Upload
blaze-cross
View
214
Download
0
Tags:
Embed Size (px)
Citation preview
Biotechnology MethodsBiotechnology Methods
•Producing Recombinant DNAProducing Recombinant DNA
•Locating Specific GenesLocating Specific Genes
•Studying DNA SequencesStudying DNA Sequences
Recombinant DNARecombinant DNA
• DNA Produced by Joining DNA Produced by Joining Segments of DNA From Different Segments of DNA From Different SourcesSources
• eg. Bacterial plasmid DNA + eg. Bacterial plasmid DNA + Human DNA to Produce Human Human DNA to Produce Human InsulinInsulin
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Restriction enzymes: enzymes that Restriction enzymes: enzymes that cleave the DNA double helix at cleave the DNA double helix at specific nucleotide sequencesspecific nucleotide sequences
Use of the Restriction Enzyme Bam H1Use of the Restriction Enzyme Bam H1
5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’
5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’
sticky endsticky end
sticky endsticky end
Results inResults in
DNA fragments from different sources can be joined DNA fragments from different sources can be joined together if they have complementary sticky ends.together if they have complementary sticky ends.
Tools for Producing Recombinant DNATools for Producing Recombinant DNA
Plasmid: extrachromosomal, Plasmid: extrachromosomal, independently replicating, small circular independently replicating, small circular DNA molecule; a type of vector used to DNA molecule; a type of vector used to carry DNA into bacterial cellscarry DNA into bacterial cells
DNA Inserted in a Plasmid Can be Detected DNA Inserted in a Plasmid Can be Detected by Disruption of a Selectable Markerby Disruption of a Selectable Marker
ampR
tetR
Bam H1Bam H1
If additional DNA is inserted at the Bam H1 site, the tetR gene is disrupted and is no longer functional
ampR
Producing Recombinant DNA Producing Recombinant DNA
restriction enzyme
Treat source Treat source DNA with DNA with restrictionrestrictionenzymeenzyme
Treat plasmid Treat plasmid DNA with DNA with same enzymesame enzyme
restriction enzyme
Mix togetherMix togetherAdd DNA LigaseAdd DNA Ligase
Many recombinant DNAMany recombinant DNAmolecules are produced,molecules are produced,each with a different each with a different piece of source DNA piece of source DNA
TransformTransform bacterial cells bacterial cells
Each bacterial cellEach bacterial cellcarries a different carries a different recombinant plasmidrecombinant plasmid
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the gene of interest; complementary to the gene of interest; Used to locate a copy of the gene by Used to locate a copy of the gene by hybridizationhybridization
Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene
AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA
AATCGCAGCTTAGCGATAGCTTAGCGAT
TCGAATCGCTATCGAATCGCTA
Denature DNA by heatingDenature DNA by heating
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Library: collection of DNA sequences Library: collection of DNA sequences from one donor that can be screened by from one donor that can be screened by a probe to detect the gene of interesta probe to detect the gene of interest– Genomic library = Genomic library = allall of the sequences of the sequences
from the genome of a single organismfrom the genome of a single organism– cDNA library= complementary DNA, cDNA library= complementary DNA,
made using mRNA as a template, made using mRNA as a template, used to study used to study transcribedtranscribed sequences sequences
Producing cDNA MoleculesProducing cDNA Molecules
TTTTTTTT
Exon 1 Exon 2 Exon 3G AAAAAAAA…… mRNA
Reverse transcriptaseOne strand of cDNA
TTTTTTTT
AAAAAAAADNA polymerase
TTTTTTTT
AAAAAAAA
Second strand of cDNA
nuclease nuclease
cDNA
To produce a cDNA library, each cDNA from the same cell
type would be inserted into a
vector
Applying Your KnowledgeApplying Your Knowledge
Which one best describesWhich one best describes• An enzyme that cleaves DNA at specific sequences?An enzyme that cleaves DNA at specific sequences?• A sequence of DNA that is complementary to the gene A sequence of DNA that is complementary to the gene
of interest?of interest?• A collection of DNA molecules used to find a gene of A collection of DNA molecules used to find a gene of
interest?interest?• A small, independently replicating DNA molecule?A small, independently replicating DNA molecule?
1.1. ProbeProbe2.2. CloneClone3.3. PlasmidPlasmid4.4. LibraryLibrary5.5. Restriction EnzymeRestriction Enzyme
Biotechnological Methods: PCRBiotechnological Methods: PCRhttp://www.dnalc.org/ddnalc/resources/pcr.htmlhttp://www.dnalc.org/ddnalc/resources/pcr.html
PCR = Polymerase Chain Reaction PCR = Polymerase Chain Reaction
Amplifies a specific region in the DNAAmplifies a specific region in the DNA Used for identification, especiallyUsed for identification, especially if the amount of DNA is small if the amount of DNA is small Uses repeated cycles of heating to Uses repeated cycles of heating to denature DNA and cooling to synthesize denature DNA and cooling to synthesize new DNA new DNAInvolves the use of Involves the use of
---Taq polymerase (withstands heat)---Taq polymerase (withstands heat)
---primers to begin synthesis---primers to begin synthesis
Polymerase Chain Reaction:Polymerase Chain Reaction:One PCR CycleOne PCR Cycle
OriginalOriginalDouble-Double-helixhelixDNADNA
SeparateSeparateDNADNAStrandsStrands
90 °C90 °C
Primers &Primers &TaqTaqpolymerasepolymerasebindbind
50 °C50 °C
Taq PolymeraseTaq Polymerase PrimerPrimer
72 °C72 °C
DNADNAsynthesizedsynthesized
Polymerase Chain Reaction:Polymerase Chain Reaction:Multiple PCR CyclesMultiple PCR Cycles
DNADNAfragmentfragment
to beto beamplifiedamplified
2 copies2 copies 4 copies4 copies 8 copies8 copies
Biotechnological Methods: RFLPBiotechnological Methods: RFLP
RFLP AnalysisRFLP Analysis
RRestriction estriction FFragment ragment LLength ength PPolymorphismolymorphism
• Use of a probe to identify specific DNA Use of a probe to identify specific DNA fragments derived from restriction enzyme fragments derived from restriction enzyme digestion digestion
• Shows variations in sizes of fragments Shows variations in sizes of fragments between different individuals between different individuals
DNA separated by sizeDNA separated by sizeis transferred from is transferred from agarose gel to filteragarose gel to filter
DNA on filter is DNA on filter is exposed to probe exposed to probe to detect to detect complementary complementary sequences.sequences.
Southern Blotting for RFLP AnalysisSouthern Blotting for RFLP Analysis
CC SSRR CCII EE
MM NNEE EE
RFLP Analysis in ForensicsRFLP Analysis in Forensics
11 22 33 44 55 66 77
SuspectsSuspects SuspectsSuspects