CD46 and Dlg4 interact. 1 A functional interaction between ... · evidence for an interaction between CD46 and Dlg4, (ii) ... epithelial cell line, ... Sequence coding for the PDZ3

CD46 and Dlg4 interact. 1

1

A functional interaction between CD46 and Dlg4: a role for Dlg4 in epithelial

polarization.

1Mandy J. Ludford-Menting, 1Suzanne J. Thomas, Blessing Crimeen, 2Lisa J. Harris, 2Bruce

E. Loveland, 3Margaret Bills, Sarah Ellis, 4Sarah M. Russell

1These authors contributed equally to the work.

Peter MacCallum Cancer Institute, Trescowthick Research Laboratories, St Andrew’s Place,

East Melbourne, Victoria 3002, Australia.

2Austin Research Institute, Studley Rd, Heidelberg, Victoria 3084, Australia.

3Current address: St. Vincent's Institute of Medical Research, 9 Princes St, Fitzroy, Vic 3065,

Australia.

4To whom correspondence should be addressed at:

Peter MacCallum Cancer Institute, Trescowthick Research Laboratories, St Andrew’s Place,

East Melbourne, Victoria 3002, Australia.

Tel 613 9656 3727, Fax 613 9656 1411

E-mail: [email protected]

Running Title:

CD46 and Dlg4 interact.

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on November 19, 2001 as Manuscript M108479200 by guest on M

ay 28, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


2

SUMMARY

Using a Yeast Two Hybrid screen, we identified a physical interaction between CD46

and Dlg4. CD46 is a ubiquitous human cell surface receptor for the complement

components C3b and C4b, and for measles virus and human herpes virus 6. Dlg4 is a

scaffold protein important for neuronal signaling, and is homologous to the Drosophila

tumor suppressor, Dlg. We show that an interaction between CD46 and Dlg4 is

important for polarization in epithelial cells. Specifically we show (i) biochemical

evidence for an interaction between CD46 and Dlg4, (ii) that this interaction is specific

for the Cyt1 and not the Cyt2 domain of CD46, (iii) that both CD46 and an alternatively

spliced isoform of Dlg4 are polarized in normal human epithelial cells, and (iv) that the

polarized expression of CD46 in epithelial cells requires the Dlg4 binding domain, and

alters with expression of a truncated form of Dlg4. This is the first identification of a

direct, and cytoplasmic domain-specific interaction between CD46 and an intracellular

signaling molecule, and provides a molecular mechanism for the polarization of CD46.

These data also indicate that, in addition to the known role for Dlg4 in neuronal cells,

Dlg4 may be important for polarization in epithelial cells.

by guest on May 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

INTRODUCTION

CD46 (or Membrane Cofactor Protein) is a receptor for the complement

components C3b and C4b, and for several pathogens, including the measles virus and

human herpes virus 6 (1-5). CD46 is expressed on all human cells except erythrocytes,

and protects cells from complement-mediated destruction by acting as a cofactor for the

factor-I mediated breakdown of C3b and C4b (1, 6). The expression of CD46 is

upregulated on many tumor cells, and different alternatively spliced isoforms of CD46 are

expressed on both malignant cells and activated T cells (6). When expressed in the canine

epithelial cell line, MDCK, CD46 is polarized to the basolateral surface (7-9).

In addition to the effects of CD46 on the activity of complement, it has recently

become clear that signaling through CD46 can have important effects on both innate and

acquired immunity. For instance, signaling through CD46 can affect the production of

interleukin 12, macrophage inflammatory protein-1a, and nitric oxide by macrophages,

the production of interleukin 6 by astrocytes, IgE class switching in B cells, and

proliferation of T cells (10-16). CD46 is alternatively spliced to give two different

cytoplasmic domains (Cyt1 and Cyt2, Fig1 A), each of which is expressed in every cell

type examined to date (6). The cytoplasmic domains have different signaling

characteristics: (i) expression of Cyt1 causes a preferential increase in the production of

nitric oxide by macrophages (13), and (ii) only the Cyt2 domain can be phosphorylated on

tyrosine, and coprecipitates with a 38 kDa phosphorylated protein (17). The cytoplasmic

domains are only 28 and 35 amino acids long respectively, and are therefore likely to

signal via interactions with other intracellular proteins. CD46 has been

coimmunoprecipitated with SHP-1 in macrophages (18), and antibodies to CD46 can

cause the phosphorylation of p120cbl and LAT in T cells (15). These observations


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

describe cellular processes that can be affected by CD46, but as yet we cannot describe

the molecular pathways through which CD46 affects cell events. As a first step towards

elucidating these pathways, we sought to identify proteins that interact with the different

cytoplasmic domains by a Yeast Two-Hybrid screen.

We show here that the Cyt1 domain interacts with Dlg4, a member of the MAGUK

family of proteins that provides a scaffold for the assembly of signaling complexes. Dlg4,

also called Post-Synaptic Density (PSD)-95 or Synapse Associated Protein (SAP)-90, is one

of a family of four human proteins. This family shares a single homologue in Drosophila: a

tumor suppressor called Discs Large or Dlg (19, 20, 21). The Dlg proteins are thought to

have two primary functions: (i) to mediate the localization and clustering of receptors (22-

28), and (ii) to form a scaffold for the assembly of signaling proteins (27-36). Dlg proteins

have multiple protein-protein interaction motifs: three PDZ domains, an SH3 domain and a

guanylate kinase-like domain (GuK). By virtue of their PDZ domains, Dlg proteins are part

of a larger family of proteins that are polarized, and that recruit other proteins to a polarized

domain in neurons and epithelial cells (22, 37, 38). Thus, the interactions of PDZ domain-

containing proteins with each other, with membrane-bound receptors, and with the

cytoskeleton, serve to define and regulate polarization, and to coordinate signaling networks.

PDZ domains are 90 amino acid modules which classically interact with the C-terminal 4

residues of proteins with the sequence X-S/T-X-I/L/V. Dlg4 has previously been shown to

interact with receptors that are important for neuronal signaling, and is localized to the

postsynaptic density region of neurons. Results described herein indicate that Dlg4 interacts

with CD46, a protein not known to play a role in synaptic signaling. We show that the C-

terminal 4 residues of the CYT1 domain (FTSL) of CD46 interact with the PDZ3 domain of

Dlg4. We also show colocalization of CD46 and Dlg in epithelial tissues, and describe


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

evidence suggesting that this interaction is important for the polarization of CD46 in

epithelial cells.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

EXPERIMENTAL PROCEDURES

Yeast Two-Hybrid Screen. The sequence encoding the Cyt1 domain of CD46 was

fused in frame to the GAL4 binding domain (GAL4-BD) in the pAS2.1 vector (Clontech).

The vector was transformed into PJ09-4A yeast cells (39), selected on Trp-deficient medium,

and screened for expression of the bait by immunoblotting with an antibody to the GAL4-BD

(Santa Cruz). The yeast were further transformed with a library of the GAL4-AD fused to

cDNA from human peripheral blood lymphocytes activated with phytohaemagglutinin, and

selected in medium deficient in Trp, Leu and His with 3 mM 3-AT. Of 3 x 106 independent

clones screened, 112 colonies grew on both His-deficient and Ade-deficient medium. DNA

was extracted from each of these colonies and characterized by restriction digestion and

sequencing. DNA from one colony corresponded to a partial cDNA sequence of human

Dlg4.

To test for specificity, yeast were cotransformed with bait and prey vectors and selected on

plates deficient in Leu and Trp, then streaked onto both Ade- and His- deficient media and

assessed for growth. Control clones for these tests included GAL4-pLAM (Clontech) and

GAL4-ABP280 (40), and vectors expressing the GAL4-BD and GAL4-AD alone. At least 4

clones were tested for each transformation, and clones were analyzed by immunoblotting

with antibodies to the GAL4-AD and –BD respectively (Santa Cruz) to ensure equivalent

protein expression.

Cloning and construct derivation. The mutant constructs used in Yeast Two-

Hybrid specificity tests were derived from the original GAL4-BD-CYT1 fusion used in the

screen and the GAL4-AD-Dlg-4 fusion isolated from the screen. Mutations were made using

the Quick-Change Site-Directed Mutagenesis kit (Stratagene). The primer sequences were as

follows, with the underlined residue indicating a mutation from the original sequence:


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

GTAAAATTTACTTCTCGCTGAGAAGGAGAGATG and

CATCTCTCCTTCTCAGCGAGAAGTAAATTTTAC for the GAL4-BD-CYT1(L358R) and

for CD46-Cyt1L(358R), CAGCCGATTCGAGGCCTAGATCCACGACCTTCG and

CGAACCTCGTGGATCTAGGCCTCGAATCGGCTG for the GAL4-AD-Dlg4(trunc), and

CGAATTGTGATCCACGCGGGCTCCACGGGCCTG and

CAGGCCCGTGGAGCCCGCGTGGATCACAATTCG for the GAL4-AD-Dlg4mutPDZ3.

To generate an expression construct of Dlg4, the 5’ region was amplified from cDNA

from human spleen polyA+ RNA, and fused to the Dlg4 fragment isolated in the Yeast-Two

Hybrid screen using Splice Overlap Extension PCR. This splice variant of Dlg4 (which lacks

exon 20)( 44) was then subcloned into pcDNA3 (InVitrogen) and fully sequenced. The splice

variant of Dlg4 that encodes an intact GuK domain was created using an amplified GuK-

encoding domain from pooled human leukemic cells using RT-PCR. The PCR product

contained FseI and EcoRI restriction sites, which allowed insertion into the original

expression construct of Dlg4. Sequence coding for the PDZ3 domain of Dlg4 was amplified

from the original Yeast Two Hybrid clone and was fused in frame to the coding region of

EGFP in the EGFP-C2 vector (Clontech) using EcoR1 sites. GST fusion proteins were

created in the pGEX-4T-1 vector (Amersham) using CD46-Cyt1 and Cyt2 sequences

amplified from Gly 342 to beyond the stop codon.

Molecular Modelling. Molecular modelling of the peptide FTSL bound to PDZ3

domain was performed using the known X-ray crystallographic structure of PDZ3 of Dlg4 in

complex with its peptide ligand QTSV (41) (PDB entry 1BE9). Computer graphics program

“O” (42) was used to replace sidechains of QTSV to those of FTSL respectively; Cβ and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

peptide mainchain atoms were unaltered. Using “O” rotamers, FTSL sidechains were

modelled for stereochemical fit and favorable contact with the PDZ domain.

Transfections. For transient expression, the canine kidney epithelial cell line,

MDCK or the human kidney epithelial cell line, 293, were transfected using FuGene6

(Roche), and analysed 2-3 days later. Stable transfectants of MDCK cells were selected in

G418 for resistance to neomycin, and then screened for expression of CD46 or Dlg4 by

immunofluorescence or flow cytometry. Antibodies used were K28/43 and K28/86.2 mouse

monoclonal antibodies to Dlg4 (Upstate Biotechnology). The 1839 polyclonal rabbit

antibody was raised against the recombinant extracellular domain of CD46. Clones were

generated by limiting dilution. To obtain double transfectants, cells were transfected with

CD46, selected, cloned, and then transfected with EGFP-PDZ3 and enriched by flow

cytometry.

Immunofluorescence and analysis of polarization. MDCK cells were grown to

confluency on polyester transwell membranes (24mm, pore size 0.4 µm). The apical and

basolateral regions of the cells were stained by incubation with primary and secondary

antibody in the inside of the insert (FITC) or the base of the well (Fluor594) respectively.

The membranes were removed from the insert with a scalpel blade, and sealed on a slide with

ProLong antifade. Immunofluorescence was analyzed using a Bio-Rad (Bio-Rad

Laboratories; Hercules, CA) confocal scanning microscope (model MRC1000). The 488-nm

line from a krypton/argon laser was used to excite the FITC-tagged secondary antibody and

emission was detected through the 522-nm filter. The 568-nm line from a krypton/argon

laser was used to excite the Fluo594-tagged secondary antibody and emission was detected

through the 605-nm filter. Optical sections were recorded at 0.4-um vertical steps with each

image averaged for seven scans. All images were processed using the Comos program (Bio-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

Rad) and Cas 4.02 (confocal assistant software, copyright Todd Clark Brelje). Staining

patterns are representative of the staining observed in at least three clones of each construct

transfected, and staining with subclass control antibodies indicated that the staining was

specific.

Immunohistochemistry. Sections of human kidney were fixed in methanol at 37°C for 18

hours, blocked in 5 % BSA and immunolabelled in 0.8 % BSA with primary antibody and

then biotinylated swine anti-mouse/rabbit secondary antibody. Signal was amplified with

streptavidin peroxidase and visualized using 3,3’Diaminobenzadine (Dako, USA). Bound

antibody was detected with streptavidin-coupled peroxidase and 3,3’Diaminobenzadine

(Dako, USA). Sections were counterstained with haemotoxylin.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

RESULTS

CD46 interacts with Dlg4. We screened for proteins interacting with the cytoplasmic

domains of CD46 by a Yeast Two Hybrid assay, using a library derived from activated human

peripheral blood lymphocytes. Two separate “baits” were used in the screen, in which the

cytoplasmic domains of CD46-Cyt1 and CD46-Cyt2 (Fig1 A, Bi & Bii) were fused to the

GAL4 binding domain (GAL4-BD-Cyt1, Fig1 Biv) and GAL4-BD Cyt2, Fig1 Bvi). After

screening with the GAL4-BD-Cyt1 clone, a partial cDNA clone encoding Dlg4 (PSD-95) was

isolated (43). Full length Dlg4 includes 5 domains known to be important for protein-protein

interactions, namely 3 PDZ domains, one SH3 domain and a guanylate kinase like domain

(Fig1 Ci). The clone we isolated corresponded to a previously described alternatively spliced

variant (a deletion of exon 20, which causes a frame shift leading to a premature termination,

44) in which the GuK domain was truncated by 102 amino acids (termed Dlg4-DelGuK, Fig1

Cii). Protein encoded by the yeast clone (termed GAL4-AD-Dlg4, Fig1 Ciii) contained the

GAL4-AD fused in frame to the C-terminal 45 amino acids of PDZ2 (starting at nucleotide

1590 within the PDZ2 domain (43)), the complete PDZ3 domain, the SH3 domain and the N-

terminal part of the GuK domain. Thus, the only intact modules were the PDZ3 and the SH3

domains.

To map the domains of each protein that were important for the interaction, we compared the

growth of yeast transformed with CD46 and either the Dlg4 fusion from the Yeast Two

Hybrid screen (GAL4-AD-Dlg4), or mutants thereof (see Fig1 B & C). Cotransformation of

GAL4-BD-Cyt1 and GAL4-AD-Dlg4 allowed growth on selective media, indicating that

these proteins interact (Fig2, Ai). However, mutation of R318 adjacent to the GLGF domain

of PDZ3 (critical for binding to other C-terminal peptides (41), GAL4-AD-Dlg4mutPDZ3,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

Fig1 Cv) completely abrogated growth, indicating that a functional PDZ domain was required

for interaction of the fusion protein (Fig2 Aii). Truncation of the Gal4-Dlg4 clone at the end

of PDZ3 (GAL4-AD-Dlg4(trunc)) allowed growth, although at a consistently reduced rate

(Fig2 Aiii). This clone contains only the C-terminal 45 amino acids of the PDZ2 domain and

the complete PDZ3 domain. Coexpression of GAL4-BD-Cyt1 with an irrelevant GAL4-AD

fusion protein (GAL4-AD-ABP280) did not confer growth (Fig2 Aiv), indicating that the

interactions between CD46 and Dlg4 fusion proteins were specific. These data indicate that

GAL4-AD-Dlg4 interacts with the Cyt1 domain via the PDZ3 domain, but suggest that the C-

terminal region of the molecule might enhance binding.

We next investigated the regions of CD46 that were important for binding to Dlg4.

Cotransformation of GAL4-AD-Dlg4 with GAL4-BD-Cyt1 gave the expected growth (Fig2

Bi), but cotransformation of GAL4-AD-Dlg4 with GAL4-BD-Cyt2 did not confer growth

(Fig2 Bii). This indicated that the binding of Dlg4 was specific for the Cyt1 isoforms of

CD46. As the C-terminal 4 residues of the Cyt1 domain (FTSL) fits the consensus for

binding to PDZ domains, we tested whether these residues interacted with the PDZ3 domain

of Dlg4. Mutation of the C-terminal leucine residue of CD46 (GAL4-BD-Cyt1(L358R), Fig1

Biii) completely abrogated growth (Fig2 Biii), indicating that the C-terminus of CD46 is

important for binding to Dlg4. Cotransformation with two irrelevant GAL4-BD fusion

proteins did not confer growth (Fig2 Biv & v). These data show that the CD46 Cyt1, but not

Cyt2, domain binds to Dlg4 through its C-terminus, and are consistent with the hypothesis

that the consensus Dlg4 binding site within CD46-Cyt1 (the FTSL sequence) is necessary for

the interaction.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12

CD46 can interact with Dlg4 expressed in mammalian cells. We tested whether the

interaction between CD46 and Dlg4 could be replicated in a system other than the Yeast Two

Hybrid system, using Dlg4 expressed in mammalian cells. The transformed human kidney

cell line, 293T, was transfected with vector alone or either alternatively spliced variant of

Dlg4 (Dlg4 and Dlg4-delGuK, Fig1 Ci & ii). Transfected cells were lysed, and incubated

with beads coupled to GST or a GST-Cyt1 (Fig1 Bvii) or GST-Cyt2 (Fig1 Bviii) fusion

protein. Transfection of the two splice variants of Dlg4 gave equivalent levels of expression,

and the expected difference in size between the splice variants (Fig3 A). A band of lower

molecular weight was also seen when Dlg4 was transfected, consistent with previous reports

(45). It is thought that this band might be generated by proteolytic cleavage of the N-

terminus (45). In each case the GST-Cyt1 fusion protein interacted with Dlg4, but neither

GST alone nor GST-Cyt2 interacted. Interestingly, the lower molecular weight form of Dlg4

consistently bound more strongly to the GST-Cyt1, perhaps indicating that the modification

causing this form affects the binding of Dlg4 to CD46.

We attempted to coimmunoprecipitate CD46 and Dlg from the transfected 293T cells, using

the endogenous CD46. We were unable to do this, and in fact found that CD46 and Dlg were

not colocalised in these cells (Dlg expression was predominantly cytoplasmic, data not

shown). The intracellular localization of Dlg is regulated by complex mechanisms that may

be cell specific, and therefore it is possible that CD46 and Dlg are colocalised and able to

interact only in certain cell types. Other cell types, in which CD46 and Dlg do colocalize (see

below), expressed Dlg at levels too low to allow for efficient coimmunoprecipitation with the

available antibodies. However, our data with GST fusion proteins indicate that the Cyt1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

domain of CD46 can interact with both alternatively spliced isoforms of Dlg4 expressed by

mammalian cells, but the Cyt2 domain does not interact with Dlg4.

An interaction with Cyt1 is compatible with the structure of PDZ3. Although the C-

terminus of the Cyt1 domain contains the consensus sequence for PDZ binding (X-S/T-X-

I/L/V), the Phe at position –3 differs from the charged residue at this position in proteins

previously reported to bind to Dlg4. The crystal structure of the PDZ3 domain of Dlg4 has

been solved, both without peptide and with the C-terminus of CRIPT (an intracellular protein

that binds to PDZ3 of Dlg4 via the C-terminal sequence, QTSV) (32, 41). We used this

structure (Fig4 A) to model the C-terminus of CD46-Cyt1 in the groove of PDZ3 (Fig4 B).

The four-residue segment binds to the PDZ domain through antiparallel main chain

interactions with a β-sheet of the domain. The carboxylate group of the peptide is recognized

by a network of main chain amides provided by the loop sequence Gly322-Leu323-Gly324-

Phe325 as well as by the Arg318 sidechain. Additional side chain contacts and a

hydrophobic pocket determine the selectivity of the C-terminal consensus sequence. In this

model the Cyt1 domain fits in the groove with no obstructions, and although two hydrogen

bonds are lost compared with the CRIPT structure, this is unlikely to prevent the interaction.

A carboxyl terminal leucine in place of valine is possible with slight adjustment to the

hydrophobic pocket, considering local steric constraints and potential Van der Waal contacts.

Thus, the CD46 Cyt1 domain peptide sequence FTSL can be accommodated by a PDZ3

binding pocket.

The biological significance of an interaction between CD46 and Dlg4. Many PDZ-

containing proteins, including Dlg-1, are expressed in epithelial cells, where they regulate cell


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

polarization (37, 38). Both RNA and protein for Dlg4 have been identified in non-brain

tissues such as kidney (44). Interestingly, CD46 is polarized when ectopically expressed in

the MDCK epithelial cell line (7-9), so we next investigated whether CD46 and Dlg family

members were colocalized in epithelial tissue. An irrelevant antibody gave no

immunostaining in the epithelium of the kidney tubules, indicating that the staining was

specific (Fig5 Ai). Staining with antibodies to the Dlg family (Fig5 Aii), or specifically to

Dlg4 (Fig5 Aiii), showed apical polarization, Staining of normal human kidney sections with

antibodies to CD46 (Fig 5 Aiv), showed apical polarization, and indicated that CD46 and

Dlg4 are colocalized in epithelial cells. This polarized staining is not an artifact of the

immunohistochemistry procedure, as staining a different tissue section with Dlg gave the

same polarized staining (Fig5 Bi), but staining with an antibody to actin gave diffuse

reactivity over the whole cell (Fig5 Bii). These data are the first indication of a tissue in

which CD46 and Dlg4 might interact, and also suggested that Dlg4, as well as Dlg1, might be

involved in epithelial cell polarization. We also found polarization and colocalization of

CD46 in human gut epithelial tissue (data not shown) indicating that this role might extend to

other epithelial tissues.

Basolateral targeting of CD46 requires an interaction with PDZ-containing proteins.

The combined observations that (i) CD46 interacts with a PDZ domain, (ii) PDZ-containing

proteins are important for asymmetric targeting, and (iii) CD46 is polarized in epithelial cells

(above data and 7-9), suggested that this interaction might be important for intracellular

targeting of CD46. Further evidence for this hypothesis was that the removal of the FTSL

region of CD46 prevented basolateral targeting (8), however, the observation that the CD46


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


15

Cyt2 domain was also basolaterally targeted (7) suggested that additional mechanisms for

polarization were present in the CD46 sequence. We firstly investigated the expression of

Dlg family proteins in MDCK cells. Both mRNA and protein corresponding to Dlg4 were

detected in MDCK cells by RT-PCR and by immunoblots with an antibody specific for Dlg4

(data not shown). Other Dlg family members were expressed at higher levels as indicated by

immunoblotting with an antibody to the Dlg family, including Dlg1, which is known to be

important for epithelial polarization (37, 38). Dlg proteins are highly conserved amongst

mammalian species (human Dlg4 is 99% identical to mouse Dlg4, and the same four family

members have been identified in both mouse and human).

MDCK cells (which do not express CD46) were transfected with CD46 variants to

investigate the role of Dlg in the targeting of CD46. We firstly investigated the localization

of Dlg in these cells. MDCK cells were immunostained with antibodies to the Dlg family

(Fig6 Ai), and to CD46 (Fig6 Aii). In both cases the staining was predominantly at the

periphery of the cells, and was colocalised (Fig6 Aiii). We assessed protein targeting by

seeding transfected MDCK cells onto transwell plates in which both upper and lower surfaces

were accessible to antibody. After allowing development of a completely confluent polarized

monolayer, we stained for CD46 using either a FITC-coupled secondary antibody (upper

surface), or a Fluo594 -coupled secondary antibody (lower surface). The slides were viewed

by confocal microscopy, with images taken horizontally, at the apical (upper) or basolateral

(lower) lever of the monolayer, and vertically. We found that CD46-Cyt1 was targeted to the

basolateral region of MDCK cells (Fig6 Bi & iii), in agreement with the results of Maisner et

al (7). The staining was specific for CD46 as cells transfected with vector alone showed no

staining (Fig6 Bii & iv). However, in contrast to CD46-Cyt1 (Fig6 Bi & iii), and to the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


16

results of Maisner et al, CD46-Cyt2 was not polarized to the basolateral region, but was

distributed throughout the cell surface (Fig6 Cii & iv). Importantly, the mutation of leucine

358 of the Cyt1 domain (CD46-Cyt1L358R), that had abrogated GAL4-CtermDlg4 binding

in yeast two hybrid assays, prevented basolateral targeting (compare Fig6 Di & iii with Dii &

iv). Although CD46-Cyt1L358R could still be observed on the basolateral domain, protein

was also apical, indicating that the mechanism for localizing CD46-Cyt1 specifically to the

basolateral domain had been prevented. These observations suggest that the interaction with

Dlg is required for CD46 polarization.

To further verify this hypothesis, we sought to block the interaction between CD46 and Dlg

and to investigate the effect of this block on CD46 polarization. We speculated that, if

CD46-Cyt1 was polarized via an interaction with a PDZ-containing protein, we would be

able to block that interaction by overexpression of the PDZ3 domain in isolation from the rest

of the molecule. We created a construct that encoded PDZ3 fused in frame to EGFP to

enable monitoring of expression. Because the EGFP emitted at similar wavelengths to FITC,

we labeled both upper and lower chambers with Fluo594 for these experiments. The

expression of CD46-Cyt1 gave the expected basolateral staining (Fig7 Ai & iii), but

coexpression of CD46-Cyt1 with the PDZ3 domain of Dlg4 fused to EGFP (EGFP-PDZ3)

prevented the basolateral polarization of CD46-Cyt1 (Fig7 Aii & iv). Thus, in the presence

of the EGFP-PDZ3, CD46-Cyt1 was expressed on both apical and basolateral surfaces,

resembling the localization of CD46-Cyt2. The expression of EGFP-PDZ3 had no effect on

the polarization of Cyt2 (compare Fig7 Bi & iii with Fig 7 Bii & iv). These data are

consistent with the model that overexpression of a PDZ3 domain can compete with wildtype


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


17

PDZ-containing domains to prevent the basolateral targeting of CD46. These data together

strongly suggest that CD46-Cyt1 is polarized via an interaction with Dlg proteins.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


18

DISCUSSION

We describe here a novel interaction between the Cyt1 cytoplasmic domain of CD46 (a

receptor for complement, measles virus and HHV6), and Dlg4 (an adaptor protein that

mediates signaling in the synapses of neurons), and demonstrate that Dlg4 or a similar protein

can regulate the intracellular trafficking of CD46 in epithelial cells. These studies highlight a

role for Dlg4 in the organization of epithelial cells, suggest the mechanism by which CD46

polarization is regulated, and provide a basis for the understanding of CD46 signal

transduction mechanisms.

A role for Dlg4 in epithelial polarization. The ubiquitous expression of Dlg4 has been

described previously (44), but attention has remained focused on a role for Dlg4 in nervous

tissue. We were interested in the possibility that CD46 and Dlg4 might interact in the brain,

because both measles virus and HHV6 (two pathogens that use CD46 as a receptor) are

associated with neuronal pathology (for instance subacute sclerosing panencephalitis caused

by measles, and febrile convulsions and encephalitis caused by HHV6, 46, 47). It is

conceivable that a component of this pathology could be due to effects on Dlg4 function, and

particularly on nitric oxide-mediated toxicity (48), caused by pathogen-receptor interactions.

In the absence of human brain sections of suitable quality for immunostaining, we looked for

colocalization of CD46 and Dlg in the brain of a mouse transgenic for CD46-Cyt1 (49).

These data suggest that CD46 and Dlg4 are not colocalized in neurons (data not shown), so

we have no evidence to suggest that CD46 and Dlg4 have a functional interaction in the

brain. However, our data indicate for the first time a possible role for Dlg4 in regulating the

polarization of CD46 in epithelial tissue. We identified mRNA transcripts for Dlg4 in


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


19

MDCK cells, and in human epithelial cell lines, using RT-PCR (data not shown). Scanning

of the EST databases and SAGE analysis indicates that Dlg4 is expressed in tissues such as

normal ovarian epithelium, normal ductal epithelial cells, adenomas and adenocarcinomas.

In addition, immunostaining with an antibody specific for Dlg4 showed expression in normal

human epithelial tissue. It is possible that Dlg4 and Dlg1 may both contribute to the

polarization of epithelial proteins.

Interestingly, the Dlg4 clone that we isolated during our yeast two hybrid screen contained a

110 base deletion, which changed the reading frame and therefore resulted in deletion of most

of the guanylate kinase-like domain. Clones with this deletion have been identified

previously from mammary gland and testicular tissue (44), and we have identified it in

numerous cell types by RT-PCR (data not shown) and searching of the GenBank EST

databases. Searching for EST sequences corresponding to this region indicated that the

splicing of Dlg4 is tissue specific. Of the 12 sequences that contained exon 20, 11 were

from brain or nervous tissue. By contrast, of the 8 sequences in which exon 20 was deleted,

all were from non-brain derived tissue such as breast, prostate and head and neck tumors, and

Wilm’s tumor. We show here that both splice variants of Dlg4 can bind to CD46. Recent

reports have suggested that Dlg4 adopts a tertiary conformation in which the interaction of

the GuK domain with other regions of the protein affect the capacity of Dlg4 to bind to and

cluster other proteins (50, 51). It is therefore likely that these splice variants might differ in

their ability to recruit proteins into a signaling complex. The tissue-specific splicing of Dlg4

may reflect a different function for the protein in different tissues. The data described above

indicate both that Dlg4 is expressed in epithelial tissues, and that Dlg4 in epithelial tissues is

an alternatively spliced form.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


20

A mechanism for the basolateral targeting of CD46. Three studies have described the

basolateral targeting of CD46 in the polarized MDCK epithelial cell line. The targeting of

CD46-Cyt1 isoforms was prevented by various mutations in the last 4 amino acids of the

CYT1 domain (7-9). The molecular mechanisms regulating this polarization had not been

elucidated, but it was thought that the FTSL sequence might operate in a similar manner to a

canonical YxxL basolateral targeting sequence. In light of the observed interaction between

CD46 and Dlg, we considered the alternative possibility that Dlg4 or a related family member

might regulate the polarization of CD46 in epithelial cells. We show: (i) that the L358R

mutant (which fails to bind Dlg4) is targeted differently than the wild-type CD46-Cyt1, (ii)

that expression of the PDZ3 domain of Dlg4 alone (PDZ3-EGFP) can affect the basolateral

targeting of CD46 (perhaps acting as a dominant negative inhibitor of Dlg family binding),

and (iii) that the two proteins are copolarized in normal human epithelial cells. A previous

report (7) had shown that an isoform containing the Cyt2 domain of CD46 (that does not bind

to Dlg4) is also basolateral in MDCK cells. However, in our hands this was not the case, and

three different clones expressing Cyt2 isoforms displayed a non-polarized distribution similar

to that of CD46(L358R) and of the Cyt1 isoform coexpressed with PDZ3-EGFP. We do not

know why our data are different to the published data (7), however our results fit with the

idea that basolateral targeting of CD46 requires an interaction between the FTSL region of

the Cyt1 domain and Dlg4 or related proteins. This study (7) also showed other mutations

that prevented basolateral targeting, and all of these mutations disrupted the consensus PDZ-

binding motif of CD46 and so are likely to prevent binding of CD46 to Dlg4. Although it

was suggested that the FTSL sequence mediates targeting by its resemblance to a YxxL

basolateral targeting sequence (8, 9), it is not usual for such a sequence to (i) remain


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


21

functional when the tyrosine is replaced by a phenylalanine, and (ii) be functional at the C-

terminus of a protein. Interestingly, there is a YxxL motif just upstream of the sequence that

Maisner et al define as the cytoplasmic domain (see Fig1 A). We mutated this motif (Y to A)

in both the Cyt1 and Cyt2 isoforms of CD46 and found no effect on the polarization of CD46

(data not shown). Furthermore, we found that CD46 expressed in MDCK cells could be

internalized irrespective of binding to Dlg, and that expression of Dlg did not chance the rate

or extent of internalization (data not shown). We suggest that the mechanism by which the

FTSL sequence regulates the basolateral distribution of CD46-Cyt1 is through an interaction

with the PDZ domain of Dlg4 or a similar molecule.

We were concerned that the polarization of CD46 in MDCK cells might not necessarily

reflect trafficking in normal human polarized cells, and so investigated the expression of both

CD46 and Dlg4 in human kidney sections. CD46 was clearly polarized in kidney (Fig5) and

gut (data not shown) epithelial cells, and colocalized with Dlg4 and the Dlg family. Both

proteins were apical in these cells, rather than basolateral as in the MDCK cells. The

localization of other polarized proteins has been shown to change depending on the cell in

which it is expressed (52, 53). Interestingly, our immunohistochemistry indicates that all of

the CD46 in human kidney epithelium is polarized, even though our data suggests that Cyt2

isoforms would not be polarized. Possible explanations for this observation include either

that the Cyt2 domain is not expressed in these tissues, or that it is “piggy-backed” by the Cyt1

domain when the isoforms are coexpressed. We favour the second hypothesis, as we have

seen significant expression of the Cyt2 isoforms in kidney tissue, and in epithelial cell lines

(54, data not shown).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


22

The mechanisms by which CD46 transmits intracellular signals is not yet known. The known

role of Dlg4 as a scaffold for signaling complexes, and the wealth of literature showing

interactions between Dlg4 and other signaling molecules, provides a basis for the

investigation of interactions between CD46 and many of these signaling proteins. For

example, Dlg proteins interact with the src-family kinases, lck and fyn (34, 35), and CD46

can be phosphorylated by lck (17). It will be interesting to determine whether the

phosphorylation of CD46 by lck is mediated by an interaction through Dlg4. Importantly, we

have identified a single residue of the CD46 Cyt1 domain that can be mutated to prevent the

interaction with Dlg4. This can be used to determine the relevance of Dlg to cellular effects

mediated by CD46 signaling, such as effects on cytokine production.

These data described in this study indicate that the Cyt1 domain of CD46 is both physically

and functionally associated with Dlg4. This is the first identification of a direct, and isoform-

specific interaction between CD46 and an intracellular protein, forming a potential platform

for the assembly of a signaling complex. This interaction provides a molecular mechanism

for the polarization of CD46 in epithelial cells described previously (7-9). Furthermore, these

data suggest that, in addition to the documented role of Dlg4 in establishing neuronal

architecture, Dlg4 may contribute to epithelial cell polarization.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


23

REFERENCES

1. Oglesby, T.J., Allen, C.J., Liszewski, M.K., White, D.J., and Atkinson, J.P. (1992) J.

Exp. Med. 175, 1547-51.

2. Naniche, D., Varior-Krishan, G., Cervoni, F., Wild, T.F., Rossi, B., Rabourdin-Combe, C.,

and Gerlier, D. (1993) J.Virol. 67, 6025-6032.

3. Dorig, R.E., Marcil, A., Chopra, A. and Richardson, C.D. (1993) Cell, 75, 295-305.

4. Manchester, M., Eto, D.S., Valsamakis, A., Liton, P.B., Fernandez-Munoz, R., Rota, P.

A., Bellini, W.J., Forthal, D.N., and Oldstone, M.B. (2000) J Virol 74, 3967-74.

5. Santoro F, Kennedy PE, Locatelli G, Malnati MS, Berger EA, Lusso P. (1999) Cell.

99, 817-27.

6. Russell, S.M., Sparrow, R.L., McKenzie, I.F.C. and Purcell, D.F.J. (1992). Eur. J.

Imm. 22: 1513-1518.

7. Maisner, A., Liszewski, M. K., Atkinson, J. P., Schwartz-Albiez, R., and Herrler, G.

(1996) J Biol Chem 271, 18853-8.

8. Maisner, A., Zimmer, G., Liszewski, M. K., Lublin, D. M., Atkinson, J. P., and Herrler,

G. (1997) J Biol Chem 272, 20793-9.

9. Teuchert, M., Maisner, A., and Herrler, G. (1999) J Biol Chem 274, 19979-84.

10. Karp, C. L., Wysocka, M., Wahl, L. M., Ahearn, J. M., Cuomo, P. J., Sherry, B.,

Trinchieri, G., and Griffin, D. E. (1996). Science 273, 228-31.

11. Karp, C. L. (1999) Immunol Rev 168, 91-101.

12. Imani, F., Proud, D. and Griffin, D.E. (1999) J. Immunol. 162, 1597-602.

13. Hirano, A., Yang, Z., Katayama, Y., Korte-Sarfaty, J., and Wong, T. C. (1999) J Virol

73, 4776-85.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


24

14. Katayama, Y., Hirano, A., and Wong, T. C. (2000) J Virol 74, 1252-7.

15. Astier A, Trescol-Biemont MC, Azocar O, Lamouille B, Rabourdin-Combe C.

(2000) J. Immunol. 164, 6091-5.

16. Marie, J.C., Kehren, J., Trescol-Biemont, Evlashev, A., Valentin, H., Walzer, T.,

Tedone, R., Loveland, B., Bicholas, J.F., Rabourdin-Combe, C. and Horvat, B. (2001)

Immunity 14, 69-79.

17. Wang, G., Liszewski, M.K., Chan, A.C. and Atkinson, J.P. (2000) J. Immunol. 164,

1839-1846.

18. Kurita-Taniguchi M, Fukui A, Hazeki K, Hirano A, Tsuji S, Matsumoto M, Watanabe

M, Ueda S, Seya T. (2000) J Immunol. 165, 5143-52.

19. Woods, D.F & Bryant, P.J. (1991) Cell 66, 451-64.

20. Fujita, A. & Kurachi, Y. (2000) Biochem. Biophys. Res. Commun. 269, 1-6.

21. Dimitratos, S.D., Woods, D.F., Stathakis, D.G., and Bryant, P.J. (1999) BioEssays

21, 912-921.

22. Garner, C.C., Nash, J. & Huganir, R.L. (2000) Trends. Cell. Biol. 10, 274-80.

23. Kornau, HC., Schenker LT., Kennedy MB., and Seeburg, P.H. (1995) Science. 269,

1737–40.

24. Kim, E., Niethammer, M., Rothschild, A., Jan, Y. N., and Sheng, M. (1995) Nature

378, 85-8.

25. Irie, M., Hata, M., Ichtenko, K., Toyoda, A., Hirao, K., Takai, Y., Rosahl, T.W.,

Sudhof, T.C. (1997) Science, 277, 1511–5.

26. Huang Y.Z., Won, S., Ali, D.W., Wang, Q., Tanowitz, M., Du, Q.S., Pelkey, K.A.,

Yang, D.J., Xiong, W.C., Salter, M.W., and Lin Mei (2000). Neuron, 26. 443–455.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


25

27. Husi, H., Ward, M.A., Choudhary, J.S., Blackstock, W.P. and Grant, S.G.N. (2000)

Nat Neurosci. 3:661-9.

28. Sheng, M., and Sala, C. (2001). Annu Rev. Neuro. 24, 1-29.

29. Hanada, T., Lin, L., Chandy, K.G., Oh, S.S. & Chisti, A.H. (1997) J. Biol. Chem.

272, 26899.

30. Kim, E., Naisbitt, S., Hsueh, Y.-P., Rao, A., Rothschild, A., Craig, A.M., and Sheng, M.

(1997) J. Cell. Biol. 136, 669-678.

31. Kim, J.H., Liao, D., Lau, L.-F., & Huganir, R.L. (1998) Neuron 20, 683.

32. Niethammer, M., Valtschanoff, J.G., Kapoor, T.M., Allison, D.W., Weinberg, R.J.,

Craig, A.M. & Sheng, M. (1998) Neuron 20, 693.

33. Passafaro, M., Sala, C., Niethammer, M. and Sheng, M. (1999) Nature Neuroscience,

2, 1063-1069.

34. Tezuka, T., Umemori, H., Akiyama, T., Nakanishi, S., and Yamamoto, T. (1999) Proc.

Natl. Acad. Sci (USA) 96, 435-440.

35. Hanada, T., Lin, L., Tibaldi, E. V., Reinherz, E. L., and Chishti, A. H. (2000) J Biol

Chem. 275, 28774-84.

36. Savinainen A, Garcia, E.P., Dorow, D., Marshall, J. and Liu, Y.F. (2001) J. Biol.

Chem. 276,11382-6.

37. Kim, S. K. (1997) Curr Opin Cell Biol 9, 853-9.

38. Fanning, A. S., and Anderson, J. M. (1999) J Clin Invest 103, 767-72.

39. James, P., Halladay, J. & Craig, E.A. (1996) Genetics 144, 1425 – 1436.

40. Browne, K.A, Johnstone, R.W., Jans, D.A., and Trapani, J.A. (2000) J. Biol. Chem

275, 39262-6.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


26

41. Doyle, D.A., Lee, A., Lewis, J., Kim, E., Sheng, M. and MacKinnon, R. (1996) Cell 85,

1067-1076.

42. Jones, T.A. and Kjeldgaard, M. (1994) O - The Manual. Uppsala University Press,

Uppsala.

43. Stathakis, D.G., Hoover, K.B., You, Z., and Bryant, P.J.. (1997) Genomics, 44, 71–

82.

44. Stathakis, D.G., Udar, N, Sandgren, O., Andreasson, S., Bryant, P.J., Small, K., and

Forsman-Semb, K. (1999) J. Neurochem. 73, 2250-2265.

45. Topinka, J.R. and Bredt, D.S. (1998) Neuron 20, 125-134.

46. Scheider-Schaulies S, ter Meulen, V. (1999) Arch Virol. Suppl 15, 139-58.

47. Campadelli-Fiume, G., Mirandola, P. and Menotti, L. (1999) Emerging Infectious

Diseases 5, 353-366.

48. Sattler, R., Xiong, Z., Lu, W.-Y., Hafner, M., MacDonald, J.F., and Tymianski, M.

(1999). Science, 284, 1845-1848.

49. Thorley, B.R., Milland, J., Christiansen, D., Lanteri, M.B., McInnes, B., Moeller, I.,

Rivailler, P., Horvat, B., Rabourdin-Combe, C., Gerlier, D., McKenzie, I.F.C., and

Loveland, B.E. (1997) Eur. J. Immunol. 27, 726 – 734.

50. Wu, H., Reissner, C., Kuhlendahl, S., Coblent, B., Reuver, S., Kindler, S., Gundelfinger,

E.D., and Garner, C.C. (2000) EMBO J 19, 5740-5751.

51. McGee, A.W. and Bredt, D.S. (1999) J. Biol. Chem 274, 17431-17436.

52. Roush, D.L., Gottardi, C.J., Naim, H.Y., Roth, M.G., aand Caplan, M.J. (1998) J.

Biol. Chem 273, 26862-9.

53. Breton, S., Wiederhold, T., Marshansky, V., Nsumu, N.N., Ramesh, V. and Brown,

D. (2000) J. Biol. Chem 16, 18219-24.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


27

54. Johnstone, R.W., Russell, S.M., Loveland, B.E. and McKenzie, I.F. (1993) Mol Immunol

30, 1231-41.

55. Evans, S.V. (1993) J. Molec. Graphics 11, 134-138.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


28

FOOTNOTES.

We thank Phillip James (University of Wisconsin) for the PJ yeast strain, Peter Gunning

(New Children’s Hospital, NSW) for the antibody to β-actin, Caroline Farrelly and Manuella

Palatsides (Peter MacCallum Cancer Institute) for technical assistance, Alpha Yap

(University of Queensland) for helpful discussions and Ricky Johnstone and Joe Trapani

(Peter MacCallum Cancer Institute), and Julie Milland (Austin Research Institute) for critical

reading of the manuscript.

S. Russell is supported by a Wellcome Senior Research Fellowship in Medical Science in

Australia.

Abbreviations are : Dlg, Discs large; FITC, fluorescein isothiocyanate; MDCK, Madin-Darby

canine kidney; SAP, synapse-associated protein; MAGUK, membrane-associated Guanylate

kinase; PSD, Post-synaptic density.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


29


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


30

FIGURE LEGENDS

Figure 1. Structure of CD46 and Dlg4. (A) Sequence of the two alternatively spliced

cytoplasmic domains of CD46. Immediately following the hydrophobic transmembrane

domain is a common domain of 12 amino acids starting at amino acid 331, followed by

unique sequence of 15 or 23 amino acids for the Cyt1 and Cyt2 domains respectively.

Numbering of CD46 amino acid residues is according to Russell et al (6). (B) Schematic of

the domain structure of CD46 and constructs of CD46 used in this study. (i) & (ii) The

extracellular domain of CD46 is composed of four Short Consensus Repeat (SCR) domains

responsible for binding to ligands (filled ovals), and the glycosylated Ser/Thr/Pro (STP-rich

domain, bold line), the transmembrane domain (thin line) is common in all isoforms and is

followed by the cytoplasmic domain 1 (dotted oval) or 2 (hashed oval). (iii) The point

mutation (L358R) in the cytoplasmic domain of Cyt1, which prevents binding to Dlg4, is

indicated by an X. For yeast two hybrid analysis the GAL-4 activation domain (square) was

fused to the sequence corresponding to the Cyt1 domain of CD46 (iv), the Cyt1 domain with

a L358R mutation (v), or the Cyt2 domain (vi). The Cyt1 (vii) and Cyt2 (viii) domain was

also fused to glutathione-S-transferase (GST)(indicated by a triangle). (C) Schematic of the

domain structure of Dlg4 and constructs of Dlg4 used in this study. (i) Dlg4 is composed of 3

PDZ domains (triangles), an SH3 domain (rectangle) and a GuK (guanylate kinase) domain

(oval). (ii) An alternatively spliced isoform of Dlg4 in which most of the GuK domain is

deleted (circle). (iii) The clone isolated during Yeast Two Hybrid screening contains the

GAL4 activation domain (square) fused to Dlg4 beginning at residue 198 in PDZ 2, and

corresponds to the isoform in which most of the GuK domain is deleted. Constructs created

for this study include (iv) the original Yeast Two Hybrid clone with a stop codon


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


31

immediately after the PDZ3 domain, (v) the original Yeast Two Hybrid clone with a single

amino acid change in Arg 318 of PDZ3, and (vi) the PDZ3 domain of Dlg4 fused in frame to

EGFP (filled rectangle). Sequence numbering is from Stathakis et al (43).

Fig2. Dlg4 binds specifically to the Cyt1 domain of CD46 through PDZ3. (A). The

interaction between Dlg4 and CD46 requires PDZ3 of Dlg4. Yeast strain PJ69-4A was

cotransformed with (i) GAL4-AD-Dlg4, (ii) GAL4-AD-Dlg4mutPDZ3, (iii) GAL4-AD-

Dlg4(trunc) or (iv) GAL4-ABP280 together with GAL4-BD-Cyt1. Yeast colonies were

subjected to growth tests on selective medium deficient in Leu, Trp and His. (B) The

interaction between Dlg4 and CD46 is specific for the C-terminus of the Cyt1 domain of

CD46. Yeast strain PJ69-4A was cotransformed with isolated GAL4-AD-Dlg4 together with

(i) GAL4-BD-Cyt1, (ii) GAL4-BD-Cyt2, (iii) GAL4-BD-Cyt1(L358R), (iv) pLAM, and (v)

pAS2-1. Yeast colonies were subjected to growth tests on selective medium deficient in Leu,

Trp and His.

Fig. 3. CD46-Cyt1 interacts with Dlg4 expressed in mammalian cells. (A) Human 293T

cells were transfected with vector alone, Dlg4, or Dlg4-DelGuK (left panel). Cell lysates

were incubated with beads coupled to GST, GST-Cyt1, or GST-Cyt2 fusion protein. After

extensive washing the bound protein was electrophoresed under reducing conditions and

immunoblotted with antibody to Dlg4 (right panel).

Figure 4. The Cyt1 domain is compatible with the model of the PDZ3 domain. (A) X-ray

crystallographic structure of the third PDZ domain of Dlg4 (blue) in complex with its peptide

ligand QTSV (orange) (41). PDZ amino acids 308-402 are shown. PDZ sidechains (white)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


32

interacting with the peptide specifically are Arg318, Gly 322, Leu323, Gly324, Phe325,

Asn326, Ile327, Gly329, Ser339, His372, Leu379, and Gly383. A well-ordered H2O molecule

(red) hydrogen bonds the peptide carboxylate group to Arg318 of PDZ. (B) Molecular model

of peptide FTSL (green) interacting with PDZ domain, based on the crystal structure of PSD-

95 complex seen in figure A. Images were generated with Setor (55).

Fig. 5. CD46 and Dlg4 are coexpressed and copolarized in normal human epithelial

cells. A. Sections of a normal human kidney were immunostained with antibodies to (i)

the murine Ly2.1 antigen (IgG2a antibody, negative control antibody), (ii) the Dlg family,

(iii) Dlg4, and (iv) CD46 (1840). B. To determine whether the apical staining was due to

inaccessibility of the basolateral regions to antibody, immunostaining with antibody to the

Dlg family (i) was compared with immunostaining with antibody to actin (ii). Sections

were counterstained with haemotoxylin, specific staining is represented by the brown

color, and scale bars represent 100 µm (A, left panels) and 10 µm (A, right panels and B).

Fig 6. The Dlg4-binding site of CD46 is required for basolateral targeting in polarized

MDCK cells. A. MDCK cells transfected with CD46-Cyt1 were grown to confluency on

trasnwell plates, fixed in methanol for 20 minutes and immunostained with antibodies to Dlg

family (followed by Fluo-594-labelled secondary antibody, panel i and red in panel iii) or to

CD46 (followed by FITC-labelled secondary antibody, panel ii and green in panel iii). An

optical section was taken through the middle of the cells. B. MDCK were transfected with

CD46-Cyt1 (i & iii) or with a vector control (ii & iv), and immunostained to detect apical (i

& ii) or basolateral (iii & iv) expression of CD46 with the 1840 rabbit antibody to CD46.

Cells were seeded onto transwell plates and grown to confluency. The upper and lower


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


33

surfaces of the membrane were stained with the 1840 antibody to CD46 and either FITC-

labeled (upper) or Fluo-594-labelled (lower) anti-rabbit secondary antibodies. The slides

were viewed by confocal microscopy, with images taken horizontally, at the apical (upper) or

basolateral (lower) level of the monolayer, and vertically (bottom images). C. MDCK cells

were transfected with CD46-Cyt1 (i, iii, v) and CD46-Cyt2 (ii, iv, vi) and cultured and

stained as for A. Vertical sections (v & vi) indicate both basolateral (green) and apical (red)

staining. D. MDCK cells were transfected with CD46-Cyt1 (i, iii, v) and CD46-

Cyt1(L358R) (ii, iv, vi) and cultured and stained as for A. Vertical sections (v & vi) indicate

both basolateral (green) and apical (red) staining.

Fig 7. Expression of the PDZ3 domain of Dlg4 prevents basolateral targeting of CD46-

Cyt1. MDCK cells were firstly transfected with CD46-Cyt1 (A) or CD46-Cyt2 (B), and then

were cotransfected with EGFP (i & iii) or EGFP-PDZ3 (ii & iv), sorted by flow cytometry for

EGFP fluorescence, and tested for polarization of CD46. Cells were seeded onto transwell

plates and grown to confluency. The upper and lower surfaces of the membrane were stained

with the 1840 antibody to CD46 and Fluo-594-labelled anti-rabbit secondary antibodies. The

slides were viewed by confocal microscopy, with images taken horizontally, at the apical

(upper) or basolateral (lower) lever of the monolayer.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Loveland, Margaret Bills, Sarah Ellis and Sarah M. RussellMandy J. Ludford-Menting, Suzanne J. Thomas, Blessing Crimeen, Lisa J. Harris, Bruce E.

polarisationA functional interaction between CD46 and Dlg4: a role for Dlg4 in epithelial

published online November 19, 2001J. Biol. Chem.

10.1074/jbc.M108479200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M108479200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M108479200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/11/19/jbc.M108479200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2001/11/19/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/11/19/jbc.M108479200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

CD46 and Dlg4 interact. 1 A functional interaction between ... · evidence for an interaction between CD46 and Dlg4, (ii) ... epithelial cell line, ... Sequence coding for the PDZ3