h o o hs d wih

h ioio.

You c volu you cou,

whv h k o odl. th co

u us b cocd o h I

h y o cocio dos .

Old cous c do h job, lhough

hy glly g sil clculios.

You c lso choos how uch cou

oy you w o do.

You do d o woy bou hcks

bkig io you cou sys.Scuiy chcks ocig h i

svs d h liid cbiliis o h

quid sow k iciig i

h ojcs cosidbly s h

sug h I.


11/24

c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l

Distributed Computingin Actionth scic w c do is uchd by

wh w could do wih y oh vil

bl ools, sys Vijy pd, sciis

Sod Uivsiy i Clioi who

sd disibud couig ojc

clld Foldig@Ho.

pd sudis h dyics o how

ois old io hi uiqu shs.

By sudyig how hy old, pd c

s wh gos wog d how dugs

igh ch isoldd ois.pois old uch s h you c

old shi. th quicks o is do i jus

5 illiohs o scod.

pd sys h i would k vy

s dsko cou o h

housd ys o colly siul

h ocss! Bu wih h hl o ly

250,000 sol cous d o

>project structureMost people enjoy a little friendly

COMPETITION, and protein struc

ture prediction researchers are no

exception. Every other year, these

experts go head-to-head to see

whose computer MODELS mae

the best predictions.

th gol is o os cculy odl

h shs o -slcd ois. th

coss do kow h cul suc

us o hs olculs, bu h judgs

do. a viwig h is, h judgs

ivi h os succssul odls o

iiol ig wh hy lk

bou h ochs hy usd. th

i gou discusss how ll c do

v b job i h uu.

h 1 illio plySio

3 gigcosols, pd c do h job i lss

h wk.

tisly dod bou 40 hous o

ocssig i vy dy bw

his wo cous. H likd kowig

h his cous w doig so

hig usul. tisly sys, thy

o jus siig h lik sud

los Biish slg o big idl.

Fo his disibud couig oj

cs, tisly ckd how uch wok

his cou coibud cod oohs. I his cou hld dic

oi sucu, h sw his o

h ojcs Wb si d yb v

ublishd i sciic joul. So

ojcs lso would wd scil

cics.

Sig h ic ks big

dic, sys pd. Wh you

th sciiss do cully cll h

v cos o v coiio.

Is couiy-wid xi o

iov h ccucy o oi dicio

odlig so schs c discov

w dugs o quickly d chly. EC

do o y chiis, you do s dic lik bw wh you giv d

how is usd. Fo us, you c cully

s wh you cou hs dod d

h suls.

Svig scic, hough, is o h oly

b. Disibuig couig lso os

is icis civ socil wok.

my ojcs hv ssg bods

wh doos c os qusios bou

h scic o do houghs bou li.

Doos who lly w o b kd

h o o will o coiiv s.I lik coig o g y ss

bov y bs, sys tisly.

Bu h lso hs joyd h socil

sc. Fo o , h xlis, th

i i is o d lk wih ids

d do sohig good d wohwhil

whil w i. EC

Scientists oten are

rewarded or makingbig breakthroughs, with

the Nobel Prize being

the ultimate honor.

Read about the winner

o a high school science

competition on page 18.

The computer model

generated by David

Bakers team or the

2004 communitywide

experiment (let) was

strikingly similar to the

proteins actual structure

(right). > phili Bdly, Dvid Bk


12/24


movie mania

Just as sound and color revolutionized the film industry, computer technology

has changed the way scientists view biology. Researchers today not only

can tae snapshots of

biology, they can animate

entire biological processes,

thrusting viewers deep into

never-before-seen worlds.

>scientists develop sixth senseThans to a HIGH-TECH tool, scientists

just regained their SIXTH SENSE.

Bo you hik o ci fick

sig Buc Willis, hik bou lig

you uscls fx s you ush box

coss c o lugig owd s

you c suddly sos. ths hysicl

soss o xl cus wh

y xs cosid h

sixh y o ssoy

xic.

A scientist manipulates plastic

models o two proteins while

the computer tracks and

displays their electrostatic

properties, shown here as

redand blue clouds. > ahu Olso

So sciiss

los his ss i h

cou g. thy o

log usd hysicl odls o biologi

cl olculs, lik ois o Dna, o

s how hy ogh. Isd, hy

usd cou-gd odls.

my sciiss sod wokig

wih hysicl odls logh, sys

ahu Olso, sucul olcul

biologis. th u o sil c

io chgs d h kid o udsd

ig you g o icig wih yousuoudigs w los wh cou

ghics ook ov.

Olso d his h Scis

rsch Isiu i L Joll, Clioi,

hv dvlod ool h llows h

o do boh: hysiclly

iul odl o

biologicl olcul

whil wchig is

chicl d biohysi

cl ois chg

o cou sc.

Olso sys cobiig

h wo xics

will l schs och d

udsd biologicl obls i

w wys.

th sciiss us scil is

h g lsic o ls 3-D

shs s sily s oh is

oduc 2-D icus. as Olso d

ohs hold d ic wih h odls,

c cods clos-u sho o h

odls i oio. a cou og

h suioss ghics, lik h

g o os o h gy

bw odld olculs.Olso cobis h odl d

cou ghics io o ig h

llows hi o sudy ll h di cs

o h biologicl olcul. Olso hos

h o dy his ic could doubl s

vido g h ls suds xlo

d ly h olcul lvl. EC

! pic upa nearby object.Rotate it so you see all

its sides. Does it eel

heavy? What about cold?

Smooth? How would you

determine these qualities

i you only saw the object

on a computer screen?


13/24

c o m p u t i n g l i f e | m o v i e m a n i a

>now playing on a computer near youBy David Bochner

Superman is super strong, super

fast and generally super fly. But in a

COMIC boo, hes also super FLAT,leaving many of his superhero feats

up to your imagination. But when

the comic boo turns cinematic,

Superman truly comes ALIVE.

Sois sciiss oly g o

s h coic book viw o biology:

exil d givs schs jus

sshos o wh biologicl ocss

looks lik scic i. So, cou

iol biologis Kvi Sbosu h

Los alos niol Lbooy i nwmxico is bigig hos ocsss o li.

Sbosu uss high-oc

cous o c ovis o iy

olcul chi s i vy

livig ogis. this chi clld

h iboso builds ois o h

gic isucios codd i Dna.

The ribosome plays itsel in this molecular

movie, now appearing on the Computing Life

Web site. > Kvi Sbosu

Isd i udsdig h oigi

o li, Sbosu sys h sudis h

iboso bcus i y b h olds

ic i h cll.

Bu hs o o i h cuiosiy.

Sbosu lso sys h bou hl

o ll ibioics usd o bcil

icios g h iboso, ig

h b udsdig o his biologicchi could ld o su-sog dugs.

to k his ovis, Sbosu

ss wih xil d, lik h

sucu o iboso i icul

isc, d gs soybod o

sos. Hudds o cocd cou

ocssos o sucou h

u h sshos io i ovi

lld wih ioio sciiss could

ohwis s o v igi.

You c look sic sucus o

h iboso, sys Sbosu, buh oly wy o wch i i oio is h

sucou siulio.

His hs cd o o h

lgs biologicl siulios v,

bigig w li o chcs i h

old soy o oi syhsis.

An artist s rendering o how chemicals change and move among cells in

the brain. Watch the animation on the Computing Life Web site. > Ki Hg

Amid a networ of BLOOD vessels

and star-shaped support cells,

neurons in the BRAIN signal each

other. The mists of COLOR show the

flow of important molecules, such as

glucose, oxygen and nitric oxide.

this ig is ssho o

52-scod siulio cd by Ki

Hg, iio is wokig wih h

Lbooy o nuo Igig h

Uivsiy o Clioi, Los agls. th

iio, which oys how chicls

chg d ov og clls i h bi,

ook bou 300 hous o c. to u i

ll ogh, Hg wokd closly wih

nl pksh, uobiologis i h

s lb. pksh iiilly skd o

>the art of animationBy Karin Jegalian

dwig o illus sch , bu

h dico o h lb suggsd oduc

ig iio isd.

Hg, who sudid hooghy, vido

d ghic dsig i collg d l

d gdu dg i di s,

dos o dw ovis -by-.

Isd, sh builds viul sculus

lld wih colo, ligh, xu d oio

d h guids h viws y hough

h scs.

th lb us his iio, log

wih dozs o ohs, o is Wb si d

lso lys i i s-o-h- h

duig sios o sciiss,

suds d oh visios.

Hg sys h ol is o k h

sch o ccssibl o di

udics. Sig iio, sh

xlis, ks i si o cohd

wh sch is syig.

http://publications.nigms.nih.gov/computinglie/moviemania.htmweb exclusives @


14/24


>preparing for a pandemic

MIDAS,not to be conused with

the king who turned

everything to gold, standsor Models o Inectious

Disease Agent Study.

?How would your simu

lated lie be dierent

rom your best riends?

Just months after the first cases of Flu and You

, to c h dic fu siulios,

h mIDaS schs us cou

odls o build viul ciis, couis

d v cois. H,

housds o d ol

go o school, wok, sos

d oh lcs. th

schs bs h

sids civiis o

ioio bou cul

ol lik you.

Sh eubk,

hysicis Vigii tch

Uivsiy i Blcksbug d o h

mIDaS , hs odld viul

vsios o jo

U.S. ooli s usig locl

soio d csus d. I

eubks ciis, h lly six (o

w) dgs o sio bwy wo ol kig i sy o

gs o sd.

Viuss do c uch bou

goghy, sys eubk. thy c

bou socil woks d how ol

co io coc wih ch oh.

SWINE FLU appeared in April 2009

millions of Americans had gotten

sic and some had even died.

By the end of the year, the

virus had spread world

wide, creating the first

influenza PANDEMIC

since 1968.

as dug cois

oducd vcci h

vd illios o o

cchig his fu, schs

iciig i iiol ojc

clld mIDaS w siulig diss

sd. th siulios l h xlo

how h dic igh uold, who

ws o likly o g sick d which

ivios igh oc h os

ol. th suls hld io ublicolicy dcisios.

sim sicness

Scientists are creating their own virtual worlds where people live and wor

and get sic. Here, researchers can mimic viruses and predict the spread of

contagious diseases through a community. Successful simulations can help us

better prepare for real-life outbreas.


15/24

c o m p u t i n g l i f e | s i m s i c k n e s s

y sch wod io Googl d

Meet the Simulators

Stephen Eubank started out

studying highenergy physics

but then got into modeling the

dynamics o nonlinear systems,

which are systems that cant be

solved by adding up all o the

parts. He has developed computa

tional models to study natural

languages, trafc patterns and

fnancial markets. He plans to use

the inectious disease models to

study how behaviors, like smoking,

spread through society.

Christina Mills has a Sc.D. (like a

Ph.D.) and an M.D. For her, model

ing inectious diseases is a dream

job because it combines her

interests in math, biology and

human health. While most o hercolleagues with double degrees

practice benchtobedside

research in which they translate

lab fndings into patient care,

Mills says shell stick with the

computerstoclinics approach.

?

What questions

would you want

to ask the models?

siul 180-dy oubk i

Virtual Virusesaoh ky o sudyig h sd

o icio wih cous ivolvs

dvloig viul vsio o h g.

to odl is sd s lisiclly s

ossibl, h schs ck dow

vyhig kow bou h icious

g. eubk, who hs sudid lgu,

sllox d hx, hs ghd

ioio o how ch g sds

bw ol, how cogious i is

d how log i ks o icd

so o show syos.Wh hy do kow h cul

chcisics o icious diss,

h mIDaS schs us hlh

os d sciic d collcd

duig li oubks o si wh

uu o igh b lik.

Duig gdu school, Chisi

mills odld dic fu bo w

hd v hd o swi fu (lso clld

H1n1). Sh did lo o h sch

i h liby, scouig h shlvs o

sciic icls h discussd h1918 Sish fu dic h

killd bw 20 d 40 illio

ol woldwid.

I ws vy old-shiod, sys

mills, who ws sudyig iiol

hlh Hvd mdicl School i

Boso, msschuss. I could jus

g h cssy ioio. th

hu vully ld h o h 1918

sissio s.

Asking QuestionsWih ll h odlig ics i lc, h

mIDaS schs ivi olicyks

o sk qusios h c b swd

usig h odls. Qusios g o

What happens i we dont do anything?

o How many people could be protected

i we intervene?

th schs c di

siulios h chg h vibls,

lik h cogiousss o h vius o h

ub o ol kig sow dys

eubks o ol who voluily

hg ou ho o void icio.

Whs so g bou h cou

siulios is h you c y ou

di siuios h you c

c i l sociis, sys eubk.

Wih o h 250 ossibl cobi

ios o siul, eubk sys h

lis o sisicis o hl hidi which gs will

oduc h os ioiv suls.

Is sy o co u wih qusios,

sys mills. th hd is guig

ou which os w should d

could sw.

Bcus o h ou o d d

clculios ivolvd, h siulios u

o high-oc cous h c

o hous. eubk uss sow o

gs o k sshos o h d

dic s i occus.

I kow xcly wh viul so

gs icd, shows syos d

covs, sys eubk, xliig h

h cou cods vy chg i

diss s.

>>>


16/24

In 2006, MIDAS modelers mapped the potential spread

o pandemic fu in the United States. Each dot changes

rom green to red as more people in that area get sick.

The top map shows what could happen i we didnt

do anything. The bottom map shows the eect o

giving people a less eective vaccine while a better

one is being developed. > Proceedings o the National Academy o Sciences

Watch this pandemic fu spread on the Computing Life

Web site.


Flu Forecasteubk d oh schs

odlig h 2009 H1n1 dic

fu siuld oubk scios i

couiis coss h Uid

Ss. th suls suggsd h

ly vcciio o school kids bsducd diss sd, whil

vcciig lds bc o

io l o. th siulios

lso idicd h ol isk o

sious colicios lik g

wo o idividuls wih

xisig hlh obls should b

giv ivil dicis o k

h s sigs o illss.

Whil h suls gd by

h siulios usul, eubk

ssss h hy o gu

o wh cully will h. H d

ohs o will sk di odls

h s qusios d, wh h

odls g, hyll hv o

codc i h dicios. EC

!create a timelineo what you did yesterday.

List all the people (even i

you dont know their names)

you came into contact with.

I you were contagious with

the seasonal fu, how many

o these people do you think

you would have inected? The

answer is surprisingly low.

Estimates suggest that youd

pass the virus to no more than

three people. But i more than

one other person catches it

rom you, the bug will con

tinue to spread.

http://publications.nigms.nih.gov/computinglie/simsickness.htmweb exclusives @


17/24

vius cully cuss is owdis. Lik hugy wol ck

h cls ou h locl d

oulio, h vius vully

svs isl. Icig oo y

ol ducs is ood

suly.

this wok is jus o xl

o how schs c dvlo

odls o sw qusios

bou oubks o dgu

o oh disss. Wih h

iclly bsd odl, cologispj rohi h Uivsiy o

Gogi i al xid 30 ys o

idiologicl d o thild, ho

so o dgu. H ld h vi

ol cos, lik w

us, c -ou osquio

fywys d i u chg dgu

icio s.

c o m p u t i n g l i f e | s i m s i c k n e s s

>the rise & fall of deadly dengue

This map rom 2007 shows areas inested with the

mosquito that carries the dengue virus (orange) and

areas with both the mosquito and dengue epidemic

activity (red). > Cs o Diss Cool d pvio

Dengue is common

in Haiti, and survi

vors o the massive

earthquake that

devastated the coun

trys capital in 2010

aced a greater risk

o inection due to

standing water andcontaminated sanita

tion systems.

By Alison Davis

If you live in the United States and

dont travel ABROAD, chances

are youll never come down with

DENGUE fever. Thats not the case

for people living in tropical and

subtropical climates, lie South

America, Africa and the Caribbean.

Bw 50 d 100 illio o hs

ol cch h osquio-sid

dgu vius vy y. mos o h

will bouc bck 2 wks o s

d x fuids. a sll cg,

howv, wo b so lucky. a

cocig dgu scod i,

so ol y dvlo oilly

l dgu hohgic v.

Sciiss suscd h h hu

iu sys igh b o bl o

kig h scod icio o

dgous, bu uil cly hy

w su how.

Usig cou siulios,

idiologiss h Johs Hokis

Bloobg School o public Hlh iBlio, myld, ld h h

icd sos ibodis ois

h should gh o dgu cully

hl h vius coy isl. mo cois

k h vius b do,

llowig i o sd s d ic

o ol.

Bu h schsDk

Cuigs d Dold Buk, who is

ow h Uivsiy o pisbugh i

psylvilso ld h h


18/24

integrating biology

>bacteria blast off

Identifying all the parts of a cell or organism wont necessarily tell you how

those parts wor together to mae the system run. To do this, scientists

have turned to a relatively new field called systems biology that combines

experimental data and computational models to diagram everything from

how cells move to how hearts beat. With the diagrams, the researchers can

tiner with different parts and begin to explore questions nearly impossible

to answer through traditional lab experiments.


Ten, nine, eight, seven, six, five, four,

three, two, one . . . BLAST OFF!

Whil his objc igh look lik

ock blsig hough sc, is lly

k bciu jig oud viul cll.

I ssListeria, y o bci

bs kow o cusig ood oisoig.

Couiol biologis Joh

albs d hicl biologis

G Odll h Uivsiy o

Wshigos C o Cll Dyics

i Fidy Hbo cd i o sudy how

h bciu ovs oud h clls

i ics, ulily kig you sick o

you soch.

By cobiig xil d

wih cou-bsd ochs,

albs d Odll hv cd viul

odls oListeria h show i ovig

hough i. this o col

icu y bl h schs o

idiy w wys o v ood-

bo illsss. AD

In this computer model, aListeria bacterium propels itsel through an inected

cell by stimulating the growth o cellular flaments (yellow and red) at thecells surace. > Joh albs, Sus rlski, G Odll

http://publications.nigms.nih.gov/computinglie/integratingbiology.htmweb exclusives @


19/24

Each spot on this globe represents a

city, and each color corresponds to a

community o easily connected cities.

> Luis a.n. al, rog Gui

This sphere represents all the known

chemical reactions in theE. coli

bacterium. > Luis a.n. al

c o m p u t i n g l i f e | i n t e g r a t i n g b i o l o g y

Lie us, CELLS rely on transporta

tion to do their daily activities. But

while we can choose to tae cars,

busses, bies and even Segways,

cells tae the pedestrian approach

They MOVE themselves.

a cll ovs by gbbig oo

sohig, lik h wll o blood

vssl, d h ullig isl owd.

this obiliy is ssil o

woud hlig. Wh you cu yousl,

you whi blood clls sd o h

woud lik dics.

Bu cllul ov c lso cus

hlh obls, lik wh cc clls

sd o oh s o h body.

Sciiss w o udsd how

clls ov so hy c dvlo w

>on the move

dugs h c v u o so cll ig biology och o sudyig cll

io logh. Bu lik os biologicl ov. Sh uss hicl

ocsss, cll ov hs b quios d cou sow o: sy o gu ou bcus i ivolvs ic ogh h vious coo

hudds o ois. h k clls oo log. AD

Cll biologis Cl W-So

h niol Isius o Hlh i

Bhsd, myld, ks syss

s

?

Did you know that

some cells orm ladders

so other cells can climb

up them?

This image, taken with a microscope

camera, shows the intricate network o

fbers that builds a cells structure. These

fbers are called microtubules (yyeellolloww) andactin flaments (blue). > Cl W-So

>connected worldsFor scientists, the INTERNET is

more than an information super

highway and AIRPORTS arent just

places where planes tae off and

land. They are examples of complex

NETWORkS that can help research

ers study even more complicated

ones in the body.

nwoks, whh socil o cllul,

sh ub o us. ech o is

sys d u o di ls

h coc hough io cs

o civiy clld hubs. Hubs could b

Wb gs likd o y oh sis o

jo ios h ou ssgs o

ddiiol ciis. Couicio occus

wihi h wok, lig i ogiz

isl d v chg ov i.

ay wok c sv s odl o

udsdig oh bcus ll hs

syss o by siil s o uls,

sys hysicis Luis al nohws

Uivsiy i evso, Illiois.

al odls h woks o h

I d i vl, bu h lso s

bolic woks h iic

hwys by which clls g h

gy dd o cy ou biologicl

ocsss sig h oducio o

ois o h bkdow o dugs. H

cs sil couiol odls h

show how h hs o hs colicd

woks coc d couic.

Kowig ll h dils bou h bodys

woks y hl sciiss l o

wi h o v ci disss, jus

lik i c coolls -ou ls o

void hudsos. AD


20/24


made possible by

Youve learned a lot about how computing power gives us new perspectives

on biology. At the center of it all is a component more advanced thanany silicon chip inside a computer processor. Its the human brain.

Biologists, engineers, physicists, computer scientists,

epidemiologists, geneticists and even writers and

artists have brought their brainpower to the

table to solve these old and new problems.

>time for computationBy Jilliene Mitchell

Going from Moms or Dads savory h dics how ois old d ch lgb cous, h sys h kw i ws

home cooing to the CAMPUS o oh biologicl olculs. i o visi h h hl oo, wh

By h i h gdud o high suds could wok wih uos. th ocafeterias mystery meat can beschool, Hiso hd sd his id o. Hiso ishd h clss wih

a big adjustment for any COLLEGEsch o sciiss old h his B-, which, cosidig how ough h clss

freshman. But for Ryan Harrison, a s d civd uous wds, ws, h sys l o lik a+.BIOMEDICAL engineering and icludig o iz i h 2005 Il I sudy lo, dis Hiso. Bu I

economics major at Johns Hopins Scic tl Sch h ios sill k i o do higs h I joy.

University in Baltimore, Maryland, it olds d os sigious high aog his hobbis: dicig o-

wasnt a big deal. school scic coiio. c ly, xiig wih ligh d

a gduio, Hiso soud o sud h oducios dWhil os o his high school idsud o Hokis d lyig his voi cou g.ook i sy hi ls y o ully joyh Gy lb. ev d h ugh disdvgd kidssioiis, Hiso s his dowiwih ull collg i Blio how o ly chss, Hokis, wh h wokd i hcous lod, h xliig h i ws lso goodchicl d bioolcul giigsill oud i o cic o hi.lb o osso J Gy. Hiso go

wok o ros. Wih so y iss, oh chc hough his high school,Do b o Hisos biggs chllgswhich os og h is

oold, hough. i collg ws dig i o

ll o his civiis d

dcidig wh h ulily

wd o do ossiolly. as

h wo i his oli diy (s

xcs o h x g), I hv

o qusios ow bou y

uu h v bo. Bu, I

guss hs ol o

gowig u.

suds wih schs.Jus bcus hHiso hd b wiig his owws wd-cou ogs sic h 4h gd.wiig schSo wh his high school biology ch g 17 dosioducd hi o Gy, vyhig ll io hs whizlc. H ws io couiol biology vyhig! Whd w idily hi i o! sys Hiso.h sd losig hWhil i h Gy lb, Hisobl i high-lvliovd h ros cou og

Harrison in high

school, when

many scientists

mistook him or a

college or graduate

student!

> Sh S

a


21/24

c o m p u t i n g l i f e | m a d e p o s s i b l e b y

> excerpts from an internshipRyan Harrison spent his first

SUMMER off from college in New

Yor City, where he did a 10-weeINTERNSHIP at Weill Medical

College of Cornell University.

Isd o wokig i cou

lb, h wokd i w lb, col

wih liv ogiss, chicls d i

dishs. H sudid how icul

oi cs h li cycl o h

si h cuss li.

Hiso wo bou his su

xic i his blog, Vd Foc:

Discovis i Li d pooics.

BL O G

NAME:

RyanHarrison

Thursday 8:37pm

Ive been in New York City or almost a month now.

Settling in well to my new lab environment and even

orgetting that Im in NYC occasionally. . . . Wish I

could work a little more independently, but I under

stand that I just dont have the proper laboratory

background/experience to handle my own indepen

dent project. I guess I was expecting a Gray lab type

arrangement where I work at my own pace at a

problem I selected and I am the only one respon

sible or the outcome (good or bad). . . . Whatever Idecide to do, I think it will combine computational

with wet lab work. Since I havent the slightest

idea how my lie is going to unold, I am just going

to do what I enjoy.

To fnd out what Harrison is doing now,

visit this story on the Couig Li Web site.

Drew Endy lies taing things APART What got you interested in science? Why do you want to do this?

and putting them bac together I cuious. I bohs wh I do I sd o hik bou why is b so

bies, cars, lawn mowers. He udsd how higs wok. hd o udsd biology. th coclusio

Iv co o is h h biologicl syssessentially does the same thing Youre trained as an engineer. How doesw d i u sy o udsd

when he tries to understand that inuence your approach to biology?I gu h i I w o hv biology h

I you sk gis wh hy w oBIOLOGY. A professor at Stanford I udsd, Id b b o buildigdo i hi h, hy w o k

University in Palo Alto, California, i ysl.sohig. my is is o b bl o

Endy assembles and PROGRAMS ouily, libly, quickly, sily d What makes the feld so hot right now?living machines. I ased him a few chly u ogh h bis d ics Svy ys go, hysiciss cquestions about his wor and why o biology o k w d usul higs. io biology d lly shook higs u.

he lies it. DB I susc h whs hig ow isYoure in a new feld called synthetich h gis coig io biology,biology. Whats the goal o this feld?d hy goig o shk higs u.

Is o k oui h giig

h ogig o livig ogiss.

>programming biology

>>>

http://publications.nigms.nih.gov/computinglie/madepossible.htmweb exclusives @


22/24


With the help o a Hollywood illustrator and others, Endy created a comic book called

Adventures in Synthetic Biology. He hopes to use it as a teaching tool. To read the

entire comic, visit this story online. > Dw edy

Describe your typical day.

I l lik I zy, hlig su

h. I ch couss o syhic

biology, d I suvis h sch i ylb. evy ow d h I g lil bi o

i o hik.

What have you thought about lately?

a w discovig biology s o

slow h u is ivig w biology?

I did so bck-o-h-vlo clculios

d his ub could b colly wog,

bu soi bw h y 2085 d

2105 w should b bl o squc ll h

Dna o h l i oh.

What do you like most about your job?th ol i sch so o h

cools, [os] isig [d] ics

ol you v goig o . I s jus

g xic.

What do you think makes or a

successul scientist?

th bs, os u-lovig, hy

sciiss Iv s h ol who

cogiz wh id is wokig d

bdo i o b id wihou lig

oo bd.

Do you think youll always be a scientist?

I doig wh I w o b doig, d i

I ws, I would chg i. I so oi

i h uu, Id h b isig hs

s i souh Fc, o oh

Fc, o whv hy is hss

i Fc, I su I would go do h.

O cous, Id hv o l Fch.

Last words?

pol xss g wod,

xci d los gicl lio

shi wih h livig wold. Bu I hik ov

h coig ys s h os

xc wll s siio i biology

wh i bcos uch sil d

si o gi livig syss. W do

cully kow how o do h igh ow,

bu h lssos buid i h lo d

wisdo o oh giig discilis.


23/24

Discrimination ProhibitedUd ovisios o licbl ublic lws

cd by Cogss sic 1964, o so

i h Uid Ss shll, o h gouds

o c, colo, iol oigi, hdic, o

g, b xcludd o iciio i, b

did h bs o, o b subjcd o

disciiio ud y og o civiy

(o, o h bsis o sx, wi h sc o y

ducio og o civiy) civig

Fdl cil ssisc. I ddiio,

excuiv Od 11141 ohibis discii

io o h bsis o g by cocos

d subcocos i h oc

o Fdl cocs, d excuiv Od

11246 ss h o dlly udd

coco y discii gis yloy o lic o loy

bcus o c, colo, ligio, sx, o

iol oigi. tho, h ogs o

h niol Isiu o Gl mdicl

Scics us b od i colic

wih hs lws d excuiv Ods.

Accessibility

this ublicio c b d vilbl

i os h o ccssibl o

ol wih disbiliis. to qus his

il i di o, coc h

nIGmS Oc o Couicios d

public Liiso 301-496-7301; sd

-il o [email protected]; o wi

o h oc h ollowig ddss:

45 C Div mSC 6200, Bhsd, mD

20892-6200. I you hv qusios o

cos bou his ublicio, you

c us h s coc ioio

o ch h dio, eily Clso.

Additional Copies and Web Links

to od ddiiol cois o Computing

Lie o oh nIGmS ublicios, go

o h://ublicios.igs.ih.gov/od

o us h coc ioio bov.

a udd Wb vsio h icluds

ddiiol liks, siulios d

oh ils is vilbl h://

ublicios.igs.ih.gov/couigli.
mailto:[email protected]://publications.nigms.nih.gov/ordermailto:[email protected]://publications.nigms.nih.gov/order


24/24

When I was in high school, I never thought therewas a field that combined all my interests.

Christina Mills, a scientist who uses modeling to study

infectious diseases

> thin you want to compute life?People with many different talents

can join in COMPUTING LIFE. If youre

interested, as yourself what aspects

of the research featured here you find

EXCITING. Do the projects blend many

of your academic interests? Are there

particular biological problems youd

lie to solve?Here are a few tips on how to get

started looing into COMPUTING LIFE

as a career.

nIH publicio no. 10-5861

Fbuy 2010

h://www.igs.ih.gov

> ask you scic ch o

guidc couslo bou

oouiis o wok wih

sch by collg

o oh isiuio.

> Sch h Wb o sciiss

wokig h cossods o biology

d couio.

> e-il sciiss you loclcollg o uivsiy o o

ioio.

> e scic i o g xi

c sig sch suls.
http:///reader/full/http://www.nigms.nih.govhttp:///reader/full/http://www.nigms.nih.gov

Documents

Computing Life