Download pdf - Computing Life

Transcript
  • 8/3/2019 Computing Life

    1/24

    computing life

    2 searching or genetic treasures

    7 the next top protein model

    10 movie mania

    12 sim sicknessU.S. Department OF 16 integrating biologyHeaLtH anD HUman SerVICeSniol Isius o Hlhniol Isiu o Gl mdicl Scics 18 made possible by

  • 8/3/2019 Computing Life

    2/24

    What is NIGMS? th niol Isiu o Gl mdiclScics (nIGmS) suos bsic sch o gs, ois d

    clls. I lso uds sudis o udl ocsss such s how

    clls couic, how ou bodis us gy d how w

    sod o dicis. th suls o his sch ics ou

    udsdig o li d ly h oudio o dvcs i h

    digosis, d vio o diss. th Isius

    sch iig ogs oduc h x gio o

    sciiss, d nIGmS hs ogs o ics h divsiy o h

    biodicl d bhviol sch wokoc. nIGmS suod

    h sch o os o h sciiss iod i his bookl.

    poducd by h Oc o Couicios d public Liiso

    niol Isiu o Gl mdicl Scics

    niol Isius o Hlh

    U.S. D o Hlh d Hu Svics

  • 8/3/2019 Computing Life

    3/24

    From text messaging riends to navigat

    ing city streets with GPS technology,

    were all living the computing lie. But

    as weve upgraded rom snail mail and

    compasses, so too have scientists.

    Computer advances now let re

    searchers quickly search through DNA

    sequences to nd gene variations that

    could lead to disease, simulate how fu

    might spread through your school and

    design three dimensional animations

    o molecules that rival any video game.

    By teaming computers and biology,

    scientists can answer new and old

    questions that could oer insights into

    the undamental processes that keep

    us alive and make us sick.

    This booklet introduces you tojust some o the ways that physicists,

    biologists and even artists are com

    puting lie. Each section ocuses on

    a dierent research problem, oers

    examples o current scientic projects

    and acquaints you with the people

    conducting the work. You can ollow

    the links or online extras and other

    opportunities to learn aboutand get

    involved inthis exciting new interdis

    ciplinary eld.

  • 8/3/2019 Computing Life

    4/24

    We share:

    70%of our genes withfruit flies and

    98%with chimpanzees and

    99.9%with each other.

    Imagine finding a treasure chest that contains all of the precious gems and

    metals ever mined, but you can only lift the lid far enough

    see the glint of gold and the sparle of diamonds.

    Thats how some biologists felt not too long ago.

    Advances in computer technology have opened the

    genetic treasure chest all the way, revealing thehuman genome and answering questions about

    diseases, drug treatments and even crimes.

    to

    searching for genetic treasures

    National Institute of General Medical Sciences

  • 8/3/2019 Computing Life

    5/24

    ?In 2005, the U.S. Food

    and Drug Administrationapproved a heart

    ailure drug specically

    targeted to Arican

    Americans. Why do

    you think some people

    raised ethical concerns?

    c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s

    MEDICINES that wor wonders

    for you can be ineffective or

    even harmful to others. Why?

    Age, weight, lifestyle and other

    medicines each play a role, but

    so do GENES.

    Sciiss us cous o d h

    scic gic viios h c h

    wy w sod o dugs. this ld osch is clld hcogics,

    d is gol is o di h y

    d dos o dici bs suid o

    ch idividul.

    Gicis Gy plz roch plo

    alo i Clioi lds o sch

    wokig i his ld. His gou hs

    lookd o iy dics h chg

    how ic ocss, o boliz, h

    dug wi.

    nly 2 illio aics, scilly

    hos who hv h diss o

    covig o jo sugy, k

    wi o v ddly blood clos.

    Bu wi is icky o scib. too

    uch cuss xcssiv bldig d oo

    lil could llow clos o o. Docos

    us cul, il-d-o och o

    d h igh ou o ch so.

    th Clioi schs ioid

    h g h ks zy h ic

    d o boliz wi. Schig

    wih cous, hy h oud sligh

    viios i h gs Dna h could

    ifuc how quickly h ils

    liid h dug o hi bodis.

    th sciiss w bl o us h

    ics gic ols o dic how

    h ic would ocss h dug. Siil

    sudis i hus could ulily hl

    docos o quickly d cisly

    scib h igh dos o wi.

    >side effects: genes and medicinesBy Susan Gaidos

  • 8/3/2019 Computing Life

    6/24

    >answers from africaBy Alisa Zapp Machalek

    Geneticist Sarah Tishoff splits

    her time between her LABORATORYat the University of Pennsylvania

    in Philadelphia and remote parts

    of AFRICA.

    Sh woks wih d collcs Dna o

    ol s divs s hu-ghs

    i h jugls o cl aic; gi-

    gowig s i souh aic;

    d odic, cl-isig wios

    i s aic.

    By dsigig cou odls o

    co h Dna o hs di

    oulios, sh hos o ck dow

    g viios h k so ol

    lss suscibl o li o o

    h wolds ldig cuss o dh.

    pol i ci aic ibs h

    hv b xosd o li o

    housds o ys c coc h

    diss d suviv i. ths ibs-

    ol dvlod gic dios

    h gv h ul sisc o

    li, which hy ssd o o hi

    National Institute of General Medical Sciences

    Tishko enlists Arican

    tribespeople in her project

    to understand how human

    genomes have responded

    to malaria. > Sarah Tishko

    dscds. though h gios,

    h sisc gs hv bco ocoo i h oulio.

    tishko clls his ocss h oois

    o ul slcio. Followig h il

    c ld sciiss o h gic bsis o

    i sisc d ossibly o uu

    his o li d oh disss

    So , h il hs k tishko o

    d idicig h i sisc o

    li is cusd by vi i h g

    o scic zy ickd G6pD.

    pol wih his gic vi k

    lss o h zy, which is dd osvl io chicl cios

    isid clls.

    U o o-qu o h ol livig

    i li-isd gios o aic hv

    his vi. evywh ls, w h

    5 c hv i.

    Udsdig how h G6pD gic

    vi ocs ol o li

    could vully hl d v

    h sd o h diss. th wok,

    tishko dds, is lso hlig o uvl

    h hisoy o od hus i aic

    d byod.

    http://publications.nigms.nih.gov/computinglie/searching.htmweb exclusives @

  • 8/3/2019 Computing Life

    7/24

    c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s

    >word gamesIf youre hooed on SUDOkU, you

    should try the letter game called

    GENETIC CODE. Heres an

    easy example: Put the following

    words in a sequence so that each

    one differs from the previous word

    by just one letter.

    FAN BIT BAT BAN FUN

    now igi wokig wih wods

    h coi housds o ls. ad,

    isd o shufig oud cogizbl

    wods, you hv log, sigly do

    sigs o as, ts, Gs d Cs h ls

    o h Dna cod.

    ths wh sciiss c wh hy

    y o ck d lyz chgs wihi

    ogiss gic il, ogo. th sk y soud ough,

    bu is sy wih h hl o cous.

    Sciiss yiclly s wih

    collcio o g squcs o

    di ol o ogiss. ths

    squcs could co o blood,

    bodily issus o v ci bos.

    to gu ou wh h viios

    occud, schs us cou

    iol ools o u h g squcs

    i choologicl od. I his wy,

    cous vlig h gic

    chgs, cobiios d quiks h

    c h ehs kbl biologicl

    divsiy. AZM

    >mutiny against antibioticsWhat can dirty DIAPERS teach us

    about MEDICINE? That infectious

    bugs are cagey.

    Wh sciiss dsigd h s

    ibioics o h 50 ys go,

    hy clld h dicl vls. th

    dugs cud coo icios cusd

    by bci i jus dys, slshig dh

    s d soig dicl c.

    Bu hough iy gic chgs,

    od i by ou ow ovus d

    isus o ibioics, su bugs ow

    ous ou oc su dugs. Ci

    bcil sis hv dvlod sisc o ibioics h oc killd h

    d ssd his biliy o hi dsc

    ds. tody, w o hs sis c

    v ovco vy xisig ibioic.

    Sciiss hough h y

    gios wihou xosu o i

    bioics, h bci would vully

    succub o h dugs oc gi.

    Uouly, h dos s o b

    h cs, sys Buc Lvi, oulio

    gicis eoy Uivsiy i

    al, Gogi.

    Lvi lyzdE. colibci hhlss kid i ou colos oud i

    70 diy dis o dy c c.

    O-qu o h bci i h usd

    dis w sis o soyci,

    ibioic ly scibd i h

    vious 30 ys.

    Lvis di discovy ws buoyd

    by sch ld by richd Lski,

    icobiologis michig S

    Uivsiy i es Lsig who id

    i Lvis lb.

    Sic 1988, Lski hs oiod

    fsks o soyci-sisE. coli.

    a 10 ys d 20,000 bcil

    gios, h foodd h bugs wih

    soyci o h s i. thy

    id uzd by h dug.

    Lvi d ohs hv u housds

    o cou siulios o co u

    wih sgis h slow h dvlo

    d sd o sisc.

    mae up

    your own3-letter series, and

    as your friendsto arrange them.

    !

    hesweris:BIt,Bat,Ban,Fan,FUn.

    !blow

    your nose.Theres a good chance

    that your tissue contains

    Staphylococcus aureus, or

    staph bacteria. Normally,

    this common bug doesntcause sickness, but it

    occasionally can be lie

    threatening. Computer

    models can help identiy

    strategies or keeping the

    spread o these inections

    at bay, especially in

    hospitals, where they can

    be the most dangerous.

    Bcus dug-sis bci will

    coiu o lgu us, Lvi joks h

    sch o ibioic sisc os

    h c c oouiy. H sys,

    W us coiully discov w wys

    o dl wih bcil icios. I ll

    suds h wh you gdu o

    school, h ly o higs o

    you o do! AZM

  • 8/3/2019 Computing Life

    8/24

    In 1995, a Louisiana nurse accused

    her ex-boyfriend, a doctor, of attempt

    ed MURDER. She claimed he gave her

    the AIDS virus by injecting her with

    blood from an HIV-positive patient.

    Lawyers from both sides recruited

    scientists to analyze viral DNA fromthe nurse.

    to ov is cs, h oscuio

    hd o covic h juy h h vius

    o h us d h vius o h

    i w clos livs. So, sci

    iss dusd o Dna gis!

    th ivsigiv , ld by

    couiol biologis Dvid Hillis

    h Uivsiy o txs ausi d

    viologis michl mzk Bylo

    Collg o mdici i Houso, txs,

    usd chiqu clld Dna gi

    ig o co h Dna squcs o

    h wo vil sls. th lso

    usd ub o di cou

    ogs o ic ogh how h vil

    squcs os likly chgd bw

    h llgd ijcio i 1994 d h il

    i 1998.

    th suls showd h ci

    gic squcs o h uss vius

    w idicl o hos o h is

    >csd: crime scene dna

    vius. th doco ws covicd o

    d scod-dg ud d

    scd o 50 ys i iso. Lwys

    ld his cs ll h wy u o h

    U.S. Su Cou, which l h

    covicio sd i 2002.

    th cs ks h s i h

    such gic lysis, clld hylo

    gics, ws usd s vidc i

    U.S. ciil cou. AZM

    By 2010, the Innocence Project,

    which oers legal assistance to

    people who claim theyve been

    wrongully accused, says that

    DNA fngerprinting had led to the

    reeing o more than 240 people.

    ?whodo youthin is guilty?Evidence rom a crime scene

    leads police to ve suspects.Compare DNA rom the perpetr

    tors blood let at the crime sce

    with the suspects DNA below.

    DNA sequence from perpetrators

    blood found at the crime scene:

    AGGCTGCCTACGCGGTTAGG

    DNA sequences from suspects:

    #1 AGGATGGCTACCCGGTTAGG

    #2 AGGCTGCCTCAGCGGATAGG

    #3 AGGCTGCCTACGCGGTTAGG

    #4 CGGCAGCCTACTCGGTTAGG

    #5 AGGCTGGATACGCGGCTAGG

    In the Louisiana murder trial,

    scientists compared more than

    2,000 letters o HIV rom about 3

    people. Computers did most o

    the work!

    Computational biologists

    helped prove that a doctor

    tried to murder his ex

    girlriend using a syringe

    lled with the AIDS virus.

    National Institute of General Medical Sciences

    eris:#3.

  • 8/3/2019 Computing Life

    9/24

    c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l

    Baker used his computer program

    to design a small protein not ound

    in nature. > Bi Kuhl, Gu Ds, Dvid Bk

    the next top protein model

    From building muscles to healing wounds, our bodies rely on proteins chainsof small molecules called amino acids that fold into unique shapes. Incorrectly

    folded proteins can cause disorders lie sicle cell disease or cystic fibrosis.

    Ever-improving computer power is maing it easier for researchers to

    predict how proteins fold and interact with other molecules, possibly leading

    to new treatments for protein-related disorders.

    >tailor-made proteinsBy Emily Carlson

    Scientists can easily determine h h-disiol sh

    a proteins amino acid sequence, o his d-u olcul.

    but they cant reliably PREDICT Bk usd h squc o

    build cul oi h wshow this sequence will fold into

    sbl d qui siil i suca three-dimensional STRUCTURE.

    u o h o h hd dw,So couiol biologis Dvid

    vlidig his och.Bk h Uivsiy o Wshigo

    Wih h biliy o whi u wi Sl ook di och. H

    ois, Bks sch y ksd by skchig oi sucu

    i ossibl o cusoiz ois hh obody hd v s. nx, h

    could b usd s dugs o iy biologicl

    lid o cou odlig og chis o ci disss.h dvlod clld ros o ll hi

    wh io cid squc would o

    http://publications.nigms.nih.gov/computinglie/topprotein.htmweb exclusives @

  • 8/3/2019 Computing Life

    10/24

    National Institute of General Medical Sciences

    >modeling@home

    In high school, Johnathon Tinsleyhad MIXED feelings about MATH and

    SCIENCE. Math was very challeng

    ing, he recalls. I enjoyed some

    parts of biology, but not physics.

    this Biish g hld

    sch o cus o disss lik

    aIDS d alzhis jus by

    lig schs us

    his cou wh h

    ws. You c g

    ivolvd, oo!tisly is o

    ch d clld

    disibud couig

    h lis o h ublic

    o hl dvc hlh

    d dici. though his

    och, schs hss

    h ow o sol cous o

    WARNING!Beore you download

    distributed computing

    sotware onto a public

    computer, like the ones at

    school or work, ask i its

    OK. I you dont, you could

    get into serious trouble!

    DC Distributed computing

    @home Most likely a distributed computing project

    Credit Points received or solving a calculation

    Work Unit Problem sent to a donated computer

    BOINC The Berkeley Open Inrastructure or NetworkComputing, or the ree sotware program usedby many DC projects

    PC Personal computer

    Server Computer that sends inormation to othercomputers in a network

    Wanna Volunteer?

    Folding@Home: http://olding.stanord.edu

    Rosetta@home: http://boinc.bakerlab.org/rosetta

    FightAIDS@Home: http://fghtaidsathome.scripps.edu

    I you visit the Web sites o distributedcomputing projects, youll likely ndcomputerese. Heres a brie glossary.

    While youre sleeping, your

    computer could be doingscientifc research.

    sw io qusios bou biology.th yicl cous i sciiss lb

    c o ll o h quid ub

    cuchig, bu wok o hudds d

    v housds o sol cous c.

    How It WorksYou joi disibud couig wok

    by dowlodig sow.

    Wh you cou is busy,

    i sds ssg o sv

    i h schs lb

    bsiclly syig, Hy, Ivilbl. C I hl? th

    sv ssigs chuk o

    lg clculio h i kows

    h ho cou c solv.

    th dod cou y

    sd svl dys wokig ou

    h obl. Wh is do, i hds

    i h sw. Jus lik chs, ol

    i h lb chck h sul, lso kigsu h o o hs d wih

    h ioio.

    You c volu you cou,

    whv h k o odl. th co

    u us b cocd o h I

    h y o cocio dos .

    Old cous c do h job, lhough

    hy glly g sil clculios.

    You c lso choos how uch cou

    oy you w o do.

    You do d o woy bou hcks

    bkig io you cou sys.Scuiy chcks ocig h i

    svs d h liid cbiliis o h

    quid sow k iciig i

    h ojcs cosidbly s h

    sug h I.

  • 8/3/2019 Computing Life

    11/24

    c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l

    Distributed Computingin Actionth scic w c do is uchd by

    wh w could do wih y oh vil

    bl ools, sys Vijy pd, sciis

    Sod Uivsiy i Clioi who

    sd disibud couig ojc

    clld Foldig@Ho.

    pd sudis h dyics o how

    ois old io hi uiqu shs.

    By sudyig how hy old, pd c

    s wh gos wog d how dugs

    igh ch isoldd ois.pois old uch s h you c

    old shi. th quicks o is do i jus

    5 illiohs o scod.

    pd sys h i would k vy

    s dsko cou o h

    housd ys o colly siul

    h ocss! Bu wih h hl o ly

    250,000 sol cous d o

    >project structureMost people enjoy a little friendly

    COMPETITION, and protein struc

    ture prediction researchers are no

    exception. Every other year, these

    experts go head-to-head to see

    whose computer MODELS mae

    the best predictions.

    th gol is o os cculy odl

    h shs o -slcd ois. th

    coss do kow h cul suc

    us o hs olculs, bu h judgs

    do. a viwig h is, h judgs

    ivi h os succssul odls o

    iiol ig wh hy lk

    bou h ochs hy usd. th

    i gou discusss how ll c do

    v b job i h uu.

    h 1 illio plySio

    3 gigcosols, pd c do h job i lss

    h wk.

    tisly dod bou 40 hous o

    ocssig i vy dy bw

    his wo cous. H likd kowig

    h his cous w doig so

    hig usul. tisly sys, thy

    o jus siig h lik sud

    los Biish slg o big idl.

    Fo his disibud couig oj

    cs, tisly ckd how uch wok

    his cou coibud cod oohs. I his cou hld dic

    oi sucu, h sw his o

    h ojcs Wb si d yb v

    ublishd i sciic joul. So

    ojcs lso would wd scil

    cics.

    Sig h ic ks big

    dic, sys pd. Wh you

    th sciiss do cully cll h

    v cos o v coiio.

    Is couiy-wid xi o

    iov h ccucy o oi dicio

    odlig so schs c discov

    w dugs o quickly d chly. EC

    do o y chiis, you do s dic lik bw wh you giv d

    how is usd. Fo us, you c cully

    s wh you cou hs dod d

    h suls.

    Svig scic, hough, is o h oly

    b. Disibuig couig lso os

    is icis civ socil wok.

    my ojcs hv ssg bods

    wh doos c os qusios bou

    h scic o do houghs bou li.

    Doos who lly w o b kd

    h o o will o coiiv s.I lik coig o g y ss

    bov y bs, sys tisly.

    Bu h lso hs joyd h socil

    sc. Fo o , h xlis, th

    i i is o d lk wih ids

    d do sohig good d wohwhil

    whil w i. EC

    Scientists oten are

    rewarded or makingbig breakthroughs, with

    the Nobel Prize being

    the ultimate honor.

    Read about the winner

    o a high school science

    competition on page 18.

    The computer model

    generated by David

    Bakers team or the

    2004 communitywide

    experiment (let) was

    strikingly similar to the

    proteins actual structure

    (right). > phili Bdly, Dvid Bk

  • 8/3/2019 Computing Life

    12/24

    National Institute of General Medical Sciences

    movie mania

    Just as sound and color revolutionized the film industry, computer technology

    has changed the way scientists view biology. Researchers today not only

    can tae snapshots of

    biology, they can animate

    entire biological processes,

    thrusting viewers deep into

    never-before-seen worlds.

    >scientists develop sixth senseThans to a HIGH-TECH tool, scientists

    just regained their SIXTH SENSE.

    Bo you hik o ci fick

    sig Buc Willis, hik bou lig

    you uscls fx s you ush box

    coss c o lugig owd s

    you c suddly sos. ths hysicl

    soss o xl cus wh

    y xs cosid h

    sixh y o ssoy

    xic.

    A scientist manipulates plastic

    models o two proteins while

    the computer tracks and

    displays their electrostatic

    properties, shown here as

    redand blue clouds. > ahu Olso

    So sciiss

    los his ss i h

    cou g. thy o

    log usd hysicl odls o biologi

    cl olculs, lik ois o Dna, o

    s how hy ogh. Isd, hy

    usd cou-gd odls.

    my sciiss sod wokig

    wih hysicl odls logh, sys

    ahu Olso, sucul olcul

    biologis. th u o sil c

    io chgs d h kid o udsd

    ig you g o icig wih yousuoudigs w los wh cou

    ghics ook ov.

    Olso d his h Scis

    rsch Isiu i L Joll, Clioi,

    hv dvlod ool h llows h

    o do boh: hysiclly

    iul odl o

    biologicl olcul

    whil wchig is

    chicl d biohysi

    cl ois chg

    o cou sc.

    Olso sys cobiig

    h wo xics

    will l schs och d

    udsd biologicl obls i

    w wys.

    th sciiss us scil is

    h g lsic o ls 3-D

    shs s sily s oh is

    oduc 2-D icus. as Olso d

    ohs hold d ic wih h odls,

    c cods clos-u sho o h

    odls i oio. a cou og

    h suioss ghics, lik h

    g o os o h gy

    bw odld olculs.Olso cobis h odl d

    cou ghics io o ig h

    llows hi o sudy ll h di cs

    o h biologicl olcul. Olso hos

    h o dy his ic could doubl s

    vido g h ls suds xlo

    d ly h olcul lvl. EC

    ! pic upa nearby object.Rotate it so you see all

    its sides. Does it eel

    heavy? What about cold?

    Smooth? How would you

    determine these qualities

    i you only saw the object

    on a computer screen?

  • 8/3/2019 Computing Life

    13/24

    c o m p u t i n g l i f e | m o v i e m a n i a

    >now playing on a computer near youBy David Bochner

    Superman is super strong, super

    fast and generally super fly. But in a

    COMIC boo, hes also super FLAT,leaving many of his superhero feats

    up to your imagination. But when

    the comic boo turns cinematic,

    Superman truly comes ALIVE.

    Sois sciiss oly g o

    s h coic book viw o biology:

    exil d givs schs jus

    sshos o wh biologicl ocss

    looks lik scic i. So, cou

    iol biologis Kvi Sbosu h

    Los alos niol Lbooy i nwmxico is bigig hos ocsss o li.

    Sbosu uss high-oc

    cous o c ovis o iy

    olcul chi s i vy

    livig ogis. this chi clld

    h iboso builds ois o h

    gic isucios codd i Dna.

    The ribosome plays itsel in this molecular

    movie, now appearing on the Computing Life

    Web site. > Kvi Sbosu

    Isd i udsdig h oigi

    o li, Sbosu sys h sudis h

    iboso bcus i y b h olds

    ic i h cll.

    Bu hs o o i h cuiosiy.

    Sbosu lso sys h bou hl

    o ll ibioics usd o bcil

    icios g h iboso, ig

    h b udsdig o his biologicchi could ld o su-sog dugs.

    to k his ovis, Sbosu

    ss wih xil d, lik h

    sucu o iboso i icul

    isc, d gs soybod o

    sos. Hudds o cocd cou

    ocssos o sucou h

    u h sshos io i ovi

    lld wih ioio sciiss could

    ohwis s o v igi.

    You c look sic sucus o

    h iboso, sys Sbosu, buh oly wy o wch i i oio is h

    sucou siulio.

    His hs cd o o h

    lgs biologicl siulios v,

    bigig w li o chcs i h

    old soy o oi syhsis.

    An artist s rendering o how chemicals change and move among cells in

    the brain. Watch the animation on the Computing Life Web site. > Ki Hg

    Amid a networ of BLOOD vessels

    and star-shaped support cells,

    neurons in the BRAIN signal each

    other. The mists of COLOR show the

    flow of important molecules, such as

    glucose, oxygen and nitric oxide.

    this ig is ssho o

    52-scod siulio cd by Ki

    Hg, iio is wokig wih h

    Lbooy o nuo Igig h

    Uivsiy o Clioi, Los agls. th

    iio, which oys how chicls

    chg d ov og clls i h bi,

    ook bou 300 hous o c. to u i

    ll ogh, Hg wokd closly wih

    nl pksh, uobiologis i h

    s lb. pksh iiilly skd o

    >the art of animationBy Karin Jegalian

    dwig o illus sch , bu

    h dico o h lb suggsd oduc

    ig iio isd.

    Hg, who sudid hooghy, vido

    d ghic dsig i collg d l

    d gdu dg i di s,

    dos o dw ovis -by-.

    Isd, sh builds viul sculus

    lld wih colo, ligh, xu d oio

    d h guids h viws y hough

    h scs.

    th lb us his iio, log

    wih dozs o ohs, o is Wb si d

    lso lys i i s-o-h- h

    duig sios o sciiss,

    suds d oh visios.

    Hg sys h ol is o k h

    sch o ccssibl o di

    udics. Sig iio, sh

    xlis, ks i si o cohd

    wh sch is syig.

    http://publications.nigms.nih.gov/computinglie/moviemania.htmweb exclusives @

  • 8/3/2019 Computing Life

    14/24

    National Institute of General Medical Sciences

    >preparing for a pandemic

    MIDAS,not to be conused with

    the king who turned

    everything to gold, standsor Models o Inectious

    Disease Agent Study.

    ?How would your simu

    lated lie be dierent

    rom your best riends?

    Just months after the first cases of Flu and You

    , to c h dic fu siulios,

    h mIDaS schs us cou

    odls o build viul ciis, couis

    d v cois. H,

    housds o d ol

    go o school, wok, sos

    d oh lcs. th

    schs bs h

    sids civiis o

    ioio bou cul

    ol lik you.

    Sh eubk,

    hysicis Vigii tch

    Uivsiy i Blcksbug d o h

    mIDaS , hs odld viul

    vsios o jo

    U.S. ooli s usig locl

    soio d csus d. I

    eubks ciis, h lly six (o

    w) dgs o sio bwy wo ol kig i sy o

    gs o sd.

    Viuss do c uch bou

    goghy, sys eubk. thy c

    bou socil woks d how ol

    co io coc wih ch oh.

    SWINE FLU appeared in April 2009

    millions of Americans had gotten

    sic and some had even died.

    By the end of the year, the

    virus had spread world

    wide, creating the first

    influenza PANDEMIC

    since 1968.

    as dug cois

    oducd vcci h

    vd illios o o

    cchig his fu, schs

    iciig i iiol ojc

    clld mIDaS w siulig diss

    sd. th siulios l h xlo

    how h dic igh uold, who

    ws o likly o g sick d which

    ivios igh oc h os

    ol. th suls hld io ublicolicy dcisios.

    sim sicness

    Scientists are creating their own virtual worlds where people live and wor

    and get sic. Here, researchers can mimic viruses and predict the spread of

    contagious diseases through a community. Successful simulations can help us

    better prepare for real-life outbreas.

  • 8/3/2019 Computing Life

    15/24

    c o m p u t i n g l i f e | s i m s i c k n e s s

    y sch wod io Googl d

    Meet the Simulators

    Stephen Eubank started out

    studying highenergy physics

    but then got into modeling the

    dynamics o nonlinear systems,

    which are systems that cant be

    solved by adding up all o the

    parts. He has developed computa

    tional models to study natural

    languages, trafc patterns and

    fnancial markets. He plans to use

    the inectious disease models to

    study how behaviors, like smoking,

    spread through society.

    Christina Mills has a Sc.D. (like a

    Ph.D.) and an M.D. For her, model

    ing inectious diseases is a dream

    job because it combines her

    interests in math, biology and

    human health. While most o hercolleagues with double degrees

    practice benchtobedside

    research in which they translate

    lab fndings into patient care,

    Mills says shell stick with the

    computerstoclinics approach.

    ?

    What questions

    would you want

    to ask the models?

    siul 180-dy oubk i

    Virtual Virusesaoh ky o sudyig h sd

    o icio wih cous ivolvs

    dvloig viul vsio o h g.

    to odl is sd s lisiclly s

    ossibl, h schs ck dow

    vyhig kow bou h icious

    g. eubk, who hs sudid lgu,

    sllox d hx, hs ghd

    ioio o how ch g sds

    bw ol, how cogious i is

    d how log i ks o icd

    so o show syos.Wh hy do kow h cul

    chcisics o icious diss,

    h mIDaS schs us hlh

    os d sciic d collcd

    duig li oubks o si wh

    uu o igh b lik.

    Duig gdu school, Chisi

    mills odld dic fu bo w

    hd v hd o swi fu (lso clld

    H1n1). Sh did lo o h sch

    i h liby, scouig h shlvs o

    sciic icls h discussd h1918 Sish fu dic h

    killd bw 20 d 40 illio

    ol woldwid.

    I ws vy old-shiod, sys

    mills, who ws sudyig iiol

    hlh Hvd mdicl School i

    Boso, msschuss. I could jus

    g h cssy ioio. th

    hu vully ld h o h 1918

    sissio s.

    Asking QuestionsWih ll h odlig ics i lc, h

    mIDaS schs ivi olicyks

    o sk qusios h c b swd

    usig h odls. Qusios g o

    What happens i we dont do anything?

    o How many people could be protected

    i we intervene?

    th schs c di

    siulios h chg h vibls,

    lik h cogiousss o h vius o h

    ub o ol kig sow dys

    eubks o ol who voluily

    hg ou ho o void icio.

    Whs so g bou h cou

    siulios is h you c y ou

    di siuios h you c

    c i l sociis, sys eubk.

    Wih o h 250 ossibl cobi

    ios o siul, eubk sys h

    lis o sisicis o hl hidi which gs will

    oduc h os ioiv suls.

    Is sy o co u wih qusios,

    sys mills. th hd is guig

    ou which os w should d

    could sw.

    Bcus o h ou o d d

    clculios ivolvd, h siulios u

    o high-oc cous h c

    o hous. eubk uss sow o

    gs o k sshos o h d

    dic s i occus.

    I kow xcly wh viul so

    gs icd, shows syos d

    covs, sys eubk, xliig h

    h cou cods vy chg i

    diss s.

    >>>

  • 8/3/2019 Computing Life

    16/24

    In 2006, MIDAS modelers mapped the potential spread

    o pandemic fu in the United States. Each dot changes

    rom green to red as more people in that area get sick.

    The top map shows what could happen i we didnt

    do anything. The bottom map shows the eect o

    giving people a less eective vaccine while a better

    one is being developed. > Proceedings o the National Academy o Sciences

    Watch this pandemic fu spread on the Computing Life

    Web site.

    National Institute of General Medical Sciences

    Flu Forecasteubk d oh schs

    odlig h 2009 H1n1 dic

    fu siuld oubk scios i

    couiis coss h Uid

    Ss. th suls suggsd h

    ly vcciio o school kids bsducd diss sd, whil

    vcciig lds bc o

    io l o. th siulios

    lso idicd h ol isk o

    sious colicios lik g

    wo o idividuls wih

    xisig hlh obls should b

    giv ivil dicis o k

    h s sigs o illss.

    Whil h suls gd by

    h siulios usul, eubk

    ssss h hy o gu

    o wh cully will h. H d

    ohs o will sk di odls

    h s qusios d, wh h

    odls g, hyll hv o

    codc i h dicios. EC

    !create a timelineo what you did yesterday.

    List all the people (even i

    you dont know their names)

    you came into contact with.

    I you were contagious with

    the seasonal fu, how many

    o these people do you think

    you would have inected? The

    answer is surprisingly low.

    Estimates suggest that youd

    pass the virus to no more than

    three people. But i more than

    one other person catches it

    rom you, the bug will con

    tinue to spread.

    http://publications.nigms.nih.gov/computinglie/simsickness.htmweb exclusives @

  • 8/3/2019 Computing Life

    17/24

    vius cully cuss is owdis. Lik hugy wol ck

    h cls ou h locl d

    oulio, h vius vully

    svs isl. Icig oo y

    ol ducs is ood

    suly.

    this wok is jus o xl

    o how schs c dvlo

    odls o sw qusios

    bou oubks o dgu

    o oh disss. Wih h

    iclly bsd odl, cologispj rohi h Uivsiy o

    Gogi i al xid 30 ys o

    idiologicl d o thild, ho

    so o dgu. H ld h vi

    ol cos, lik w

    us, c -ou osquio

    fywys d i u chg dgu

    icio s.

    c o m p u t i n g l i f e | s i m s i c k n e s s

    >the rise & fall of deadly dengue

    This map rom 2007 shows areas inested with the

    mosquito that carries the dengue virus (orange) and

    areas with both the mosquito and dengue epidemic

    activity (red). > Cs o Diss Cool d pvio

    Dengue is common

    in Haiti, and survi

    vors o the massive

    earthquake that

    devastated the coun

    trys capital in 2010

    aced a greater risk

    o inection due to

    standing water andcontaminated sanita

    tion systems.

    By Alison Davis

    If you live in the United States and

    dont travel ABROAD, chances

    are youll never come down with

    DENGUE fever. Thats not the case

    for people living in tropical and

    subtropical climates, lie South

    America, Africa and the Caribbean.

    Bw 50 d 100 illio o hs

    ol cch h osquio-sid

    dgu vius vy y. mos o h

    will bouc bck 2 wks o s

    d x fuids. a sll cg,

    howv, wo b so lucky. a

    cocig dgu scod i,

    so ol y dvlo oilly

    l dgu hohgic v.

    Sciiss suscd h h hu

    iu sys igh b o bl o

    kig h scod icio o

    dgous, bu uil cly hy

    w su how.

    Usig cou siulios,

    idiologiss h Johs Hokis

    Bloobg School o public Hlh iBlio, myld, ld h h

    icd sos ibodis ois

    h should gh o dgu cully

    hl h vius coy isl. mo cois

    k h vius b do,

    llowig i o sd s d ic

    o ol.

    Bu h schsDk

    Cuigs d Dold Buk, who is

    ow h Uivsiy o pisbugh i

    psylvilso ld h h

  • 8/3/2019 Computing Life

    18/24

    integrating biology

    >bacteria blast off

    Identifying all the parts of a cell or organism wont necessarily tell you how

    those parts wor together to mae the system run. To do this, scientists

    have turned to a relatively new field called systems biology that combines

    experimental data and computational models to diagram everything from

    how cells move to how hearts beat. With the diagrams, the researchers can

    tiner with different parts and begin to explore questions nearly impossible

    to answer through traditional lab experiments.

    National Institute of General Medical Sciences

    Ten, nine, eight, seven, six, five, four,

    three, two, one . . . BLAST OFF!

    Whil his objc igh look lik

    ock blsig hough sc, is lly

    k bciu jig oud viul cll.

    I ssListeria, y o bci

    bs kow o cusig ood oisoig.

    Couiol biologis Joh

    albs d hicl biologis

    G Odll h Uivsiy o

    Wshigos C o Cll Dyics

    i Fidy Hbo cd i o sudy how

    h bciu ovs oud h clls

    i ics, ulily kig you sick o

    you soch.

    By cobiig xil d

    wih cou-bsd ochs,

    albs d Odll hv cd viul

    odls oListeria h show i ovig

    hough i. this o col

    icu y bl h schs o

    idiy w wys o v ood-

    bo illsss. AD

    In this computer model, aListeria bacterium propels itsel through an inected

    cell by stimulating the growth o cellular flaments (yellow and red) at thecells surace. > Joh albs, Sus rlski, G Odll

    http://publications.nigms.nih.gov/computinglie/integratingbiology.htmweb exclusives @

  • 8/3/2019 Computing Life

    19/24

    Each spot on this globe represents a

    city, and each color corresponds to a

    community o easily connected cities.

    > Luis a.n. al, rog Gui

    This sphere represents all the known

    chemical reactions in theE. coli

    bacterium. > Luis a.n. al

    c o m p u t i n g l i f e | i n t e g r a t i n g b i o l o g y

    Lie us, CELLS rely on transporta

    tion to do their daily activities. But

    while we can choose to tae cars,

    busses, bies and even Segways,

    cells tae the pedestrian approach

    They MOVE themselves.

    a cll ovs by gbbig oo

    sohig, lik h wll o blood

    vssl, d h ullig isl owd.

    this obiliy is ssil o

    woud hlig. Wh you cu yousl,

    you whi blood clls sd o h

    woud lik dics.

    Bu cllul ov c lso cus

    hlh obls, lik wh cc clls

    sd o oh s o h body.

    Sciiss w o udsd how

    clls ov so hy c dvlo w

    >on the move

    dugs h c v u o so cll ig biology och o sudyig cll

    io logh. Bu lik os biologicl ov. Sh uss hicl

    ocsss, cll ov hs b quios d cou sow o: sy o gu ou bcus i ivolvs ic ogh h vious coo

    hudds o ois. h k clls oo log. AD

    Cll biologis Cl W-So

    h niol Isius o Hlh i

    Bhsd, myld, ks syss

    s

    ?

    Did you know that

    some cells orm ladders

    so other cells can climb

    up them?

    This image, taken with a microscope

    camera, shows the intricate network o

    fbers that builds a cells structure. These

    fbers are called microtubules (yyeellolloww) andactin flaments (blue). > Cl W-So

    >connected worldsFor scientists, the INTERNET is

    more than an information super

    highway and AIRPORTS arent just

    places where planes tae off and

    land. They are examples of complex

    NETWORkS that can help research

    ers study even more complicated

    ones in the body.

    nwoks, whh socil o cllul,

    sh ub o us. ech o is

    sys d u o di ls

    h coc hough io cs

    o civiy clld hubs. Hubs could b

    Wb gs likd o y oh sis o

    jo ios h ou ssgs o

    ddiiol ciis. Couicio occus

    wihi h wok, lig i ogiz

    isl d v chg ov i.

    ay wok c sv s odl o

    udsdig oh bcus ll hs

    syss o by siil s o uls,

    sys hysicis Luis al nohws

    Uivsiy i evso, Illiois.

    al odls h woks o h

    I d i vl, bu h lso s

    bolic woks h iic

    hwys by which clls g h

    gy dd o cy ou biologicl

    ocsss sig h oducio o

    ois o h bkdow o dugs. H

    cs sil couiol odls h

    show how h hs o hs colicd

    woks coc d couic.

    Kowig ll h dils bou h bodys

    woks y hl sciiss l o

    wi h o v ci disss, jus

    lik i c coolls -ou ls o

    void hudsos. AD

  • 8/3/2019 Computing Life

    20/24

    National Institute of General Medical Sciences

    made possible by

    Youve learned a lot about how computing power gives us new perspectives

    on biology. At the center of it all is a component more advanced thanany silicon chip inside a computer processor. Its the human brain.

    Biologists, engineers, physicists, computer scientists,

    epidemiologists, geneticists and even writers and

    artists have brought their brainpower to the

    table to solve these old and new problems.

    >time for computationBy Jilliene Mitchell

    Going from Moms or Dads savory h dics how ois old d ch lgb cous, h sys h kw i ws

    home cooing to the CAMPUS o oh biologicl olculs. i o visi h h hl oo, wh

    By h i h gdud o high suds could wok wih uos. th ocafeterias mystery meat can beschool, Hiso hd sd his id o. Hiso ishd h clss wih

    a big adjustment for any COLLEGEsch o sciiss old h his B-, which, cosidig how ough h clss

    freshman. But for Ryan Harrison, a s d civd uous wds, ws, h sys l o lik a+.BIOMEDICAL engineering and icludig o iz i h 2005 Il I sudy lo, dis Hiso. Bu I

    economics major at Johns Hopins Scic tl Sch h ios sill k i o do higs h I joy.

    University in Baltimore, Maryland, it olds d os sigious high aog his hobbis: dicig o-

    wasnt a big deal. school scic coiio. c ly, xiig wih ligh d

    a gduio, Hiso soud o sud h oducios dWhil os o his high school idsud o Hokis d lyig his voi cou g.ook i sy hi ls y o ully joyh Gy lb. ev d h ugh disdvgd kidssioiis, Hiso s his dowiwih ull collg i Blio how o ly chss, Hokis, wh h wokd i hcous lod, h xliig h i ws lso goodchicl d bioolcul giigsill oud i o cic o hi.lb o osso J Gy. Hiso go

    wok o ros. Wih so y iss, oh chc hough his high school,Do b o Hisos biggs chllgswhich os og h is

    oold, hough. i collg ws dig i o

    ll o his civiis d

    dcidig wh h ulily

    wd o do ossiolly. as

    h wo i his oli diy (s

    xcs o h x g), I hv

    o qusios ow bou y

    uu h v bo. Bu, I

    guss hs ol o

    gowig u.

    suds wih schs.Jus bcus hHiso hd b wiig his owws wd-cou ogs sic h 4h gd.wiig schSo wh his high school biology ch g 17 dosioducd hi o Gy, vyhig ll io hs whizlc. H ws io couiol biology vyhig! Whd w idily hi i o! sys Hiso.h sd losig hWhil i h Gy lb, Hisobl i high-lvliovd h ros cou og

    Harrison in high

    school, when

    many scientists

    mistook him or a

    college or graduate

    student!

    > Sh S

    a

  • 8/3/2019 Computing Life

    21/24

    c o m p u t i n g l i f e | m a d e p o s s i b l e b y

    > excerpts from an internshipRyan Harrison spent his first

    SUMMER off from college in New

    Yor City, where he did a 10-weeINTERNSHIP at Weill Medical

    College of Cornell University.

    Isd o wokig i cou

    lb, h wokd i w lb, col

    wih liv ogiss, chicls d i

    dishs. H sudid how icul

    oi cs h li cycl o h

    si h cuss li.

    Hiso wo bou his su

    xic i his blog, Vd Foc:

    Discovis i Li d pooics.

    BL O G

    NAME:

    RyanHarrison

    Thursday 8:37pm

    Ive been in New York City or almost a month now.

    Settling in well to my new lab environment and even

    orgetting that Im in NYC occasionally. . . . Wish I

    could work a little more independently, but I under

    stand that I just dont have the proper laboratory

    background/experience to handle my own indepen

    dent project. I guess I was expecting a Gray lab type

    arrangement where I work at my own pace at a

    problem I selected and I am the only one respon

    sible or the outcome (good or bad). . . . Whatever Idecide to do, I think it will combine computational

    with wet lab work. Since I havent the slightest

    idea how my lie is going to unold, I am just going

    to do what I enjoy.

    To fnd out what Harrison is doing now,

    visit this story on the Couig Li Web site.

    Drew Endy lies taing things APART What got you interested in science? Why do you want to do this?

    and putting them bac together I cuious. I bohs wh I do I sd o hik bou why is b so

    bies, cars, lawn mowers. He udsd how higs wok. hd o udsd biology. th coclusio

    Iv co o is h h biologicl syssessentially does the same thing Youre trained as an engineer. How doesw d i u sy o udsd

    when he tries to understand that inuence your approach to biology?I gu h i I w o hv biology h

    I you sk gis wh hy w oBIOLOGY. A professor at Stanford I udsd, Id b b o buildigdo i hi h, hy w o k

    University in Palo Alto, California, i ysl.sohig. my is is o b bl o

    Endy assembles and PROGRAMS ouily, libly, quickly, sily d What makes the feld so hot right now?living machines. I ased him a few chly u ogh h bis d ics Svy ys go, hysiciss cquestions about his wor and why o biology o k w d usul higs. io biology d lly shook higs u.

    he lies it. DB I susc h whs hig ow isYoure in a new feld called synthetich h gis coig io biology,biology. Whats the goal o this feld?d hy goig o shk higs u.

    Is o k oui h giig

    h ogig o livig ogiss.

    >programming biology

    >>>

    http://publications.nigms.nih.gov/computinglie/madepossible.htmweb exclusives @

  • 8/3/2019 Computing Life

    22/24

    National Institute of General Medical Sciences

    With the help o a Hollywood illustrator and others, Endy created a comic book called

    Adventures in Synthetic Biology. He hopes to use it as a teaching tool. To read the

    entire comic, visit this story online. > Dw edy

    Describe your typical day.

    I l lik I zy, hlig su

    h. I ch couss o syhic

    biology, d I suvis h sch i ylb. evy ow d h I g lil bi o

    i o hik.

    What have you thought about lately?

    a w discovig biology s o

    slow h u is ivig w biology?

    I did so bck-o-h-vlo clculios

    d his ub could b colly wog,

    bu soi bw h y 2085 d

    2105 w should b bl o squc ll h

    Dna o h l i oh.

    What do you like most about your job?th ol i sch so o h

    cools, [os] isig [d] ics

    ol you v goig o . I s jus

    g xic.

    What do you think makes or a

    successul scientist?

    th bs, os u-lovig, hy

    sciiss Iv s h ol who

    cogiz wh id is wokig d

    bdo i o b id wihou lig

    oo bd.

    Do you think youll always be a scientist?

    I doig wh I w o b doig, d i

    I ws, I would chg i. I so oi

    i h uu, Id h b isig hs

    s i souh Fc, o oh

    Fc, o whv hy is hss

    i Fc, I su I would go do h.

    O cous, Id hv o l Fch.

    Last words?

    pol xss g wod,

    xci d los gicl lio

    shi wih h livig wold. Bu I hik ov

    h coig ys s h os

    xc wll s siio i biology

    wh i bcos uch sil d

    si o gi livig syss. W do

    cully kow how o do h igh ow,

    bu h lssos buid i h lo d

    wisdo o oh giig discilis.

  • 8/3/2019 Computing Life

    23/24

    Discrimination ProhibitedUd ovisios o licbl ublic lws

    cd by Cogss sic 1964, o so

    i h Uid Ss shll, o h gouds

    o c, colo, iol oigi, hdic, o

    g, b xcludd o iciio i, b

    did h bs o, o b subjcd o

    disciiio ud y og o civiy

    (o, o h bsis o sx, wi h sc o y

    ducio og o civiy) civig

    Fdl cil ssisc. I ddiio,

    excuiv Od 11141 ohibis discii

    io o h bsis o g by cocos

    d subcocos i h oc

    o Fdl cocs, d excuiv Od

    11246 ss h o dlly udd

    coco y discii gis yloy o lic o loy

    bcus o c, colo, ligio, sx, o

    iol oigi. tho, h ogs o

    h niol Isiu o Gl mdicl

    Scics us b od i colic

    wih hs lws d excuiv Ods.

    Accessibility

    this ublicio c b d vilbl

    i os h o ccssibl o

    ol wih disbiliis. to qus his

    il i di o, coc h

    nIGmS Oc o Couicios d

    public Liiso 301-496-7301; sd

    -il o [email protected]; o wi

    o h oc h ollowig ddss:

    45 C Div mSC 6200, Bhsd, mD

    20892-6200. I you hv qusios o

    cos bou his ublicio, you

    c us h s coc ioio

    o ch h dio, eily Clso.

    Additional Copies and Web Links

    to od ddiiol cois o Computing

    Lie o oh nIGmS ublicios, go

    o h://ublicios.igs.ih.gov/od

    o us h coc ioio bov.

    a udd Wb vsio h icluds

    ddiiol liks, siulios d

    oh ils is vilbl h://

    ublicios.igs.ih.gov/couigli.

    mailto:[email protected]://publications.nigms.nih.gov/ordermailto:[email protected]://publications.nigms.nih.gov/order
  • 8/3/2019 Computing Life

    24/24

    When I was in high school, I never thought therewas a field that combined all my interests.

    Christina Mills, a scientist who uses modeling to study

    infectious diseases

    > thin you want to compute life?People with many different talents

    can join in COMPUTING LIFE. If youre

    interested, as yourself what aspects

    of the research featured here you find

    EXCITING. Do the projects blend many

    of your academic interests? Are there

    particular biological problems youd

    lie to solve?Here are a few tips on how to get

    started looing into COMPUTING LIFE

    as a career.

    nIH publicio no. 10-5861

    Fbuy 2010

    h://www.igs.ih.gov

    > ask you scic ch o

    guidc couslo bou

    oouiis o wok wih

    sch by collg

    o oh isiuio.

    > Sch h Wb o sciiss

    wokig h cossods o biology

    d couio.

    > e-il sciiss you loclcollg o uivsiy o o

    ioio.

    > e scic i o g xi

    c sig sch suls.

    http:///reader/full/http://www.nigms.nih.govhttp:///reader/full/http://www.nigms.nih.gov

Recommended