Biogenesis, Maturation and Surface Trafficking of Wild-Type and Mutant

CFTR

Ph.D. Dissertation

Károly Varga, M.D.

School of Basic Medicine

Semmelweis University, Budapest

and

Department of Cell Biology

University of Alabama at Birmingham, Birmingham, AL

Supervisor: LászlóRosivall, MD, PhD, DSc

Consultant: James F. Collawn, PhD (UAB)

Official reviewers: László Tretter, MD, PhD, DSc

József Kardos, PhD

Chairman of the committee: László Buday, MD, PhD, DSc

Members of the committee: Péter Várnai, MD, PhD

Gergely Szakács, MD, PhD, DSc

Budapest-Birmingham, AL

2010

2

TABLE OF CONTENTS

1. Abbreviations 4

2. Introduction 6

2.1. Cystic Fibrosis and CFTR 6

2.2. CFTR Structure and Biochemistry 7

2.3. The ΔF508 Mutant CFTR 7

2.4. Ablation of Internalization Signals 8

2.5. Intracellular Processing of CFTR 9

2.6. DF508 CFTR Rescue and Stability 11

3. Aims and hypotheses 14

4. Materials and methods 15

4.1. Construction of CFTR Mutants 15

4.2. Tyransient Transfection of COS-7 Cells 15

4.3. Cell Culture 15

4.4. Small Molecular Correctors (Pharmacological Chaperones 16

4.5. Immunoprecipitation 17

4.6. Biotinylation 17

4.7. Internalization Assays 18

4.8. CFTR Cell-Surface Half-Life Measurements 18

4.9. Metabolic Pulse-Chase Assays 18

4.10. Western Blot 20

4.11. Whole Cell patch Clamp Assay 20

4.12. Single Cell Patch Clamp 21

4.13. Semiquantitative RT-PCR 22

4.14. Fluorescence-Based Kinetic Real-Time PCR 22

4.15. Microscopy 23

4.16. Ussing Chamber Abnalyses 23

4.17. Statistical Analysis 24

5. Results 25

5.1. Ablation of Internalization Signals in the C-terminal Tail of CFTR

enhances Surface expression 25

3

5.1.1. Mutations in the Carboxy-Terminal Tail of CFTR Increase Surface

Expression 25

5.1.2. Mutations at Tyr1424

and Ile1427

Do Not Alter CFTR Maturation

Efficiency or Protein Half-life 26

5.1.3. Tyrosine 1424 and Isoleucine 1427 Are Necessary for CFTR

Endocytosis 26

5.1.4. The Y1424A and Y1424A,I1427A CFTR Have Normal Chloride

Channel Properties 27

5.2. Intracellular Processing of CFTR is Efficient in Epithelial cell Lin 35

5.2.1. Calu-3 Cells Express High Levels of CFTR Compared with

Heterologous Expression Systems 35

5.2.2. Maturation and Protein Stability Are Enhanced in Calu-3Cells 36

5.2.3. ERAD of CFTR Is Insignificant in Calu-3 Cells 37

5.2.4. Cell Surface CFTR Expression Is Elevated in Calu-3 Cells 37

5.2.5. CFTR Maturation Is Efficient in T84 Cells Grown under Standard

Tissue Culture Conditions 38

5.3. Pharmacological Chaperones Enhance Surface Stability of ΔF508CFTR 49

5.3.1. ΔF508CFTR rescue by permissive temperature in HeLaDF cells 49

5.3.2. Extended half-life of r ΔF508 CFTR at the permissive temperature

in HeLaDF cells 50

5.3.3. rΔF508CFTR endocytosis is accelerated in airway epithelial cells 50

5.3.4. Shortened cell-surface half-life of r ΔF508CFTR in CFBE41o

cells 52

5.3.5. Permissive temperature culture stabilizes r ΔF508CFTR in polarized

epithelial cells 52

5.3.6. Permissive temperature culture corrects the functional defect

associated with r ΔF508CFTR 53

5.3.7. Pharmacological chaperones correct the internalization defect and

increase the surface stability of r ΔF508CFTR 54

5.3.8. Pharmacological chaperones extend the cell-surface half-life of

rΔF508 CFTR 55

6. Discussion 66

4

7. Conclusions 75

8. Summary 77

9. My Publications associated with the Thesis 82

10. My publications not associated with the Thesis 86

11. Acknowledgements 87

12. References 89

5

1. ABBREVIATIONS

ABC ATP-binding cassette

ATP adenosine triphosphate

Band B core glycosylated CFTR

Band C complex glycosylated CFTR

BHK baby hamster kidney

cAMP cyclic adenosine monophosphate

Calu-3 human lung adenocarcinoma metastasis

CF cystic fibrosis

CFBE41o- CF bronchial epithelium

CFTR cystic fibrosis transmembrane conductance regulator

CHO Chinese hamster ovary

CMV cytomegalovirus

Cor-325 (VRT-325, 4-cyclohexyloxy-2-{1[4-(4-methoxy-

benzensulfonyl)-piperazin-1-yl]-ethyl}-quinazoline)

Corr-4a [2-(5-Chloro-2-methoxy-phenylamino)-4‟-methyl-

[4,5‟]bithiazolyl-2‟-]-phenyl-methanone

COS-7 kidney cells of the African green monkey

C-tail carbocyl-terminal tail

ΔF508 mutation with phenylalanine missing at position 508

DMSO dimethyl-sulfoxide

ER endoplasmic reticulum

ERAD endoplasmic reticulum associated degradation

HeLa immortalized human cervical cancer cells

HTS high throughput screening

Isc short-circuit current

mRNA messenger ribonucleic acid

MSD membrane spanning domain

NBD nucleotide-binding domain

PKA protein kinase A

R regulatory domain

6

rΔF508 ΔF508 mutant CFTR on plasma membrane

RIPA radioimmune precipitation buffer

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

T84 human colon carcinoma

TR transferrin receptor

TS temperature-sensitive

7

2. INTRODUCTION

2.1. Cystic Fibrosis and CFTR

Cystic fibrosis (CF) is the most prevalent hereditary disease among Caucasians (Collins,

1992, Cohn et al., 1993). It is an autosomal recessive genetic disorder resulting in a fatal

outcome in most cases. The affected sites are mainly the exocrine glands with a

consequent disfunction of the lungs, the pancreas, the GI tract and the reproductive

system (Rowntree and Harris, 2003). Approximately 1:25 people of European, 1:22 of

Ashkenazi Jewish, 1:46 of Hispanic 1:65 of African and 1:90 of Asian descent carry at

least one mutated CFTR allele, and about 30,000 people in the United States are living

with CF (Rosenstein and Cutting, 1998).

CF caused by mutations in the 180-kb cystic fibrosis transmembrane conductance

regulator (CFTR) gene located on the long (q) arm of chromosome 7 at position 31.2.

The gene product, the CFTR protein is a 168 kDa multidomain chloride channel that

belongs to the adenosine triphosphate (ATP)-binding casette (ABC) transporter super-

family. It is expressed in a wide variety of cell types, but it is most abundant at the

apical surface of secretory epithelia, where it functions as part of a large

macromolecular protein complex (Cohn et al., 1993). CFTR, also referred to as ABC

transporter ABCC7, plays a significant role in electrolyte and fluid movement

regulation across epithelial cell layers. Although CFTR is not the only chloride channel

in these tissues, its current is critical in maintaining transepithelial osmotic balance

(Cohn et al., 1993, Kreda et al., 2005). Functional insufficiency of the mutated CFTR

protein gives rise to CF symptoms such as pancreatic insufficiency, high salt

concentration in sweat, thick, dehydrated mucus in the airways with frequent upper

respiratory tract infections and consequential respiratory failure. Obstruction or absence

of the vas deferens in male, and reduced fertility in female CF patients are well known

complications of the disease as well (Zielenski and Tsui, 1995, Rowntree and Harris,

2003).CF is a monogenetic disorder, and its clinical severity varies widely. There are

more than 1,500 mutations listed in the CFTR database

(http://www.genet.sickkids.on.ca/cftr), but a 3 bp deletion resulting in a loss of a

8

phenylalanine residue at position 508 ( F508) is the most prevalent disease causing

mutation and is responsible for more than 70% of all CF cases.

2.2. CFTR Structure and Biochemistry

CFTR is comprised of two homologous halves, with each half containing a large

membrane-spanning region with six transmembrane segments (TM1 and TM2) and a

nucleotide –binding domain (NBD1 and NBD2). The two halves are separated by a

large regulatory domain (R) containing multiple consesnsus phosphorilation sites

(Bradbury et al., 1992). A schematic diagram of the CFTR structure is shown in Figure

1. Two asparagine residues of the CFTR protein are N-glycosylated in the endoplasmic

reticulum, and after proper folding, the protein traffics to the Golgi apparatus from the

ER and the carbohydrate chains are modified in the trans-Golgi network to their mature

form (O'Riordan et al., 2000). Mature, fuly glycosylated CFTR leaves the Golgi and

directly travels to the apical cell membrane or to the recycling endosomes (Bertrand and

Frizzell, 2003). Within any pool of CFTR expressed in cells there is a mixture of core

glycosylated (ER form) and complex glycosylated (post-Golgi form) CFTR. The

differentially glycosylated forms can be distinguished by the difference of their

molecular weights subjected to denaturing SDS-PAGE electrophoresis. Figure 1B.

showes the two CFTR forms as the ER form or Band B, and post-Golgi form or Band C.

2.3. The F508 Mutant CFTR

One or more deffective alleles containing the F508 mutation can be detected in more

than 90% of all CF cases. This aberrant protein is caused by a three nucleotide deletion

that results in the abscence(Δ) of a single phenylalanine (F) at position 508 within the

CFTR protein (ΔF508 or F508 CFTR)(Rowntree and Harris, 2003). The F508 position

is within the NBD1 domain, but its abscence has been found to compromise the proper

folding not only of this domain but possibly also of the NBD2, TM1 and TM2 domains

(Du et al., 2005, Younger et al., 2006). As a result, majority of the newly synthethised

F508 CFTR is recognized as misfolded protein by the ER quality controll machinery

and consequently degraded by the proteosome, resulting in CF phenotype (Cheng et al.,

9

1990a, Jensen et al., 1995a, Gelman et al., 2002). As a result of failing to exit the ER,

F508 CFTR appears as a band B only when analyzed by SDS-PAGE.Certain in vitro

conditions allow F508 CFTR to escape the ER-associated degradation patway and

traffic to the cell surface; these mechanisms will be discussed later in this section.

2.4. Ablation of Internalization Signals

Previous studies have demonstrated that CFTR is internalized from the cell surface

(Prince et al., 1994, Lukacs et al., 1997, Prince et al., 1999) through clathrin-coated

pits(Bradbury et al., 1994, Lukacs et al., 1997). Furthermore, CFTR has been shown to

interact with PDZ-domain-containing proteins at its COOH terminus (Short et al., 1998,

Wang et al., 1998) and syntaxin 1A at its NH2 terminus (Naren et al., 1997, Naren et al.,

1998). How these interactions affect cell surface expression is not clear, but they imply

that CFTR may exist in at least two cell surface pools, one tethered to the actin

cytoskeleton and one associated with the endocytic pathway. Subcellular localization

studies reveal that CFTR is found in the endosomes in epithelial cells (Webster et al.,

1994), supporting the view that CFTR enters the endocytic pathway. Whether CFTR is

constitutively recycled is not known. In previous studies, our laboratory demonstrated

that a key feature of CFTR endocytosis was the presence of a tyrosine residue at

position 1424 in the COOH-terminal tail of CFTR. Because tyrosine-based signals have

been proposed to consist of the motif YXXΦ where Φ is a large hydrophobic residue and

X is any residue (Trowbridge et al., 1993), we tested the hypotheses that the isoleucine

residue at position 1427 is important for CFTR endocytosis and that ablation of this

putative signal YXXI would increase the steady-state surface expression of CFTR. To

this end, we performed an integrated series of biochemical and electrophysiological

assays designed to study maturation efficiency, trafficking, and Cl− channel function of

the wild-type and two COOH-terminal mutant CFTR proteins. We find that the

substitution of Tyr1424

and Ile1427

with alanine residues resulted in a 2-fold increase in

surface expression, whereas the single Y1424A mutation shows an intermediate

phenotype. CFTR internalization assays revealed that the elevated surface expression

was attributed to a dramatic decrease in endocytosis, suggesting that these residues are

necessary for CFTR internalization. Because the chloride channel activity and relative

10

surface expression of Y1424A and I1427A CFTR are elevated to a similar extent, we

propose that these substitutions affect protein trafficking but not CFTR chloride channel

function. To our knowledge, this is the first CFTR mutant that has enhanced rather than

diminished activity at the cell surface because of attenuation of internalization.

2.5. Intracellular Processing of CFTR

Newly synthesized proteins entering the secretory pathway are carefully monitored by

the ER quality control machinery to ensure that only correctly folded molecules exit

and continue their journey to the cell surface(Hampton, 2002). Misfolded membrane

and secretory proteins are promptly recognized as such and degraded by the ER-

associated degradation pathway (ERAD; reviewed in (Hampton, 2002, Goldberg, 2003).

Understanding this process is critical, since a number of diseases, including cystic

fibrosis, congenital hypothyrosis, and familial hypercholesterolemia are caused by

protein folding defects that often arise from missense or deletion mutations (Aridor and

Hannan, 2000, 2002). Despite the fact that many of these mutations result in the

production of proteins that retain some biological activity, they are rapidly degraded by

ERAD, preventing proper targeting of the proteins to their biologically relevant

destinations (reviewed in Ref. (Kim and Arvan, 1998)).

Interestingly, inefficient protein biogenesis appears to occur even for “wild type”

proteins, with a number of examples that include the epithelial sodium channels (Weisz

et al., 2000), Shaker-type potassium channels (Liu et al., 2001), major

histocompatibility complex class II molecules (Sant et al., 1991), the δ opioid receptor

(Petäjä-Repo et al., 2000, Petäjä-Repo et al., 2001), the erythropoietin receptor

(Yoshimura et al., 1990), the erythrocyte anion exchanger 1 (Band 3)(Li et al., 2000),

and CFTR (Cheng et al., 1990b). Many of these proteins, including CFTR, are

assembled in the cell membrane as part of a multiprotein complex (Sun et al., 2000a,

Sun et al., 2000b), suggesting that the molecular rationing of the components in these

complexes might be regulated during biogenesis.

Interestingly, even the wild type protein is substrate for ERAD, with as much as 75%

being degraded by the proteasome during biogenesis (Cheng et al., 1990b, Ward and

Kopito, 1994, Ward et al., 1995). Since only a small fraction of newly synthesized wild

11

type CFTR reaches the cell surface where it performs its biological function, the

question has often arisen as to why CFTR biogenesis so inefficient. A study by Tector

and Hartl (Tector and Hartl, 1999) suggested the possibility that transmembrane

segment 6 in TMD1 is unstable due to 3 charged residues within this domain.

Substitution of these residues with non-charged amino acids resulted in an increase in

protein stability but a loss of chloride transport(Tector and Hartl, 1999), suggesting that

protein stability had been compromised for biological function. This hypothesis has not

been evaluated in cells endogenously expressing CFTR.

It has been suggested that an appropriate cellular context may be necessary to support

proper membrane protein trafficking. In addition, it is possible that altered protein

trafficking may result from the use of overexpression systems or non-physiological

experimental conditions (reviewed in Bertrand et al. (Bertrand and Frizzell, 2003)).

Given that the initial studies of CFTR biogenesis were performed primarily in

transfected, heterologous overexpression systems, a careful analysis of endogenous

CFTR biogenesis both in the early (ER) and post-Golgi pathways is warranted.

Heterologous systems may lack CFTR binding partners such as EBP50, syntaxin 1A,

and CAL ((Sun et al., 2000b), (Naren et al., 1997, Short et al., 1998, Naren and Kirk,

2000, Cheng et al., 2002)), and association of these and other proteins with CFTR may

be required for proper maturation and/or trafficking.

In one of the studies presented below, we monitored the maturation efficiency of CFTR

in two human epithelial cell lines that endogenously expresses CFTR, Calu-3(Shen et

al., 1994), and T84 cells (Cohn et al., 1992). Metabolic pulse-chase analysis of CFTR in

these cells grown under both nonpolarizing and polarizing conditions indicated that core

glycosylated (Band B) CFTR is very efficiently (~100%) processed to a maturely

glycosylated (Band C) protein that is extremely stable. Moreover, quantitative cell

surface biotinylation assays revealed that the CFTR surface pool is substantially

elevated in Calu-3 cells compared with heterologous expression systems. Thus,

endogenous CFTR maturation differs fundamentally from the patterns reported in

recombinant overexpression systems, and these differences extend across multiple

cellular compartments. Our findings cast doubt upon the viewpoint that wild type CFTR

protein maturation is inefficient.

12

2.6. ΔF508 CFTR Rescue and Stability

ΔF508 CFTR is a well-known example of a clinically relevant TS (temperature-

sensitive) processing mutant. At 37 °C, the restrictive temperature, the ΔF508 CFTR

protein is rapidly degraded by ERAD [ER (endoplasmic reticulum) associated

degradation], preventing ΔF508 CFTR expression at the cell surface and resulting in the

CF phenotype(Cheng et al., 1990b, Jensen et al., 1995b, Ward et al., 1995). At 27 °C,

the permissive temperature, some of the ΔF508 CFTR protein escapes ERAD and is

delivered to the cell membrane, where it is called rΔF508 (rescued ΔF508) CFTR.

Because rΔF508 CFTR partially retains its chloride channel activity (Dalemans et al.,

1991), several methods have been introduced to promote ΔF508 CFTR escape from

ERAD and deliver it to the cell membrane(Brown et al., 1996, Yang et al., 2003, Zhang

et al., 2003, Loo et al., 2005, Pedemonte et al., 2005, Loo et al., 2006, Norez et al.,

2006), but to date, the most efficient method for the rescue of ΔF508 CFTR is

permissive temperature cell culture (Denning et al., 1992). Although first observed 15

years ago, it remains unclear how culture at 27 °C facilitates ΔF508 CFTR escape from

ER quality control. It is well established, however, that returning cells to the restrictive

temperature after low temperature rescue results in rapid internalization and degradation

of rΔF508 CFTR (Sharma et al., 2004, Bebok et al., 2005). It is not known whether

rΔF508 CFTR displays the same cell-surface instability, or how function of rΔF508

CFTR is affected, if left at the permissive temperature.

In addition to low-temperature culture, chemical compounds such as glycerol(Sato et

al., 1996), DMSO (Bebok et al., 1998) and organic solutes (Zhang et al., 2003) have

also been shown to facilitate ΔF508 CFTR escape from ERAD. These compounds exert

their effects by enhancing the efficiency of ΔF508 CFTR folding or by increasing

differentiation and polarity of the host cell(Bebok et al., 1998). Recently, a handful of

small molecular correctors were identified by high-throughput screening based on their

ability to promote rΔF508 CFTR expression (Pedemonte et al., 2005, Loo et al., 2006,

Suen et al., 2006, Wang et al., 2007b). In most cases, the mechanism by which these

compounds facilitate ERAD escape is not known. Furthermore, their effects at the cell

surface have not been tested.

13

Although the effects of low temperature culture on ΔF508 CFTR folding in the ER has

been studied for years, it is not known whether the surface defects exhibited by rΔF508

CFTR are also TS, and therefore possibly related to the ER folding defect. Additionally,

it has not been determined whether treatment of rΔF508 CFTR with chemical

compounds known to promote rescue can affect ΔF508 CFTR cell-surface properties,

such as surface stability. Answers to these questions are essential to understand the

altered trafficking, decreased stability and compromised function of the rΔF508 CFTR

protein. In this present study, we provide more detailed information on the effects of

permissive temperature culture and of two small molecule correctors on rΔF508 CFTR

cell-surface trafficking. We used two different CFTR-expressing model cell lines, HeLa

and CFBE41o- cells, in order to identify cell-type- and polarization-specific differences

in the cell-surface trafficking of WT (wild-type) CFTR and rΔF508 CFTR, and to

determine whether methods known to facilitate ΔF508 CFTR exit from the ER also

stabilize rΔF508 CFTR at the cell surface.

14

Figure1. CFTR Structure

EC

IC

NH2

TMD2

ACTIN

H1

H2

H3

COOH

NH2

TMD1

Synta

xin

1A

Cell membrane

R domain

NBD1 NBD2E3KARP

CAL

CAP70

DT

RL

PKA

ezrin

EB

P5

0

YSDI

AP-2

Glycan chains

Syntaxin 8

COPII

15

3. AIMS AND HYPOTHESES

First, to test the hypotheses that the isoleucine residue at position 1427 is important for

CFTR endocytosis and that ablation of this putative internalization signal YXXI would

increase the steady-state surface expression of CFTR. To test if these substitutions have

any effect on the chloride channel properties of CFTR

Second, to monitor the maturation efficiency of CFTR in heterologous expression

systems such as HeLa and COS-7 cells and in two human epithelial cell lines that

endogenously expresses CFTR, Calu-3 (Shen et al., 1994), and T84 cells (Cohn et al.,

1992) using metabolic pulse-chase analysis of CFTR in these cells grown under both

nonpolarizing and polarizing conditions, and to compare quantitative cell surface levels.

Based on recent results that epithelial specific factors regulate both CFTR biogenesis

and function, we hypothesized that CFTR biogenesis in endogenous CFTR expressing

epithelial cells may be more efficient.

Third, to determine whether the surface defects exhibited by rΔF508 CFTR are also TS,

and therefore possibly related to the ER folding defect. Additionally, to study if

treatment of rΔF508 CFTR with chemical compounds known to promote rescue can

affect ΔF508 CFTR cell-surface properties, such as surface stability. Our hypothesis

was that permissive temperature culture and small molecular correctors not only can

rescue ΔF508 CFTR from ERAD, but also stabilizes it at the cell surface.

16

4. MATERIALS AND METHODS

4.1. Construction of CFTR Mutants

CFTR (wild-type) was provided by the Gregory James Cystic Fibrosis Center Vector

Core and Dr. Jeong Hong. The construction of the Y1424A mutant was described

previously(Prince et al., 1999). For construction of the Y1424A,I1427A mutant, aBstXI-

SgrAI fragment that coded for the COOH-terminal tail region of Y1424A CFTR was

subcloned into pSK-Bluescript (Stratagene). A second-site mutation was prepared from

the corresponding pSK-Bluescript vector containing theBstXI-SgrAI fragment from

single-stranded DNA as described previously (Trowbridge et al., 1993)by the method of

Kunkel(Kunkel, 1985). Mutants were selected by sequencing and then subcloned into

theBstXI-SgrAI site of pGT-1-CFTR. The mutations were verified by

dideoxynucleotide sequencing (Tabor and Richardson, 1987) using the Sequenase kit

(U. S. Biochemical Corp.) according to the manufacturer's directions.

4.2. Transient Transfection of COS-7 Cells

COS-7 cells were transiently transfected using LipofectAMINE PLUS reagent

(Invitrogen) according to the manufacturer's protocol. Transfected cells were cultured

for 24-48 h before analysis in a humidified incubator in 5% CO2 at 37 oC before

analysis.

4.3. Cell Culture

COS-7 cells were cultured in modified Eagle's medium (Invitrogen) with 10% FBS at

37 °C in a humidified incubator in 5% CO2 and transiently transfected using

LipofectAMINE Plus reagent (Invitrogen) according to the manufacturer's directions.

The cells were incubated at 37  °C in a humidified incubator for 24–48 h before

analysis.

Calu-3, and T84 cells were obtained from the ATCC (www.atcc.org) and maintained in

the Cystic Fibrosis Research Center at University of Alabama at Birmingham. HeLa

cells overexpressing wild type CFTR were transduced and selected as previously

described(Wu et al., 2000, Kappes et al., 2003), cultured in Dulbecco's modified Eagle's

17

medium (Invitrogen) with 10% FBS at 37 °C in a humidified incubator in 5% CO2. For

cell monolayers, Calu-3 cells were seeded on 6.5- or 12-mm diameter Transwell filters

(Corning-Costar, Corning, NY). After 2-3 days, the medium containing 10% FBS was

exchanged to 2% FBS containing media, and cells were cultured for an additional 7-9

days with liquid both at the apical and the basolateral compartments. Under these

conditions, the cells formed monolayers with trans-epithelial resistances of >800 Ω·cm2.

HeLa F (where DF indicates a cell line expressing ΔF508 CFTR), HeLaWT, CFBE41o-

F and CFBE41o-WT cell lines were developed and cultured as described

previously(Bebok et al., 2005). HeLa cells were grown in Eagle's modification of MEM

(minimal essential medium; Invitrogen) supplemented with 10% (v/v) FBS (fetal bovine

serum). Calu-3 cells were obtained from A.T.C.C. and were maintained in Eagle's

modification of MEM supplemented with 10% (v/v) FBS, 2 mM glutamine, 1 mM

pyruvate and 0.1 mM non-essential amino acids. CFBE41o- cell cultures were

maintained in DMEM (Dulbecco's modified Eagle's medium) Ham's F12 medium

(50:50, v/v) (Invitrogen) with 10% (v/v) FBS. For experiments requiring polarized cells,

Calu-3 CFBE41o-

F and CFBE41o-WT cells were seeded on to 12 mm diameter

Transwell filters (Costar, Corning). Under these conditions, the cells formed polarized

monolayers with transepithelial resistances of >1000 W/cm2, as measured by a Millicell

electrical resistance system (Millipore).

4.4. Small molecular correctors (pharmacological chaperones)

Small molecular correctors were provided by Cystic Fibrosis Foundation Therapeutics

(Bethesda, MD, U.S.A.). Compounds tested were CFcor-325 (VRT-325, 4-

cyclohexyloxy-2-{1[4-(4-methoxy-benzensulfonyl)-piperazin-1-yl]-ethyl}-quinazoline)

(Loo et al., 2006, Van Goor et al., 2006)and Corr-4a ({2-(5-chloro-2-methoxy-

phenylamino)-4´-methyl-[4,5´]-bithiazolyl-2´-yl}-phenyl-methanone) (Pedemonte et al.,

2005). Both compounds were used at a 10 mM stock concentration in DMSO and a 10

mM working concentration in OPTIMEM medium (Invitrogen) supplemented with 2%

(v/v) FBS. The presence of the vehicle (0.1% DMSO) in the medium did not mediate

ER escape of ΔF508 CFTR in control samples, or facilitate changes in internalization.

In all experiments, control samples contained the DMSO vehicle.

18

4.5. Immunoprecipitation

Cells were lysed in RIPA buffer [1% Nonidet P40, 0.5% sodium deoxycholate, 150 mM

NaCl and 50 mM Tris/HCl (pH 8.0)] containing Complete mini protease inhibitor

(Roche). CFTR was immunoprecipitated using 1 mg/ml (final concentration) mouse

monoclonal anti-CFTR C-terminal antibody (24-1, A.T.C.C. number HB-11947) and 35

ml of Protein A–agarose (Roche)(Jurkuvenaite et al., 2006). TR (transferrin receptor)

was immunoprecipitated using 1 mg/ml (final concentration) mouse anti-TR (B3/25;

Roche) and 35 ml Protein A-agarose(Zaliauskiene et al., 2000). Immunoprecipitations

were carried out for 2h at 4 °C.

4.6. Biotinylation

Cells were cooled to 4oC, washed with phosphate-buffered saline containing 1.0 mM

MgCl2 and 0.1mM CaCl2 (PBS c/m), and incubated for 30 min with 10 mM NaIO4 in

the dark. The cells were again washed with PBS c/m and labeled with 2 mM biotin-LC-

hydrazide in 100 mM sodium acetate (pH 5.5) for 30 min. These labeled cells were

extensively washed with PBS c/m and lysed in RIPA lysis buffer. After biotinylation

and lysis, samples were divided into two equal samples and immunoprecipitated with

anti-CFTR nucleotide binding domain 1 antibody and protein A-agarose. One of the

immunoprecipitated samples was then eluted from the beads using Laemmli sample

buffer (without bromphenol blue), diluted in RIPA buffer (150 mm NaCl, 1% Nonidet

P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mmTris-HCl, pH 8.0) 10-fold, and the

biotinylated fraction was captured with avidin-Sepharose beads (Pierce) overnight at

4oC. Both total CFTR and biotinylated CFTR were then in vitro phosphorylated using

[γ32

P]ATP (PerkinElmer Life Sciences) and cAMP-dependent protein kinase

(Promega).

19

4.7. Internalization assays

CFTR internalization assays were performed as described previously(Peter et al., 2002,

Jurkuvenaite et al., 2006). Briefly, surface carbohydrate groups on the cells were

oxidized with sodium periodate (NaIO4, 10mM), washed on ice with Mg2+

- and Ca2+

-

supplemented (0.5 mM MgCl2 and 0.9 mM CaCl2) PBS buffer and warmed to 37 °C or

27 °C for 2.5 or 10 min. Oxidized surface carbohydrate groups remaining on the cell

surface after a warm-up period were labelled with biotin–LC–hydrazide (1 mg/ml;

Pierce), followed by cell lysis in RIPA buffer. CFTR was then immunoprecipitated as

described above. CFTR internalization was identified as the percentage loss of

biotinylated CFTR during the warm-up period compared with the control samples (no

warm-up period).

4.8. CFTR cell-surface half-life measurements

Cells were metabolically labeled (Jurkuvenaite et al., 2006) and biotinylated as

described previously (Peter et al., 2002). Initial (0 time point) samples were

immediately lysed in RIPA buffer, and the rest of the samples were transferred into to a

37 °C incubator for 2, 4 and 8 h. At each time point, cells were lysed in RIPA buffer,

CFTR was immunoprecipitated and analysed by SDS/PAGE (6% gels) and Western

blotting (see below), and autoradiography was performed following the manufacturer's

instructions (PhosphorImager; Amersham Biosciences). Half-lives of the proteins were

calculated as described previously (Green et al., 1994, Jurkuvenaite et al., 2006).

4.9. Metabolic Pulse-Chase Assays

For transiently transfected COS-7 cells: One day post-transfection, COS-7 cells (one

35-mm dish/time point) were rinsed three times and incubated in methionine-free

Dulbecco's modified Eagle's medium for 1 h and then pulsed in the same media

containing 200 μCi/ml trans-[35

S]methionine (ICN Biomedicals). Pulse-labeled cells

were chased for 0, 4, 14, 18, or 24 h in complete media. At each time point, the cells

were placed on ice and rinsed with cold phosphate-buffered saline, lysed in RIPA

buffer, and incubated for an additional 30 min on ice. CFTR was immunoprecipitated

from the post-nuclear supernatants and analyzed by SDS-PAGE and autoradiography

20

(PhosphorImager, AmershamBiosciences). Calculation of the protein half-lives was

performed as described by Straley et al. (1998)(Straley et al., 1998).

For endogenously expressing Calu-3 and T84 cells: One hour before addition of radio

labeled amino acids, the tissue culture medium was replaced with methionine/cysteine-

free minimal essential medium. After 1 h of methionine starvation at 37 °C, 300 μCi/ml

EasyTag Protein Labeling Mixture ([35

S]methionine/cysteine, PerkinElmer Life

Sciences) was added, and cells were pulse-labeled for 30 min (for the maturation

studies) or 60 min (for protein half-life analysis). The radioactive medium was then

exchanged with cold, complete medium and cultured for various chase periods. Cells

were lysed at the time points indicated and CFTR was immunoprecipitated using the 24-

1 monoclonal antibody and protein A+G-agarose (Roche Diagnostics).

Immunoprecipitated samples were analyzed by SDS-PAGE (6% gels) and detected

using autoradiography (PhosphorImager, Amersham Biosciences). Calculation of

protein half-lives was performed as described by Straley et al. (1998)(Straley et al.,

1998). Maturation efficiency was measured by comparing the density of the labeled

Band B to the density of the fully glycosylated band C using IPLab software

(Scanalytics, Inc.) as described previously(Bebok et al., 2002).

For stable transduced HeLa and CFBE cells: For experiments at 37 °C, cells were

metabolically labelled as described previously (Jurkuvenaite et al., 2006). For metabolic

labelling during permissive temperature (27 °C) culture, cells were transferred to 27 °C

and the medium replaced with cysteine- and methionine-free MEM (Specialty Media,

Phillipsburg, NJ, U.S.A.) for 1 h. Cells were subsequently incubated with 300 mCi/ml

[35

S]methionine/cysteine (EasyTagTM

; PerkinElmer) for 18 h at 27 °C. This extended

metabolic labelling pulse was necessary to produce a labelled CFTR signal at 27 °C that

formed sufficient quantities of mature, glycosylated CFTR (C band) to follow during

the chase period. On completion of labelling, the medium was replaced with complete

medium without radioisotopes and cells were cultured at either 37 °C or 27 °C for the

time points indicated.

21

4.10. Western Blot

Total and biotinylated CFTR or TR were detected as described previously(Jurkuvenaite

et al., 2006). Briefly, CFTR and TR were immunoprecipitated and analysed by

SDS/PAGE (6% gels) and Western blotting. Membranes were blocked overnight in 3%

(w/v) BSA and 0.5% Tween 20 in PBS. All antibodies were incubated for 1 h at 25 °C.

Total CFTR was detected with polyclonal anti-[CFTR NBD (nucleotide binding

domain)2] antibody (1:5000 dilution, H-182; Santa Cruz Biotechnology). Total TR was

detected with a polyclonal anti-(TR external domain) antibody (1:5000 dilution;

MorphoSys, Raleigh, NC, U.S.A.). Biotinylated CFTR and TR were detected with HRP

(horseradish peroxidase)-conjugated avidin (1:5000 dilution; Sigma).

Chemiluminescence was induced with high-sensitivity Immobilon Western substrate

(Millipore). The membranes were exposed for different time periods (up to 3 min) and a

linear range for a standard set of diluted samples was calibrated. Western blots were

analysed and densities measured using ImageJ (National Institutes of Health),

ScionImage (National Institutes of Health), or IPLab (BD Biosciences) software.

Results are means (n 3).

4.11. Whole Cell Patch Clamp Assays

Individual dishes of transfected COS-7 cells were used in electrophysiological

recordings as described previously (Moyer et al., 1998). One modification is that

PClamp 8.0 software was used in this study. COS-7 cells were transiently transfected

with each of the CFTR constructs along with pGL-1 (pGreen Lantern-1, a green

fluorescence protein (GFP) plasmid). Under these conditions, >90% GFP and CFTR co-

transfectants respond to cyclic AMP mixture (250 μM 8-Br-cAMP and chlorophenyl

thio-cAMP plus 2 μM forskolin) treatment with an increase in whole cell Cl−

conductance. Background levels of cyclic AMP-activated Cl− conductance were

monitored in non-transfected cells in the same dish that lack GFP fluorescence, in

mock-transfected cells, and in parental cells. In these whole-cell recordings, the bath

(extracellular) solution contained 145 mm Tris-Cl, 1 mm CaCl2, 1 mm MgCl2, 5 mm

glucose, 60 mm sucrose, and 5 mM HEPES, pH 7.45. The pipette (intracellular)

solution contained 145 mM Tris-Cl, 5 mM HEPES, 100 nM CaCl2 and MgCl2 (chelated

22

with 2 mM EGTA), and 5 mm Mg2+

-ATP, pH 7.45. These solutions were designed to

study the only current flowing through Cl− channels because Cl

− is the only permeant

ion in solution, to clamp intracellular Ca2+

at ∼100 nm, and to prevent swelling-

activated Cl−currents with added sucrose in the bath solution.

4.12. Single Channel Patch Clamp

Assays of single channel recordings were obtained from membrane patches in both the

cell-attached and inside-out configurations. Recording pipettes were constructed from

borosilicate glass capillaries (Warner Instrument Corporation, Hamden, CT) using a

Narishige PC-10 microelectrode puller (Narishige Scientific Instrument Laboratory,

Tokyo, Japan) and were fire-polished with a Narishige microcentrifuge. The pipettes

were partially filled with standard pipette solution and had tip resistances of 5–10

megaohms. Experiments were performed at room temperature (20–22  °C). Currents

were recorded at 50–60 mV (negative to pipette potential) using an Axopatch 200B

patch clamp amplifier (Axon Instruments, Union City, CA) low pass-filtered at 1000 Hz

(LPF-8, Warner Instruments), sampled every 100 μs with a Digidata 1321A interface

(Axon Instruments), and stored onto the computer hard disk using PClamp 8 software

(Axon Instruments). A brief protocol of stepping the holding potential from −100 to

+100 mV and back to −100 mV served to inactivate a contaminating voltage-dependent

Cl− channel (probably ClC-2) that was hyperpolarization-activated but inactivated

permanently by a +100-mV pulse. The pipette solution contained (in mmol/liter): 150

NaCl, 1 MgCl2, 1 CaCl2, 5 HEPES, pH 7.4. The bath solution contained (in mmol/liter):

150 NaCl, 1 MgCl2, 5 EGTA, 5 HEPES, pH 7.4.

4.13. Semiquantitative RT-PCR

Total RNA was isolated from each filter using RNeasy mini kit (Qiagen). RNA

concentration was calculated based on the absorbance of samples at 260 nm. One tube

from the RT-PCR kit (Qiagen) was used to amplify the CFTR mRNA using 1 ng of total

RNA as templates. The primers were designed to anneal to two different exons (exon 10

and exon 11) to prevent possible amplification from genomic DNA and pre-mRNA. The

sequences of the primers were 5′ ACTTCACTTCTAATGATGAT 3′(exon-10F1) and 5′

AAAACATCTAGGTATCCAA 3′(exon-11R). Two primers specific for GAPDH were

23

used as controls for each sample (Li and Wang, 1999). RT-PCR was performed as

instructed by manufacturer. The number of PCR cycles for this experiment was

experimentally determined (28 cycles) to allow semiquantification of PCR products

during the log-linear phase of amplification. RNA samples isolated from CFTR-

negative HeLa cells were used as control to assure the specificity of the PCR product.

The specificity of the GAPDH primers were previously tested (Li and Wang, 1999).

Controls with no template or reverse transcriptase were also included. Experiments were

repeated two times.

4.14. Fluorescence-based Kinetic Real-time PCR

Isolated RNA samples were also analyzed by fluorescence-based kinetic real-time PCR

using the ABI PRISM 7900 Sequence Detection System as described previously for

other genes (Haslett et al., 2002). One-step RT-PCR was performed on serial dilutions

of RNA isolates using Master Mix Reagent kit and Assay-on-Demand Gene Expression

Probes (Applied Biosystems, CFTR Assay ID: HS00357011_m1). 6-

Carboxylfluorescein was chosen as reporter dye at the 5′-end of the probe and minor

groove binder as the quencher at the 3′-end. The 5′ nuclease activity of Taq DNA

polymerase cleaves the probe and generates a fluorescent signal proportional to the

amount of starting target template. Each reporter signal is then divided by the

fluorescence of an internal reference dye 5-carboxy-X-rhodamine, to normalize for non-

PCR-related fluorescence. The TaqMan RT-PCR reaction was performed in a final

volume of 20 μl containing 0.5 μl of RNA, 10 μl of TaqMan One-step RT-PCR master

mix (Applied Biosystems), 0.5 μl of Multiscribe/RNase inhibitor, and 1 μl of 20×

primer/probe set for CFTR and/or 18 S rRNA as endogenous control. Six 10-fold serial

dilutions (100-10

-6) of RNA samples isolated from the models cell lines were amplified

in duplicates using CFTR and/or 18 S endogenous control. Data were exported from the

ABI Prism 7900SDS software into Microsoft Excel where relative standard curves were

plotted. Using the Excel Trendline option, a line of best fit was plotted. Data from each

cell line were analyzed based on these standard curves and relative quantities were

extrapolated. CFTR values were normalized to 18 S by dividing the CFTR values by the

corresponding 18 S values from the same sample according to the Applied Biosystems

relative quantification method. The specificity and quality of the primers is assured by

24

ABI. Appropriate controls with no RNA, primers, or reverse transcriptase were included

in each set of experiments.

4.15. Microscopy

Images were captured on an Olympus IX170 inverted epifluorescence microscope

equipped with step motor, filter wheel assembly (Ludl Electronics Products, Hawthorne,

NY), and 83,000 filter set (Chroma Technology, Brattleboro, VT). Images were

captured with SenSys-cooled charge-coupled high-resolution camera (Photometrics,

Tucson, AZ). Partial deconvolution of images was performed using IPLab software

(Scanalytics, Fairfax, VA). (Bebok et al., 2002)

4.16. Ussing chamber analyses

Measurements of Isc (short-circuit current) and Rt (transepithelial resistance) were

performed as described previously (Chen et al., 2006). Briefly, filters containing

monolayers of either CFBE41o-

F or CFBE41o-WT cells were mounted in Ussing

chambers (Jim's Instruments, Iowa City, IA, U.S.A.) and bathed on both sides with

solutions containing 120 mM NaCl, 25 mM NaHCO3, 3.3 mM KH2PO4, 0.83 mM

K2HPO4, 1.2 mM CaCl2, 1.2 mM MgCl2, 10 mM Hepes (sodium-free), 10 mM mannitol

(apical compartment) and 10 mM glucose (basolateral compartment). Osmolality of all

solutions, as measured by a freezing depression osmometer (Wescor, Logan, UT,

U.S.A.), was between 290 and 300 mOsm/kg of water. The bath solutions were stirred

vigorously by continuous bubbling with 95% O2 and 5% CO2 at 37 °C (pH 7.4).

Monolayers were short-circuited to 0 mV, and Isc (mA/cm2) was measured with an

epithelial voltage clamp (VCC-600; Physiologic Instruments, San Diego, CA, U.S.A.).

A 10 mV pulse of 1 s duration was imposed every 10 s to monitor Rt, which was

calculated using Ohm's law. Data were collected using the Acquire and Analyse

program (version 1.45; Physiologic Instruments). Results are DIsc forskolin (response to

forskolin) and DIsc glybenclamide (response to glybenclamide). During Ussing chamber

analysis, the temperatures (27 °C or 37 °C) were maintained by using a temperature-

controlled water bath for at least 30 min before analysis. Following establishment of

steady-state values of Isc and Rt, forskolin (10 mM) and/or the indicated inhibitors were

25

added to the apical compartments, and Isc and Rt were measured continuously until new

steady-state values were reached.

4.17. Statistical analysis

Results were expressed as means ± S.D. Statistical significance among means was

determined using the Student's t test (two samples).

26

5. RESULTS

5.1. Ablation of Internalization Signals in the C-terminal Tail of CFTR

enhances Surface expression

5.1.1. Mutations in the Carboxyl-terminal Tail of CFTR Increase

Surface Expression

Our hypothesis in these experiments is that if both tyrosine 1424 and isoleucine 1427

are important for CFTR internalization, complete disruption of these residues should

increase CFTR surface expression. Because little is known concerning the nature of

CFTR endocytosis and recycling or how these processes affect CFTR function, we

constructed a double substitution COOH-terminal mutant in which both tyrosine 1424

and the isoleucine 1427 were changed to alanine.

First, we determined the effects of these substitutions on CFTR surface expression by

comparing the percentage of wild-type and mutant CFTR at the cell surface using a

surface biotinylation assay. COS-7 cells expressing wild-type, Y1424A, and

Y1424A,I1427A CFTR were surface-biotinylated and lysed in RIPA buffer (see

“Materials and Methods”). Total CFTR was measured following immunoprecipitation

from 50% of the lysate detected by in vitro phosphorylation ([γ-32

P]ATP and protein

kinase A) and analyzed by SDS-PAGE and autoradiography (Fig.2,top panel, total

CFTR). CFTR was also immunoprecipitated from the other half of the lysate. This

fraction was then eluted from the protein-A beads, reprecipitated using monomeric

avidin-Sepharose (to separate biotinylated CFTR), and detected as described above for

the total CFTR (Fig.2, top panel). The percentage CFTR at the cell surface was

markedly increased for Y1424A,I1427A CFTR compared with both wild-type (108%

increase, n = 10,p < 0.001) and Y1424A CFTR (59% increase, n = 10, p < 0.001) (Fig.

2,bottom panel). The surface biotinylation data indicated that modification of residues

Tyr1424

and Ile1427

increased the steady-state surface expression of CFTR. The potential

mechanisms that could account for these differences include changes in 1) maturation

efficiency, 2) protein half-life, or 3) internalization and/or recycling rates.

27

5.1.2. Mutations at Tyr1424

and Ile1427

Do Not Alter CFTR Maturation

Efficiency or Protein Half-life

To test the effects of these mutations on maturation efficiency and protein half-life, we

performed metabolic pulse-chase experiments on COS-7 cells expressing wild-type,

Y1424A, and Y1424A, I1427A CFTR. CFTR half-lives were measured 24 h post-

transfection. The results in Fig. 3 show that the half-lives for wild-type (Wt), Y1424A,

and Y1424A,I1427A CFTR were 10.3 ± 2.3, 11.3 ± 2.6, and 11.3 ± 1.5 h (mean ± S.D.).

This finding indicated that the elevated surface expression of the mutants was not

attributed to enhanced protein half-life.

5.1.3. Tyrosine 1424 and Isoleucine 1427 Are Necessary for CFTR

Endocytosis

To test whether elevated surface expression was attributed to alterations in the

internalization rate of CFTR, we performed internalization assays on COS-7 cells

expressing wild-type, Y1424A, and Y1424A,I1427A CFTR. Using a warm-up period

between periodate and the biotin LC-hydrazide treatments (0 or 2.5 min), we monitored

the loss of the surface pool of CFTR (see “Materials and Methods”). During this warm-

up period, previously oxidized carbohydrate residues are internalized and therefore do

not react with the membrane-impermeant biotin LC hydrazide. A representative

internalization assay for each of the constructs is shown in Fig.4, top panel. A summary

of eight assays is shown in the lower panel. For wild-type CFTR, 34% of the surface

pool was internalized in 2.5 min. For Y1424A and Y1424A,I1427A CFTR,

internalization dropped to 21 and 8%, respectively, during the same time period. These

results demonstrate that CFTR endocytosis is inhibited by 76% when these two residues

are modified.

5.1.4. The Y1424A and Y1424A,I1427A CFTR Have Normal Chloride

Channel Properties

Because the biochemical data suggested that a specific motif in the CFTR COOH

terminus dramatically affected endocytosis and because point mutations in the NH2

terminus lead to both disruption of binding to docking machinery and changes in CFTR

28

ion channel function, we tested whether the mutation of Tyr1424

and Ile1427

affected

chloride channel function. Whole cell patch clamp recordings were performed to assess

the total population of CFTR Cl− channels in the plasma membrane of transfected COS-

7 cells. Tris-Cl-containing solutions were used in bath (extracellular) and pipette

(intracellular) solutions so that Cl− was the only major permeant ionic species in the

recordings. GFP was also expressed together with the CFTR-bearing vectors to detect

cells that were successfully transfected prior to recording. Cells that did not express

GFP served as internal controls. Three sets of transiently transfected COS-7 cells were

examined in parallel with the above biotinylation experiments (Table I). In agreement

with the surface biotinylation assays, CFTR whole cell Cl− currents in Y1424A CFTR

and Y1424A,I1427A CFTR-transfected cells were elevated compared with wild-type

CFTR-expressing cells (Table I), suggesting that the elevated Cl− channel activity was

the result of the elevated surface expression of CFTR. Typical whole cell current traces

after stimulation with cAMP agonist mixture for wild-type and mutant CFTR are shown

in Fig.5 A. Fig. 5 B shows wild-type CFTR Cl− current-voltage relationships

demonstrating insensitivity of the currents to DIDS (100 μM) and inhibition of the

currents by glibenclamide (100 μM). These pharmacological properties are consistent

with wild-type CFTR(Schwiebert et al., 1998). The time and voltage independence of

the currents and the linear I–V relationship are also consistent with CFTR chloride

channel activity. Fig. 5, C and D, show the Y1424A and Y1424A,I1427A Cl− current-

voltage relationships, respectively, and indicate that although the sensitivities to DIDS

and glibenclamide remain similar to wild-type (Fig. 5 B), the total current is elevated in

the single and double mutants. Whereas the representative I–V plots show a variability

in sensitivity to glibenclamide, inhibition with this Cl− channel-blocking drug was only

partial ranging from 50 to 90% for both wild-type and mutant currents.

Single channel biophysical properties of wild-type, Y1424A, and Y1424A,I1427A

CFTR were also assessed. Before the recording of CFTR Cl− channel properties under

cAMP-stimulated conditions was undertaken, voltage steps between −100 and +100 mV

were necessary to inactivate a pseudo-channel with similar Cl−conductance as CFTR.

The properties of this channel were not inconsistent with ClC-2, known to be expressed

in COS-7 cells(Thiemann et al., 1992). Representative recordings of wild-type,

Y1424A, and Y1424A,I1427A CFTR at 50–60 mV (negative to pipette potential) are

29

shown in Fig.5 E. Single channel conductance for all three constructs was 7–8

picoSiemens for stretches of the recordings where a subset of the channels could be

analyzed. Biophysical analysis of single channel kinetics was not possible, because each

patch obtained from a positively transfected cell had at least 10 channels. We could

never obtain patches with a single channel. Furthermore, a base line without channel

openings was not observed. Nevertheless, the whole cell and single channel recordings

together show that the difference in Cl− channel activity is attributed to elevated surface

expression without a significant change in CFTR chloride channel properties among

wild-type, Y1424A, and Y1424A,I1427A CFTR.

30

Figure 2: Surface expression levels of wild-type and mutant CFTR in COS-7 cells.

The levels of expression of wild-type (Wt), Y1424A, and Y1424A,I1427A CFTR were

analyzed in COS-7 cells 48 h after transfection. Cells were lysed in RIPA buffer, and

CFTR was immunoprecipitated using an anti-nucleotide binding domain 1 polyclonal

antibody. Total, total CFTR from 50% of the lysate. Biotinylated CFTR was eluted from

the antibody-protein A beads and reprecipitated using avidin-Sepharose beads.

Biotinylated, CFTR from 50% of the lysate. Mock transfected cells were used as a

negative control (lanes 1and 5). Immunoprecipitated (Total) and reprecipitated

(Biotinylated) CFTR were in vitro phosphorylated with protein kinase A and [γ-

32P]ATP and analyzed by SDS-PAGE and autoradiography. A representative gel of 10

is shown (top panel). The relative amounts of wild-type (lanes 2 and 6), Y1424A (lanes

3 and7), and Y1424A, I1427A CFTR (lanes 4 and8) are shown. The averages ± S.E.

were calculated from the phosphorimaging analysis from 10 independent experiments.

*,p < 0.02; +, p < 0.001 (compared with wild-type CFTR (lower panel)).

31

Figure 3: Point mutations in the CFTR COOH terminus do not affect protein

stability or maturation efficiency. The protein turnover and processing of CFTR and

CFTR mutants were monitored in COS-7 cells 24 h after transfection in metabolic

pulse-chase experiments. After a 1-h pulse and the indicated chase time periods, the

cells were lysed in RIPA buffer and CFTR or CFTR mutants were immunoprecipitated

and analyzed as described under “Materials and Methods.” Mock (M) transfected cells

were used as a negative control. The top panel shows a representative gel. Bands B and

C of CFTR indicated on the left. The average half-lives and maturation efficiencies from

four independent experiments shown below demonstrate that the half-lives (left panel)

and maturation efficiencies (right panel) are not affected by these two CFTR

substitutions.

In the same series of experiments, we also compared the amount of immaturely

glycosylated CFTR (Band B) at 0 time with the amount of maturely glycosylated CFTR

(Band C) at 4 h (top panel). The average maturation efficiency for wild-type (Wt),

Y1424A, and Y1424A,I1427A CFTR were 32, 31, and 31%, respectively (bottom right

panel). This finding demonstrated that elevated surface expression of Y1424A,I1427A

CFTR was not because of alterations in maturation efficiency.

32

Figure 4: Comparisons of the internalization rates of CFTR and CFTR mutants.

COS-7 cells transfected with wild-type, Y1424A, or Y1424A,I1427A CFTR were

analyzed 48-h post-transfection. Wild-type or mutant CFTR was biotinylated using a

two-step surface periodate/LC-hydrazide biotinylation procedure. At zero time, both

steps were conducted at 4  °C to label the entire pool of CFTR. Internalization was

monitored by a loss of biotinylated of the cell surface pool by including a 37  °C

incubation period (Time (min)) between periodate and biotin LC-hydrazide treatments.

Biotinylated CFTR and total CFTR were detected as shown in Fig.2. The percentage of

wild-type, Y1424A, and Y1424A,I1427A CFTR internalized after 2.5 min was 34, 18,

and 8 respectively. 1 of 8 representative experiments is shown. In thebottom panel, the

percentage of CFTR internalized at each time point was calculated based on

phosphorimaging analysis (averages from eight experiments: *, p < 0.05 compared with

Wt; +, p < 0.001 compared with Wt).

33

Transient transfection

cAMP-activated chloride current1-

a

Non-green Green

Control Wild type Y1424A Y1424A/I1427A

pA at +100 mV

Set 1 255  ± 361-b

 (13)1-c

1070  ± 95 (5) 1650  ± 200* (5) 2125  ± 195† (5)

(Fold-difference)

1.0 1.54 1.99

Set 2 201  ± 68 (3) 738  ± 52 (5) 986  ± 24* (5) 1451  ± 35† (5)

(Fold-difference)

1.0 1.34 1.97

Set 3 393  ± 140 (4) 1193  ± 55 (7) 1767  ± 164* (7) 3424  ± 205† (6)

(Fold-difference)

1.0 1.48 2.87

Fold-difference average

1.0 1.45  ± 0.06* 2.28  ± 0.30†

Table I

Summary of whole cell patch clamp recordings for wild-type CFTR and for CFTR

mutants shows elevated activity in the mutants relative to wild type

34

Figure 5: Chloride channel activity of the CFTR COOH-terminal mutants is

normal but expression of the mutants is elevated. Table I. shows the complete

summary of the whole-cell patch clamp data. Panel A showed typical whole-cell current

records. Typical whole-cell I–V plots for wild-type CFTR (panel B), Y1424A (panel

C), and Y1424A,I1427A (panel D) showing cyclic AMP-stimulated chloride currents in

the absence of blockers (squares), presence of DIDS (upward triangles), and presence

of glibenclamide (inverted triangles). A non-green cell showing background cyclic

AMP-stimulated chloride currents is also shown in each plot (circles). A linear I–V

relationship and time- and voltage-independent kinetics are hallmarks of CFTR

channels and were similar in nature between wild type (WT) and the mutants. Panel E

shows representative single channel current traces for WT and the mutants. Although

these segments of recordings show more channels and more “wave-like” cooperative

gating in the mutantsversus the wild type, N or number of channels per patch could not

35

be calculated because a quiet 0-channel base line was never reserved in patches that

contained CFTR channels.

5.2. Intracellular Processing of CFTR is Efficient in Epithelial cell Lines

5.2.1. Calu-3 Cells Express High Levels of CFTR Compared with

Heterologous Expression Systems

To compare CFTR biogenesis in heterologous versus endogenous expression systems,

we first determined the relative amounts of CFTR in transiently transfected COS-7

cells, in HeLa cells stably expressing CFTR, and in cells that endogenously express

CFTR, Calu-3 cells. COS-7 cells represent a common cell type that has been used

extensively to study CFTR biogenesis(Cheng et al., 1990b, Prince et al., 1999, Peter et

al., 2002), while HeLa and Calu-3 cells (Loffing et al., 1998, Loffing et al., 1999, Sun et

al., 2000b, Bebok et al., 2002) were selected based on their stable, high expression

levels of wild type CFTR.

To compare CFTR expression levels in the model cell lines, CFTR was

immunoprecipitated from 250 μg of total cellular protein under standardized conditions.

Relative amounts of CFTR expressed in each cell type were calculated based on

densitometry and are shown in Fig. 6A. In COS-7 cells, CFTR expression levels are

dependent upon transfection efficiency, while in HeLa and Calu-3 cells, the expression

levels were consistently high. Since the relative expression level in Calu-3 cells was

similar to HeLa cells stably expressing wild type CFTR, we selected Calu-3 cells for the

initial analysis.

The simplest explanation for high CFTR levels both in HeLa and Calu-3 cells is that

they have similar CFTR mRNA levels, protein synthetic rates, and stability. To compare

CFTR mRNA levels in HeLa and Calu-3 cells, we developed a semiquantitative RT-

PCR using GAPDH as an internal control. As shown in Fig. 6B, while GAPDH

message levels are similar, CFTR message levels are significantly higher in HeLa cells

than in Calu-3 (in contrast to rather similar protein levels (Fig. 6A)). To further assess

these differences, we also performed TaqMan Quantitative PCR (Fig. 6C). The results

of the real-time experiments establish that CFTR message levels in HeLa cells are 3.5-

36

fold higher than in Calu-3 cells. These findings imply that the high steady-state levels of

CFTR in Calu-3 cells must be due to increased translational rate, increased maturation

efficiency, extended protein half-life, or some combination of these effects.

5.2.2. CFTR Maturation and Protein Stability Are Enhanced in Calu-3

Cells

To monitor CFTR maturation efficiency and protein half-life in Calu-3 cells and

compare these values to previously reported results, we performed metabolic pulse-

chase experiments and followed CFTR maturation in COS-7, HeLa, and Calu-3 cells. In

these experiments, we compared the amount of the newly synthesized Band B CFTR

and its conversion to the fully glycosylated Band C CFTR in each cell type. The results

indicate that significantly more CFTR was synthesized in COS-7 and HeLa cells than in

Calu-3 cells, as was first described by Cheng et al. (Cheng et al., 1990b). The

conversion of the immaturely glycosylated CFTR to the maturely glycosylated form

was extremely inefficient, with 27 ± 7.1% (mean ± S.D.; n = 7) maturation efficiency in

COS-7 cells and 39 ± 5.1% (n = 11) in HeLa (Fig. 7A). In contrast, while the amount of

the newly synthesized Band B form of CFTR was the lowest in Calu-3 cells, the

maturation efficiency was 92.4 ± 8% (n = 11) after 4 h (Fig. 7B). These results indicate

that although less CFTR was being produced in Calu-3 cells, the protein was processed

much more efficiently to the mature form. Furthermore, comparing the total densities of

Band B and Band C CFTR over the 4-h chase indicated that the total densities remain

constant. This suggests that there is no early degradation, and all newly synthesized

Band B is converted into Band C, and that the maturation only reaches maximum after 4

h of the pulse.

To test whether increased CFTR maturation efficiency alone is responsible for high

CFTR levels in Calu-3 cells, we determined the half-life of the fully glycosylated CFTR

in each cell line. Using a more extended chase period in the metabolic labeling

experiments, we found that CFTR half-lives were 10.8 ± 2.5 h (mean ± S.D.) in COS-7

cells, 12.3 ± 1.7 h in HeLa cells, and 22.0 ± 4.2 h in Calu-3 cells (Fig. 8). The results

indicate that CFTR is more stable in Calu-3 cells compared with heterologous cells.

37

Therefore, more efficient CFTR maturation and elongated protein half-lives contribute

to the high steady state CFTR levels in these cells.

5.2.3. ERAD of CFTR Is Insignificant in Calu-3 Cells

Early degradation of wild type CFTR by the proteasome has been described as a

common feature of CFTR biogenesis (Jensen et al., 1995b, Ward et al., 1995, Bebok et

al., 1998). Because CFTR maturation approaches 100% efficiency in Calu-3 cells, we

hypothesized that the disappearance of Band B CFTR in these cells is clearly the result

of maturation and not degradation by the proteasome. To test this possibility, we

compared the effects of two proteasome inhibitors (ALLN (50 μM) (Jensen et al.,

1995b) and clasto-lactacystin-β-lactone (10 μm)(Dick et al., 1996)) on the half-lives of

Band B CFTR in HeLa and Calu-3 cells. As shown in Fig. 9, while 50 μM ALLN

caused a significant increase in the half-life of Band B CFTR in HeLa cells, it had no

effect on the stability of the immature CFTR in Calu-3 cells, suggesting that the core-

glycosylated protein is not a substrate for ERAD in Calu-3 cells. Similar results were

seen when the proteasome was blocked using 10 μM clasto-lactacystin-β-lactone (data

not shown). These results support our hypothesis that in Calu-3 cells all newly

synthesized, core-glycosylated CFTR is processed to the fully glycosylated form, and

therefore, there is no role for the proteasome in the early events of CFTR processing in

Calu-3 cells.

5.2.4. Cell Surface CFTR Expression Is Elevated in Calu-3 Cells

To test whether increased CFTR stability translates to a higher percentage of CFTR at

the cell surface, we performed quantitative cell surface biotinylation experiments and

compared the biotinylated and total pools of CFTR in each of the cell lines. The results

shown in Fig. 10A indicate that the biotinylated CFTR pool in COS-7 cells was 11 ±

2.2% (mean ± S.D.), in HeLa was 9.7 ± 1.5%, and in Calu-3 was 20 ± 4.0%. Since

Calu-3 cells were grown on plastic dishes under standard tissue culture conditions; we

tested whether growing the cells on semipermeable supports as polarized monolayers

affects CFTR surface expression. After growing the cells for 9-12 days on 12-mm

filters, the cells formed tight monolayers as monitored by measuring transepithelial

resistance (>800 Ω·cm2). Under these conditions, the biotinylated CFTR fraction was 17

38

± 5%, similar to non-polarized cells. These results demonstrate that the surface CFTR

pool in Calu-3 cells is higher, but cell polarity does not affect the relative surface pool.

The fact that CFTR surface expression is not elevated in polarized cells was somewhat

surprising, given that in HT29 cells, a colonic epithelial cell line, CFTR surface

expression requires polarization of the colonocytes (Morris et al., 1994). To confirm

that Calu-3 cells had formed polarized monolayers, we monitored the expression a ZO-

1, a marker for tight junctions (red)(Coyne et al., 2002), and CFTR (green) localization

in the Calu-3 cells using immunocytochemistry (Fig. 10B). The results shown in Fig.

10B indicate that the Calu-3 cells have formed tight monolayers as evidenced by ZO-1

staining (red) close to the apical surface and that CFTR (green) is found both at the cell

surface and in intracellular sites. Next, we tested whether the rate and efficiency of

CFTR maturation was affected by cell polarity. The results shown in Fig. 10C confirm

that similar to conventional tissue culture conditions (Fig 7 A and B), CFTR maturation

is also efficient under polarizing conditions (>90%). Interestingly, these experiments in

Calu-3 monolayers suggested that the amount of radiolabeled CFTR dramatically

decreased compared with non-polarized conditions and that rates of conversion of

newly synthesized (Band B) CFTR to fully glycosylated (Band C) CFTR was slower

than under standard conditions. Only ∼30% of the newly synthesized (Band B) CFTR

was converted into fully glycosylated (Band C) at 2 h, and maturation was completed

only after 6 h of chase.

5.2.5. CFTR Maturation Is Efficient in T84 Cells Grown under Standard

Tissue Culture Conditions

To determine whether efficient CFTR maturation is a special feature of Calu-3 cells or

present in other endogenous CFTR expressing cell lines, we also tested T84 and HT29

colonic epithelial cell lines endogenously expressing wild type CFTR. Fig 11A indicates

that steady state CFTR protein levels are highest in Calu-3 cells. In T84 and HT29 cells,

CFTR levels are 3- and >10-fold lower than in Calu-3, respectively (Fig 11A). TaqMan

RT-PCR measurements demonstrated that CFTR message levels in T84 cells are 4-fold

and in HT29 are 10-fold lower than in Calu-3 cells grown under the same conditions

(Fig 11B). Because of low transcription and consequent low translation of CFTR in

39

HT29 cells, only T84 cells synthesized sufficient amounts of the protein to effectively

follow maturation efficiency. As shown in Fig 11C, although CFTR synthetic levels

were quite low and maturation efficiency in the early chase periods was variable, by the

end of the 4th h into the chase, the maturation of the newly synthesized protein was

virtually 100% in T84 cells. These results indicate that efficient processing of

endogenous wild type CFTR is not a unique feature of Calu-3 cells but also exists in a

colonic epithelial cell line.

40

Figure 6: CFTR and mRNA levels in different cell lines.A, steady-state wild type

CFTR protein level is high in Calu-3 cells. In transfected COS-7 cells, wild type CFTR

expression levels were analyzed 48 h after transfection. HeLa cells stably expressing

CFTR, and Calu-3 cells endogenously expressing the protein, were grown under

41

standard conditions and tested at ~80% confluence. CFTR was immunoprecipitated

from 250 μg of total protein from each cell type using an anti-CFTR C-terminal

monoclonal antibody, 24-1. Immunoprecipitated CFTR was in vitro phosphorylated

with protein kinase A and [γ-32

P]ATP and analyzed by SDS-PAGE and

autoradiography. A representative gel of four is shown (upper panel). The relative

amounts of wild type CFTR expressed in each of the cell lines were calculated based on

densitometry (lower panel). The averages ± S.D. were calculated from four independent

experiments. B, CFTR mRNA levels are significantly lower in Calu-3 cells than in

HeLa cells. CFTR message levels in HeLa and Calu-3 cells were tested using

semiquantitative RT-PCR using GAPDH as control (upper panel, representative gel is

shown) and TaqMan quantitative PCR using 18 S rRNA as control (lower panel).

Results are plotted as CFTR mRNA levels relative to 18 S rRNA, mean and S.D. of four

separate samples amplified under the same condition. In contrast to slightly lower

CFTR protein levels, CFTR message levels are ~4-fold higher in HeLa cells.

42

Figure 7: CFTR maturation is efficient in Calu-3 cells. COS-7, HeLa, and Calu-3

cells were pulse-labeled with 300 mCi/ml 35

S-labeled amino acids (EasyTag Protein

Labeling Mixture, PerkinElmer Life Sciences). After the pulse, the

[35

S]methionine/cysteine-containing medium was replaced with complete medium.

Cells were lysed at the time points specified, and CFTR was immunoprecipitated with

43

anti-CFTR 24-1 antibody. Samples were separated by SDS-PAGE on 6% gels and

analyzed using a Phosphorimager (Amersham Biosciences). CFTR maturation

efficiency was measured by comparing the density of labeled band B (100%) after a 30-

min pulse to the density of Band C after 4 h of chase using IPLab software. A, average

maturation efficiencies at the end of a 4-h chase in each cell line tested. Results are

plotted as percent of newly synthesized Band B converted to Band C by the end of a 4-h

chase (average + S.D., n = number of experiments). B, representative pulse-chase

experiments are shown for each cell line (left panels). Arrows indicate the core (Band

B) and fully glycosylated (Band C) CFTR. Average disappearance of Band B

(maturation and/or degradation) and formation of Band C at each time point (right

panels). Disappearance of Band B (diamonds) and formation of Band C (squares) were

calculated based on densitometry at each chase time point. Results are plotted as percent

of band B density at the 0 time point (average + S.D., n = 5).

44

Figure 8: CFTR half-life is longer in Calu-3 cells compared with heterologous

expression systems. In COS-7 cells, CFTR half-lives were tested 24 h after transfection

and in HeLa and Calu-3 cells 24 h after seeding. After a 1-h pulse with [35

S]methionine

(EasyTag Protein Labeling Mixture) and the indicated chase periods in complete

medium, the cells were lysed in radioimmune precipitation assay buffer and CFTR was

immunoprecipitated and analyzed as described above. A, average CFTR half-lives were

monitored by densitometry (n = number of experiments). Calculation of the protein

half-lives was performed as described by Straley et al. (1998)(Straley et al., 1998). B,

representative gels for CFTR half-life measurements are shown below for each of the

cell types.

45

Figure 9: Proteasome inhibition has no effect on CFTR processing in Calu-3 cells.

Metabolic pulse-chase experiments were performed as described in the legend to Fig. 7

on Calu-3 and HeLa in the presence (+) or absence (-) of 50 μm ALLN. In the +

samples, ALLN was present in the medium during the entire experiment. Representative

gels are shown on the left, and the densities of Band B (triangle and diamond) and Band

C (× and square) CFTR at each chase time point is plotted as percent of Band B at the 0

time point. ALLN treatment resulted in an increase of the half-life of Band B in HeLa

cells only (top, right panel). A representative of two experiments is shown.

46

Figure 10: CFTR distribution in COS-7, HeLa, and Calu-3 cells. A, the relative

surface pools of CFTR expressed in COS-7, HeLa, and Calu-3 cells were determined

using a surface biotinylation assay(Peter et al., 2002). In these assays, the total CFTR

from 50% of the lysates (T) was compared with the biotinylated fraction (B). Cells were

47

lysed in radioimmune precipitation assay buffer, and CFTR was immunoprecipitated

using anti-CFTR C-terminal (24-1) monoclonal antibody. From the other 50% of the

lysates, CFTR was immunoprecipitated as described above, eluted, and re-captured

using avidin-Sepharose beads (biotinylated CFTR (B)). Total CFTR (T) and biotinylated

CFTR (B) were in vitro phosphorylated with protein kinase A and [γ-32

P]ATP,

separated by SDS-PAGE, and analyzed by Phosphorimaging and densitometry.

Representative gels of seven or more experiments are shown. The average percentage of

biotinylated CFTR for each cell type was calculated based on densitometry. B, CFTR

distribution in Calu-3 monolayers. Calu-3 cells were grown on permeable supports and

analyzed after 10-12 days of culture using indirect immunofluorescence. CFTR was

labeled with 24-1 monoclonal antibody and anti-mouse IgG, Alexa-Fluor488 (green).

Tight junctions were stained using a polyclonal (rabbit) anti-ZO1 antibody (Zymed

Laboratories Inc.) and anti-rabbit IgG Alexa-Fluor596 (red). A side view and a top view

at the apical membrane domain are shown. CFTR (green) is present at the apical

membrane and also intracellularly. Tight junctions are well developed as represented by

the organized red staining of ZO1. C, CFTR maturation efficiency in Calu-3 cells grown

on filters. Calu-3 cells were grown on 12-mm filters and metabolically labeled, and

CFTR maturation efficiency was monitored as described in the legend to Fig. 7.

Conversion of the Band B to Band C was compared at each time points of the chase.

Results are plotted as percent of Band B at the 30 min (highest density) chase time.

48

Figure 11: CFTR expression and maturation in T84 cells. CFTR protein (A) and

mRNA levels (B) were compared in Calu-3, T84, and HT29 cells as described under

“Materials and Methods.” CFTR maturation efficiency was monitored in T84 cells as

described in the legend to Fig. 7(C). A representative gel (n = 3) is shown (C, left

panel). The relative amount of fully glycosylated CFTR (Band C, squares) and core

glycosylated CFTR (Band B, diamonds) is plotted as percent of the immature Band B

after the pulse (right panel).

49

5.3. Pharmacological Chaperones Enhance Surface Stability of ΔF508

CFTR

5.3.1. ΔF508 CFTR rescue by permissive temperature in HeLa F cells

In order to study the cell-surface trafficking of rΔF508 CFTR, we first established

whether permissive temperature culture of HeLaDF cells could generate sufficient

amounts of fully glycosylated ΔF508 CFTR at the cell surface in order to measure

endocytosis rates. Following culture at 27 °C for 48 h, CFTR was immunoprecipitated

from whole-cell lysates and analysed for the presence of mature, glycosylated band C

(rΔF508 CFTR). The results in Fig. 12(A) demonstrate that a significant amount of fully

glycosylated CFTR is formed during 27 °C culture. To confirm that the fully

glycosylated rΔF508 CFTR was expressed at the cell surface, cells were surface

biotinylated using biotin–LC–hydrazide(Peter et al., 2002). Biotinylated CFTR was

detected in HeLaDF cells after 27 °C culture, but not in cells maintained at 37 °C (Fig.

12A). Control cells expressing WT CFTR served as a comparison in order to illustrate

the level of ΔF508 CFTR rescue.

To determine the stability of rΔF508 CFTR after permissive temperature rescue, WT

CFTR- or rΔF508 CFTR-expressing HeLa cells were raised to the restrictive

temperature and the protein half-lives of WT CFTR and rΔF508 CFTR were determined

by metabolic pulse–chase analysis. For these experiments, cells were cultured at 27 °C

for 24 h and metabolically labelled with [35

S]-methionine for an additional 18 h at 27 °C

(see the Experimental section). The cells were then returned to 37 °C, and the labelled

proteins were chased for the time periods specified. The results indicate that the half-life

of WT CFTR is 12±1.5 h, whereas the half-life of rΔF508 CFTR is 4±1 h (Fig. 12B).

The rΔF508 CFTR protein half-life is much shorter than that of WT CFTR (P<0.001),

and these results are in agreement with previously published experiments performed in

BHK (baby-hamster kidney) and CHO (Chinese-hamster ovary) cells (Sharma et al.,

2001, Gentzsch et al., 2004).

50

5.3.2. Extended half-life of rΔF508 CFTR at the permissive temperature in

HeLaDF cells

Next, we tested whether extended culture at the permissive temperature would affect the

half-lives of WT CFTR and rΔF508 CFTR in HeLa cells. We followed the protocol

described above (see the Experimental section), but instead of transferring the cells to

37 °C after metabolic labelling, they were incubated at 27 °C for the time periods

indicated. The results show that at 27 °C, the half-lives of WT CFTR and rΔF508 CFTR

were 60±11 h and 63±9 h respectively (Fig. 12C), demonstrating that the instability of

rΔF508 CFTR compared with WT CFTR which was observed at the restrictive

temperature is not apparent at the permissive temperature; in other words, the rΔF508

CFTR half-life defect is a TS defect.

We next sought to determine why rΔF508 CFTR has a short half-life at the restrictive

temperature by examining the internalization properties of WT CFTR and rΔF508

CFTR in HeLa cells and epithelial cells (CFBE41o- and Calu-3) under both non-

polarized and polarized conditions. These experiments served to test cell-type- and

polarization-specific differences in the trafficking of the two proteins.

5.3.3. rΔF508 CFTR endocytosis is accelerated in airway epithelial cells

To determine the cell-surface stability of WT CFTR and rΔF508 CFTR in HeLa cells at

37 °C, we measured their internalization rates using a two-step biotinylation protocol

(Jurkuvenaite et al., 2006). To measure CFTR endocytosis rates, we oxidized the

surface carbohydrate groups of cell surface glycoproteins at the initial (zero) time point

(see the Experimental section) and then allowed the proteins to be internalized for 2.5

min, at which time the oxidized glycoproteins remaining at the cell surface were

labelled with biotin. An internalization time of 2.5 min was chosen for all assays

conducted at 37 °C because, at this temperature, previous internalization time courses in

multiple cell lines indicated that periodate-oxidized CFTR modified at the initial time

point did not recycle back to the cell surface (results not shown). Since the biotin–LC–

hydrazide is membrane impermeable, the only biotin-accessible CFTR is what remains

on the cell surface during the warm-up period (see the Experimental section). Therefore

changes in the surface pool of CFTR after a 2.5 min warm-up period were reflected in a

51

loss of „biotinylatable‟ CFTR, and this loss corresponds to the amount of CFTR that had

been internalized from the cell surface.

Following biotin labelling, cells were lysed and total CFTR was immunoprecipitated as

described above. At each time point, biotinylated CFTR was detected by Western blot

with HRP-conjugated avidin. With this protocol, biotin labelling of band B CFTR is not

observed unless cells are first permeabilized (Peter et al., 2002), suggesting that under

non-permeabilizing conditions such as those presented herein, this biotinylation method

used does not label intracellular proteins. The results of these experiments indicate that

both WT CFTR and rΔF508 CFTR endocytosis rates are rapid, with 25±5% and 27±5%

of the surface pool internalized in 2.5 min respectively (Fig. 13A). This result is

consistent with a previous comparison of WT CFTR and rΔF508 CFTR internalization

rates in BHK cells (Sharma et al., 2004).

Since in vivo CFTR is expressed on the apical surface in epithelial cells, we next

compared the surface stability of WT CFTR and rΔF508 CFTR in both polarized and

non-polarized human airway epithelial cells at 37 °C. In CFBE41o-WT cells grown on

plastic dishes (non-polarized cells), CFTR endocytosis slowed to 14±4% of the surface

pool internalized in 2.5 min (P=0.02 compared with HeLaWT). In contrast, 29±5% of

rΔF508 CFTR was internalized during the same time period in CFBE41o-DF (Fig.

13B), a rate similar to that seen in HeLaDF cells [P=NS (not significant)]. Furthermore,

the difference between WT CFTR and rΔF508 CFTR internalization rates was more

pronounced when the cells were grown as polarized monolayers. In polarized cells, WT

CFTR internalization dropped significantly to 3.2±2% per 2.5 min (P<0.0001 compared

with HeLaWT), whereas rΔF508 CFTR internalization remained at 30±3% per 2.5 min.

As a further control, we measured WT CFTR internalization in polarized Calu-3 cells

with similar results (5±1% per 2.5 min; P=NS), indicating that the surface pool of WT

CFTR is very stable in polarized epithelia (Fig. 13C), whereas rΔF508 CFTR is not

stable. Because it was clear that WT CFTR trafficking did not appear to be faithfully

represented in HeLa cells, and our goal was to identify the defect in rΔF508 CFTR

compared with the control WT CFTR protein, we focused our efforts on analysing the

rΔF508 CFTR trafficking defect in human airway epithelial cells.

52

5.3.4. Shortened cell-surface half-life of rΔF508 CFTR in CFBE41o-DF cells

Because polarization affected WT CFTR but not rΔF508 CFTR internalization, we then

tested the cell-surface half-lives of both WT CFTR and rΔF508 CFTR in CFBE41o-

cells using a cell-surface biotinylation-based assay (Fig. 14). The results indicate that

the surface half-life of biotinylated WT CFTR was 8.5±1 h in non-polarized cells (Fig.

14, top left-hand panel) and 8.3±0.3 h in polarized cells (P=NS, Fig. 14, top right-hand

panel), demonstrating that the stability of the WT CFTR protein was not affected by cell

polarization. Examination of rΔF508 CFTR indicated that the surface half-life of the

rescued protein was very short (less than 2 h) under both non-polarized and polarized

conditions (1.8±0.1 compared with 2.0±0.2 h respectively; P=NS, Fig. 14, middle

panels). Thus rΔF508 CFTR surface stability is decreased compared with WT CFTR,

and polarization did not affect the surface stability of either protein (Fig. 14, bottom

panels).

5.3.5. Permissive temperature culture stabilizes rΔF508 CFTR in polarized

epithelial cells

Since the rΔF508 CFTR trafficking defect in epithelial cells is the result of enhanced

endocytosis, we tested whether permissive temperature culture could correct this defect.

To answer this question, we compared the effects of 27 °C treatment on WT CFTR and

rΔF508 CFTR cell-surface trafficking in polarized CFBE41o- cells using cell-surface

half-life and internalization experiments. The results show that both WT CFTR and

rΔF508 CFTR are extremely stable at the cell surface at 27 °C, with cell-surface half-

lives much greater than 8 h (Fig. 15, top panels). Because CFTR levels were not

monitored beyond 8 h, we cannot calculate to what extent permissive temperature

culture stabilized WT CFTR or rΔF508 CFTR. However, since WT CFTR and rΔF508

CFTR surface half-life measurements were similar at 27 °C, these results reveal that 27

°C treatment eliminated the drastic difference in surface half-life between WT CFTR

and rΔF508 CFTR observed at 37 °C. Measurement of WT CFTR and rΔF508 CFTR

internalization rates at 27 °C revealed a dramatic decrease in both cell lines. In fact,

CFTR internalization was not measurable after the 2.5 min warm-up period. After a 10

min warm-up period, WT CFTR and rΔF508 CFTR internalization rates were 20±3%

53

per 10 min (P=0.05) and 22±4% per 10 min (P=0.0004) respectively (Fig. 15, middle

and bottom panels), which indicated that 27 °C treatment eliminated the difference in

internalization rates between WT CFTR and rΔF508 CFTR. Importantly, the results of

these studies indicate that both the short surface half-life and the rapid internalization

rate of rΔF508 CFTR are TS defects.

5.3.6. Permissive temperature culture corrects the functional defect

associated with rΔF508 CFTR

In addition to the trafficking defect, rΔF508 CFTR fails to respond to cAMP after

forskolin stimulation in CFBE41o-DF cells (Bebok et al., 2005). Since we observed that

permissive temperature culture corrects the endocytosis defect in rΔF508 CFTR and

restores the protein half-life to levels equivalent to WT CFTR, we then tested whether it

might also correct the functional defect(Bebok et al., 2005). In these experiments,

polarized CFTR-expressing CFBE41o-DF monolayers were cultured at 27 °C for 48 h to

facilitate rΔF508 CFTR expression on the cell surface. These monolayers were then

mounted in Ussing chambers, where cAMP-activated Isc was measured at either 37 °C

or 27 °C. Forskolin (10 mM) was added to the apical compartment to enhance

intracellular cAMP levels and activate Isc. When the current reached a maximum and

stabilized, glybenclamide was added at increasing concentrations to block Isc. In some

experiments, a CFTR-specific inhibitor was used to block currents(Yang et al., 2003), as

described previously(Chen et al., 2006). Forskolin was used consistently to activate Isc

because we found that, in both WT CFTR- and ΔF508 CFTR-expressing cells, it was

sufficient to stimulate cAMP-mediated chloride currents. A cocktail designed to

maximally stimulate cAMP responses [forskolin, IBMX (3-isobutyl-1-methylxanthine)

and bromoadenosine–cAMP] did not increase the current beyond the forskolin-induced

current. Likewise, glybenclamide was used consistently because the CFTR-specific

inhibitor did not further inhibit the currents, indicating that glybenclamide provided

maximal CFTR channel inhibition (results not shown). The magnitude of the resulting

Isc was compared with parallel CFBE41o-WT controls (see the Experimental section).

The results show that at 37 °C, cells expressing WT CFTR channels produce an anion

current that is readily stimulated by forskolin and can be inhibited completely by

glybenclamide (Fig. 16, top left-hand panel), whereas cells expressing rΔF508 CFTR

54

exhibit very weak responses to both treatments (Fig. 16, middle left-hand panel), in

agreement with our previous findings(Bebok et al., 2005). When the temperature is

maintained at 27 °C, however, rΔF508 CFTR-expressing cells exhibit an anion current

similar to cells expressing WT CFTR (Fig. 16, top and middle right-hand panels). Direct

channel stimulation by 50 mM genistein further enhanced the rΔF508 CFTR current at

27 °C (results not shown), in agreement with a previous observation that at 37 °C,

rΔF508 CFTR produced a current in response to genistein(Bebok et al., 1998). This

restoration of the functional defect suggests that the loss of cAMP response has been

regained at 27 °C. In consideration with the previous studies, these experiments reveal

that both the surface trafficking and functional activity defects of rΔF508 CFTR are TS.

5.3.7. Pharmacological chaperones correct the internalization defect and

increase the surface stability of rΔF508 CFTR

As shown above, maintenance of the TS ΔF508 protein at the permissive temperature

corrects multiple trafficking and functional defects, in that 27 °C treatment not only

rescues ΔF508 CFTR from ERAD, but also stabilizes the endocytosis and surface

stability defects as long as cells are maintained at 27 °C. On the basis of these results,

we investigated whether two pharmacological chaperones which facilitate ΔF508 CFTR

exit from the ER, a quinazoline compound (CFcor-325) and a bisaminomethylbithiazole

compound (Corr-4a)(Loo et al., 2006, Wang et al., 2007a), have any effect on rΔF508

CFTR or WT CFTR cell-surface trafficking at 37 °C.

First, we studied the effect of the compounds on WT CFTR and rΔF508 CFTR

endocytosis in CFBE41o- cells. For these experiments, CFBE41o

-WT or

-DF cells were

cultured for 48 h at 27 °C, followed by a 1 h pre-treatment with 10 mM CFcor-325,

Corr-4a, or a vehicle control (DMSO) at 37 °C. Internalization assays were then

performed at 37 °C. The results indicated that both CFcor-325 and Corr-4a decreased

the internalization rate of rΔF508 CFTR from 30% to ~5% and ~1% respectively

(P<0.005, Fig. 17, top and middle panels). Interestingly, the compounds had no effect

on WT CFTR endocytosis or TR endocytosis from the apical surface (Fig. 17, bottom

panels), suggesting that the effect was specific for rΔF508 CFTR.

55

5.3.8. Pharmacological chaperones extend the cell-surface half-life of

rΔF508 CFTR

Next, we monitored the effects of CFcor-325 or Corr-4a on the cell-surface half-life of

WT CFTR and rΔF508 CFTR. For these experiments, CFBE41o-WT or

-DF cells were

cultured for 48 h at 27 °C, followed by treatment with 10 mM CFcor-325, Corr-4a or a

vehicle control (DMSO) at 37 °C. CFTR cell-surface half-lives were then evaluated in

the presence of correctors or vehicle using the surface biotinylation-based assay. The

results indicated that treatment with either small molecule corrector stabilized rΔF508

CFTR compared with untreated controls (Fig. 18). CFcor-325 extended the half-life of

rΔF508 CFTR from 2.5±0.4 h to 4.6±0.9 h (P=0.004), and Corr-4a extended the half-

life from 2.6±0.6 h to 4.5±1.2 h (P=0.03), indicating that both compounds stabilized the

half-life of rΔF508 CFTR. Significantly, neither compound affected the half-lives of

neither WT CFTR nor TR (Fig. 18, bottom panels), suggesting the effects observed are

specific for rΔF508 CFTR.

56

Figure 12: ΔF508 CFTR rescue and stability in HeLa cells (A) Low temperature (27

°C) rescue of ΔF508 CFTR in HeLaDF cells. CFTR was immunoprecipitated from

HeLaDF cells that had been cultured at 27 °C or 37 °C for 48 h or HeLaWT cells

cultured at 37 °C, analysed by SDS/PAGE, Western blotted and detected using

polyclonal anti-(CFTR NBD2) antibody (Total, left-hand panel). Arrows indicate ER

(Band B) and post-ER forms (Band C) of CFTR. The presence of rΔF508 CFTR at the

cell surface (Band C) was confirmed by cell-surface biotinylation, immunoprecipitation

of CFTR and Western blotting with HRP-conjugated avidin (Surface, right-hand panel).

(B) WT CFTR and rΔF508 CFTR half-lives at 37 °C. CFTR half-lives were measured

in metabolic pulse–chase experiments (see the Experimental section). HeLaDF and

57

HeLaWT cells were cultured at 27 °C for 24 h, followed by metabolic labelling for 18 h

and chased at 37 °C for up to 18 h. At the time points indicated, cells were subjected to

lysis, CFTR immunoprecipitation, SDS/PAGE and phosphorimaging. Representative

gels of pulse–chase experiments for WT CFTR and rΔF508 CFTR (ΔF508, top and

middle panels respectively) and calculated half-lives (bottom panel) are shown (n=4).

(C) Extended half-lives of WT CFTR and rΔF508 CFTR at 27 °C. Pulse–chase

experiments were performed in HeLaDF and HeLaWT cells as described in (B), except

that the chase was performed at 27 °C (see the Experimental section). Representative

images (top and middle panels) and calculated half-lives (bottom panel) are shown

(n=4).

58

Figure 13: rΔF508 CFTR endocytosis in HeLa and airway epithelial cells.

(A)Internalization of WT CFTR and rΔF508 CFTR in HeLa cells. CFTR endocytosis

was measured using a modified biotinylation assay (see Experimental section).

Representative gels of immunoprecipitated (Total) and cell-surface biotinylated WT

CFTR and ΔF508 CFTR (Surface) at 0 and 2.5 min of internalization (Int.) are shown.

Internalization rates of WT CFTR and rΔF508 CFTR (ΔF508) are plotted as the

percentage decrease in CFTR Band C density after a 2.5 min internalization step (n=5).

(B) WT CFTR and rΔF508 CFTR internalization in non-polarized and polarized

epithelial cells. CFBE41o-DF (ΔF508) and CFBE41o

-WT (WT) cells grown under non-

polarized (plastic dishes, left-hand panels) or polarized (permeable supports, right-hand

panels) conditions were tested for CFTR internalization (Int.). Representative gels are

shown. Internalization rates are the percentage density decrease in cell surface Band C

CFTR after a 2.5 min internalization step compared with 0 min (n=5). (C) WT CFTR

59

internalization in polarized Calu-3 cells. Calu-3 cells grown under polarized conditions

(permeable supports) were tested for CFTR internalization. A representative gel

showing cell-surface biotinylated WT CFTR (surface) at 0 and 2.5 min of

internalization (Int.) is shown (n=4).

60

Figure 14: Cell-surface half-lives of WT CFTR and rΔF508 CFTR in CFBE41o-

cells. Representative gels are shown of WT CFTR (CFBE WT, top panels) and rΔF508

CFTR (CFBE ΔF508, middle panels) half-life measurements performed at 37 °C under

non-polarized and polarized conditions. Half-lives were calculated using densitometry

followed by analysis as described previously [34], and the results are shown in the

bottom panel (n=4).

61

Figure 15: Surface stability of rΔF508 CFTR at 27 °C in airway epithelial cells. Cell

surface stability (top panels) and internalization rates (middle panels) of CFTR were

measured at 27 °C (see Experimental section). In polarized CFBE41o- cells, both WT

CFTR and rΔF508 CFTR are extremely stable at 27 °C. There was no detectable

decrease in biotinylated Band C CFTR during the 8 h chase. Representative gels from

CFBE41o-WT and CFBE41o

-DF (ΔF508) are shown (top panels). For internalization

rates, total and cell surface CFTR were detected. Representative gels are shown (middle

panels). Internalization rates are plotted as the percentage decrease in density of Band C

CFTR at 10 min (bottom panel; n=4). Biot.: biotinylated CFTR.

62

Figure 16: Ussing chamber analysis of rΔF508 CFTR after low temperature

correction. Polarized CFBE41o-WT and CFBE41o

-DF (ΔF508) monolayers were

cultured at 27 °C for 48 h. Cells were mounted in Ussing chambers and temperature-

equilibrated (37 °C or 27 °C as indicated) for 30 min, followed by measurement of

baseline steady state Isc and Rt values. Forskolin (FSK, 10 mM) was added to the apical

chambers, and Isc and Rt values were monitored until a new baseline was obtained. The

indicated concentrations of glybenclamide (GLYB) were then added apically, and Isc

and Rt values were monitored. Representative traces (top and middle panels) are shown.

Results are DIsc (mA/cm2) of FSK (which represents a positive current following

63

forskolin activation) or of GLYB, which represents a negative current following

administration of glybenclamide to block channel activity (bottom panels; n 5). ΔF508

CFTR-expressing monolayers exhibited significantly blunted responses to forskolin and

glybenclamide compared with WT CFTR-expressing monolayers at 37 °C (bottom

panels). These responses were significantly enhanced when monolayers were

maintained at the permissive temperature (27 °C, *P<0.005; +P<0.01), so that there

were no significant differences between WT CFTR and rΔF508 CFTR responses at this

temperature (bottom panels). For each condition, the number of experimental repeats is

indicated in parentheses.

64

Figure 17: CFcor-325 and Corr-4a increase the stability of WT CFTR and rΔF508

CFTR. Internalization assays for WT CFTR (WT) and rΔF508 CFTR (ΔF508) were

performed at 37 °C in CFBE41o-DF and CFBE41o

-WT cells following low temperature

rescue in the presence or absence of CFcor-325 or Corr-4a. Representative gels (top

panels) and the percentage of CFTR internalized for each corrector is shown (middle

panels; n=4). The percentage of TR internalized, measured under identical conditions, is

also shown (bottom panels). WT CFTR and TR internalization rates were tested as

controls and ~5% of WT CFTR and ~30% of rescued ΔF508 CFTR was internalized in

2.5 min in untreated cells. Both CFcor-325 and Corr-4a treatment significantly

decreased rΔF508 CFTR internalization in CFBE41o-DF cells (n=4; P<0.05). No

changes in WT CFTR and TR internalization rates were measured.

65

Figure 18: CFcor-325 and Corr-4a extend the cell-surface half-life of rΔF508

CFTR. Polarized CFBE41o-DF (ΔF508) and CFBE41o

-WT (WT) cells were cultured at

27 °C for 48 h, returned to 37 °C, and treated with CFcor-325 or Corr-4a for 8 h. Cell-

surface CFTR half-lives were measured following cell-surface biotinylation.

Representative gels (top panels) and the mean CFTR half-life for each pharmacological

agent and untreated control (middle panels; n=4) are shown. The TR half-life was also

measured in the presence or absence of correctors as an additional control (bottom

panels; n=4).

66

6. DISCUSSION

The first aim of this study focused on the internalization signal for CFTR endocytosis.

Several observations suggest that the only internalization signal in CFTR is the Tyr1424

-

X-X-Ile1427

motif in the COOH-terminal tail. First, the ablation of the only endocytosis

signal in the transferrin receptor YTRF resulted in a similar loss of internalization

activity (Collawn et al., 1990). Furthermore, the rate of endocytosis of the 20

YTRF23

→20

ARTA23

mutant was the same as a transferrin receptor containing only a 4-amino

acid cytoplasmic tail, indicating that this motif and more specifically these two residues

were the only residues in the 61-amino acid cytoplasmic tail of the transferrin receptor

that were necessary for endocytosis. Second, the internalization rate of Y1424A,I1427A

CFTR is comparable with the rate of bulk flow lipid uptake via the endocytic pathway

(~2%/min.)(Mukherjee et al., 1997), suggesting that the residual internalization activity

observed in these studies reflects nonspecific uptake through clathrin-coated pits.

Considering that clathrin-coated pits constitute ~2% of the cell surface (Mukherjee et

al., 1997), our findings suggest that the double mutant has completely lost the ability to

concentrate in these surface domains. This result has particular significance given the

increasing evidence that CFTR enters the endocytic pathway via clathrin-coated pits

(Bradbury et al., 1994, Lukacs et al., 1997, Weixel and Bradbury, 2001).

The signal identified here, YXXI, appears to function only as an internalization signal

and not a “down-regulation” signal for conferring CFTR degradation. If YXXI was

important to mediate CFTR degradation, metabolic pulse-chase experiments would have

revealed an extended half-life when the signal was inactivated. Our studies indicate that

CFTR lacking YXXI is stabilized at the cell surface because endocytosis of this mutant

is severely compromised. This also suggests that CFTR participates in the membrane-

recycling pathway. This idea is consistent with previously reported immunolocalization

studies that have shown that CFTR co-localizes with rab4, a component of recycling

endosomes (Webster et al., 1994). The reasons why CFTR would be part of this

pathway are unclear, but it may be to regulate the amount of functional chloride

channels at the cell surface in the same manner as aquaporins and glucose transporters

are regulated (Jhun et al., 1992, Holman et al., 1994, Brown et al., 1995, Katsura et al.,

1995, Nielsen et al., 1995, Pessin et al., 1999).

67

The specific residues identified by these studies, YXXI, that are important for CFTR

endocytosis are conserved in the ten COOH-terminal tail sequences spanning from

Xenopus to human(Prince et al., 1999). The tyrosine residue is conserved among all

species with the exception of the dogfish, which has a phenylalanine residue. The

isoleucine residue is conserved in 7 of 10 sequences with a very conservative leucine

residue substitution in the other three, indicating that this motif, YXX(I/L), is highly

conserved in the sequences identified to date. Both FXXL (dogfish) and YXX(I/L)

conform to the YXXΦ motif common to internalization signals, where X is any amino

acid and Φ is a hydrophobic residue (Trowbridge et al., 1993).

The identification of the YXXI signal is also consistent with recent studies that a region

that includes this sequence interacts with the endocytic clathrin adaptor complex AP-2

using plasmon resonance analysis(Weixel and Bradbury, 2001). Together, their study

(Weixel and Bradbury, 2001) and ours support the view that CFTR endocytosis occurs

through clathrin-coated pits. Our study shows that two residues in the COOH-terminal

tail, tyrosine 1424 and isoleucine 1427, regulate the steady-state distribution of CFTR

between the plasma membrane and intracellular sites. This raises the important and

testable hypotheses that the Y1424,I1427 signal controls CFTR entry into clathrin-

coated pit regions at the apical membrane and that ablation of this signal abrogates one

type of microdomain targeting in polarized epithelial cells.

Regarding Aim 2., initial studies of CFTR biogenesis described complete and early

degradation of the ΔF508 CFTR and inefficient maturation of the wild type protein

(Cheng et al., 1990b, Lukacs et al., 1994, Ward and Kopito, 1994). Most of these

studies employed heterologous overexpression systems, with one exception(Ward and

Kopito, 1994). Kopito and colleagues (Ward and Kopito, 1994) compared wild type

CFTR maturation efficiency in stable HEK cells to HT29 and T84 cells endogenously

expressing wild type CFTR. In these cells, CFTR expression levels were 10-50-fold

lower than in HEK, but the maturation efficiency of CFTR was only ~25% after 2 h of

chase. In our studies, CFTR maturation in Calu-3 and T84 cells reached the maximum

(~100%) only after 4 h. Analysis of CFTR maturation efficiency in COS-7 and HeLa

cells suggested that there was no significant increase in Band C levels between the 2-

and 4-h chase periods, whereas in Calu-3 cells and T84 cells CFTR maturation was only

68

completed by the end of the 4th h. This slower CFTR processing noted in endogenously

expressing cells was even more pronounced in Calu-3 cells grown as polarized

monolayers. As a comparison with other cell lines, we found that CFTR mRNA and

protein levels were 4- and10-fold higher in Calu-3 cells than in T84 and HT29 cells.

While we were not able to follow the maturation of the protein in HT29 cells, analysis

in T84 revealed that CFTR maturation was very efficient and only complete by the end

of a 4-h chase.

A more rapid disappearance of Band B CFTR in T84 and HT29 than in HEK cells was

also described and attributed only to degradation(Ward and Kopito, 1994). However,

those experiments were completed before the role of the proteasome in early CFTR

degradation was described or before protein overexpression was shown to overload the

proteasome. Subsequently, it has been demonstrated that either the inhibition of the

proteasome (Ward and Kopito, 1994, Jensen et al., 1995b) or protein overproduction

(Johnston et al., 1998) could result in delayed degradation. Therefore, it is now clear

that disappearance of Band B could be due to both degradation and maturation. In our

studies, proteasome blockade revealed that in Calu-3 cells disappearance of band B was

not due to proteasomal degradation, whereas in HeLa cells it partially was.

The increased half-life of the mature CFTR in Calu-3 cells suggests that epithelial

factors stabilize CFTR. This finding is supported by studies showing that CFTR half-

life in heterologous systems is 8-12 h (Lukacs et al., 1994, Peter et al., 2002), whereas

in LLC-PK1 (Heda et al., 2001) and in MDCK cells (Swiatecka-Urban et al., 2002), two

kidney epithelial cells stably expressing the wild type CFTR, the half-life is

significantly longer when the cells are grown under polarized conditions. Increased

stability of the mature wild type CFTR in epithelial cells is also consistent with our

previous findings that growing MDCK cells as polarized monolayers results in

increased steady-state CFTR levels and function. Furthermore, possible cell type-

specific differences in wild type CFTR biogenesis and stability are suggested by our

findings that cellular polarization in Calu-3 cells did not have a significant effect on

total and cell surface CFTR levels in contrast to our previous findings in MDCK cells

(Bebok et al., 2001).

69

Both morphological and cell surface biotinylation studies indicate the existence of a

large intracellular CFTR pool in Calu-3 cells. The dynamics and precise cellular

localization of this pool remain unclear, but several studies (Prince et al., 1994,

BRADBURY, 1999, Bradbury et al., 1999, Prince et al., 1999, Ameen et al., 2000,

Silvis et al., 2003) have indicated that CFTR is found in endosomal and recycling

endosomal compartments. How regulation of surface localized CFTR is accomplished

in polarized epithelia and whether there is a physiological role for the intracellular pool

remain open questions.

The factors that allow efficient CFTR maturation as well as those that are responsible

for stabilizing the mature protein in Calu-3 and T84 cells have not been identified.

However, dramatic progress has been made recently in identifying tissue-specific

factors that organize the delivery and function of transport proteins to their appropriate

membrane domains (Madrid et al., 2001, Li et al., 2003, Krumins et al., 2004). These

results suggest that both the cellular context and molecular rationing of transport

components are important not only for proper function but also for intracellular

trafficking (Krumins et al., 2004). Nevertheless, normal epithelial cell function depends

on the accurate delivery of a large number of membrane components to a particular cell

surface domain, and defects in this process often lead to disease (Aridor and Hannan,

2000, 2002). Therefore, it is crucial to understand how different cell types organize the

biogenesis and intracellular processing of key molecules (Bertrand and Frizzell, 2003).

Since CFTR plays a central role in the regulation of epithelial ion transport in multiple

organ systems, understanding its biogenesis, cellular distribution, and stability in

epithelia may be the first step toward identifying the molecular defects leading to early

degradation of otherwise functional mutants, such as ΔF508 CFTR.

The importance of elucidating the biogenesis and intracellular journey of wild type

CFTR is also underscored by two publications indicating that some ΔF508 CFTR can be

found at the cell surface in native epithelia (Kalin et al., 1999, Penque et al., 2000).

These earlier reports raise the possibility that in the correct physiological milieu, even

the mutant protein might traffic differently than reported in heterologous expression

systems. Furthermore, a number of CFTR-associating proteins have been identified and

shown to regulate either the function (Naren et al., 1997) or the intracellular journey of

70

CFTR (Cheng et al., 2002). Whether these or other yet to be identified proteins have any

effect on the biogenesis and stability of the wild type protein in native epithelia remains

to be determined. Although endogenous, wild type CFTR synthesis is quite low in many

native tissues, our results suggest the usefulness of cell lines endogenously expressing

CFTR as powerful tools for investigating cell type-specific differences in CFTR

biogenesis and function.

Our third aim concentrated on understanding the trafficking of the low temperature or

chemical chaperone rescued DF508 CFTR. From previous studies it was evident that

the fate of rΔF508 CFTR at the cell surface after low temperature rescue is one of the

first examples of how the cellular quality-control mechanisms operate at the plasma

membrane and/or early endosomes (Sharma et al., 2004). Although culture at the

permissive temperature allows some of the TS ΔF508 CFTR protein to escape from

ERAD, this maturely glycosylated rΔF508 CFTR is rapidly degraded once the

temperature is raised to the restrictive temperature, 37 °C. The goal of this study was to

follow the cell surface fate of rΔF508 CFTR at the permissive and restrictive

temperatures, 27 °C and 37 °C, and compare the results with the WT CFTR protein.

Since CFTR is normally expressed in epithelial cells, we also examined the fate of both

proteins in polarized epithelia to determine whether any epithelial-specific differences

exist between WT CFTR and rΔF508 CFTR surface trafficking. Additionally, we

performed functional studies to measure transepithelial chloride currents in response to

physiological stimuli, such as cAMP. Finally, on the observation that permissive

temperature treatment stabilizes and functionally corrects rΔF508 CFTR at the cell

surface, we tested whether pharmacological chaperones that permit escape from ERAD

stabilize the rΔF508 CFTR surface pool.

A number of studies have shown that culturing cells at 27 °C is an efficient method of

facilitating ΔF508 CFTR delivery to the cell surface (Denning et al., 1992, Brown et al.,

1996, Sharma et al., 2001, Zhang et al., 2003, Gentzsch et al., 2004, Sharma et al., 2004,

Bebok et al., 2005, Loo et al., 2005, Pedemonte et al., 2005, Swiatecka-Urban et al.,

2005, Loo et al., 2006, Wang et al., 2007b). However, the fate of the low temperature-

cultured rΔF508 CFTR at the cell surface has only been followed at 37 °C(Sharma et

al., 2004, Bebok et al., 2005, Swiatecka-Urban et al., 2005). Here, we show that when

71

the cells are kept at 27 °C, the stability of rΔF508 CFTR is enhanced, and the

differences between WT CFTR and rΔF508 CFTR trafficking and half-life that are seen

at 37 °C disappear. One potential explanation for this observation is that protein

degradation slows down at the permissive temperature, resulting in accumulation of

both the WT CFTR and ΔF508 CFTR. This hypothesis is supported by the finding that

ubiquitination of rΔF508 CFTR is inhibited at 28 °C(Sharma et al., 2004). However,

another possibility is that at 27 °C, ΔF508 CFTR folds properly and remains in a

properly-folded state, resulting not only in exit from the ER, but also in a more stable

surface phenotype at this temperature. When cells are returned to 37 °C, the

conformation of rΔF508 CFTR reverts to a misfolded stage, as proposed

previously(Sharma et al., 2001). In this misfolded conformation, proteins are more

likely to be accessible to ubiquitination and subsequent degradation by cell-surface-

associated mechanisms.

The endocytosis defect of rΔF508 CFTR is eliminated at 27 °C, but our results indicate

that endocytosis still occurs, albeit more slowly. In a number of cell types, temperatures

between 16 °C and 22 °C block degradation of endocytosed proteins by preventing their

transport to lysosomes (Dunn et al., 1980, Parton et al., 1989, Haylett and Thilo, 1991).

ΔF508 CFTR has been shown to accumulate in endocytic-like structures similar to the

WT CFTR protein when the cells were shifted to16oC (Gentzsch et al., 2004), consistent

with the idea that the early part of the endocytic pathway still operates at this

temperature, but delivery to the later stages is blocked. It remains unclear whether

transport to the lysosome, lysosomal processing or the initial steps of ubiquitin-

dependent endocytosis are still functional at 27 °C, but it is clear from our results here

that internalization of rΔF508 CFTR is dramatically slowed down to WT CFTR levels

at 27 °C, which is consistent with the latter possibility. Further support for this idea

comes from proteasomal inhibition studies using lactacystin in BHK cells expressing

rΔF508 CFTR(Gentzsch et al., 2004). In these studies, lactacystin treatment

dramatically stabilized the surface pool of rΔF508 CFTR (Gentzsch et al., 2004),

consistent with the idea that the free ubiquitin pool is limited during proteasomal

inhibition.

72

One important result from our study is that the surface defect of rΔF508 CFTR is due to

an enhanced endocytosis rate compared with WT CFTR. Interestingly, we have also

shown here that this defect is only present in polarized epithelial cells, such as

CFBE41o- cells, and not in HeLa cells. Our results demonstrate that WT CFTR

endocytosis is dependent both on cellular background and on polarization. In non-

polarized HeLa cells, more than 30% of WT CFTR internalizes within 2.5 min. In

CFBE41o-WT and Calu-3 cells grown on plastic dishes (non-polarized cells), CFTR

internalization slows down to ~15%. When the cells are grown on permeable supports

(polarized), CFTR internalization is only 2–5% in 2.5 min.

It is tempting to speculate that WT CFTR internalization rates are so low in polarized

epithelia because the majority of WT CFTR is anchored to the cytoskeleton and does

not participate in the internalization process. This notion is consistent with the results of

Haggie et al.(Haggie et al., 2006), in which single-particle tracking was used to

demonstrate that CFTR is coupled to the actin cytoskeleton via EBP50

(ezrin/radixin/moesin-binding phosphoprotein-50)/ezrin and immobilized at the plasma

membrane.

The difference we observed in WT CFTR internalization rates in polarized epithelia

differs from our results in HeLa cells and from the work of Lukacs and co-workers in

BHK cells (Sharma et al., 2004). One explanation for these discordant results is that in

non-polarized cells, the cell membrane and the cytoskeleton are less organized

compared with polarized cells, resulting in inefficient tethering of WT CFTR and an

increased mobile pool available for endocytosis.

Importantly, we observed that the trafficking of rΔF508 CFTR did not follow the same

kinetics as WT CFTR in polarized epithelial cells, at least at 37 °C. At this temperature,

regardless of cell line or polarization, rΔF508 CFTR endocytosis rates remain

consistently high (~30% in 2.5 min). One possible explanation for this observation is

that, in contrast to our model for WT CFTR, the majority of rΔF508 CFTR is not

tethered properly to the cytoskeleton, resulting in a more mobile surface pool. This

inefficient cytoskeletal tethering could result from the inability of the mutant protein to

interact with one or more of the cytosolic factors responsible for stabilization of the WT

73

CFTR protein. The idea that rΔF508 CFTR is not in a large macromolecular complex is

supported by the observation that rΔF508 CFTR is poorly responsive to cAMP-

mediated stimuli in CFBE41o-DF cells at 37 °C(Bebok et al., 2005), suggesting that

rΔF508 CFTR has lost the association with the previously identified apical signalling

complex(Naren et al., 2003, Gentzsch et al., 2004, Bebok et al., 2005). Alternatively, it

is possible that, after rescue from ERAD at the permissive temperature, rΔF508 CFTR

reverts to a misfolded state when cells are returned to the restrictive temperature. The

resulting conformational alterations in the protein may enhance its ability to interact

with the clathrin-based endocytic machinery and/or cell-surface-associated

ubiquitination machinery. The consequence is that rΔF508 CFTR may be endocytosed

and degraded in the lysosome more actively than the WT CFTR protein at 37 °C.

Because improved surface half-life does not necessarily translate to improved channel

activity, it is essential to note that the biochemical rescue mediated by permissive

temperature culture is accompanied by a functional correction. We showed that after

permissive temperature rescue, continued culture at 27 °C results in rΔF508 CFTR

channels which are functionally similar to WT CFTR channels in their ability to

respond to physiological stimuli such as forskolin. This functional correction also

supports the idea that at the permissive temperature, the rescued protein is associated

with the functional complex (Bebok et al., 2005) that allows activation by cAMP. The

idea that the channel activity is TS is further supported by a recent report on ΔF508

CFTR with two altered RXR motifs that demonstrated that the single channel activity of

rΔF508 CFTR decreased as the temperature was increased from 30 °C to 37 °C

(Hegedus et al., 2006).

Since extended culture at the permissive temperature slowed the endocytosis rates of

rΔF508 CFTR to WT CFTR levels in addition to mediating its escape from ERAD, an

obvious question was whether chemical correctors that facilitate ΔF508 CFTR exit from

the ER would also provide rΔF508 CFTR cell-surface stability at 37 °C. The results

illustrated that two small molecules known to rescue ΔF508 CFTR from ERAD, CFcor-

325 and Corr-4a, also stabilized the mutant protein at the cell surface. Importantly, these

compounds had no effect on endocytosis or the protein half-life of two other cell-

surface molecules, WT CFTR and TR, suggesting that the effects are rΔF508 CFTR-

74

specific. Further support for the idea that the compounds are specific was provided by a

recent report by Clarke and co-workers demonstrating that these compounds interact

directly with CFTR (Wang et al., 2007a).

A significant result of this study is that both compounds corrected the rΔF508 CFTR

internalization defect to WT CFTR rates. Despite this effect, although the surface half-

life of the rescued protein increased with these compounds, the corrected half-life

remained significantly shorter than WT CFTR. This result indicates that correcting the

internalization defect of the rΔF508 CFTR protein may not be sufficient for optimal

stabilization, and supports previous findings that impaired recycling is a critical

component in the compromised surface stability of rΔF508 CFTR (Sharma et al., 2004).

75

7. CONSLUSIONS

1. The data presented here demonstrate that two key residues in the COOH-terminal tail

dramatically regulate the steady-state distribution of CFTR between the cell surface

and intracellular sites. This is the first demonstration of a CFTR mutant whose

activity is actually enhanced relative to wild-type CFTR. We established this

observation using both surface biotinylation and patch clamp measurements. In

examining the mechanism for the elevated surface expression of CFTR, we first

showed that total expression levels of wild-type, Y1424A, and Y1424A,I1427A were

the same. We next demonstrated that maturation efficiency and protein half-life were

unaffected, suggesting that a primary alteration caused by these substitutions

involved changes in distribution between the intracellular and cell surface

compartments. This alteration could result from decreased internalization or

increased recycling or both. Moreover, we showed that Y1424A,I1427A CFTR was

internalized much more slowly than the native protein (76% inhibition at 2.5 min)

with an internalization rate of ~2%/min.

2. To our knowledge, the experiments shown here represent the first complete analysis

of wild type CFTR biogenesis in human epithelial cell lines endogenously expressing

the protein and highlight the following important points. First, in contrast to

heterologous CFTR-expressing cell lines, CFTR maturation is efficient in Calu-3 and

T84 cells. Second, the mature CFTR is very stable and a large portion of it is

intracellular. Third, since CFTR biogenesis is efficient, ERAD plays no role in the

degradation of the wild type protein. And finally, although CFTR message levels are

low in Calu-3 cells compared with transduced cells, the steady-state protein levels

are comparable with heterologous expression systems, suggesting that CFTR

biogenesis and protein stability are not faithfully reproduced in the heterologous

systems. These studies indicate that detailed analysis of endogenous CFTR

expressing cell lines is warranted.

76

3. In polarized epithelial cells, permissive temperature culture of a TS mutant, ΔF508

CFTR, not only rescues it from ERAD, but also stabilizes it at the cell surface and

restores its cAMP responsiveness, suggesting that both the stability and the

functional defects at the cell surface are TS, not just the maturation defect. Two

pharmacological chaperones, CFcor-325 and Corr-4a, mediate an effect similar to

permissive temperature treatment, but the rΔF508 CFTR correction of cell-surface

half-life is only partial. Our results indicate that permissive temperature culture of a

clinically-relevant TS ER processing mutant can facilitate correction of both cell-

surface trafficking and functional defects, and offer hope that the treatments that

enhance the release of misfolded proteins from the ER may also benefit protein

stability and function at the cell surface. Understanding this process in more detail

will provide a broader base of knowledge of how pharmacological chaperones and

different classes of compounds can be used to promote protein function and stability

of this and other TS mutations.

77

8. SUMMARY

Here we show that a second substitution in the carboxyl-terminal tail of CFTR, I1427A,

on Y1424A background more than doubles CFTR surface expression as monitored by

surface biotinylation. Internalization assays indicate that enhanced surface expression of

Y1424A, I1427A CFTR is caused by a 76% inhibition of endocytosis. Patch clamp

recording of chloride channel activity revealed that there was a corresponding increase

in chloride channel activity of Y1424A, I1427A CFTR, consistent with the elevated

surface expression, and no change in CFTR channel properties. Y14124A showed an

intermediate phenotype compared with the double mutation, both in terms of surface

expression and chloride channel activity. Metabolic pulse-chase experiments

demonstrated that the two mutations did not affect maturation efficiency or protein half-

life. Taken together, our data show that there is an internalization signal in the COOH

terminus of CFTR that consists of Tyr (1424)-X-X-Ile(1427) where both the tyrosine

and the isoleucine are essential residues. This signal regulates CFTR surface expression

but not CFTR biogenesis, degradation, or chloride channel function.

One unusual feature of this protein is that during biogenesis, approximately 75% of wild

type CFTR is degraded by the endoplasmic reticulum (ER)-associated degradative

(ERAD) pathway. Examining the biogenesis and structural instability of the molecule

has been technically challenging due to the limited amount of CFTR expressed in

epithelia. Consequently, investigators have employed heterologous overexpression

systems. Based on recent results that epithelial specific factors regulate both CFTR

biogenesis and function, we hypothesized that CFTR biogenesis in endogenous CFTR

expressing epithelial cells may be more efficient. To test this, we compared CFTR

biogenesis in two epithelial cell lines endogenously expressing CFTR (Calu-3 and T84)

with two heterologous expression systems (COS-7 and HeLa). Consistent with previous

reports, 20 and 35% of the newly synthesized CFTR were converted to maturely

glycosylated CFTR in COS-7 and HeLa cells, respectively. In contrast, CFTR

maturation was virtually 100% efficient in Calu-3 and T84 cells. Furthermore,

inhibition of the proteasome had no effect on CFTR biogenesis in Calu-3 cells, whereas

it stabilized the immature form of CFTR in HeLa cells. Quantitative reverse

transcriptase-PCR indicated that CFTR message levels are approximately 4-fold lower

78

in Calu-3 than HeLa cells, yet steady-state protein levels are comparable. Our results

question the structural instability model of wild type CFTR and indicate that epithelial

cells endogenously expressing CFTR efficiently process this protein to post-Golgi

compartments.

Misfolded proteins destined for the cell surface are recognized and degraded by the

ERAD [ER (endoplasmic reticulum) associated degradation] pathway. TS (temperature-

sensitive) mutants at the permissive temperature escape ERAD and reach the cell

surface. In this present paper, we examined a TS mutant of the CFTR [CF (cystic

fibrosis) transmembrane conductance regulator], CFTR ΔF508, and analysed its cell-

surface trafficking after rescue [rΔF508 (rescued ΔF508) CFTR]. We show that rΔF508

CFTR endocytosis is 6-fold more rapid (~30% per 2.5 min) than WT (wild-type, ~5%

per 2.5 min) CFTR at 37 °C in polarized airway epithelial cells (CFBE41o-). We also

investigated rΔF508 CFTR endocytosis under two further conditions: in culture at the

permissive temperature (27 °C) and following treatment with pharmacological

chaperones. At low temperature, rΔF508 CFTR endocytosis slowed to WT rates (20%

per 10 min), indicating that the cell-surface trafficking defect of rΔF508 CFTR is TS.

Furthermore, rΔF508 CFTR is stabilized at the lower temperature; its half-life increases

from <2 h at 37 °C to >8 h at 27 °C. Pharmacological chaperone treatment at 37 °C

corrected the rΔF508 CFTR internalization defect, slowing endocytosis from ~30% per

2.5 min to ~5% per 2.5 min, and doubled ΔF508 surface half-life from 2 to 4 h. These

effects are ΔF508 CFTR-specific, as pharmacological chaperones did not affect WT

CFTR or transferrin receptor internalization rates. The results indicate that small

molecular correctors may reproduce the effect of incubation at the permissive

temperature, not only by rescuing ΔF508 CFTR from ERAD, but also by enhancing its

cell-surface stability

79

Összefoglalás

Ezen munkában bemutatjuk, hogy egy második aminosav helyettesítés a CFTR carboxy-

végén, nevezetesen I1427A az Y1424A mellett több, mint kétszeresere növeli a CFTR

sejtfelszíni megjelenését amint az biotinilációval igazolható. Internalizációs viszgálatok

azt igazolják, hogy a Y1424A,I1427A megnövekedett sejtfelszíni megjelenése

hátterében az endocytosis 76%-os gátlása áll. A klórcsatorna aktivitás Patch clamp

vizsgálatai igazolták, hogy ennek megfelelően a Y1424A,I1427A CFTR klórcsatorna

aktivitás növekedett, hasonlóan a sejtfelszíni megjelenéshez, de e mellett a CFTR

csatorna tulajdonságok nem változtak. A Y1424A egy közbenső fenotípusnak megfelelő

tulajdonságokat mutat a dupla mutációval való összehasonlitásban, mind a setfelszíni

megjelenés, mind a klórcsatorna aktivitás tekintetében. Metabolikus pulse-chase

kísérletek tanusága szerint ezen két mutációnak semmilyen hatása nem volt sem a

fehérje érésére, sem annak fél-életidejére. Mindezt összevetve elmondhatjuk, hogy

adataink tanulsága szerint a CFTR COOH-vége egy Tyr(1424)-X-X-Ile(1427)

internalizációs szignált tartalmaz, amelyben mind a tyrozin, mind az izoleucin

esszenciális összetevők. Ez a szignál a CFTR sejtfelszíni megjelenését szabályozza,

viszont annak biogenezisére, dagradációjára és klórcsatorna funkciójára nincs hatással.

Ezen fehérje egyik szokatlan tulajdonsága, hogy a biogenezis során a wild type CFTR

mintegy 75%-a degradálódik az ERAD-ban. A molekula biogenezisének és strukturális

instabilitásának vizsgálata komoly technikai kihívást jelent, mivel az epitheliális sejtek

CFTR termelése alacsony. Ebből következően a kutatók heterológ túltermelő

rendszereket alkalmaznak. Azon új eredmények alapján melyek azt mutatják, hogy

epithelia specifikus faktorok szabályozzák mind a CFTR biogenezist, mind a funkciót,

feltételeztük, hogy a CFTR biogenezis az azt endogénen termelő epitheliális sejtekben

valószínűleg sokkal hatékonyabb. Ennek igazolására összehasonlítottuk a CFTR

biogenezist két epitheliális sejtvonalban, melyek endogénen termelik a CFTR-t (Calu-3

és T84), valamint két heterológ rendszerben (COS-7 és HeLa). A korábban közölt

adatoknak megfelelően a COS-7 és a HeLa sejtekben az újonnan termelt CFTR 20 és 35

%-a alakult át érett CFTR-é. Ezzel ellentétben a CFTR érése virtuálisan 100% volt a

Calu-3 és a T84 sejtvonalakban. Mindezen felül a proteasome gátlása a Calu-3 sejtekben

nem volt hatással a biogenezisre, viszont a HeLa sejtekben stabilizálta az éretlen CFTR

80

formát. Kvantitatív rt-PCR vizsgálatokban a CFTR message szint a Calu-3 sejtekben

négyszer alacsonyabb, mint a HeLa sejtekben, noha a steady-state fehérjeszintek

hasonlóak. Eredményeink kérdésessé teszik a wild type CFTR strukturális instabilitás

modeljét és azt igazolják, hogy a CFTR-t endogénen termelő epitheliális sejtek

hatékonyan továbbítják azt a post-Golgi kompartmentekbe.

A sejtfelszínre szánt, de nem megfelelően átalakított (missfolded) fehérjéket az ERAD

(endoplazmikus retikulumhoz társult degradáció) út felismeri és degradálja. Permisszív

hőmérsékleten a hőérzékeny mutánsok képesek kiszabadulni az ERAD-ból és elérni a

sejtfelszínt. Ezen munkában egy hőérzékeny CFTR mutáns, a ΔF508 esetében vizsgáltuk

annak sejtfelszíni forgalmát a kiszabadítást követően. Igazoljuk, hogy a kiszabadított,

ugynevezett rΔF508 CFTR endocitózis hatszor gyorsabb (mintegy 30% 2,5 perc alatt),

mint a wild type (mintegy 5% 2,5 perc alatt) 37oC-on polarizált légúti epitheliális

sejtekben (CFBE41o- ). Vizsgáltuk az rΔF508 CFTR endocitózist két másik esetben is:

permisszív hőmérsékleten (27oC) valamint pharmakológiai chaperonokkal való kezelést

követően. Alacsony hőmérsékleten a rΔF508 CFTR endocitózis a wild type szintjére

csökkent (20% 10 perc alatt), amely azt mutatja, hogy a sejtfelszíni forgalom hibája a

rΔF508 CFTR esetében hőérzékeny. Mindezen felül a rΔF508 CFTR alacsonyabb

hőmérsékleten stabil : a fél-életidő a 37oC-on mért ≤2 óráról 27

oC-on ≥8 órára

emelkedik. Pharmakológiai chaperonokkal való kezelés 37oC-on korrigálja a rΔF508

CFTR internalizációs hibáját: az endocitózis mintegy 30%-ról kb. 5%-ra csökken 2,5

perc alatt, illetve a felszíni fél-életidő 2-ről 4 órára emelkedik. Ezen hatások ΔF508

CFTR specifikusak, mivel a pharmakológiai chaperonok nem voltak hatással a wild type

CFTR illetve a transferrin receptor internalizációs tulajdonságaira. Eredményeink azt

igazolják, hogy kis molekulatömegű korrektorokkal reprodukálni tudjuk a permisszív

hőmérsékleten való inkubáció hatását, nem csak azzal, hogy a ΔF508 CFTR

kiszabadítható az ERAD-ból, hanem azzal is, hogy annak sejtfelszini stabilitása szintén

nő.

81

9. MY PUBLICATIONS ASSOCIATED WITH THE THESIS

1 Bebok Z, Varga K, Hicks JK, Venglarik CJ, Kovacs T, Chen L, Hardiman KM,

Collawn JF, Sorscher EJ, Matalon S. Reactive oxygen nitrogen species decrease

cystic fibrosis transmembrane conductance regulator expression and cAMP-mediated

Cl- secretion in airway epithelia. J Biol Chem. 2002 Nov 8;277(45):43041-9. Epub

2002 Aug 22.PMID: 12194970

2 Peter K, Varga K, Bebok Z, McNicholas-Bevensee CM, Schwiebert L, Sorscher EJ,

Schwiebert EM, Collawn JF. Ablation of internalization signals in the carboxyl-

terminal tail of the cystic fibrosis transmembrane conductance regulator enhances cell

surface expression. J Biol Chem. 2002 Dec 20;277(51):49952-7. Epub 2002 Oct 9.

3 Varga K, Jurkuvenaite A, Wakefield J, Hong JS, Guimbellot JS, Venglarik CJ, Niraj

A, Mazur M, Sorscher EJ, Collawn JF, Bebök Z. Efficient intracellular processing of

the endogenous cystic fibrosis transmembrane conductance regulator in epithelial cell

lines. J Biol Chem. 2004 May 21;279(21):22578-84. Epub 2004 Apr 1.

4 Bebok Z, Collawn JF, Wakefield J, Parker W, Li Y, Varga K, Sorscher EJ, Clancy

JP. Failure of cAMP agonists to activate rescued deltaF508 CFTR in CFBE41o-

airway epithelial monolayers. J Physiol. 2005 Dec 1;569(Pt 2):601-15. Epub 2005 Oct

6.

5 Jurkuvenaite A, Varga K, Nowotarski K, Kirk KL, Sorscher EJ, Li Y, Clancy JP,

Bebok Z, Collawn JF. Mutations in the amino terminus of the cystic fibrosis

transmembrane conductance regulator enhance endocytosis. J Biol Chem. 2006 Feb

10;281(6):3329-34. Epub 2005 Dec 8.

6 Varga K, Goldstein RF, Jurkuvenaite A, Chen L, Matalon S, Sorscher EJ, Bebok Z,

Collawn JF. Enhanced cell-surface stability of rescued DeltaF508 cystic fibrosis

transmembrane conductance regulator (CFTR) by pharmacological chaperones.

Biochem J. 2008 Mar 15;410(3):555-64.

7 Tucker TA, Varga K, Bebok Z, Zsembery A, McCarty NA, Collawn JF, Schwiebert

EM, Schwiebert LM. Transient transfection of polarized epithelial monolayers with

CFTR and reporter genes using efficacious lipids. Am J Physiol Cell Physiol. 2003

Mar;284(3):C791-804. Epub 2002 Nov 6.

82

8 Estell K, Braunstein G, Tucker T, Varga K, Collawn JF, Schwiebert LM. Plasma

membrane CFTR regulates RANTES expression via its C-terminal PDZ-interacting

motif. Mol Cell Biol. 2003 Jan;23(2):594-606.

9 Rowe SM, Varga K, Rab A, Bebok Z, Byram K, Li Y, Sorscher EJ, Clancy JP.

Restoration of W1282X CFTR activity by enhanced expression. Am J Respir Cell

Mol Biol. 2007 Sep;37(3):347-56. Epub 2007 May 31.

10 Chen L, Bosworth CA, Pico T, Collawn JF, Varga K, Gao Z, Clancy JP, Fortenberry

JA, Lancaster JR Jr, Matalon S. DETANO and nitrated lipids increase chloride

secretion across lung airway cells. Am J Respir Cell Mol Biol. 2008 Aug;39(2):150-

62. Epub 2008 Feb 28.

Abstracts

1. Bebok Z, C Venglarik, K Varga, T Kovacs, K Shestra, J Collawn, E Sorscher, S

Matalon. Functional consequences of decreased CFTR levels caused by nitric oxide

in epithelial cell monolayers. Pediatric Pulmonology Supplement 22: 272 (Abst. 289),

2001.

2. Tucker TA, K Varga, Z Bebok, GM Braunstein, JF Collawn, EM Schwiebert.

G551D-CFTR and ΔF508-CFTR inhibit wild-type CFTR maturation and/or function

in human airway epithelial cells in a dominant negative-like manner. Pediatric

Pulmonology Supplement 24: 185 (Abst. 13), 2002.

3. Bebok Z, K Varga, JF Collawn, J Hong, EM Schwiebert, CJ Venglarik, EJ Sorscher.

Processing of endogenous wild-type CFTR is efficient in Calu-3 cells. Pediatric

Pulmonology Supplement 24: 185 (Abst. 14), 2002.

4. Varga K, Z Bebok, EJ Sorscher, EM Schwiebert, T Tucker, LM Schwiebert, JF

Collawn. Wild-type CFTR surface expression and endocytosis display different

kinetics in human airway epithelial cells when compared to heterologous expression

systems. Pediatric Pulmonology Supplement 24: 195 (Abst. 45), 2002.

5. Jurkuvenaite A, Varga K, Niraj A, Horvath G, Sorscher EJ, Schwiebert E, Schwiebert

L, JF Collawn, Z Bebok Biogenesis of CFTR in CALU 3 Cells: Intracellular

processing of the wild type protein Pediatric Pulmonology Supplement 25; 193-194

(Abst. 25.) 2003

83

6. Clancy JP, Fan L, Bebok Z, Cobb B, Hardy K, Hong J, Varga K, Schorscher E.

AdCFTR Expression in CFBE 41o cells: a high resistance human airway monolayer

model Pediatric Pulmonology Supplement 25; 229 (Abst. 130) 2003

7. Varga K, Jurkuvenaite A, Niraj A, Schorscher E, Bebok Z, Collawn J. CFTR

endocytosis in polarized Calu 3 cells is remarkably slow. Pediatric Pulmonology

Supplement 25; 232 (Abst. 139) 2003

8. Jurkuvenaite A, Rab A, Varga K, Niraj A, Sorscher EJ, Collawn JF, Bebok Z.

Efficient wild type CFTR biogenesis in epithelial cells: Inhibition of the proteasome

has no effect on core-glycosylated CFTR stability. Pediatric Pulmonology Supplement

27; 190 (Abst. 6) 2004

9. BebokZ, Collawn JF, Fan L, Varga K, Li Y, Sorscher EJ, Wakefield J, Clancy JP.

Failure to activate rescued ∆F508 CFTR at the cell surface of airway epithelial Cells

using conventional receptor pathways. Pediatric Pulmonology Supplement 27; 191

(Abst. 7) 2004

10. Varga K, Jurkuvenaite A, Li Y, Clancy JP, Sorscer EJ, bebok Z, Collawn JF. Surface

stability of the rescued ∆F508 CFTR is compromised by inefficient recycling.

Pediatric Pulmonology Supplement 27; 193 (Abst. 13) 2004

11. Varga K, Jurkuvenaite A, Schwiebert EM, Sorscher EJ, Bebok Z, Collawn JF.

Lantrunculin treatment increases CFTR endocytosis in Calu-3 monolayers. Pediatric

Pulmonology Supplement 27; 193 (Abst. 14) 2004

12. Bebok Z, Wakefield J, Collawn J, Fan L, Varga K, Fortenberry J, Hong J, Sorscher E,

Clancy JP. Comparison of FRT and CFBE41o- epithelia to study CFTR processing

and function. Pediatric Pulmonology Supplement 27; 231 (Abst. 126) 2004

13. Varga K, Jurkuvenaite A, Goldstein R, Sorscher E, Bebok Z, Collawn J. Differences

in the trafficking of WT and rescued ∆F508 CFTR in human airway epithelia.

Pediatric Pulmonology Supplement 28; 196 (Abst. 18) 2005

14. Jurkuvenaite A, Varga K, Nowotarsky K, Kirk K, Li Y, Clancy J, Sorscher E, Bebok

Z, Collawn J. Two naturally-occurring mutations enhance CFTR endocytosis.

Pediatric Pulmonology Supplement 28; 196 (abst. 20) 2005

15. Matalon S, Chen L, Varga K, Bebok Z, Patel R, Collawn J. Modulation of Chloride

Secretion across Airway and Alveolar Epithelial Cells by Nitric Oxide and Its

Cngeners. Proceedings of the American Thoracic Society, Vol 2: A299, 2005

84

16. Varga K, Jurkuvenaite A, Rideg O, Rowe SM, Clancy JP, Sorscher EJ, Bebok Z,

Collawn J. ∆F508 CFTR Surface stability in human airway epithelial cells. Pediatric

Pulmonology Supplement 29; 214 (Abst. 17) 2006

17. Rideg O, Rab A, Jurkuvenaite A, Varga K, Li Y, Clancy JP, Sorscher EJ, Collawn JF,

Bebok Z. Cellular mechanisms associated with ∆F508 CFTR rescue. Pediatric

Pulmonology Supplement 29; 213 (Abst. 14) 2006

18. Rowe SM, Bebok Z, Bartoszewski R, Varga K, Collawn J, Sorscher EJ, Clancy JP.

∆F508 CFTR activity in polarized epithelial cells – distinct differences in cyclic AMP

dependent Cl- transport. Pediatric Pulmonology Supplement 30; 285 (Abst. 238) 2007

19. Varga K, Jurkuvenaite A, Goldstein R, Bartoszewski R, Sorscher EJ, Bebok Z,

Collawn J. Small molecular correctors increase the surface stability of rescued ∆F508

CFTR. Pediatric Pulmonology Supplement 30; 288 (Abst. 245) 2007

20. Rowe SM, Bebok Z, Varga K, Collawn J, Sorscher EJ, Clancy JP. Comparison of

maneuvers to correct ∆F508 CFTR: chemical agents and low temperature produce

surface targeted protein with similar activation profiles. Pediatric Pulmonology

Supplement 30; 299 (Abst. 277) 2007

21. Rowe SM, Varga K, Bebok Z, Li Y, Fan L, Nowartowski K, Prasin J, Barnes S,

Clancy JP, Sorscher EJ. Processing correction and direct activation of ∆F508 CFTR

by the Flavonoid Equol in vitro. Pediatric Pulmonology Supplement 30; 299 (Abst.

276) 2007

22. Pyle LC, Ehrhardt A, Wang W, Varga K, Nowotarski KJ, Rowe SM, Sorscher EJ.

Mechanisms underlying potentiator activation of CFTR. Pediatric Pulmonology

Supplement 30; 305 (Abst. 292) 2007

85

10. MY PUBLICATIONS NOT ASSOCIATED WITH THE THESIS

1. Lyuksyutova OI, Varga K, Van Buren CT, Pivalizza EG. Thrombelastography in a

patient with prolonged partial thromboplastin time undergoing a kidney transplant.

Anesth Analg. 2009 Apr;108(4):1355-6.

86

11. ACKNOWLEDGEMENT

First of all my sincere thanks go to Dr. Laszlo Rosivall, the Head of PhD School of

Medical Sciences for his extraordinary help finalizing my work and for his generosity to

accept it in his program.

This work was accomplished at the Department of Cell Biology and at the Gregory

Fleming James Cystic Fibrosis Research Center at the University of Alabama at

Birmingham, Birmingham, AL, U.S.A.

The work on the internalization signal studies was supported in part by a fellowship

from the Research Development Program of the Cystic Fibrosis Foundation (CFF) (to

K. Peter and K. Varga), Grants COLLAWOOGO from the CFF and DK 60065 from the

National Institutes of Health (to J. F. Collawn), Grant DK 54367 from the National

Institutes of Health (to E. M. Schwiebert.), and a grant from the Research Development

Program of the CFF and the National Institutes of Health (to E. J. Sorscher.).

The work on the biogenesis studies was supported in part by a fellowship from the

Research Development Program of the Cystic Fibrosis Foundation (CFF) (to K. Varga),

an American Lung Association grant (to Z. Bebok), National Institutes of Health Grant

DK60065 (to J. F. Collawn), and a grant from the Research Development Program of

the CFF and the National Institutes of Health (to E. J. Sorscher).

The work on the CF corrector studies was supported by NIH (National Institutes of

Health) grants DK60065 (to J. F. Collawn), HL076587 (to Z. Bebok), HL075540 (to S.

Matalon), P30 DK072402 (to E. J. Sorscher) and by a Cystic Fibrosis Foundation grant

CFF R464-CR07 (to E. J. Sorscher).

I thank Dr Robert Bridges (Department of Physiology and Biophysics, Rosalind

Franklin University of Medicine and Science, North Chicago, IL, U.S.A.), Dr Melissa

Ashlock (Cystic Fibrosis Foundation Therapeutics, Bethesda, MD, U.S.A.) and Cystic

Fibrosis Foundation Therapeutics for providing the pharmaceutical correctors.

All of the members of the Collawn, Bebok, Sorscher and Matalon labs have been

invaluable in their contribution to this work. Particularly my sincere thanks go to James

87

F. Collawn and Zsuzsa Bebok, two extraordinary scientists, whom were not only my

teachers, supervisors and supporters, but also true friends.

88

12. REFERENCES

Ameen NA, van Donselaar E, Posthuma G, de Jonge H, McLaughlin G, Geuze HJ,

Marino C, Peters PJ (Subcellular distribution of CFTR in rat intestine supports a

physiologic role for CFTR regulation by vesicle traffic. Histochem Cell Biol

114:219-228.2000).

Aridor M, Hannan LA (Traffic Jam: A Compendium of Human Diseases that Affect

Intracellular Transport Processes. Traffic 1:836-851.2000).

Aridor M, Hannan LA (Traffic Jams II: An Update of Diseases of Intracellular Transport.

Traffic 3:781-790.2002).

Bebok Z, Collawn JF, Wakefield J, Parker W, Li Y, Varga K, Sorscher EJ, Clancy JP

(Failure of cAMP agonists to activate rescued ΔF508 CFTR in CFBE41o– airway

epithelial monolayers. The Journal of Physiology 569:601-615.2005).

Bebok Z, Tousson A, Schwiebert LM, Venglarik CJ (Improved oxygenation promotes

CFTR maturation and trafficking in MDCK monolayers. Am J Physiol Cell

Physiol 280:C135-145.2001).

Bebok Z, Varga K, Hicks JK, Venglarik CJ, Kovacs T, Chen L, Hardiman KM, Collawn

JF, Sorscher EJ, Matalon S (Reactive Oxygen Nitrogen Species Decrease Cystic

Fibrosis Transmembrane Conductance Regulator Expression and cAMP-mediated

Cl− Secretion in Airway Epithelia. Journal of Biological Chemistry 277:43041-

43049.2002).

Bebok Z, Venglarik CJ, Panczel Z, Jilling T, Kirk KL, Sorscher EJ (Activation of Delta

F508 CFTR in an epithelial monolayer. Am J Physiol Cell Physiol 275:C599-

607.1998).

Bertrand CA, Frizzell RA (The role of regulated CFTR trafficking in epithelial secretion.

Am J Physiol Cell Physiol 285:C1-18.2003).

Bradbury NA (Intracellular CFTR: Localization and Function. Physiol Rev 79:175-

191.1999).

Bradbury NA, Clark JA, Watkins SC, Widnell CC, Smith HS, Bridges RJ

(Characterization of the internalization pathways for the cystic fibrosis

transmembrane conductance regulator. Am J Physiol-Lung Cell Mol Physiol

276:L659-L668.1999).

89

Bradbury NA, Cohn JA, Venglarik CJ, Bridges RJ (Biochemical and biophysical

identification of cystic fibrosis transmembrane conductance regulator chloride

channels as components of endocytic clathrin-coated vesicles. Journal of

Biological Chemistry 269:8296-8302.1994).

Bradbury NA, Jilling T, Berta G, Sorscher EJ, Bridges RJ, Kirk KL (Regulation of

plasma membrane recycling by CFTR. Science 256:530-532.1992).

Brown CR, Hong-Brown LQ, Biwersi J, Verkman AS, Welch WJ (Chemical chaperones

correct the mutant phenotype of the delta F508 cystic fibrosis transmembrane

conductance regulator protein. Cell Stress Chaperones 1:117-125.1996).

Brown D, Katsura T, Kawashima M, Verkman AS, Sabolic I (Cellular distribution of the

aquaporins: a family of water channel proteins. Histochem Cell Biol 104:1-

9.1995).

Chen L, Patel RP, Teng X, Bosworth CA, Lancaster JR, Matalon S (Mechanisms of

Cystic Fibrosis Transmembrane Conductance Regulator Activation by S-

Nitrosoglutathione. Journal of Biological Chemistry 281:9190-9199.2006).

Cheng J, Moyer BD, Milewski M, Loffing J, Ikeda M, Mickle JE, Cutting GR, Li M,

Stanton BA, Guggino WB (A Golgi-associated PDZ Domain Protein Modulates

Cystic Fibrosis Transmembrane Regulator Plasma Membrane Expression. Journal

of Biological Chemistry 277:3520-3529.2002).

Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith

AE (Defective intracellular transport and processing of CFTR is the molecular

basis of most cystic fibrosis. Cell 63:827-834.1990a).

Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith

AE (Defective intracellular transport and processing of CFTR is the molecular

basis of most cystic fibrosis. Cell 63:827-834.1990b).

Cohn JA, Nairn AC, Marino CR, Melhus O, Kole J (Characterization of the cystic

fibrosis transmembrane conductance regulator in a colonocyte cell line.

Proceedings of the National Academy of Sciences of the United States of America

89:2340-2344.1992).

Cohn JA, Strong TV, Picciotto MR, Nairn AC, Collins FS, Fitz JG (Localization of the

cystic fibrosis transmembrane conductance regulator in human bile duct epithelial

cells. Gastroenterology 105:1857-1864.1993).

90

Collawn JF, Stangel M, Kuhn LA, Esekogwu V, Jing S, Trowbridge IS, Tainer JA

(Transferrin receptor internalization sequence YXRF implicates a tight turn as the

structural recognition motif for endocytosis. Cell 63:1061-1072.1990).

Collins FS (Cystic fibrosis: molecular biology and therapeutic implications. Science

256:774-779.1992).

Coyne CB, Vanhook MK, Gambling TM, Carson JL, Boucher RC, Johnson LG

(Regulation of Airway Tight Junctions by Proinflammatory Cytokines. Mol Biol

Cell 13:3218-3234.2002).

Dalemans W, Barbry P, Champigny G, Jallat S, Dott K, Dreyer D, Crystal RG, Pavirani

A, Lecocq JP, Lazdunski M (Altered chloride ion channel kinetics associated with

the delta F508 cystic fibrosis mutation. Nature 354:526-528.1991).

Denning GM, Anderson MP, Amara JF, Marshall J, Smith AE, Welsh MJ (Processing of

mutant cystic fibrosis transmembrane conductance regulator is temperature-

sensitive. Nature 358:761-764.1992).

Dick LR, Cruikshank AA, Grenier L, Melandri FD, Nunes SL, Stein RL (Mechanistic

Studies on the Inactivation of the Proteasome by Lactacystin. Journal of

Biological Chemistry 271:7273-7276.1996).

Du K, Sharma M, Lukacs GL (The [Delta]F508 cystic fibrosis mutation impairs domain-

domain interactions and arrests post-translational folding of CFTR. Nat Struct

Mol Biol 12:17-25.2005).

Dunn WA, Hubbard AL, Aronson NN (Low temperature selectively inhibits fusion

between pinocytic vesicles and lysosomes during heterophagy of 125I-asialofetuin

by the perfused rat liver. Journal of Biological Chemistry 255:5971-5978.1980).

Gelman MS, Kannegaard ES, Kopito RR (A Principal Role for the Proteasome in

Endoplasmic Reticulum-associated Degradation of Misfolded Intracellular Cystic

Fibrosis Transmembrane Conductance Regulator. Journal of Biological Chemistry

277:11709-11714.2002).

Gentzsch M, Chang X-B, Cui L, Wu Y, Ozols VV, Choudhury A, Pagano RE, Riordan

JR (Endocytic Trafficking Routes of Wild Type and {Delta}F508 Cystic Fibrosis

Transmembrane Conductance Regulator. Mol Biol Cell 15:2684-2696.2004).

Goldberg AL (Protein degradation and protection against misfolded or damaged proteins.

Nature 426:895-899.2003).

91

Green S, Setiadi H, McEver R, Kelly R (The cytoplasmic domain of P-selectin contains a

sorting determinant that mediates rapid degradation in lysosomes. J Cell Biol

124:435-448.1994).

Haggie PM, Kim JK, Lukacs GL, Verkman AS (Tracking of Quantum Dot-labeled CFTR

Shows Near Immobilization by C-Terminal PDZ Interactions. Mol Biol Cell

17:4937-4945.2006).

Hampton RY (ER-associated degradation in protein quality control and cellular

regulation. Current Opinion in Cell Biology 14:476-482.2002).

Haslett JN, Sanoudou D, Kho AT, Bennett RR, Greenberg SA, Kohane IS, Beggs AH,

Kunkel LM (Gene expression comparison of biopsies from Duchenne muscular

dystrophy (DMD) and normal skeletal muscle. Proceedings of the National

Academy of Sciences of the United States of America 99:15000-15005.2002).

Haylett T, Thilo L (Endosome-lysosome fusion at low temperature. Journal of Biological

Chemistry 266:8322-8327.1991).

Heda GD, Tanwani M, Marino CR (The Delta F508 mutation shortens the biochemical

half-life of plasma membrane CFTR in polarized epithelial cells. Am J Physiol

Cell Physiol 280:C166-174.2001).

Hegedus T, Aleksandrov A, Cui L, Gentzsch M, Chang X-B, Riordan JR (F508del CFTR

with two altered RXR motifs escapes from ER quality control but its channel

activity is thermally sensitive. Biochimica et Biophysica Acta (BBA) -

Biomembranes 1758:565-572.2006).

Holman GD, Lo Leggio L, Cushman SW (Insulin-stimulated GLUT4 glucose transporter

recycling. A problem in membrane protein subcellular trafficking through

multiple pools. Journal of Biological Chemistry 269:17516-17524.1994).

Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR (Multiple

proteolytic systems, including the proteasome, contribute to CFTR processing.

Cell 83:129-135.1995a).

Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR (Multiple

proteolytic systems, including the proteasome, contribute to CFTR processing.

Cell 83:129-135.1995b).

Jhun BH, Rampal AL, Liu H, Lachaal M, Jung CY (Effects of insulin on steady state

kinetics of GLUT4 subcellular distribution in rat adipocytes. Evidence of

92

constitutive GLUT4 recycling. Journal of Biological Chemistry 267:17710-

17715.1992).

Johnston JA, Ward CL, Kopito RR (Aggresomes: A Cellular Response to Misfolded

Proteins. J Cell Biol 143:1883-1898.1998).

Jurkuvenaite A, Varga K, Nowotarski K, Kirk KL, Sorscher EJ, Li Y, Clancy JP, Bebok

Z, Collawn JF (Mutations in the Amino Terminus of the Cystic Fibrosis

Transmembrane Conductance Regulator Enhance Endocytosis. Journal of

Biological Chemistry 281:3329-3334.2006).

Kalin N, Claass A, Sommer M, Puchelle E, Tummler B (Delta F508 CFTR protein

expression in tissues from patients with cystic fibrosis. J Clin Invest 103:1379-

1389.1999).

Kappes JC, Wu X, Wakefield JK (Production of trans-lentiviral vector with predictable

safety. Methods Mol Med 76:449-465.2003).

Katsura T, Verbavatz JM, Farinas J, Ma T, Ausiello DA, Verkman AS, Brown D

(Constitutive and regulated membrane expression of aquaporin 1 and aquaporin 2

water channels in stably transfected LLC-PK1 epithelial cells. Proceedings of the

National Academy of Sciences of the United States of America 92:7212-

7216.1995).

Kim PS, Arvan P (Endocrinopathies in the Family of Endoplasmic Reticulum (ER)

Storage Diseases: Disorders of Protein Trafficking and the Role of ER Molecular

Chaperones. Endocr Rev 19:173-202.1998).

Kreda SM, Mall M, Mengos A, Rochelle L, Yankaskas J, Riordan JR, Boucher RC

(Characterization of wild-type and deltaF508 cystic fibrosis transmembrane

regulator in human respiratory epithelia. Mol Biol Cell 16:2154-2167.2005).

Krumins AM, Barker SA, Huang C, Sunahara RK, Yu K, Wilkie TM, Gold SJ, Mumby

SM (Differentially Regulated Expression of Endogenous RGS4 and RGS7.

Journal of Biological Chemistry 279:2593-2599.2004).

Kunkel TA (Rapid and efficient site-specific mutagenesis without phenotypic selection.

Proceedings of the National Academy of Sciences of the United States of America

82:488-492.1985).

93

Li G, Alexander EA, Schwartz JH (Syntaxin Isoform Specificity in the Regulation of

Renal H+-ATPase Exocytosis. Journal of Biological Chemistry 278:19791-

19797.2003).

Li J, Quilty J, Popov M, Reithmeier RA (Processing of N-linked oligosaccharide depends

on its location in the anion exchanger, AE1, membrane glycoprotein. Biochem J

349:51-57.2000).

Li J, Wang C-c (“Half of the Sites” Binding ofd-Glyceraldehyde-3-phosphate

Dehydrogenase Folding Intermediate with GroEL. Journal of Biological

Chemistry 274:10790-10794.1999).

Liu TI, Lebaric ZN, Rosenthal JJC, Gilly WF (Natural Substitutions at Highly Conserved

T1-Domain Residues Perturb Processing and Functional Expression of Squid Kv1

Channels. J Neurophysiol 85:61-71.2001).

Loffing J, Moyer BD, McCoy D, Stanton BA (Exocytosis is not involved in activation of

Cl- secretion via CFTR in Calu-3 airway epithelial cells. Am J Physiol Cell

Physiol 275:C913-920.1998).

Loffing J, Moyer BD, Reynolds D, Stanton BA (PBA increases CFTR expression but at

high doses inhibits Cl- secretion in Calu-3 airway epithelial cells. Am J Physiol

Lung Cell Mol Physiol 277:L700-708.1999).

Loo T, Bartlett M, Clarke D (Rescue of Folding Defects in ABC Transporters Using

Pharmacological Chaperones. Journal of Bioenergetics and Biomembranes

37:501-507.2005).

Loo TW, Bartlett MC, Wang Y, Clarke DM (The chemical chaperone CFcor-325 repairs

folding defects in the transmembrane domains of CFTR-processing mutants.

Biochem J 395:537-542.2006).

Lukacs GL, Mohamed A, Kartner N, Chang XB, Riordan JR, Grinstein S

(CONFORMATIONAL MATURATION OF CFTR BUT NOT ITS MUTANT

COUNTERPART (DELTA-F508) OCCURS IN THE ENDOPLASMIC-

RETICULUM AND REQUIRES ATP. Embo J 13:6076-6086.1994).

Lukacs GL, Segal G, Kartner N, Grinstein S, Zhang F (Constitutive internalization of

cystic fibrosis transmembrane conductance regulator occurs via clathrin-

dependent endocytosis and is regulated by protein phosphorylation. Biochem J

328:353-361.1997).

94

Madrid R, Le Maout S, Barrault MB, Janvier K, Benichou S, Merot J (Polarized

trafficking and surface expression of the AQP4 water channel are coordinated by

serial and regulated interactions with different clathrin-adaptor complexes. Embo

J 20:7008-7021.2001).

Morris AP, Cunningham SA, Tousson A, Benos DJ, Frizzell RA (Polarization-dependent

apical membrane CFTR targeting underlies cAMP-stimulated Cl- secretion in

epithelial cells. Am J Physiol Cell Physiol 266:C254-268.1994).

Moyer BD, Loffing J, Schwiebert EM, Loffing-Cueni D, Halpin PA, Karlson KH,

Ismailov II, Guggino WB, Langford GM, Stanton BA (Membrane Trafficking of

the Cystic Fibrosis Gene Product, Cystic Fibrosis Transmembrane Conductance

Regulator, Tagged with Green Fluorescent Protein in Madin-Darby Canine

Kidney Cells. Journal of Biological Chemistry 273:21759-21768.1998).

Mukherjee S, Ghosh RN, Maxfield FR (Endocytosis. Physiol Rev 77:759-803.1997).

Naren AP, Cobb B, Li C, Roy K, Nelson D, Heda GD, Liao J, Kirk KL, Sorscher EJ,

Hanrahan J, Clancy JP (A macromolecular complex of β2 adrenergic receptor,

CFTR, and ezrin/radixin/moesin-binding phosphoprotein 50 is regulated by PKA.

Proceedings of the National Academy of Sciences of the United States of America

100:342-346.2003).

Naren AP, Kirk KL (CFTR Chloride Channels: Binding Partners and Regulatory

Networks. News Physiol Sci 15:57-61.2000).

Naren AP, Nelson DJ, Xie W, Jovov B, Pevsner J, Bennett MK, Benos DJ, Quick MW,

Kirk KL (Regulation of CFTR chloride channels by syntaxin and Munc18

isoforms. Nature 390:302-305.1997).

Naren AP, Quick MW, Collawn JF, Nelson DJ, Kirk KL (Syntaxin 1A inhibits CFTR

chloride channels by means of domain-specific protein–protein interactions.

Proceedings of the National Academy of Sciences of the United States of America

95:10972-10977.1998).

Nielsen S, Chou CL, Marples D, Christensen EI, Kishore BK, Knepper MA (Vasopressin

increases water permeability of kidney collecting duct by inducing translocation

of aquaporin-CD water channels to plasma membrane. Proceedings of the

National Academy of Sciences of the United States of America 92:1013-

1017.1995).

95

Norez C, Noel S, Wilke M, Bijvelds M, Jorna H, Melin P, DeJonge H, Becq F (Rescue of

functional delF508-CFTR channels in cystic fibrosis epithelial cells by the

[alpha]-glucosidase inhibitor miglustat. FEBS Letters 580:2081-2086.2006).

O'Riordan CR, Lachapelle AL, Marshall J, Higgins EA, Cheng SH (Characterization of

the oligosaccharide structures associated with the cystic fibrosis transmembrane

conductance regulator. Glycobiology 10:1225-1233.2000).

Parton R, Prydz K, Bomsel M, Simons K, Griffiths G (Meeting of the apical and

basolateral endocytic pathways of the Madin- Darby canine kidney cell in late

endosomes. J Cell Biol 109:3259-3272.1989).

Pedemonte N, Lukacs GL, Du K, Caci E, Zegarra-Moran O, Galietta LJV, Verkman AS

(Small-molecule correctors of defective ΔF508-CFTR cellular processing

identified by high-throughput screening. The Journal of Clinical Investigation

115:2564-2571.2005).

Penque D, Mendes F, Beck S, Farinha C, Pacheco P, Nogueira P, Lavinha J, Malho R,

Amaral MD (Cystic fibrosis F508del patients have apically localized CFTR in a

reduced number of airway cells. Lab Invest 80:857-868.2000).

Pessin JE, Thurmond DC, Elmendorf JS, Coker KJ, Okada S (Molecular Basis of Insulin-

stimulated GLUT4 Vesicle Trafficking. Journal of Biological Chemistry

274:2593-2596.1999).

Petäjä-Repo UE, Hogue M, Laperrière A, Bhalla S, Walker P, Bouvier M (Newly

Synthesized Human δ Opioid Receptors Retained in the Endoplasmic Reticulum

Are Retrotranslocated to the Cytosol, Deglycosylated, Ubiquitinated, and

Degraded by the Proteasome. Journal of Biological Chemistry 276:4416-

4423.2001).

Petäjä-Repo UE, Hogue M, Laperrière A, Walker P, Bouvier M (Export from the

Endoplasmic Reticulum Represents the Limiting Step in the Maturation and Cell

Surface Expression of the Human δ Opioid Receptor. Journal of Biological

Chemistry 275:13727-13736.2000).

Peter K, Varga K, Bebok Z, McNicholas-Bevensee CM, Schwiebert L, Sorscher EJ,

Schwiebert EM, Collawn JF (Ablation of Internalization Signals in the Carboxyl-

terminal Tail of the Cystic Fibrosis Transmembrane Conductance Regulator

96

Enhances Cell Surface Expression. Journal of Biological Chemistry 277:49952-

49957.2002).

Prince LS, Peter K, Hatton SR, Zaliauskiene L, Cotlin LF, Clancy JP, Marchase RB,

Collawn JF (Efficient Endocytosis of the Cystic Fibrosis Transmembrane

Conductance Regulator Requires a Tyrosine-based Signal. Journal of Biological

Chemistry 274:3602-3609.1999).

Prince LS, Workman RB, Marchase RB (Rapid endocytosis of the cystic fibrosis

transmembrane conductance regulator chloride channel. Proceedings of the

National Academy of Sciences of the United States of America 91:5192-

5196.1994).

Rosenstein BJ, Cutting GR (The diagnosis of cystic fibrosis: a consensus statement.

Cystic Fibrosis Foundation Consensus Panel. J Pediatr 132:589-595.1998).

Rowntree RK, Harris A (The phenotypic consequences of CFTR mutations. Ann Hum

Genet 67:471-485.2003).

Sant A, Hendrix L, Coligan J, Maloy W, Germain R (Defective intracellular transport as a

common mechanism limiting expression of inappropriately paired class II major

histocompatibility complex alpha/beta chains. J Exp Med 174:799-808.1991).

Sato S, Ward CL, Krouse ME, Wine JJ, Kopito RR (Glycerol Reverses the Misfolding

Phenotype of the Most Common Cystic Fibrosis Mutation. Journal of Biological

Chemistry 271:635-638.1996).

Schwiebert EM, Morales MM, Devidas S, Egan ME, Guggino WB (Chloride channel and

chloride conductance regulator domains of CFTR, the cystic fibrosis

transmembrane conductance regulator. Proceedings of the National Academy of

Sciences of the United States of America 95:2674-2679.1998).

Sharma M, Benharouga M, Hu W, Lukacs GL (Conformational and temperature-sensitive

stability defects of the delta F508 cystic fibrosis transmembrane conductance

regulator in post-endoplasmic reticulum compartments. J Biol Chem 276:8942-

8950.2001).

Sharma M, Pampinella F, Nemes C, Benharouga M, So J, Du K, Bache KG, Papsin B,

Zerangue N, Stenmark H, Lukacs GL (Misfolding diverts CFTR from recycling to

degradation: quality control at early endosomes. J Cell Biol 164:923-933.2004).

97

Shen RQ, Finkbeiner WE, Wine JJ, Mrsny RJ, Widdicombe JH (CALU-3 - A HUMAN

AIRWAY EPITHELIAL-CELL LINE THAT SHOWS CAMP-DEPENDENT

CL- SECRETION. Am J Physiol 266:L493-L501.1994).

Short DB, Trotter KW, Reczek D, Kreda SM, Bretscher A, Boucher RC, Stutts MJ,

Milgram SL (An Apical PDZ Protein Anchors the Cystic Fibrosis Transmembrane

Conductance Regulator to the Cytoskeleton. Journal of Biological Chemistry

273:19797-19801.1998).

Silvis MR, Picciano JA, Bertrand C, Weixel K, Bridges RJ, Bradbury NA (A Mutation in

the Cystic Fibrosis Transmembrane Conductance Regulator Generates a Novel

Internalization Sequence and Enhances Endocytic Rates. Journal of Biological

Chemistry 278:11554-11560.2003).

Straley KS, Daugherty BL, Aeder SE, Hockenson AL, Kim K, Green SA (An Atypical

Sorting Determinant in the Cytoplasmic Domain of P-Selectin Mediates

Endosomal Sorting. Mol Biol Cell 9:1683-1694.1998).

Suen YF, Robins L, Yang B, Verkman AS, Nantz MH, Kurth MJ (Sulfamoyl-4-

oxoquinoline-3-carboxamides: Novel potentiators of defective [Delta]F508-cystic

fibrosis transmembrane conductance regulator chloride channel gating.

Bioorganic & Medicinal Chemistry Letters 16:537-540.2006).

Sun F, Hug MJ, Bradbury NA, Frizzell RA (Protein Kinase A Associates with Cystic

Fibrosis Transmembrane Conductance Regulator via an Interaction with Ezrin.

Journal of Biological Chemistry 275:14360-14366.2000a).

Sun F, Hug MJ, Lewarchik CM, Yun C-HC, Bradbury NA, Frizzell RA (E3KARP

Mediates the Association of Ezrin and Protein Kinase A with the Cystic Fibrosis

Transmembrane Conductance Regulator in Airway Cells. Journal of Biological

Chemistry 275:29539-29546.2000b).

Swiatecka-Urban A, Brown A, Moreau-Marquis S, Renuka J, Coutermarsh B, Barnaby R,

Karlson KH, Flotte TR, Fukuda M, Langford GM, Stanton BA (The Short Apical

Membrane Half-life of Rescued ΔF508-Cystic Fibrosis Transmembrane

Conductance Regulator (CFTR) Results from Accelerated Endocytosis of ΔF508-

CFTR in Polarized Human Airway Epithelial Cells. Journal of Biological

Chemistry 280:36762-36772.2005).

98

Swiatecka-Urban A, Duhaime M, Coutermarsh B, Karlson KH, Collawn J, Milewski M,

Cutting GR, Guggino WB, Langford G, Stanton BA (PDZ Domain Interaction

Controls the Endocytic Recycling of the Cystic Fibrosis Transmembrane

Conductance Regulator. Journal of Biological Chemistry 277:40099-40105.2002).

Tabor S, Richardson CC (DNA sequence analysis with a modified bacteriophage T7

DNA polymerase. Proc Natl Acad Sci U S A 84:4767-4771.1987).

Tector M, Hartl FU (An unstable transmembrane segment in the cystic fibrosis

transmembrane conductance regulator. Embo J 18:6290-6298.1999).

Thiemann A, Grunder S, Pusch M, Jentsch TJ (A chloride channel widely expressed in

epithelial and non-epithelial cells. Nature 356:57-60.1992).

Trowbridge IS, Collawn JF, Hopkins CR (SIGNAL-DEPENDENT MEMBRANE-

PROTEIN TRAFFICKING IN THE ENDOCYTIC PATHWAY. Annu Rev Cell

Biol 9:129-161.1993).

Van Goor F, Straley KS, Cao D, Gonzalez J, Hadida S, Hazlewood A, Joubran J, Knapp

T, Makings LR, Miller M, Neuberger T, Olson E, Panchenko V, Rader J, Singh A,

Stack JH, Tung R, Grootenhuis PDJ, Negulescu P (Rescue of {Delta}F508-CFTR

trafficking and gating in human cystic fibrosis airway primary cultures by small

molecules. Am J Physiol Lung Cell Mol Physiol 290:L1117-1130.2006).

Wang S, Raab RW, Schatz PJ, Guggino WB, Li M (Peptide binding consensus of the

NHE-RF-PDZ1 domain matches the C-terminal sequence of cystic fibrosis

transmembrane conductance regulator (CFTR). FEBS Letters 427:103-108.1998).

Wang Y, Loo TW, Bartlett MC, Clarke DM (Correctors Promote Maturation of Cystic

Fibrosis Transmembrane Conductance Regulator (CFTR)-processing Mutants by

Binding to the Protein. Journal of Biological Chemistry 282:33247-33251.2007a).

Wang Y, Loo TW, Bartlett MC, Clarke DM (Modulating the Folding of P-Glycoprotein

and Cystic Fibrosis Transmembrane Conductance Regulator Truncation Mutants

with Pharmacological Chaperones. Molecular Pharmacology 71:751-758.2007b).

Ward CL, Kopito RR (Intracellular turnover of cystic fibrosis transmembrane

conductance regulator. Inefficient processing and rapid degradation of wild-type

and mutant proteins. Journal of Biological Chemistry 269:25710-25718.1994).

Ward CL, Omura S, Kopito RR (DEGRADATION OF CFTR BY THE UBIQUITIN-

PROTEASOME PATHWAY. Cell 83:121-127.1995).

99

Webster P, Vanacore L, Nairn AC, Marino CR (Subcellular localization of CFTR to

endosomes in a ductal epithelium. Am J Physiol Cell Physiol 267:C340-

348.1994).

Weisz OA, Wang J-M, Edinger RS, Johnson JP (Non-coordinate Regulation of

Endogenous Epithelial Sodium Channel (ENaC) Subunit Expression at the Apical

Membrane of A6 Cells in Response to Various Transporting Conditions. Journal

of Biological Chemistry 275:39886-39893.2000).

Weixel KM, Bradbury NA (μ2 Binding Directs the Cystic Fibrosis Transmembrane

Conductance Regulator to the Clathrin-mediated Endocytic Pathway. Journal of

Biological Chemistry 276:46251-46259.2001).

Wu X, Wakefield JK, Liu H, Xiao H, Kralovics R, Prchal JT, Kappes JC (Development

of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2:47-

55.2000).

Yang H, Shelat AA, Guy RK, Gopinath VS, Ma T, Du K, Lukacs GL, Taddei A, Folli C,

Pedemonte N, Galietta LJV, Verkman AS (Nanomolar Affinity Small Molecule

Correctors of Defective ΔF508-CFTR Chloride Channel Gating. Journal of

Biological Chemistry 278:35079-35085.2003).

Yoshimura A, Longmore G, Lodish HF (Point mutation in the exoplasmic domain of the

erythropoietin receptor resulting in hormone-independent activation and

tumorigenicity. Nature 348:647-649.1990).

Younger JM, Chen L, Ren H-Y, Rosser MFN, Turnbull EL, Fan C-Y, Patterson C, Cyr

DM (Sequential Quality-Control Checkpoints Triage Misfolded Cystic Fibrosis

Transmembrane Conductance Regulator. Cell 126:571-582.2006).

Zaliauskiene L, Kang S, Brouillette CG, Lebowitz J, Arani RB, Collawn JF (Down-

Regulation of Cell Surface Receptors Is Modulated by Polar Residues within the

Transmembrane Domain. Mol Biol Cell 11:2643-2655.2000).

Zhang X-M, Wang X-T, Yue H, Leung SW, Thibodeau PH, Thomas PJ, Guggino SE

(Organic Solutes Rescue the Functional Defect in ΔF508 Cystic Fibrosis

Transmembrane Conductance Regulator. Journal of Biological Chemistry

278:51232-51242.2003).

Zielenski J, Tsui LC (Cystic fibrosis: genotypic and phenotypic variations. Annu Rev

Genet 29:777-807.1995).