8/3/2019 Computing Life
1/24
computing life
2 searching or genetic treasures
7 the next top protein model
10 movie mania
12 sim sicknessU.S. Department OF 16 integrating biologyHeaLtH anD HUman SerVICeSniol Isius o Hlhniol Isiu o Gl mdicl Scics 18 made possible by
8/3/2019 Computing Life
2/24
What is NIGMS? th niol Isiu o Gl mdiclScics (nIGmS) suos bsic sch o gs, ois d
clls. I lso uds sudis o udl ocsss such s how
clls couic, how ou bodis us gy d how w
sod o dicis. th suls o his sch ics ou
udsdig o li d ly h oudio o dvcs i h
digosis, d vio o diss. th Isius
sch iig ogs oduc h x gio o
sciiss, d nIGmS hs ogs o ics h divsiy o h
biodicl d bhviol sch wokoc. nIGmS suod
h sch o os o h sciiss iod i his bookl.
poducd by h Oc o Couicios d public Liiso
niol Isiu o Gl mdicl Scics
niol Isius o Hlh
U.S. D o Hlh d Hu Svics
8/3/2019 Computing Life
3/24
From text messaging riends to navigat
ing city streets with GPS technology,
were all living the computing lie. But
as weve upgraded rom snail mail and
compasses, so too have scientists.
Computer advances now let re
searchers quickly search through DNA
sequences to nd gene variations that
could lead to disease, simulate how fu
might spread through your school and
design three dimensional animations
o molecules that rival any video game.
By teaming computers and biology,
scientists can answer new and old
questions that could oer insights into
the undamental processes that keep
us alive and make us sick.
This booklet introduces you tojust some o the ways that physicists,
biologists and even artists are com
puting lie. Each section ocuses on
a dierent research problem, oers
examples o current scientic projects
and acquaints you with the people
conducting the work. You can ollow
the links or online extras and other
opportunities to learn aboutand get
involved inthis exciting new interdis
ciplinary eld.
8/3/2019 Computing Life
4/24
We share:
70%of our genes withfruit flies and
98%with chimpanzees and
99.9%with each other.
Imagine finding a treasure chest that contains all of the precious gems and
metals ever mined, but you can only lift the lid far enough
see the glint of gold and the sparle of diamonds.
Thats how some biologists felt not too long ago.
Advances in computer technology have opened the
genetic treasure chest all the way, revealing thehuman genome and answering questions about
diseases, drug treatments and even crimes.
to
searching for genetic treasures
National Institute of General Medical Sciences
8/3/2019 Computing Life
5/24
?In 2005, the U.S. Food
and Drug Administrationapproved a heart
ailure drug specically
targeted to Arican
Americans. Why do
you think some people
raised ethical concerns?
c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s
MEDICINES that wor wonders
for you can be ineffective or
even harmful to others. Why?
Age, weight, lifestyle and other
medicines each play a role, but
so do GENES.
Sciiss us cous o d h
scic gic viios h c h
wy w sod o dugs. this ld osch is clld hcogics,
d is gol is o di h y
d dos o dici bs suid o
ch idividul.
Gicis Gy plz roch plo
alo i Clioi lds o sch
wokig i his ld. His gou hs
lookd o iy dics h chg
how ic ocss, o boliz, h
dug wi.
nly 2 illio aics, scilly
hos who hv h diss o
covig o jo sugy, k
wi o v ddly blood clos.
Bu wi is icky o scib. too
uch cuss xcssiv bldig d oo
lil could llow clos o o. Docos
us cul, il-d-o och o
d h igh ou o ch so.
th Clioi schs ioid
h g h ks zy h ic
d o boliz wi. Schig
wih cous, hy h oud sligh
viios i h gs Dna h could
ifuc how quickly h ils
liid h dug o hi bodis.
th sciiss w bl o us h
ics gic ols o dic how
h ic would ocss h dug. Siil
sudis i hus could ulily hl
docos o quickly d cisly
scib h igh dos o wi.
>side effects: genes and medicinesBy Susan Gaidos
8/3/2019 Computing Life
6/24
>answers from africaBy Alisa Zapp Machalek
Geneticist Sarah Tishoff splits
her time between her LABORATORYat the University of Pennsylvania
in Philadelphia and remote parts
of AFRICA.
Sh woks wih d collcs Dna o
ol s divs s hu-ghs
i h jugls o cl aic; gi-
gowig s i souh aic;
d odic, cl-isig wios
i s aic.
By dsigig cou odls o
co h Dna o hs di
oulios, sh hos o ck dow
g viios h k so ol
lss suscibl o li o o
h wolds ldig cuss o dh.
pol i ci aic ibs h
hv b xosd o li o
housds o ys c coc h
diss d suviv i. ths ibs-
ol dvlod gic dios
h gv h ul sisc o
li, which hy ssd o o hi
National Institute of General Medical Sciences
Tishko enlists Arican
tribespeople in her project
to understand how human
genomes have responded
to malaria. > Sarah Tishko
dscds. though h gios,
h sisc gs hv bco ocoo i h oulio.
tishko clls his ocss h oois
o ul slcio. Followig h il
c ld sciiss o h gic bsis o
i sisc d ossibly o uu
his o li d oh disss
So , h il hs k tishko o
d idicig h i sisc o
li is cusd by vi i h g
o scic zy ickd G6pD.
pol wih his gic vi k
lss o h zy, which is dd osvl io chicl cios
isid clls.
U o o-qu o h ol livig
i li-isd gios o aic hv
his vi. evywh ls, w h
5 c hv i.
Udsdig how h G6pD gic
vi ocs ol o li
could vully hl d v
h sd o h diss. th wok,
tishko dds, is lso hlig o uvl
h hisoy o od hus i aic
d byod.
http://publications.nigms.nih.gov/computinglie/searching.htmweb exclusives @
8/3/2019 Computing Life
7/24
c o m p u t i n g l i f e | s e a r c h i n g f o r g e n e t i c t r e a s u r e s
>word gamesIf youre hooed on SUDOkU, you
should try the letter game called
GENETIC CODE. Heres an
easy example: Put the following
words in a sequence so that each
one differs from the previous word
by just one letter.
FAN BIT BAT BAN FUN
now igi wokig wih wods
h coi housds o ls. ad,
isd o shufig oud cogizbl
wods, you hv log, sigly do
sigs o as, ts, Gs d Cs h ls
o h Dna cod.
ths wh sciiss c wh hy
y o ck d lyz chgs wihi
ogiss gic il, ogo. th sk y soud ough,
bu is sy wih h hl o cous.
Sciiss yiclly s wih
collcio o g squcs o
di ol o ogiss. ths
squcs could co o blood,
bodily issus o v ci bos.
to gu ou wh h viios
occud, schs us cou
iol ools o u h g squcs
i choologicl od. I his wy,
cous vlig h gic
chgs, cobiios d quiks h
c h ehs kbl biologicl
divsiy. AZM
>mutiny against antibioticsWhat can dirty DIAPERS teach us
about MEDICINE? That infectious
bugs are cagey.
Wh sciiss dsigd h s
ibioics o h 50 ys go,
hy clld h dicl vls. th
dugs cud coo icios cusd
by bci i jus dys, slshig dh
s d soig dicl c.
Bu hough iy gic chgs,
od i by ou ow ovus d
isus o ibioics, su bugs ow
ous ou oc su dugs. Ci
bcil sis hv dvlod sisc o ibioics h oc killd h
d ssd his biliy o hi dsc
ds. tody, w o hs sis c
v ovco vy xisig ibioic.
Sciiss hough h y
gios wihou xosu o i
bioics, h bci would vully
succub o h dugs oc gi.
Uouly, h dos s o b
h cs, sys Buc Lvi, oulio
gicis eoy Uivsiy i
al, Gogi.
Lvi lyzdE. colibci hhlss kid i ou colos oud i
70 diy dis o dy c c.
O-qu o h bci i h usd
dis w sis o soyci,
ibioic ly scibd i h
vious 30 ys.
Lvis di discovy ws buoyd
by sch ld by richd Lski,
icobiologis michig S
Uivsiy i es Lsig who id
i Lvis lb.
Sic 1988, Lski hs oiod
fsks o soyci-sisE. coli.
a 10 ys d 20,000 bcil
gios, h foodd h bugs wih
soyci o h s i. thy
id uzd by h dug.
Lvi d ohs hv u housds
o cou siulios o co u
wih sgis h slow h dvlo
d sd o sisc.
mae up
your own3-letter series, and
as your friendsto arrange them.
!
hesweris:BIt,Bat,Ban,Fan,FUn.
!blow
your nose.Theres a good chance
that your tissue contains
Staphylococcus aureus, or
staph bacteria. Normally,
this common bug doesntcause sickness, but it
occasionally can be lie
threatening. Computer
models can help identiy
strategies or keeping the
spread o these inections
at bay, especially in
hospitals, where they can
be the most dangerous.
Bcus dug-sis bci will
coiu o lgu us, Lvi joks h
sch o ibioic sisc os
h c c oouiy. H sys,
W us coiully discov w wys
o dl wih bcil icios. I ll
suds h wh you gdu o
school, h ly o higs o
you o do! AZM
8/3/2019 Computing Life
8/24
In 1995, a Louisiana nurse accused
her ex-boyfriend, a doctor, of attempt
ed MURDER. She claimed he gave her
the AIDS virus by injecting her with
blood from an HIV-positive patient.
Lawyers from both sides recruited
scientists to analyze viral DNA fromthe nurse.
to ov is cs, h oscuio
hd o covic h juy h h vius
o h us d h vius o h
i w clos livs. So, sci
iss dusd o Dna gis!
th ivsigiv , ld by
couiol biologis Dvid Hillis
h Uivsiy o txs ausi d
viologis michl mzk Bylo
Collg o mdici i Houso, txs,
usd chiqu clld Dna gi
ig o co h Dna squcs o
h wo vil sls. th lso
usd ub o di cou
ogs o ic ogh how h vil
squcs os likly chgd bw
h llgd ijcio i 1994 d h il
i 1998.
th suls showd h ci
gic squcs o h uss vius
w idicl o hos o h is
>csd: crime scene dna
vius. th doco ws covicd o
d scod-dg ud d
scd o 50 ys i iso. Lwys
ld his cs ll h wy u o h
U.S. Su Cou, which l h
covicio sd i 2002.
th cs ks h s i h
such gic lysis, clld hylo
gics, ws usd s vidc i
U.S. ciil cou. AZM
By 2010, the Innocence Project,
which oers legal assistance to
people who claim theyve been
wrongully accused, says that
DNA fngerprinting had led to the
reeing o more than 240 people.
?whodo youthin is guilty?Evidence rom a crime scene
leads police to ve suspects.Compare DNA rom the perpetr
tors blood let at the crime sce
with the suspects DNA below.
DNA sequence from perpetrators
blood found at the crime scene:
AGGCTGCCTACGCGGTTAGG
DNA sequences from suspects:
#1 AGGATGGCTACCCGGTTAGG
#2 AGGCTGCCTCAGCGGATAGG
#3 AGGCTGCCTACGCGGTTAGG
#4 CGGCAGCCTACTCGGTTAGG
#5 AGGCTGGATACGCGGCTAGG
In the Louisiana murder trial,
scientists compared more than
2,000 letters o HIV rom about 3
people. Computers did most o
the work!
Computational biologists
helped prove that a doctor
tried to murder his ex
girlriend using a syringe
lled with the AIDS virus.
National Institute of General Medical Sciences
eris:#3.
8/3/2019 Computing Life
9/24
c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l
Baker used his computer program
to design a small protein not ound
in nature. > Bi Kuhl, Gu Ds, Dvid Bk
the next top protein model
From building muscles to healing wounds, our bodies rely on proteins chainsof small molecules called amino acids that fold into unique shapes. Incorrectly
folded proteins can cause disorders lie sicle cell disease or cystic fibrosis.
Ever-improving computer power is maing it easier for researchers to
predict how proteins fold and interact with other molecules, possibly leading
to new treatments for protein-related disorders.
>tailor-made proteinsBy Emily Carlson
Scientists can easily determine h h-disiol sh
a proteins amino acid sequence, o his d-u olcul.
but they cant reliably PREDICT Bk usd h squc o
build cul oi h wshow this sequence will fold into
sbl d qui siil i suca three-dimensional STRUCTURE.
u o h o h hd dw,So couiol biologis Dvid
vlidig his och.Bk h Uivsiy o Wshigo
Wih h biliy o whi u wi Sl ook di och. H
ois, Bks sch y ksd by skchig oi sucu
i ossibl o cusoiz ois hh obody hd v s. nx, h
could b usd s dugs o iy biologicl
lid o cou odlig og chis o ci disss.h dvlod clld ros o ll hi
wh io cid squc would o
http://publications.nigms.nih.gov/computinglie/topprotein.htmweb exclusives @
8/3/2019 Computing Life
10/24
National Institute of General Medical Sciences
>modeling@home
In high school, Johnathon Tinsleyhad MIXED feelings about MATH and
SCIENCE. Math was very challeng
ing, he recalls. I enjoyed some
parts of biology, but not physics.
this Biish g hld
sch o cus o disss lik
aIDS d alzhis jus by
lig schs us
his cou wh h
ws. You c g
ivolvd, oo!tisly is o
ch d clld
disibud couig
h lis o h ublic
o hl dvc hlh
d dici. though his
och, schs hss
h ow o sol cous o
WARNING!Beore you download
distributed computing
sotware onto a public
computer, like the ones at
school or work, ask i its
OK. I you dont, you could
get into serious trouble!
DC Distributed computing
@home Most likely a distributed computing project
Credit Points received or solving a calculation
Work Unit Problem sent to a donated computer
BOINC The Berkeley Open Inrastructure or NetworkComputing, or the ree sotware program usedby many DC projects
PC Personal computer
Server Computer that sends inormation to othercomputers in a network
Wanna Volunteer?
Folding@Home: http://olding.stanord.edu
Rosetta@home: http://boinc.bakerlab.org/rosetta
FightAIDS@Home: http://fghtaidsathome.scripps.edu
I you visit the Web sites o distributedcomputing projects, youll likely ndcomputerese. Heres a brie glossary.
While youre sleeping, your
computer could be doingscientifc research.
sw io qusios bou biology.th yicl cous i sciiss lb
c o ll o h quid ub
cuchig, bu wok o hudds d
v housds o sol cous c.
How It WorksYou joi disibud couig wok
by dowlodig sow.
Wh you cou is busy,
i sds ssg o sv
i h schs lb
bsiclly syig, Hy, Ivilbl. C I hl? th
sv ssigs chuk o
lg clculio h i kows
h ho cou c solv.
th dod cou y
sd svl dys wokig ou
h obl. Wh is do, i hds
i h sw. Jus lik chs, ol
i h lb chck h sul, lso kigsu h o o hs d wih
h ioio.
You c volu you cou,
whv h k o odl. th co
u us b cocd o h I
h y o cocio dos .
Old cous c do h job, lhough
hy glly g sil clculios.
You c lso choos how uch cou
oy you w o do.
You do d o woy bou hcks
bkig io you cou sys.Scuiy chcks ocig h i
svs d h liid cbiliis o h
quid sow k iciig i
h ojcs cosidbly s h
sug h I.
8/3/2019 Computing Life
11/24
c o m p u t i n g l i f e | t h e n e x t t o p p r o t e i n m o d e l
Distributed Computingin Actionth scic w c do is uchd by
wh w could do wih y oh vil
bl ools, sys Vijy pd, sciis
Sod Uivsiy i Clioi who
sd disibud couig ojc
clld Foldig@Ho.
pd sudis h dyics o how
ois old io hi uiqu shs.
By sudyig how hy old, pd c
s wh gos wog d how dugs
igh ch isoldd ois.pois old uch s h you c
old shi. th quicks o is do i jus
5 illiohs o scod.
pd sys h i would k vy
s dsko cou o h
housd ys o colly siul
h ocss! Bu wih h hl o ly
250,000 sol cous d o
>project structureMost people enjoy a little friendly
COMPETITION, and protein struc
ture prediction researchers are no
exception. Every other year, these
experts go head-to-head to see
whose computer MODELS mae
the best predictions.
th gol is o os cculy odl
h shs o -slcd ois. th
coss do kow h cul suc
us o hs olculs, bu h judgs
do. a viwig h is, h judgs
ivi h os succssul odls o
iiol ig wh hy lk
bou h ochs hy usd. th
i gou discusss how ll c do
v b job i h uu.
h 1 illio plySio
3 gigcosols, pd c do h job i lss
h wk.
tisly dod bou 40 hous o
ocssig i vy dy bw
his wo cous. H likd kowig
h his cous w doig so
hig usul. tisly sys, thy
o jus siig h lik sud
los Biish slg o big idl.
Fo his disibud couig oj
cs, tisly ckd how uch wok
his cou coibud cod oohs. I his cou hld dic
oi sucu, h sw his o
h ojcs Wb si d yb v
ublishd i sciic joul. So
ojcs lso would wd scil
cics.
Sig h ic ks big
dic, sys pd. Wh you
th sciiss do cully cll h
v cos o v coiio.
Is couiy-wid xi o
iov h ccucy o oi dicio
odlig so schs c discov
w dugs o quickly d chly. EC
do o y chiis, you do s dic lik bw wh you giv d
how is usd. Fo us, you c cully
s wh you cou hs dod d
h suls.
Svig scic, hough, is o h oly
b. Disibuig couig lso os
is icis civ socil wok.
my ojcs hv ssg bods
wh doos c os qusios bou
h scic o do houghs bou li.
Doos who lly w o b kd
h o o will o coiiv s.I lik coig o g y ss
bov y bs, sys tisly.
Bu h lso hs joyd h socil
sc. Fo o , h xlis, th
i i is o d lk wih ids
d do sohig good d wohwhil
whil w i. EC
Scientists oten are
rewarded or makingbig breakthroughs, with
the Nobel Prize being
the ultimate honor.
Read about the winner
o a high school science
competition on page 18.
The computer model
generated by David
Bakers team or the
2004 communitywide
experiment (let) was
strikingly similar to the
proteins actual structure
(right). > phili Bdly, Dvid Bk
8/3/2019 Computing Life
12/24
National Institute of General Medical Sciences
movie mania
Just as sound and color revolutionized the film industry, computer technology
has changed the way scientists view biology. Researchers today not only
can tae snapshots of
biology, they can animate
entire biological processes,
thrusting viewers deep into
never-before-seen worlds.
>scientists develop sixth senseThans to a HIGH-TECH tool, scientists
just regained their SIXTH SENSE.
Bo you hik o ci fick
sig Buc Willis, hik bou lig
you uscls fx s you ush box
coss c o lugig owd s
you c suddly sos. ths hysicl
soss o xl cus wh
y xs cosid h
sixh y o ssoy
xic.
A scientist manipulates plastic
models o two proteins while
the computer tracks and
displays their electrostatic
properties, shown here as
redand blue clouds. > ahu Olso
So sciiss
los his ss i h
cou g. thy o
log usd hysicl odls o biologi
cl olculs, lik ois o Dna, o
s how hy ogh. Isd, hy
usd cou-gd odls.
my sciiss sod wokig
wih hysicl odls logh, sys
ahu Olso, sucul olcul
biologis. th u o sil c
io chgs d h kid o udsd
ig you g o icig wih yousuoudigs w los wh cou
ghics ook ov.
Olso d his h Scis
rsch Isiu i L Joll, Clioi,
hv dvlod ool h llows h
o do boh: hysiclly
iul odl o
biologicl olcul
whil wchig is
chicl d biohysi
cl ois chg
o cou sc.
Olso sys cobiig
h wo xics
will l schs och d
udsd biologicl obls i
w wys.
th sciiss us scil is
h g lsic o ls 3-D
shs s sily s oh is
oduc 2-D icus. as Olso d
ohs hold d ic wih h odls,
c cods clos-u sho o h
odls i oio. a cou og
h suioss ghics, lik h
g o os o h gy
bw odld olculs.Olso cobis h odl d
cou ghics io o ig h
llows hi o sudy ll h di cs
o h biologicl olcul. Olso hos
h o dy his ic could doubl s
vido g h ls suds xlo
d ly h olcul lvl. EC
! pic upa nearby object.Rotate it so you see all
its sides. Does it eel
heavy? What about cold?
Smooth? How would you
determine these qualities
i you only saw the object
on a computer screen?
8/3/2019 Computing Life
13/24
c o m p u t i n g l i f e | m o v i e m a n i a
>now playing on a computer near youBy David Bochner
Superman is super strong, super
fast and generally super fly. But in a
COMIC boo, hes also super FLAT,leaving many of his superhero feats
up to your imagination. But when
the comic boo turns cinematic,
Superman truly comes ALIVE.
Sois sciiss oly g o
s h coic book viw o biology:
exil d givs schs jus
sshos o wh biologicl ocss
looks lik scic i. So, cou
iol biologis Kvi Sbosu h
Los alos niol Lbooy i nwmxico is bigig hos ocsss o li.
Sbosu uss high-oc
cous o c ovis o iy
olcul chi s i vy
livig ogis. this chi clld
h iboso builds ois o h
gic isucios codd i Dna.
The ribosome plays itsel in this molecular
movie, now appearing on the Computing Life
Web site. > Kvi Sbosu
Isd i udsdig h oigi
o li, Sbosu sys h sudis h
iboso bcus i y b h olds
ic i h cll.
Bu hs o o i h cuiosiy.
Sbosu lso sys h bou hl
o ll ibioics usd o bcil
icios g h iboso, ig
h b udsdig o his biologicchi could ld o su-sog dugs.
to k his ovis, Sbosu
ss wih xil d, lik h
sucu o iboso i icul
isc, d gs soybod o
sos. Hudds o cocd cou
ocssos o sucou h
u h sshos io i ovi
lld wih ioio sciiss could
ohwis s o v igi.
You c look sic sucus o
h iboso, sys Sbosu, buh oly wy o wch i i oio is h
sucou siulio.
His hs cd o o h
lgs biologicl siulios v,
bigig w li o chcs i h
old soy o oi syhsis.
An artist s rendering o how chemicals change and move among cells in
the brain. Watch the animation on the Computing Life Web site. > Ki Hg
Amid a networ of BLOOD vessels
and star-shaped support cells,
neurons in the BRAIN signal each
other. The mists of COLOR show the
flow of important molecules, such as
glucose, oxygen and nitric oxide.
this ig is ssho o
52-scod siulio cd by Ki
Hg, iio is wokig wih h
Lbooy o nuo Igig h
Uivsiy o Clioi, Los agls. th
iio, which oys how chicls
chg d ov og clls i h bi,
ook bou 300 hous o c. to u i
ll ogh, Hg wokd closly wih
nl pksh, uobiologis i h
s lb. pksh iiilly skd o
>the art of animationBy Karin Jegalian
dwig o illus sch , bu
h dico o h lb suggsd oduc
ig iio isd.
Hg, who sudid hooghy, vido
d ghic dsig i collg d l
d gdu dg i di s,
dos o dw ovis -by-.
Isd, sh builds viul sculus
lld wih colo, ligh, xu d oio
d h guids h viws y hough
h scs.
th lb us his iio, log
wih dozs o ohs, o is Wb si d
lso lys i i s-o-h- h
duig sios o sciiss,
suds d oh visios.
Hg sys h ol is o k h
sch o ccssibl o di
udics. Sig iio, sh
xlis, ks i si o cohd
wh sch is syig.
http://publications.nigms.nih.gov/computinglie/moviemania.htmweb exclusives @
8/3/2019 Computing Life
14/24
National Institute of General Medical Sciences
>preparing for a pandemic
MIDAS,not to be conused with
the king who turned
everything to gold, standsor Models o Inectious
Disease Agent Study.
?How would your simu
lated lie be dierent
rom your best riends?
Just months after the first cases of Flu and You
, to c h dic fu siulios,
h mIDaS schs us cou
odls o build viul ciis, couis
d v cois. H,
housds o d ol
go o school, wok, sos
d oh lcs. th
schs bs h
sids civiis o
ioio bou cul
ol lik you.
Sh eubk,
hysicis Vigii tch
Uivsiy i Blcksbug d o h
mIDaS , hs odld viul
vsios o jo
U.S. ooli s usig locl
soio d csus d. I
eubks ciis, h lly six (o
w) dgs o sio bwy wo ol kig i sy o
gs o sd.
Viuss do c uch bou
goghy, sys eubk. thy c
bou socil woks d how ol
co io coc wih ch oh.
SWINE FLU appeared in April 2009
millions of Americans had gotten
sic and some had even died.
By the end of the year, the
virus had spread world
wide, creating the first
influenza PANDEMIC
since 1968.
as dug cois
oducd vcci h
vd illios o o
cchig his fu, schs
iciig i iiol ojc
clld mIDaS w siulig diss
sd. th siulios l h xlo
how h dic igh uold, who
ws o likly o g sick d which
ivios igh oc h os
ol. th suls hld io ublicolicy dcisios.
sim sicness
Scientists are creating their own virtual worlds where people live and wor
and get sic. Here, researchers can mimic viruses and predict the spread of
contagious diseases through a community. Successful simulations can help us
better prepare for real-life outbreas.
8/3/2019 Computing Life
15/24
c o m p u t i n g l i f e | s i m s i c k n e s s
y sch wod io Googl d
Meet the Simulators
Stephen Eubank started out
studying highenergy physics
but then got into modeling the
dynamics o nonlinear systems,
which are systems that cant be
solved by adding up all o the
parts. He has developed computa
tional models to study natural
languages, trafc patterns and
fnancial markets. He plans to use
the inectious disease models to
study how behaviors, like smoking,
spread through society.
Christina Mills has a Sc.D. (like a
Ph.D.) and an M.D. For her, model
ing inectious diseases is a dream
job because it combines her
interests in math, biology and
human health. While most o hercolleagues with double degrees
practice benchtobedside
research in which they translate
lab fndings into patient care,
Mills says shell stick with the
computerstoclinics approach.
?
What questions
would you want
to ask the models?
siul 180-dy oubk i
Virtual Virusesaoh ky o sudyig h sd
o icio wih cous ivolvs
dvloig viul vsio o h g.
to odl is sd s lisiclly s
ossibl, h schs ck dow
vyhig kow bou h icious
g. eubk, who hs sudid lgu,
sllox d hx, hs ghd
ioio o how ch g sds
bw ol, how cogious i is
d how log i ks o icd
so o show syos.Wh hy do kow h cul
chcisics o icious diss,
h mIDaS schs us hlh
os d sciic d collcd
duig li oubks o si wh
uu o igh b lik.
Duig gdu school, Chisi
mills odld dic fu bo w
hd v hd o swi fu (lso clld
H1n1). Sh did lo o h sch
i h liby, scouig h shlvs o
sciic icls h discussd h1918 Sish fu dic h
killd bw 20 d 40 illio
ol woldwid.
I ws vy old-shiod, sys
mills, who ws sudyig iiol
hlh Hvd mdicl School i
Boso, msschuss. I could jus
g h cssy ioio. th
hu vully ld h o h 1918
sissio s.
Asking QuestionsWih ll h odlig ics i lc, h
mIDaS schs ivi olicyks
o sk qusios h c b swd
usig h odls. Qusios g o
What happens i we dont do anything?
o How many people could be protected
i we intervene?
th schs c di
siulios h chg h vibls,
lik h cogiousss o h vius o h
ub o ol kig sow dys
eubks o ol who voluily
hg ou ho o void icio.
Whs so g bou h cou
siulios is h you c y ou
di siuios h you c
c i l sociis, sys eubk.
Wih o h 250 ossibl cobi
ios o siul, eubk sys h
lis o sisicis o hl hidi which gs will
oduc h os ioiv suls.
Is sy o co u wih qusios,
sys mills. th hd is guig
ou which os w should d
could sw.
Bcus o h ou o d d
clculios ivolvd, h siulios u
o high-oc cous h c
o hous. eubk uss sow o
gs o k sshos o h d
dic s i occus.
I kow xcly wh viul so
gs icd, shows syos d
covs, sys eubk, xliig h
h cou cods vy chg i
diss s.
>>>
8/3/2019 Computing Life
16/24
In 2006, MIDAS modelers mapped the potential spread
o pandemic fu in the United States. Each dot changes
rom green to red as more people in that area get sick.
The top map shows what could happen i we didnt
do anything. The bottom map shows the eect o
giving people a less eective vaccine while a better
one is being developed. > Proceedings o the National Academy o Sciences
Watch this pandemic fu spread on the Computing Life
Web site.
National Institute of General Medical Sciences
Flu Forecasteubk d oh schs
odlig h 2009 H1n1 dic
fu siuld oubk scios i
couiis coss h Uid
Ss. th suls suggsd h
ly vcciio o school kids bsducd diss sd, whil
vcciig lds bc o
io l o. th siulios
lso idicd h ol isk o
sious colicios lik g
wo o idividuls wih
xisig hlh obls should b
giv ivil dicis o k
h s sigs o illss.
Whil h suls gd by
h siulios usul, eubk
ssss h hy o gu
o wh cully will h. H d
ohs o will sk di odls
h s qusios d, wh h
odls g, hyll hv o
codc i h dicios. EC
!create a timelineo what you did yesterday.
List all the people (even i
you dont know their names)
you came into contact with.
I you were contagious with
the seasonal fu, how many
o these people do you think
you would have inected? The
answer is surprisingly low.
Estimates suggest that youd
pass the virus to no more than
three people. But i more than
one other person catches it
rom you, the bug will con
tinue to spread.
http://publications.nigms.nih.gov/computinglie/simsickness.htmweb exclusives @
8/3/2019 Computing Life
17/24
vius cully cuss is owdis. Lik hugy wol ck
h cls ou h locl d
oulio, h vius vully
svs isl. Icig oo y
ol ducs is ood
suly.
this wok is jus o xl
o how schs c dvlo
odls o sw qusios
bou oubks o dgu
o oh disss. Wih h
iclly bsd odl, cologispj rohi h Uivsiy o
Gogi i al xid 30 ys o
idiologicl d o thild, ho
so o dgu. H ld h vi
ol cos, lik w
us, c -ou osquio
fywys d i u chg dgu
icio s.
c o m p u t i n g l i f e | s i m s i c k n e s s
>the rise & fall of deadly dengue
This map rom 2007 shows areas inested with the
mosquito that carries the dengue virus (orange) and
areas with both the mosquito and dengue epidemic
activity (red). > Cs o Diss Cool d pvio
Dengue is common
in Haiti, and survi
vors o the massive
earthquake that
devastated the coun
trys capital in 2010
aced a greater risk
o inection due to
standing water andcontaminated sanita
tion systems.
By Alison Davis
If you live in the United States and
dont travel ABROAD, chances
are youll never come down with
DENGUE fever. Thats not the case
for people living in tropical and
subtropical climates, lie South
America, Africa and the Caribbean.
Bw 50 d 100 illio o hs
ol cch h osquio-sid
dgu vius vy y. mos o h
will bouc bck 2 wks o s
d x fuids. a sll cg,
howv, wo b so lucky. a
cocig dgu scod i,
so ol y dvlo oilly
l dgu hohgic v.
Sciiss suscd h h hu
iu sys igh b o bl o
kig h scod icio o
dgous, bu uil cly hy
w su how.
Usig cou siulios,
idiologiss h Johs Hokis
Bloobg School o public Hlh iBlio, myld, ld h h
icd sos ibodis ois
h should gh o dgu cully
hl h vius coy isl. mo cois
k h vius b do,
llowig i o sd s d ic
o ol.
Bu h schsDk
Cuigs d Dold Buk, who is
ow h Uivsiy o pisbugh i
psylvilso ld h h
8/3/2019 Computing Life
18/24
integrating biology
>bacteria blast off
Identifying all the parts of a cell or organism wont necessarily tell you how
those parts wor together to mae the system run. To do this, scientists
have turned to a relatively new field called systems biology that combines
experimental data and computational models to diagram everything from
how cells move to how hearts beat. With the diagrams, the researchers can
tiner with different parts and begin to explore questions nearly impossible
to answer through traditional lab experiments.
National Institute of General Medical Sciences
Ten, nine, eight, seven, six, five, four,
three, two, one . . . BLAST OFF!
Whil his objc igh look lik
ock blsig hough sc, is lly
k bciu jig oud viul cll.
I ssListeria, y o bci
bs kow o cusig ood oisoig.
Couiol biologis Joh
albs d hicl biologis
G Odll h Uivsiy o
Wshigos C o Cll Dyics
i Fidy Hbo cd i o sudy how
h bciu ovs oud h clls
i ics, ulily kig you sick o
you soch.
By cobiig xil d
wih cou-bsd ochs,
albs d Odll hv cd viul
odls oListeria h show i ovig
hough i. this o col
icu y bl h schs o
idiy w wys o v ood-
bo illsss. AD
In this computer model, aListeria bacterium propels itsel through an inected
cell by stimulating the growth o cellular flaments (yellow and red) at thecells surace. > Joh albs, Sus rlski, G Odll
http://publications.nigms.nih.gov/computinglie/integratingbiology.htmweb exclusives @
8/3/2019 Computing Life
19/24
Each spot on this globe represents a
city, and each color corresponds to a
community o easily connected cities.
> Luis a.n. al, rog Gui
This sphere represents all the known
chemical reactions in theE. coli
bacterium. > Luis a.n. al
c o m p u t i n g l i f e | i n t e g r a t i n g b i o l o g y
Lie us, CELLS rely on transporta
tion to do their daily activities. But
while we can choose to tae cars,
busses, bies and even Segways,
cells tae the pedestrian approach
They MOVE themselves.
a cll ovs by gbbig oo
sohig, lik h wll o blood
vssl, d h ullig isl owd.
this obiliy is ssil o
woud hlig. Wh you cu yousl,
you whi blood clls sd o h
woud lik dics.
Bu cllul ov c lso cus
hlh obls, lik wh cc clls
sd o oh s o h body.
Sciiss w o udsd how
clls ov so hy c dvlo w
>on the move
dugs h c v u o so cll ig biology och o sudyig cll
io logh. Bu lik os biologicl ov. Sh uss hicl
ocsss, cll ov hs b quios d cou sow o: sy o gu ou bcus i ivolvs ic ogh h vious coo
hudds o ois. h k clls oo log. AD
Cll biologis Cl W-So
h niol Isius o Hlh i
Bhsd, myld, ks syss
s
?
Did you know that
some cells orm ladders
so other cells can climb
up them?
This image, taken with a microscope
camera, shows the intricate network o
fbers that builds a cells structure. These
fbers are called microtubules (yyeellolloww) andactin flaments (blue). > Cl W-So
>connected worldsFor scientists, the INTERNET is
more than an information super
highway and AIRPORTS arent just
places where planes tae off and
land. They are examples of complex
NETWORkS that can help research
ers study even more complicated
ones in the body.
nwoks, whh socil o cllul,
sh ub o us. ech o is
sys d u o di ls
h coc hough io cs
o civiy clld hubs. Hubs could b
Wb gs likd o y oh sis o
jo ios h ou ssgs o
ddiiol ciis. Couicio occus
wihi h wok, lig i ogiz
isl d v chg ov i.
ay wok c sv s odl o
udsdig oh bcus ll hs
syss o by siil s o uls,
sys hysicis Luis al nohws
Uivsiy i evso, Illiois.
al odls h woks o h
I d i vl, bu h lso s
bolic woks h iic
hwys by which clls g h
gy dd o cy ou biologicl
ocsss sig h oducio o
ois o h bkdow o dugs. H
cs sil couiol odls h
show how h hs o hs colicd
woks coc d couic.
Kowig ll h dils bou h bodys
woks y hl sciiss l o
wi h o v ci disss, jus
lik i c coolls -ou ls o
void hudsos. AD
8/3/2019 Computing Life
20/24
National Institute of General Medical Sciences
made possible by
Youve learned a lot about how computing power gives us new perspectives
on biology. At the center of it all is a component more advanced thanany silicon chip inside a computer processor. Its the human brain.
Biologists, engineers, physicists, computer scientists,
epidemiologists, geneticists and even writers and
artists have brought their brainpower to the
table to solve these old and new problems.
>time for computationBy Jilliene Mitchell
Going from Moms or Dads savory h dics how ois old d ch lgb cous, h sys h kw i ws
home cooing to the CAMPUS o oh biologicl olculs. i o visi h h hl oo, wh
By h i h gdud o high suds could wok wih uos. th ocafeterias mystery meat can beschool, Hiso hd sd his id o. Hiso ishd h clss wih
a big adjustment for any COLLEGEsch o sciiss old h his B-, which, cosidig how ough h clss
freshman. But for Ryan Harrison, a s d civd uous wds, ws, h sys l o lik a+.BIOMEDICAL engineering and icludig o iz i h 2005 Il I sudy lo, dis Hiso. Bu I
economics major at Johns Hopins Scic tl Sch h ios sill k i o do higs h I joy.
University in Baltimore, Maryland, it olds d os sigious high aog his hobbis: dicig o-
wasnt a big deal. school scic coiio. c ly, xiig wih ligh d
a gduio, Hiso soud o sud h oducios dWhil os o his high school idsud o Hokis d lyig his voi cou g.ook i sy hi ls y o ully joyh Gy lb. ev d h ugh disdvgd kidssioiis, Hiso s his dowiwih ull collg i Blio how o ly chss, Hokis, wh h wokd i hcous lod, h xliig h i ws lso goodchicl d bioolcul giigsill oud i o cic o hi.lb o osso J Gy. Hiso go
wok o ros. Wih so y iss, oh chc hough his high school,Do b o Hisos biggs chllgswhich os og h is
oold, hough. i collg ws dig i o
ll o his civiis d
dcidig wh h ulily
wd o do ossiolly. as
h wo i his oli diy (s
xcs o h x g), I hv
o qusios ow bou y
uu h v bo. Bu, I
guss hs ol o
gowig u.
suds wih schs.Jus bcus hHiso hd b wiig his owws wd-cou ogs sic h 4h gd.wiig schSo wh his high school biology ch g 17 dosioducd hi o Gy, vyhig ll io hs whizlc. H ws io couiol biology vyhig! Whd w idily hi i o! sys Hiso.h sd losig hWhil i h Gy lb, Hisobl i high-lvliovd h ros cou og
Harrison in high
school, when
many scientists
mistook him or a
college or graduate
student!
> Sh S
a
8/3/2019 Computing Life
21/24
c o m p u t i n g l i f e | m a d e p o s s i b l e b y
> excerpts from an internshipRyan Harrison spent his first
SUMMER off from college in New
Yor City, where he did a 10-weeINTERNSHIP at Weill Medical
College of Cornell University.
Isd o wokig i cou
lb, h wokd i w lb, col
wih liv ogiss, chicls d i
dishs. H sudid how icul
oi cs h li cycl o h
si h cuss li.
Hiso wo bou his su
xic i his blog, Vd Foc:
Discovis i Li d pooics.
BL O G
NAME:
RyanHarrison
Thursday 8:37pm
Ive been in New York City or almost a month now.
Settling in well to my new lab environment and even
orgetting that Im in NYC occasionally. . . . Wish I
could work a little more independently, but I under
stand that I just dont have the proper laboratory
background/experience to handle my own indepen
dent project. I guess I was expecting a Gray lab type
arrangement where I work at my own pace at a
problem I selected and I am the only one respon
sible or the outcome (good or bad). . . . Whatever Idecide to do, I think it will combine computational
with wet lab work. Since I havent the slightest
idea how my lie is going to unold, I am just going
to do what I enjoy.
To fnd out what Harrison is doing now,
visit this story on the Couig Li Web site.
Drew Endy lies taing things APART What got you interested in science? Why do you want to do this?
and putting them bac together I cuious. I bohs wh I do I sd o hik bou why is b so
bies, cars, lawn mowers. He udsd how higs wok. hd o udsd biology. th coclusio
Iv co o is h h biologicl syssessentially does the same thing Youre trained as an engineer. How doesw d i u sy o udsd
when he tries to understand that inuence your approach to biology?I gu h i I w o hv biology h
I you sk gis wh hy w oBIOLOGY. A professor at Stanford I udsd, Id b b o buildigdo i hi h, hy w o k
University in Palo Alto, California, i ysl.sohig. my is is o b bl o
Endy assembles and PROGRAMS ouily, libly, quickly, sily d What makes the feld so hot right now?living machines. I ased him a few chly u ogh h bis d ics Svy ys go, hysiciss cquestions about his wor and why o biology o k w d usul higs. io biology d lly shook higs u.
he lies it. DB I susc h whs hig ow isYoure in a new feld called synthetich h gis coig io biology,biology. Whats the goal o this feld?d hy goig o shk higs u.
Is o k oui h giig
h ogig o livig ogiss.
>programming biology
>>>
http://publications.nigms.nih.gov/computinglie/madepossible.htmweb exclusives @
8/3/2019 Computing Life
22/24
National Institute of General Medical Sciences
With the help o a Hollywood illustrator and others, Endy created a comic book called
Adventures in Synthetic Biology. He hopes to use it as a teaching tool. To read the
entire comic, visit this story online. > Dw edy
Describe your typical day.
I l lik I zy, hlig su
h. I ch couss o syhic
biology, d I suvis h sch i ylb. evy ow d h I g lil bi o
i o hik.
What have you thought about lately?
a w discovig biology s o
slow h u is ivig w biology?
I did so bck-o-h-vlo clculios
d his ub could b colly wog,
bu soi bw h y 2085 d
2105 w should b bl o squc ll h
Dna o h l i oh.
What do you like most about your job?th ol i sch so o h
cools, [os] isig [d] ics
ol you v goig o . I s jus
g xic.
What do you think makes or a
successul scientist?
th bs, os u-lovig, hy
sciiss Iv s h ol who
cogiz wh id is wokig d
bdo i o b id wihou lig
oo bd.
Do you think youll always be a scientist?
I doig wh I w o b doig, d i
I ws, I would chg i. I so oi
i h uu, Id h b isig hs
s i souh Fc, o oh
Fc, o whv hy is hss
i Fc, I su I would go do h.
O cous, Id hv o l Fch.
Last words?
pol xss g wod,
xci d los gicl lio
shi wih h livig wold. Bu I hik ov
h coig ys s h os
xc wll s siio i biology
wh i bcos uch sil d
si o gi livig syss. W do
cully kow how o do h igh ow,
bu h lssos buid i h lo d
wisdo o oh giig discilis.
8/3/2019 Computing Life
23/24
Discrimination ProhibitedUd ovisios o licbl ublic lws
cd by Cogss sic 1964, o so
i h Uid Ss shll, o h gouds
o c, colo, iol oigi, hdic, o
g, b xcludd o iciio i, b
did h bs o, o b subjcd o
disciiio ud y og o civiy
(o, o h bsis o sx, wi h sc o y
ducio og o civiy) civig
Fdl cil ssisc. I ddiio,
excuiv Od 11141 ohibis discii
io o h bsis o g by cocos
d subcocos i h oc
o Fdl cocs, d excuiv Od
11246 ss h o dlly udd
coco y discii gis yloy o lic o loy
bcus o c, colo, ligio, sx, o
iol oigi. tho, h ogs o
h niol Isiu o Gl mdicl
Scics us b od i colic
wih hs lws d excuiv Ods.
Accessibility
this ublicio c b d vilbl
i os h o ccssibl o
ol wih disbiliis. to qus his
il i di o, coc h
nIGmS Oc o Couicios d
public Liiso 301-496-7301; sd
-il o [email protected]; o wi
o h oc h ollowig ddss:
45 C Div mSC 6200, Bhsd, mD
20892-6200. I you hv qusios o
cos bou his ublicio, you
c us h s coc ioio
o ch h dio, eily Clso.
Additional Copies and Web Links
to od ddiiol cois o Computing
Lie o oh nIGmS ublicios, go
o h://ublicios.igs.ih.gov/od
o us h coc ioio bov.
a udd Wb vsio h icluds
ddiiol liks, siulios d
oh ils is vilbl h://
ublicios.igs.ih.gov/couigli.
mailto:[email protected]://publications.nigms.nih.gov/ordermailto:[email protected]://publications.nigms.nih.gov/order8/3/2019 Computing Life
24/24
When I was in high school, I never thought therewas a field that combined all my interests.
Christina Mills, a scientist who uses modeling to study
infectious diseases
> thin you want to compute life?People with many different talents
can join in COMPUTING LIFE. If youre
interested, as yourself what aspects
of the research featured here you find
EXCITING. Do the projects blend many
of your academic interests? Are there
particular biological problems youd
lie to solve?Here are a few tips on how to get
started looing into COMPUTING LIFE
as a career.
nIH publicio no. 10-5861
Fbuy 2010
h://www.igs.ih.gov
> ask you scic ch o
guidc couslo bou
oouiis o wok wih
sch by collg
o oh isiuio.
> Sch h Wb o sciiss
wokig h cossods o biology
d couio.
> e-il sciiss you loclcollg o uivsiy o o
ioio.
> e scic i o g xi
c sig sch suls.
http:///reader/full/http://www.nigms.nih.govhttp:///reader/full/http://www.nigms.nih.gov