i

Arabidopsis thaliana Meiosis: HOP2 Interactions with Proteins and Chromatin

by

Eugenia Daradur

A thesis submitted in conformity with the requirements for the degree of Masters of Science

Cell and Systems Biology University of Toronto

© Copyright by Eugenia Daradur 2019

ii

Arabidopsis thaliana Meiosis:

HOP2 Interactions with Proteins and Chromatin

Eugenia Daradur

Masters of Science

Cell and Systems Biology

University of Toronto

2019

Abstract

Homologous Pairing 2 protein (HOP2) is believed to play a crucial role in meiosis by promoting

pairing of homologous chromosomes in anticipation of recombination. The loss of HOP2 causes

a multitude of meiotic aberrations leading to sterility in yeast, mice, and plants. My research

focuses on the Arabidopsis thaliana HOP2 homolog and its interactions with proteins and

chromatin. In this study, using co-immunoprecipitation and chromatin immunoprecipitation

assays, I set out to confirm existing and identify novel protein-protein interactions involving

HOP2. Moreover, I attempt to elucidate the manner in which HOP2 interacts with chromatin. I

demonstrate the in vivo interaction of HOP2 with Meiotic Nuclear Division 1 protein (MND1)

and the preferential interaction of HOP2 with euchromatin which follows crossover occurrence

patterns in Arabidopsis thaliana. My research corroborates previous findings regarding HOP2-

protein interactions and provides a basis for HOP2 studies involving chromatin interactions.

iii

Acknowledgments

I would like to express my sincerest gratitude to Dr. Dan Riggs for providing me the opportunity

of being part of his research team. I truly enjoyed the research that I have done in the lab, which

would have not been possible without Dr. Riggs’ exceptional and patient mentorship. I am

extremely grateful for all the advices he gave me and for everything he has taught me.

I thank my committee members Dr. Clare Hasenkampf, Dr. Rongmin Zhao and my M.Sc.

examiner Dr. Adam Mott for their excellent molecular biology expertise and providing me the

necessary help whenever needed.

I would also like to thank my lab co-workers for all their help. It was a great pleasure working

with them.

Above all, I thank my family: my soon-to-be husband, my sisters and my parents in particular,

for their love, patience and constant support while I was pursuing my M.Sc. degree. I would not

be here if it was not for them, and I will be eternally grateful for everything they have given me.

iv

Table of Contents

Acknowledgments.......................................................................................................................... iii

Table of Contents ........................................................................................................................... iv

List of Tables ................................................................................................................................ vii

List of Figures .............................................................................................................................. viii

List of Abbreviations ..................................................................................................................... ix

1 Introduction .................................................................................................................................1

1.1 Meiotic recombination: a brief description of molecular events .........................................2

1.1.1 Initiation: Double strand break (DSB) repair ...........................................................2

1.1.2 DSB processing and repair.......................................................................................4

1.1.3 Strand invasion and the synaptonemal complex ......................................................4

1.1.4 D-loop resolution .....................................................................................................4

1.1.5 Pathways to CO formation .......................................................................................5

1.1.6 Pathways to NCO formation ....................................................................................5

1.1.7 Distribution of COs in the genome ..........................................................................6

1.1.8 Late prophase I events .............................................................................................6

1.2 HOP2 and its role in meiosis ...............................................................................................7

1.2.1 HOP2 and its respective mutant phenotype .............................................................7

1.2.2 MND1, partner of HOP2..........................................................................................8

1.2.3 The HOP2/MND1 complex and its interaction with RAD51 and DMC1 ...............8

1.2.4 DNA binding of HOP2, MND1 and HOP2/MND1 .................................................9

1.3 Objectives ..........................................................................................................................10

2 Materials and Methods ..............................................................................................................11

2.1 Plant material and growth conditions ................................................................................11

2.1.1 Seed stocks .............................................................................................................11

v

2.1.2 Seed sterilization ....................................................................................................11

2.1.3 Planting to soil .......................................................................................................11

2.2 Arabidopsis genotyping .....................................................................................................12

2.2.1 DNA extraction ......................................................................................................12

2.2.2 Polymerase Chain Reaction (PCR) analysis and genotyping ................................12

2.3 Tissue harvesting and cross-linking ...................................................................................13

2.3.1 Tissue harvesting ...................................................................................................13

2.3.2 Tissue cross-linking ...............................................................................................13

2.4 Identification of the C-terminally 3xHA tagged HOP2 (HOP2::3xHA) by immunoblotting ..................................................................................................................13

2.4.1 Total protein extraction ..........................................................................................13

2.4.2 Protein electrophoresis and transfer to nitrocellulose membrane ..........................14

2.4.3 Immunoblot analysis of 831 protein extracts .........................................................14

2.5 Immunoprecipitation and visualization of HOP2::3xHA ..................................................15

2.5.1 Immunoprecipitation of HOP2::3xHA ..................................................................15

2.5.2 Immunoblotting of HOP2::3xHA ..........................................................................15

2.5.3 Detection of HOP2::3xHA by silver staining ........................................................15

2.6 Identification of HOP2::3xHA containing protein complexes ..........................................16

2.6.1 Co-immunoprecipitation of HOP2::3xHA containing protein complexes ............16

2.6.2 LC-MS/MS analysis...............................................................................................16

2.7 Chromatin immunoprecipitation (ChIP) of HOP2::3xHA-chromatin complexes .............17

2.7.1 Chromatin immunoprecipitation ............................................................................17

2.7.2 Reverse cross-linking of protein-chromatin complexes and DNA purification ....18

2.8 High-throughput sequencing of 831/Ler ChIP experiments and analysis (ChIP-seq) .......18

2.8.1 Bioinformatic analysis of ChIP-seq data ...............................................................19

2.8.2 Quantitative (Real-time) PCR (qPCR) analysis .....................................................20

vi

2.8.3 Motif search ...........................................................................................................21

3 Results .......................................................................................................................................22

3.1 A C-terminally 3xHA tagged HOP2 rescues the sterility phenotype of hop2-1................22

3.1.1 Characterization of the HOP2pro::HOP2::3xHA construct ..................................22

3.1.2 Identification of the HOP2pro::HOP2::3xHA transgene in Arabidopsis plants ...22

3.2 HOP2::3xHA protein and its protein interactions ..............................................................25

3.2.1 HOP2::3xHA accumulates in meiotic cells ...........................................................25

3.2.2 HOP2::3xHA does not accumulate in leaf cells ....................................................25

3.2.3 HOP2::3xHA co-precipitates with several unknown proteins ...............................26

3.2.4 HOP2::3xHA interacts with MND1 in vivo ...........................................................28

3.3 HOP2 protein and its interaction with chromatin ..............................................................29

3.3.1 HOP2 interacts with chromatin along the entire length of chromosomes,

except at centromeric regions ................................................................................29

3.3.2 HOP2 binding peaks associate with open chromatin features ...............................33

4 Discussion .................................................................................................................................34

4.1 Functionality of the hop2-1/HOP2::3xHA complementation system ...............................34

4.2 Analysis of in vivo HOP2-protein interactions ..................................................................35

4.2.1 HOP2 interacts with MND1 in vivo .......................................................................35

4.2.2 Weak interaction of HOP2/MND1 with DMC1 and RAD51 ................................35

4.3 Analysis of in vivo HOP2-chromatin interactions .............................................................36

4.3.1 HOP2 binding generates a broad peak pattern .......................................................36

4.3.2 Distribution of HOP2 binding peaks coincides with regions of high recombination rates ................................................................................................37

4.3.3 Distribution of HOP2 binding peaks follows CO occurrence patterns ..................38

5 Future directions........................................................................................................................40

References ......................................................................................................................................41

vii

List of Tables

Table 1 Primers used in PCR genotyping ..................................................................................... 12

Table 2 Primers used in qPCR analysis ........................................................................................ 20

Table 3 Identities of top 10 proteins that co-immunoprecipitated with HOP2::3xHA ................. 28

viii

List of Figures

Figure 1 Stages of meiosis I and II.. ............................................................................................... 2

Figure 2 Meiotic recombination model.......................................................................................... 3

Figure 3 Proposed model of HOP2/MND1 action in the mammalian system .............................. 10

Figure 4 Chromatin digestion by MNase ...................................................................................... 18

Figure 5 A schematic of the HOP2pro::HOP2::3xHA gene construct ......................................... 22

Figure 6 Validation of HOP2::3xHA transgenic plants ................................................................ 23

Figure 7 HOP2pro::HOP2::3xHA construct rescues the sterility phenotype of hop2-1. ............. 24

Figure 8 HOP2::3xHA protein accumulates in developing buds.................................................. 26

Figure 9 HOP2::3xHA co-immunoprecipitates with several unknown proteins. ........................ 27

Figure 10 Purification of HOP2::3xHA construct using ChIP. .................................................... 30

Figure 11 Distribution of HOP2 binding peaks on Arabidopsis TAIR10 genome ....................... 31

Figure 12 Validation of HOP2 binding peaks by qPCR. .............................................................. 32

Figure 13 Distribution of HOP2 binding peaks over genomic regions ........................................ 33

Figure 14 Motifs enriched at regions bound by HOP2. ................................................................ 34

Figure 15 Distribution of aggregated peaks around TSS .............................................................. 39

ix

List of Abbreviations

ABRC The Arabidopsis Biological

Resource Center

bp base pair

CAGEF The Center for the Analysis of

Genome Evolution and Function

ChIP chromatin immunoprecipitation

ChIP-seq chromatin immunoprecipitation

followed by sequencing

CO cross over

co-IP co-immunoprecipitation

dHj double Holliday junction

D-loop displacement loop

DNA deoxyribonucleic acid

DSB double stranded break

dsDNA double stranded DNA

EB extraction buffer

F forward

FS full speed

HR homologous recombination

HRP horseradish peroxidase

IgG immunoglobulin

IH inter-homolog

IP immunoprecipitation

kb kilobyte

kDa kilodalton

LC-MS/MS liquid chromatography coupled

with tandem mass spectrometry

Ler Landsberg erecta

LND low nucleosome density

MEME Multiple Em for Motif Elicitation

MNase micrococcal nuclease

MS Murashige and Skoog

NCO non cross over

NLB nuclei lysis buffer

NOR nucleolus organizer region

O/N overnight

PCR polymerase chain reaction

pro promoter

x

qPCR quantitative real-time polymerase

chain reaction

R reverse

RGE reciprocal genetic exchange

RT room temperature

SC synaptonemal complex

SD standard deviation

SDSA synthesis dependent strand

annealing

SN supernatant

SPARC The SickKids Proteomics,

Analytics, Robotics & Chemical Biology

Center

SPR surface plasmon resonance

ssDNA single stranded DNA

TCAG The Centre for Applied Genomics

TF transcription factor

TSS transcription start site

TTS transcription terminator site

UTR untranslated region

v/v volume to volume

w/v weight to volume

WT wild-type

Y2H yeast-2-hybrid

1

1 Introduction

Meiosis is a conserved specialized nuclear cell division characteristic of sexually reproducing

eukaryotes. Both mitosis and meiosis are preceded by one round of DNA replication; however,

unlike mitosis which separates the sister chromatids to yield two diploid daughter cells, meiosis

consists of two rounds of chromosome segregation, where homologous chromosomes are

separated in meiosis I followed by the segregation of sister chromatids in meiosis II to generate

four haploid cells (Figure 1). In mammals, the haploid cells directly differentiate into gametes,

but in plants, meiosis results in the production of four haploid spores that divide by mitosis to

form the male and female gametophytes that generate gametes upon maturation.

Similar to mitosis, both meiosis I and meiosis II are separated into four phases: prophase,

metaphase, anaphase and telophase (Figure 1). Prophase I is dramatically prolonged compared

to the mitotic prophase and is sub-divided into 5 stages: leptotene, zygotene, pachytene,

diplotene and diakenesis which are distinguished by specific molecular events that occur at those

times. During early prophase I, unique chromosomal interactions occur, where homologous

chromosomes find each other and pair in anticipation of homologous recombination (HR). The

pairing of the homologs is stabilized by the formation of the synaptonemal complex (SC), which

keeps the homologs closely aligned in order to promote reciprocal genetic exchanges (RGE) that

are represented by cross overs (COs) between non sister chromatids. This process is utterly

important as it is required for proper segregation of chromosomes and it generates genetically

distinct offspring. In addition, it plays an essential role in plant breeding, as the ability to

manipulate HR can result in propagating desirable genetic combinations of linked genes

throughout generations. The last 20 years have proved enlightening in unmasking specifics of

meiosis in species such as Arabidopsis thaliana (Arabidopsis). Although the processes driving

meiosis in higher eukaryotes are not fully understood yet, recent molecular advances have

allowed us to decipher some key components of the recombination pathways in plants (Lambing

et al., 2017; Mercier et al., 2015; Wang & Copenhaver, 2018; Figure 2).

2

Figure 1 Stages of meiosis I and II. Meiosis is divided into meiosis I and meiosis II which are

separated into 4 stages: prophase, metaphase, anaphase and telophase. Meiosis I involves the

pairing of homologous chromosomes, the subsequent RGE between non-sister chromatids and

the segregation of homologs into two separate cells, while meiosis II consists of segregation of

sister chromatids (without RGE) into 4 genetically distinct haploid cells.

1.1 Meiotic recombination: a brief description of molecular events

1.1.1 Initiation: Double strand break (DSB) repair

Recombination is initiated at DSB sites catalyzed by an evolutionarily conserved SPO11-

containing complex that is thought to be structurally similar to the archaeal topoisomerase VI

complex (Bergerat et al., 1997; Figure 2a). In Arabidopsis, the putative heteromeric complex

consists of two α subunits (SPO11-1 and SPO11-2) and one β subunit, the recently identified

MTOPVIB (Stacey et al., 2006; Vrielynck et al., 2016). The Saccharomyces cerevisiae (yeast)

genome has 10 other accessory proteins needed for DSB formation; however, poor conservation

between species has made it difficult to identify similar DSB promoting proteins in higher

eukaryotes. Nevertheless, recent studies identified an array of proteins required for DSB

formation in plants such as PRD1/2/3, DFO, CRC1 and COMET. While some proteins such as

PRD1 and PRD2 are shared among species, others such as PRD3, DFO, CRC1 and COMET are

3

plant specific illustrating the similarities and distinctions at the DSB formation level among

species (reviewed in Lambing et al., 2017).

Figure 2 Meiotic recombination model. Meiotic recombination is initiated by the formation of

numerous DSBs (a) that are processed into 3’ ssDNA tails (b) that invade a nearby homologous

dsDNA forming a D-loop (c). The D-loop can be directed towards a ZMM pathway (f)

generating a dHj (g) which can produce class I COs (h) or towards a non-ZMM pathway to

generate class II COs (i, j). Alternatively, the DSBs can be resolved as NCOs through different

mechanisms including the SDSA pathway (d,e), and maturation of other joint molecules (i) into

NCOs by other mechanisms (k). This figure is adapted from Lambing et al., (2017). Copyright

permission granted by the American Society of Plant Biologists.

1.1.2 DSB processing and repair

Following DSB formation, SPO11 remains covalently attached to the 5’ ends of the DSBs. The

MRE11-RAD51-NBS1 protein complex (MRN complex, Figure 2b) together with COM1

removes the SPO11 bound DNA which generates 3’ single stranded (ssDNA) tails. These tails

are further resected and act as a platform where RecA-like recombinases RAD51 and DMC1

assemble (Neale et al., 2005; Figure 2c). The assembly of these proteins onto the ssDNA

produces the presynaptic complex that subsequently engages in recombinational activities.

Although there are very few structural and biochemical differences between the two

recombinases (Sheridan et al., 2008), studies have shown that in yeast and Arabidopsis meiosis,

DMC1 alone is sufficient for efficient DSB repair and CO formation. While the catalytic

function of RAD51 may be dispensable for meiotic repair, the complete loss of RAD51 abolishes

repair, demonstrating that DMC1 requires RAD51 for proper function (Cloud et al., 2012; Da

Ines et al., 2013).

1.1.3 Strand invasion and the synaptonemal complex

The assembly of the presynaptic complex initiates the invasion of a nearby homologous

structure, forming the synaptic complex. This mechanism unwinds the double stranded DNA

(dsDNA) forming a displacement loop (D-loop, Figure 2c) which is further extended as the

synaptic complex engages in an extensive homology search (reviewed in Lambing et al., 2017).

Once such homology has been established, a tripartite proteinaceous structure called the

synaptonemal complex (SC) forms between the chromosomes and keeps them in homologous

registry (Zickler & Kleckner, 1999). The structure of the SC is conserved among species. In

Arabidopsis, two axial proteins, ASY1 and ASY3, and one central element protein ZYP1 has

been identified. The loss of any of these proteins leads to recombination defects in DSB

formation, DSB repair, and inter-homolog (IH) bias, suggesting that the SC plays a vital role at

several steps of HR (reviewed in Mercier et al., 2015).

1.1.4 D-loop resolution

The extension of the D-loop by the strand exchange mechanism can lead to several outcomes. If

the strand exchange is transient and limited DNA synthesis occurs before the D-loop dissociates

from the dsDNA, the D-loop can enter the synthesis dependent strand annealing pathway

5

(SDSA) to generate a non-crossover (NCO, Figure 2d, e). However, if the second end of the

invading DSB joins the homolog in a process called second end capture (Figure 2f), a double

Holliday junction (dHj) is formed which in turn can be processed into a class I CO by means of a

specialized protein family (Figure 2g, h). Alternatively, dHj and D-loop intermediates can enter

other lesser known pathways to generate class II COs (Figure 2i, j) or NCOs (Figure 2i, k)

(Youds & Boulton, 2011).

1.1.5 Pathways to CO formation

To date, two pathways to CO formation have been documented in higher eukaryotes: a class I

interference sensitive pathway and a class II interference insensitive pathway. The class I COs

depends on the formation of the dHj intermediate and rely on a group of proteins collectively

called the ZMM proteins (Börner et al., 2004). Genetic studies in Arabidopsis have shown that

the loss of the ZMM proteins drastically reduces, but does not completely eliminate the COs

(~85%) (Higgins et al., 2004). Moreover, the remaining COs (~15%) were shown to not exhibit

interference, which in turn lead to the discovery of a second class II CO pathway dependent on

MUS8. As expected, the loss of MUS8 eliminates a small proportion of COs per cell (~10%)

(Berchowitz et al., 2007); however, the loss of MUS8 in a zmm background does not fully

eliminate the COs, suggesting that there are other routes to CO formation yet to be identified in

eukaryotes (reviewed in Lambing et al., 2017).

1.1.6 Pathways to NCO formation

In most organisms, the number of DSBs per meiosis tremendously exceeds the number of COs.

This may be needed in order to ensure sufficient interactions along the entire lengths of

chromosomes to guarantee the obligate CO. For example, in Arabidopsis, where approximately

200-250 DSBs per meiosis are formed, only 10 of them mature into CO events with the

remaining DSBs likely being processed into NCOs (Chelysheva et al., 2010; Vignard et al.,

2007).

There are several mechanisms in place that actively promote the maturation of DSBs into NCOs.

In one mechanism, the helicase FANCM and its two cofactors MHF1 and MHF2 are thought to

actively unwind non-dHj recombination intermediates to promote NCO formation via the SDSA

pathway (Crismani et al., 2012; Girard et al., 2014). In addition, the RTR complex (RecQA/B,

6

TOP3α, RMI1) is believed to direct dHjs and other recombination intermediates towards

dissolution in favour of NCO formation (Séguéla-Arnaud et al., 2015). Moreover, anti-CO

mechanisms may regulate CO formation prior to the invasion step, as is the case with FIGL1

which is believed to control the dynamics of RAD51 and DMC1 to direct the DSB repair

towards the formation of NCOs (Girard et al., 2015). In any case, the loss of any of the proteins

mentioned above leads to an increase in class II COs, suggesting that in the absence of a NCO

promoting mechanism, MUS8 drives the recombination intermediate repair towards class II CO

formation (reviewed in Mercier et al., 2015).

1.1.7 Distribution of COs in the genome

The frequency of meiotic recombination is highly variable along chromosomes and it usually

occurs in narrow regions called hotspots (Kauppi et al., 2004). Recombination hotspots tend to

associate with euchromatin and depending on the species, COs cluster in specific chromosomal

regions. In mammals, the PRDM9 protein recognizes the CCNCCNTNNCCNC motif and directs

the formation of DSBs and subsequent COs towards intergenic regions and introns (Myers et al.,

2008; Myers et al., 2010); whereas in yeast, CO hotspots overlap with regions of low

nucleosome density (LND) in gene promoters (Berchowitz et al., 2009). In plants, CO

occurrence increases towards genic regulatory regions such as gene promoters and terminators,

and associates with active chromatin marks such as H2A.Z, H4K4me3, LND and DNA

hypomethylation regions (Choi et al., 2013). Moreover, hotspots overlap with A-rich and

CTT/CCN DNA motifs (Choi et al., 2013; Shilo et al., 2015) suggesting that although plants lack

PRDM9, the positioning of CO hotspots over specific DNA motifs might have been preserved.

1.1.8 Late prophase I events

The establishment of the COs links the homologous chromosomes through structures known as

the chiasmata. The chiasmata, along with cohesin molecules, are responsible for holding the

homologs together once the SC disassembles at late prophase I ensuring the proper segregation

of chromosomes at anaphase I which results in viable, genetically balanced meiotic products

(reviewed in Mercier et al., 2015).

7

1.2 HOP2 and its role in meiosis

1.2.1 HOP2 and its respective mutant phenotype

HOP2 was first identified in yeast where the loss of HOP2 results in cells which undergo

extensive non-homologous SC formation and meiotic checkpoint-mediated arrest as a result of

unrepaired DSBs (Leu et al., 1998). Shortly thereafter, HOP2 homologs were described in other

species such as Mus musculus (mouse) and Arabidopsis (Petukhova et al., 2003; Schommer et

al., 2003). The loss of HOP2 in mice results in meiotic cells (spermatocytes) that accumulate

unrepaired DSBs as well (Petukhova et al., 2003). However, extensive non-homologous

associations have not been observed, potentially due to the fact that the hop2 spermatocytes

undergo apoptosis prior to reaching the late stages of SC formation (Petukhova et al., 2003).

Unlike in mice and yeast, plant recombination deficient cells do not undergo arrest and/or

apoptosis. Rather, they are able to complete meiosis (albeit a dysfunctional one) because they

lack the meiotic checkpoint which is activated upon accumulation of unresolved DSBs (Vignard

et al., 2007), allowing observation of a dysfunctional meiotic progression past the

arrest/apoptosis point.

In Arabidopsis, hop2 cells are able to initiate recombination and they are not deficient in DSB

processing. This is supported by the fact that RAD51 and DMC1 are loaded on the resected 3’

ssDNA ends, and their loading is dependent on DSB formation and processing (Vignard et al.,

2007). Moreover, cytological analysis revealed a normal progression of the leptotene stage of

prophase I, with abnormalities appearing at the zygotene stage (Stronghill et al., 2010), past the

DSB formation and processing step. As meiosis progresses, the meiotic defect in hop2 cells

becomes increasingly apparent as chromosome entanglements, chromatin bridges and severe

chromatin fragmentation are observed (Schommer et al., 2003; Stronghill et al., 2010). These

findings suggested that as in mice and yeast, DSBs in Arabidopsis hop2 cells remain unrepaired

causing the fragmentation phenotype. In addition, illegitimate interactions between non

homologous chromosomes might result in chromosome entanglements and chromatin bridges

due to the formation of dicentric chromosomes.

8

1.2.2 MND1, partner of HOP2

In an attempt to decipher the role of HOP2 in yeast meiosis, Tsubouchi & Roeder (2002)

identified MND1 as a multicopy suppressor of a milder, temperature sensitive hop2-ts allele

which affects the HOP2 interaction with MND1 at restrictive temperatures; implying that over-

expression of MND1 can compensate for the partial loss of HOP2 function in the hop2-ts mutant.

Conversely, the loss of MND1 yielded similar phenotypes as hop2 mutants, such as cell cycle

arrest as a result of unrepaired DSBs (Gerton & DeRisi, 2002; Zierhut et al., 2004). Interestingly,

the bypass of the Mec1-mediated checkpoint allowed mnd1 cells to progress into the later stages

of meiosis I, exhibiting chromatin fragmentation reminiscent of the hop2 cells in Arabidopsis

(Zierhut et al., 2004).

MND1 and its mutant phenotypes have been characterized in the mammalian and plant systems,

as well. For example, Arabidopsis mnd1 cells also exhibit a defective meiotic phenotype similar

to hop2, namely chromosome entanglements, chromatin bridges and SPO11-dependent

chromatin fragmentation (Kerzendorfer, 2006).

Similar mutant phenotypes of hop2 and mnd1 suggested a possible relationship between the two

proteins. Their interaction has been further supported by co-immunoprecipitation (co-IP) data,

co-localization studies and yeast-2-hybrid (Y2H) assays. For example, in yeast, HOP2 and

MND1 have been shown to co-immunoprecipitate from meiotic cell extracts with MND1 being

the predominant protein recovered when using HOP2 as bait (Tsubouchi & Roeder, 2002).

Moreover, localization studies showed that the loading of HOP2 and MND1 onto meiotic

chromatin in both yeast and Arabidopsis is interdependent on each other and it is temporally

synchronous (Stronghill et al., 2010; Tsubouchi & Roeder, 2002). These observations concluded

that HOP2 and MND1 interact with each other, and that they likely form a complex that acts in

the early stages of meiosis.

1.2.3 The HOP2/MND1 complex and its interaction with RAD51 and DMC1

Studies in mice and yeast revealed that HOP2 and MND1 form a stable elongated heterodimer in

a 1:1 stoichiometry (Chen et al., 2004; Pezza et al., 2006). After the initial description of the

complex in yeast, where it was shown that it promotes DMC1-mediated strand invasion (Chen et

al., 2004), HOP2/MND1 has been profusely studied in higher eukaryotes, such as mammals.

9

Unlike in yeast, the mammalian HOP2/MND1 complex was implicated in DMC1 and RAD51

mediated strand exchange activities. In this system, it was proposed that HOP2/MND1 has a

bipartite stimulatory function in meiosis, as it stabilizes the RAD51 and DMC1-coated

nucleoprotein filaments and it also enhances their ability to capture dsDNA in the subsequent

step of strand invasion and exchange (Chi et al., 2007; Pezza et al., 2007; Figure 3b). In plants,

HOP2/MND1 is believed to act mainly in the DMC1-mediated DSB repair pathway, as DMC1

seems to be the main recombinase active during meiotic DSB repair (Da Ines et al., 2013;

Uanschou et al., 2013). Moreover, plants lacking HOP2/MND1 and DMC1 produce a

comparable amount of seeds as the dmc1 plants (where the repair of DSBs is done solely by

RAD51), suggesting that in the absence of DMC1, HOP2/MND1 is largely dispensable for

RAD51 function (Uanschou et al., 2013). However, a physical interaction of HOP2/MND1 with

both RAD51 and DMC1 has been shown by in vitro assays (Vignard et al., 2007); thus not

excluding the possibility that HOP2/MND1 may function with RAD51 in a meiotic or mitotic

context, as well.

1.2.4 DNA binding of HOP2, MND1 and HOP2/MND1

Both HOP2 and MND1 localize to meiotic chromosomes from early leptotene to diakinesis,

although in a slightly different pattern (Stronghill et al., 2010). As a protein complex involved in

HR, several groups inferred that HOP2/MND1 should interact with DNA. Surely, studies done in

yeast, mammals and plants revealed that HOP2, MND1 and HOP2/MND1 exhibited some level

of DNA binding, although the affinity for ssDNA and dsDNA varied across species (Chen et al.,

2004; Pezza et al., 2006; Uanschou et al., 2013). In Arabidopsis, Uanschou et al., (2013) showed

that while the C terminus of either HOP2 or MND1 does not have DNA binding affinity, the N

termini of both HOP2 and MND1 are critical for both ssDNA and dsDNA binding in vitro. On

the other hand, studies done in mammalian systems led to a model in which the N termini of both

HOP2 and MND1 are involved in dsDNA binding while the C termini are involved in ssDNA

binding (Zhao & Sung, 2015; Figure 3a). Nevertheless, in all 3 systems, HOP2, MND1 or the

HOP2/MND1 complex showed a strong affinity towards DNA in vitro.

10

Figure 3 Proposed model of HOP2/MND1 action in the mammalian system. (a) The N-

termini of both HOP2/MND1 are required for dsDNA binding, while the C-termini of the

complex are needed for the interaction with RAD51/DMC1. The C-terminus of HOP2 also

contains a domain suitable for the interaction with ssDNA. (b) The HOP2/MND1 complex

interacts with the RAD51/DMC1-ssDNA via the C-termini stabilizing the presynaptic filament.

The complex then promotes strand invasion, homology search and synaptic complex formation

via the dsDNA binding domain in the N-termini. Copyright permission granted by Zhao & Sung

(2015).

1.3 Objectives

The HOP2 protein has been extensively studied in several model organisms; however, most of

the Arabidopsis HOP2 studies were done in vitro. Therefore, the focus of my study was to

establish a system suitable for the study of HOP2 interactions with proteins and chromatin in

Arabidopsis in vivo for the purpose of confirming and expanding previous findings.

a

b

11

2 Materials and Methods

2.1 Plant material and growth conditions

2.1.1 Seed stocks

The Arabidopsis thaliana ecotype Landsberg erecta (Ler) was used as the wild-type (WT) in this

project. hop2-1 Arabidopsis plants carrying the HOP2pro::HOP2::3xHA gene construct

(hereafter referred to as 831), were previously generated by Mohammed Kesserwan and Dan

Riggs by Agrobacterium mediated transformation of HOP2/hop2-1 plants. All seeds, including

hop2-1, were obtained from our laboratory stocks or from the Arabidopsis Biological Resource

Center (ABRC).

2.1.2 Seed sterilization

Arabidopsis thaliana Ler, hop2-1 and 831 seeds were placed in separate 1.5 mL tubes. Seeds

were imbibed with distilled water for 30 minutes by vigorously shaking them on a vortex shaker

at room temperature (RT). The seeds were allowed to settle, the water removed and 1 mL of 70%

ethanol was added. The tubes were placed on the vortex shaker for another 8 minutes. Once the

seeds settled, the ethanol was removed and the seeds were washed twice with distilled water to

remove traces of ethanol. The tubes were filled with 10% (v/v) commercial bleach, 0.1% SDS

solution and placed on the vortex shaker for another 8 minutes. The seeds were allowed to settle

and washed 5 times with distilled water.

2.1.3 Planting to soil

Sterilized seeds were sowed unto pots filled with a sphagnum peat moss, perlite and vermiculite

mixture (Pro-mix) supplied with water, all purpose fertilizer (NatureProd) and beneficial

nematodes (Steinermena feltiae, Natural Insect Control). The pots were placed in trays and

covered with a plastic dome. The trays were moved to a Conviron AC60 growth chamber, and

kept under fluorescent lighting (125μ E/m2) with a 16 hr day: 8 hr night photoperiod, at 22°C.

For the first 6 days after planting, the water level was kept constant (a little above the base of the

pots) and the inside of the dome was sprayed with water daily. Afterwards, the dome was

removed, and the pots were watered every three days or as needed.

12

2.2 Arabidopsis genotyping

2.2.1 DNA extraction

A small piece of leaf was placed in a clean 1.5 mL tube and homogenized with a pestle. 500 ul of

extraction buffer (250 mM Tris-HCl pH 7.5, 250 mM NaCl, 25 mM EDTA, 0.5% SDS, SDS was

added to buffer just prior to extraction) was added to the tube, the mixture was re-ground with

the pestle until a homogenous green suspension was obtained and the tube was left on ice until

all samples were prepared. The tubes were centrifuged for 1 minute at full speed (FS) at RT and

300 ul of lysate was transferred to tubes containing 300 ul of isopropanol and mixed by

inversion. The tubes were incubated for 4 minutes at RT and centrifuged for 5 minutes at FS at

RT. The supernatant (SN) was removed and the pellet was washed with 1 mL of ice cold 70%

ethanol. The tubes were centrifuged for 5 minutes at FS at RT. The ethanol was removed and the

tubes were left to air dry for 30 minutes at RT. Once dried, the DNA pellet was re-suspended in

100 ul TE buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) and thoroughly mixed by vortexing.

The tubes were centrifuged for 1 minute at FS at RT, and 40 ul of the top layer was transferred to

properly labeled 1.5 mL tubes. DNA was stored at 4°C until needed.

2.2.2 Polymerase Chain Reaction (PCR) analysis and genotyping

PCR was performed using the primers listed in Table 1 Primers used in PCR genotypingTable 1:

Table 1 Primers used in PCR genotyping

Region amplified Primer name/sequence 5’-3’ Size (bp)

HOP2 F: P7: GAAAACTATCAGTGATGTG

721

R: 1L: TTGTACAGTTGCATATGTG

hop2-1 F: P7: GAAAACTATCAGTGATGTG

331

R: o8459: GCTTTCGCCTATAATACGACGG

HOP2::3xHA F: HOP2seq: CAAGCGTAAGAGGATGTTCAG

756

R: EGADback: TGGAGTAGACAAGCGTGTGTGCT

PCR reactions were carried out in 40 ul reaction volume consisting of 32.25 ul sterile water, 4 ul

10x PCR buffer (final concentration 1x: 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2),

13

0.8 ul dNTPs (0.2 mM), 0.8 ul forward (F) primer (0.2 uM), 0.8 ul reverse (R) primer (0.2 uM),

0.4 ul TAQ polymerase (0.2-0.4 units) and 1 ul DNA template (2-5 ng). PCR was performed

using a BioRad MJ Mini Gradient Thermal Cycler using the following PCR conditions: 1 cycle

of 2 min at 95 °C, followed by 35 cycles of 30 sec at 95°C, 30 sec at 53 °C, and 1 min at 72 °C

and finishing with a 2 min incubation at 72 °C. PCR products were examined by gel

electrophoresis at 100 V for 50 minutes in a 1% (w/v) agarose gel, supplied with ethidium

bromide (0.5 ug/mL), in 0.5x TAE (45 mM Tris base, 45 mM boric acid, 0.1 mM EDTA) and

visualized under UV light (G:Box, SynGene).

2.3 Tissue harvesting and cross-linking

2.3.1 Tissue harvesting

Inflorescences of 5 week-old plants were collected into 30 mL glass test tubes containing 15 mL

of ice cold 1x PBS buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM KH2PO4,

pH 7.4). All flowers were removed, keeping only the unopened buds. The tissue was mixed to

make sure that the buffer fully covered the inflorescences, and the tubes were left on ice for 2 hrs

to allow all air pockets to be filled by PBS for better cross-linking.

2.3.2 Tissue cross-linking

Following the 2 hr incubation, the PBS buffer was removed and 15 mL of 1% formaldehyde

(Thermo Scientific) in PBS was added to the tubes. Cross-linking of the inflorescences by

vacuum infiltration was done as previously described by Yamaguchi et al., (2014).

2.4 Identification of the C-terminally 3xHA tagged HOP2 (HOP2::3xHA) by immunoblotting

2.4.1 Total protein extraction

Approximately 100 mg of 831 inflorescence or leaf material was placed in a clean 1.5 mL tube

and crushed using a pestle. 100 ul of 1x Laemmli buffer (67 mM Tris-HCl pH 6.8, 2% 2-

mercaptoethanol, 2.7% bromophenol Blue, 5% glycerol, 2% SDS) was added to the tissue and

incubated at 95°C for 10 minutes, after which they were centrifuged at FS in a microfuge for 5

minutes at RT. The SN, which contained the protein extract, was transferred into properly

labeled tubes and stored at -20 °C until needed.

14

2.4.2 Protein electrophoresis and transfer to nitrocellulose membrane

Proteins from the 831 inflorescence and leaf extracts were separated on a denaturing SDS-PAGE

gel. The gel was run at 100 V in 1x SDS buffer (25 mM Tris base, 192 mM glycine, 0.1 %SDS,

pH 8.3) until the dye front ran off the gel. The gel was carefully removed from the apparatus, and

the proteins were electro-transferred unto a nitrocellulose membrane (Biorad) in 1x Western

Transfer buffer (25 mM Tris base, 192 mM glycine, 15% methanol, pH 8.3) for 50 minutes at

100 V.

2.4.3 Immunoblot analysis of 831 protein extracts

After the protein transfer was done, the membrane was removed and placed in a plastic

container. Prior to blocking, the nitrocellulose membrane was stained with Ponceau (0.5%

Ponceau S, 1% acetic acid) to check for the presence of proteins. Afterwards, the membrane was

blocked overnight (O/N) in 1xTBS (20 mM Tris base, 150 mM NaCl, pH7.5), 5% non-fat dried

milk and 0.2% Tween20. The next day, the blocking solution was discarded and the membrane

was washed once with 1x TBS, 2% non-fat dried milk and 0.2% Tween20. The membrane was

incubated with mouse anti-HA primary antibodies (Roche 12CA5, 1:2000 dilution in 1x TBS,

2% non-fat dried milk, 0.2% Tween20) for 1.5 hrs at RT by placing the container on a rocker.

The primary antibody solution was removed, and the membrane was washed 4 times, 5 minutes

each wash, with 1x TBS, 0.2% Tween20. The membrane was then incubated with horse

horseradish peroxidase (HRP) linked anti-mouse secondary antibody (Cell Signalling

Technologies, #7076, 1:2000 dilution in 1xTBS, 2% non-fat dried milk, 0.2% Tween20) for 1.5

hrs at RT. Following the second incubation, the membrane was washed 4 times, 5 minutes each,

with 1x TBS, 0.2% Tween20, and once more with 1x TBS to remove traces of the detergent. The

membrane was incubated for 1.5 minutes in developing solution (100 mM Tris-HCl pH 8.8, 1.25

mM luminal, 2 mM 4IPBA, 5.3 mM H2O2) and the proteins were visualized by

chemiluminescence (SRX-101A, Konica Minolta) on B Plus-Full Blue X-ray film (Mandel

Scientific Company, Inc.).

15

2.5 Immunoprecipitation and visualization of HOP2::3xHA

2.5.1 Immunoprecipitation of HOP2::3xHA

Approximately 2.5 g of 831 cross-linked inflorescences were homogenized in liquid nitrogen

using a mortar and a pestle. The powder was mixed with 4.5 mL Extraction Buffer (EB; 20 mM

Tris-HCl pH 7.5, 150mM NaCl, 10% glycerol, 2 mM EDTA, 0.1% Igepal 630, 1x protease

inhibitor cocktail (P9599, Sigma)) and the mortar containing the frozen mixture was placed at

4°C until the mixture thawed completely. The extract was transferred into several 2 mL tubes

and clarified by centrifugation at FS in a microfuge for 10 minutes at 4°C. The clarified extracts

were mixed with 50 ul of EB pre-washed anti-HA coupled Protein G magnetic beads (12CA5,

Thermofisher) and incubated for 2.5 hrs at 4°C on a rotator. The tubes were placed on a magnetic

rack to pellet the beads; the SN was removed and saved as the unbound material. The beads were

washed 4 times with EB and once more with 150 mM NaCl to remove any buffering agents. The

beads were re-suspended in 50 ul 0.1 M glycine pH 2.0, and incubated at RT for 10 minutes with

occasional mixing for elution of the protein complexes. The elution was repeated once more, and

the eluates (bound fraction) were pooled together in a 1.5 mL tube containing 8 ul of 1 M Tris

pH 9.2 for neutralizing the low pH.

2.5.2 Immunoblotting of HOP2::3xHA

The bound fraction and other fractions taken at various steps of the immunoprecipitation (IP)

were mixed with 4x Laemmli buffer to a final concentration of 1x. The detection of

HOP2::3xHA protein was done as described in section 2.3.2.

2.5.3 Detection of HOP2::3xHA by silver staining

Following protein separation by a denaturing SDS-PAGE gel, the gel was incubated twice in

fixing solution (50% methanol, 10% acetic acid) for 20 minutes. Afterwards, the gel was rinsed

in 20% ethanol for 10 minutes, and once more in water for 10 minutes. The gel was reduced in a

solution containing sodium thiosulfate (0.2 g/L) for 1 minute and rinsed twice with water for 20

seconds each wash. The gel was incubated in silver nitrate (2.0 g/L) for 20 minutes and rinsed

once with water for 20 seconds. The gel was washed once with developing solution (sodium

carbonate 30g/L, sodium thiosulfate 10 mg/L, 5% formaldehyde) and then it was placed in fresh

16

developing solution until bands developed to a desired intensity. The reaction was stopped by

exchanging the developing solution with 1% acetic acid.

2.6 Identification of HOP2::3xHA containing protein complexes

2.6.1 Co-immunoprecipitation of HOP2::3xHA containing protein complexes

Total protein extraction from 831 cross-linked inflorescences was carried out as described in

section 2.5.1. Following the capture of protein complexes and the washing of the beads, the

beads were flash frozen in liquid nitrogen and sent to the SickKids Proteomics, Analytics,

Robotics, & Chemical Biology Centre (SPARC Biocentre) where on-bead trypsin digestion was

performed for mass spectrometry analysis (LC-MS/MS).

2.6.2 LC-MS/MS analysis

All samples were analyzed using Sequest (XCorr Only) v.2.1.1.21 (Thermofisher Scientific) and

X! Tandem v.CYCLONE 2010.12.01.1 (The GPM). Sequest (XCorr Only) was set up to search

Uniprpt_Arabidopsis_Thaliana_Reviewed_July112017.fasta (unknown version, 15363 entries)

assuming the digestion enzyme trypsin. X! Tandem was set up to search a reverse concatenated

Uniprpt_Arabidopsis_Thaliana_Reviewed_July112017 database (unknown version, 30846

entries) also assuming trypsin. Scaffold v.4.8.2 (Proteome Software Inc.) was used to validate

MS/MS based peptide and protein identifications. Peptide identifications were accepted if they

could be established at greater than 95.0% probability. Peptide probabilities from X! Tandem

were assigned by the Scaffold Local FDR algorithm. Peptide probabilities form Sequest (XCorr

Only) and X! Tandem were assigned by the Peptide Prophet algorithm (Keller et al., 2002).

Protein identifications were accepted if they could be established at greater than 95.0%

probability and contained at least one identified peptide. Protein probabilities were assigned by

the Protein Prophet algorithm (Nesvizhskii et al., 2003).

17

2.7 Chromatin immunoprecipitation (ChIP) of HOP2::3xHA-chromatin complexes

2.7.1 Chromatin immunoprecipitation

Extraction of protein-chromatin complexes from 831 and Ler cross-linked inflorescences was

performed as described previously (Bowler et al., 2004). The procedure was followed until the

chromatin shearing step, where the chromatin shearing was done using micrococcal nuclease

(MNase, #M0247S, New England Biolabs) instead of sonication. Following the removal of EB3

(10 mM Tris-HCl pH8.0, 1.7 M sucrose, 0.15% Triton X-100, 2 mM MgCl2, 5 mM 2-

mercaptoethanol, 1x protease inhibitor cocktail), the pellet was re-suspended in 400 ul 1x MNase

buffer (50 mM Tris-HCl pH 7.9, 5 mM CaCl2) and incubated at 37°C for 17.5 minutes with an

appropriate amount of MNase diluted in 1x MNase buffer (200 units per 100 ug of DNA) with

occasional mixing. To stop the digestion reaction, 0.5 M EDTA was added to the samples to a

final concentration of 10 mM EDTA and mixed well. The extent of digestion was checked by

DNA gel electrophoresis, where the appearance of a laddered pattern implied effective chromatin

digestion into mono/di/tri nucleosomes (Figure 4). To lyse the nuclei, a 1/10th

volume of 20%

SDS was added to the samples to a final concentration of 1% SDS. The samples were incubated

on ice for 30 minutes with occasional mixing. The extracts were clarified by centrifuging for 10

minutes at FS at 4°C. The extract was separated from the pellet; 200 ul of the extract was diluted

10 fold (1800 ul) with ChIP Dilution Buffer (16.7 mM Tris-HCl pH8.0, 167 mM NaCl, 1.1%

Triton X-100, 1.2 mM EDTA) with 100 ul of the diluted extract being saved as the input. The

remaining 1900 ul was incubated with pre-washed with ChIP Dilution buffer anti-HA coupled

Protein G magnetic beads (12CA5, Thermofisher) for 2.5 hrs at 4°C on a rotator. The tubes were

placed on a magnetic rack to recover the beads, the SN discarded and the beads were washed as

previously described (Yamaguchi et al., 2014). The beads were mixed with 50 ul Nuclei Lysis

Buffer (NLB, 50 mM Tris-HCl pH8.0, 10 mM EDTA, 1% SDS) and incubated at 65°C for 30

minutes for elution of protein-chromatin complexes. The elution was repeated once, and the

eluates were pooled together which were subsequently subjected to reversal of protein-chromatin

cross-links.

18

Figure 4 Chromatin digestion by MNase. Undigested (-) and digested (+) chromatin was run

on a 1% agarose gel. Efficient chromatin digestion is observed by the laddering pattern that

reflects the presence of mono/di/tri nucleosomes. The left lane indicates the sizes of DNA

markers in basepairs (bp).

2.7.2 Reverse cross-linking of protein-chromatin complexes and DNA purification

The input sample was diluted 2x with NLB; both the input and the bound fractions were mixed

with 5 M NaCl to achieve a final concentration of 0.2 M NaCl (6 ul of 5 M NaCl per 100 ul of

solution). The samples were placed in a water bath and incubated at 65°C O/N for reversal of

cross-links. The next day, the DNA was purified from the input and the bound fractions using the

Qiagen PCR extraction kit (Qiagen, #28104) or the Qiagen MinElute PCR purification kit

(Qiagen, #28004).

2.8 High-throughput sequencing of 831/Ler ChIP experiments and analysis (ChIP-seq)

Purified 831 and Ler ChIP DNA samples (2 pairwise 831/Ler and 2 single 831 ChIP

experiments, for a total of 6 samples) were delivered to The Centre of Applied Genomics

19

(TCAG) for high-throughput sequencing where a library of single-end reads was prepared for

sequencing on the Illumina HiSeq2500 platform.

2.8.1 Bioinformatic analysis of ChIP-seq data

The analysis of the ChIP-seq data from one pairwise 831/Ler experiment was carried out using

TAIR10 as the reference genome. The sequence was downloaded from

https://support.illumina.com/sequencing/sequencing_software/igenome.html. The quality of the

single end reads of 831 and Ler ChIP libraries was assessed using FastQC v.11.5

(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). To remove adaptor sequences,

Trim_Galore v.0.0.4 was used

(https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) which runs Cutadapt v.1.10

(https://cutadapt.readthedocs.org/en/stable/). Following adaptor trimming, the quality of the

trimmed reads was re-assessed with FastQC v.11.5

(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). A total of 28,843,962 and

27,190,300 processed reads were obtained from the 831 and Ler ChIP libraries, respectively,

which were aligned to the TAIR10 genome using Bowtie2 v2.3.2 (http://bowtie-

bio.sourceforge.net/bowtie2/index.shtml) with default parameters. Approximately 91% of both

libraries aligned to the Arabidopsis thaliana genome. Peaks were identified from the alignment

using MACS2 v.2.1.1 (https://github.com/taoliu/MACS/) (q

20

2.8.2 Quantitative (Real-time) PCR (qPCR) analysis

From the ChIP-seq data, 5 peaks were chosen for qPCR analysis. Primer sets were designed

using primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2).

Table 2 Primers used in qPCR analysis

Primer

name

Chromosome; peak

coordinates

Gene Primer sequence 5’-3’ Size

(bp)

1-1 Chr1

4562888:4570568

HOP2, PP2A3,

ISTL6

F:CGCTTGGTCGACTATCGGAA 244

R:TCGTGCAGTATCGCTTCTCG

1-2 F:CTGAAACTTTGTGCCGTCCC 233

R:TTAGCTGCTGCGAAAGACGA

2-1 Chr3

5116658:5126661

ERF4 F:GGAGATTCGTTAACAGAGGCG 288

R:TGAAGGCACAACTAACGTCG

2-2 F:CTCCGACGTTAGTTGTGCCT 269

R:CTTCGAAATCAACGACCGAT

3-1 Chr1

5420626:5421995

TPL F:AGCTAACTGCGATAAGCAGGA 201

R:GTTAGATCTCCGTCCTCCGC

4-2 Chr3

21433991:21435768

FTIP3/

MCTP3

F:GACGACGGTCCTGCGTAATC 257

R:AGTAACGGGGTCCAGCAAAA

5-2 Chr1

30266828:30267981

TPR1 F:CGAAGGTGACGGATAACGGA 232

R:ACTCACCGAGGGTGTACTCA

Negative

control

Chr3

N/A

RTM3 F:GTGCTTTTGTGGTGTCTCCG 260

R:TCATGGATCCCAGTGCATCG

https://www.ncbi.nlm.nih.gov/tools/primer-blast/

21

Ler and 831 ChIP experiments were performed as described above. Purified DNA from the

bound fractions and the inputs were used as DNA templates for qPCR. qPCR was performed in

triplicates using the SensiFAST SYBR No-ROX kit (Bioline, Bio-98005) in 20 ul reaction

volumes. The samples were amplified using a QuantStudio 3 Real-time PCR system

(Thermofisher Scientific) according to manufacturer’s instructions. The RTM3 gene was used as

an internal control to normalize for variability of expression levels within templates. Expression

data was analyzed using the comparative Ct (2-ΔΔCt

) method (Schmittgen & Livak, 2008), where

the expression values for Ler ChIP and 831 ChIP were normalized to the RTM3 gene prior to

calculating the fold enrichment of the 831 ChIP sample over the Ler ChIP sample.

2.8.3 Motif search

The 100 highest scoring peaks (ranked by q-value) were chosen for motif scan. The 1-kilobyte

(kb) sequences (500 bp upstream and 500 bp downstream) surrounding the summits of those

peaks were extracted and subjected to motif search by Multiple EM for Motif Scan (MEME)

(http://meme-suite.org/tools/meme).

http://meme-suite.org/tools/meme

22

3 Results

3.1 A C-terminally 3xHA tagged HOP2 rescues the sterility phenotype of hop2-1

3.1.1 Characterization of the HOP2pro::HOP2::3xHA construct

The initial hop2-1 mutation in Arabidopsis arises from a T-DNA insertion in the 4th

exon of the

HOP2 gene (Schommer et al., 2003). The hop2-1 plants exhibit normal vegetative growth with

defects seen during the reproductive stages of Arabidopsis as they are completely sterile

(Schommer et al., 2003).

Our laboratory had previously isolated a transgenic hop2-1 Arabidopsis Ler line complemented

with a HOP2::3xHA construct driven by the endogenous HOP2 promoter

(HOP2pro::HOP2::3xHA), referred to as the 831 line. The 3xHA tag is fused in-frame to the last

exon of the HOP2 gene and the construct also carries a BASTA selectable marker (Figure 5).

Since hop2-1 plants are sterile, HOP2 heterozygote plants (T0) were used for Agrobacterium –

mediated transformation. Successful T1 transformants were selected based on their ability to

grow on Murashige and Skoog (MS) plates containing BASTA (10 ug/mL).

Figure 5 A schematic of the HOP2pro::HOP2::3xHA gene construct. The blue arrow depicts

the HOP2 endogenous promoter (approximately 3.5 kb); black boxes depict HOP2 exons; green

box depicts the in-frame fusion of the 3xHA tag and yellow box depicts the BASTA selectable

marker. Figure not drawn to scale.

3.1.2 Identification of the HOP2pro::HOP2::3xHA transgene in Arabidopsis plants

Transformants were examined for the presence of the HOP2::3xHA transgene by PCR analysis.

For this purpose, 3 sets of primers were designed to amplify regions corresponding to the

endogenous HOP2 gene, the T-DNA disrupted HOP2 gene (the hop2-1 insertion) and the 3xHA

tagged HOP2 construct (Figure 6a). The presence of the HOP2::3xHA construct in WT looking

plants (assessed by their ability to produce elongated siliques with seeds) that were homozygous

23

for the hop2-1 mutation suggested that the construct rescues the sterility phenotype by restoring

HOP2 function in hop2-1 plants (Figure 6b, Figure 7b).

Figure 6 Validation of HOP2::3xHA transgenic plants. (a) The location of primers used to

amplify the WT HOP2 gene (P7,1L); hop2-1 T-DNA (P7, o8459) and the HOP2pro::HOP2-

3xHA transgene (HOP2seq, EGADback). (b) PCR analysis of 2 of Ler, hop2-1 and 831 plants.

DNA from each set of plants was amplified using the 3 primer sets. +/- represent positive and

negative controls, respectively. Positive controls were as follows: Ler plant (WT HOP2), hop2-1

plant (hop2-1) and 831 plant (HOP2::3xHA); negative controls represent no DNA template.

Primer sets and resulting amplicon sizes are shown above.

a

b

24

Figure 7 HOP2pro::HOP2::3xHA construct rescues the sterility phenotype of hop2-1.

(a) WT Ler plant (b) 831 plant (c) hop2-1 plant. hop2-1 plants exhibit normal vegetative growth,

but are sterile. Sterility is easily observable by short siliques, devoid of seeds. Introduction of the

HOP2::3xHA construct is sufficient to rescue the sterility of hop2-1; 831 plants exhibit long

siliques, full of seeds (indistinguishable from WT). Close-up of siliques of Ler, 831 and hop2-1

are shown underneath each respective image.

a b c

25

3.2 HOP2::3xHA protein and its protein interactions

3.2.1 HOP2::3xHA accumulates in meiotic cells

PCR and phenotypic analysis of HOP2::3xHA containing hop2-1 plants suggested that the

tagged HOP2 construct restores the endogenous function of HOP2 in hop2-1 cells. To confirm

the translation of the construct and the accumulation of the HOP2::3xHA protein, total protein

was extracted from the inflorescences of 5 week-old 831 plants and subjected to immunoblot

analysis. The endogenous HOP2 protein is approximately 26 kDa in size; the construct

incorporates the full length HOP2 gene plus the 3xHA which adds approximately 3 kDa. The

resulting protein construct should thus be of approximately 29 kDa in size. Using antibodies

directed to the HA tag, the HOP2 construct was detected in protein extracts from 831

inflorescences, confirming the accumulation of HOP2::3xHA protein in otherwise HOP2

deficient cells (Figure 8b).

3.2.2 HOP2::3xHA does not accumulate in leaf cells

The Arabidopsis thaliana HOP2 is expressed mainly in the developing bud (Figure 8a).The

introduction of the exogenous construct in Arabidopsis raised the question whether the construct

is expressed ectopically. To confirm that this is not the case, I extracted total protein from rosette

leaves of 5 week-old 831 plants and subjected it to immunoblot analysis. The anti-HA antibodies

failed to detect the HOP2::3xHA protein in leaf protein lysate, thus confirming proper expression

of the construct in developing buds of the inflorescences (Figure 8b).

26

Figure 8 HOP2::3xHA protein accumulates in developing buds. (a) HOP2 is mainly

expressed in meiotic buds. Expression decreases once flower stage 9 is reached, with very low

expression seen in leaves. Figure adapted from www.bar.utoronto.ca (Winter et al., 2007) (b)

Anti-HA antibodies recognize the HOP2::3xHA protein in total inflorescence lysate (inf) but not

in total leaf lysate (leaf). Arrow points to the HOP2::3xHA band of ~29 kDa.

3.2.3 HOP2::3xHA co-precipitates with several unknown proteins

Mouse and yeast HOP2 co-immunoprecipitates with MND1 from meiotic extracts (Petukhova et

al., 2005; Tsubouchi & Roeder, 2002). The interaction between HOP2 and MND1 has been

highly documented and other HOP2 interactors such as DMC1, RAD51 and MIP1 have been

a

b

http://www.bar.utoronto.ca/

27

identified (Dean et al., 2009; Vignard et al., 2007). To identify in vivo HOP2-protein

interactions, I employed an IP/co-IP protocol adapted from Osman et al., (2013) which showed

that the Brassica oleracea BoASY1 interacts in planta with BoASY3.

The IP assay was first employed to ensure proper purification of HOP2::3xHA from 831 protein

lysates. By taking aliquots from different steps of the assay and subjecting them to immunoblot

analysis, the protein construct was detected in the final IP fraction, suggesting that the isolation

was successful (Figure 9a, lane 7).

Having confirmed the validity of the assay, the IP fraction was subjected to silver staining in

order to identify whether there are other proteins co-immunoprecipitating with HOP2::3xHA.

Along with the prominent band at approximately 29 kDa which indicated the presence of

HOP2::3xHA protein, several other bands of differing sizes were observed as well, suggesting

the presence of other proteins in the IP fraction (Figure 9b).

Figure 9 HOP2::3xHA co-immunoprecipitates with several unknown proteins. (a)

Immunoblot of fractions taken at several steps during the 831 IP experiment. Anti-HA antibodies

detect HOP2::3xHA only in the bound fraction, lane 7. Other lanes depict fractions taken at

several steps throughout the IP: lane 1 - total lysate (15 ul), lane 2 - total lysate (5 ul), lane 3 –

unbound (15 ul), lane 4 – unbound (5 ul), lane 5 – wash (15 ul), lane 6 – salt wash (15 ul). Arrow

points to the HOP2::3xHA band of ~29 kDa; star depicts a non-specific band. (b) Silver stain of

the bound fraction from the 831 IP experiment. Arrow points to the HOP2::3xHA band of ~29

kDa. Stars depict other protein bands detected in the bound fraction.

a b

28

3.2.4 HOP2::3xHA interacts with MND1 in vivo

Next, I wanted to identify the unknown protein bands from the silver stained gel. To this end, the

co-IP assay was repeated with minor changes to the protocol; instead of eluting the bound

proteins off the beads, the beads were snap-frozen in liquid nitrogen and shipped to SPARC for

LC-MS/MS analysis where on-bead trypsin digestion was conducted and the soluble proteins

were analyzed. As expected, MND1 was found to immunoprecipitate with HOP2 in an almost

1:1 ratio (Table 3). Unfortunately, none of the other putative interactors were identified using

this method. Although mass spectrometry analysis identified 170 other proteins, these are

abundant proteins that most likely are non-specific hits (Table 3).

Table 3 Identities of top 10 proteins that co-immunoprecipitated with HOP2::3xHA

Protein ID/name % coverage Total spectra

HOP2/ Homologous Pairing protein 2 72 52

MND1/ Meiotic Nuclear Division protein 1 53 46

rbcL/ Ribulose biphosphate carboxylase, large chain 24 15

GAPA1/ Glycerladehyde-3-phosphate dehydrogenase 29 11

GAPC1/ Glycerladehyde-3-phosphate dehydrogenase 32 12

TUBA2/ Tubulin alpha-2 chain 26 12

MED37E/ Probable mediator of RNA polymerase II transcription

subunit

21 11

GASA1/ Gibberellin-regulated protein 1 39 11

TUBB3/ Tubulin beta-3 chain 22 10

CAT3/ Catalase-3 19 9

29

3.3 HOP2 protein and its interaction with chromatin

3.3.1 HOP2 interacts with chromatin along the entire length of

chromosomes, except at centromeric regions

The interaction of HOP2 with DNA has been observed by several groups, including Uanschou et

al., (2013) who showed that the Arabidopsis HOP2/MND1 complex binds both bulk ssDNA and

dsDNA in vitro. However, studies have yet to report the manner in which HOP2 interacts with

DNA/chromatin or whether there is any sequence/motif specificity to this interaction. Thus, I

carried out ChIP assays followed by high-throughput sequencing to identify DNA regions bound

by HOP2. Inflorescences of 5 week-old 831 and Ler plants were collected and subjected to ChIP

assays. Purification of the HOP2::3xHA was checked by immunoblot analysis using anti-HA

antibodies (Figure 10). The eluted IP fractions were shipped to TCAG at SickKids for high

through put sequencing and bioinformatic analysis. Bioinformatic analysis of one pairwise

831/Ler ChIP experiment revealed a total of 1076 binding sites (q

30

Figure 10 Purification of HOP2::3xHA protein construct using ChIP. Anti-HA antibodies

recognize the HOP2::3xHA protein construct in the bound fraction following 831 ChIP but not

Ler ChIP. + represents the positive 831 control. Arrow points toward the HOP2::3xHA protein.

Stars represent the heavy and light chains of the protein G-coupled IgGs which co-eluted with

the protein complexes from the beads.

31

Figure 11 Distribution of HOP2 binding peaks on Arabidopsis TAIR10 genome. Black

blocks depict chromosomes. Blue bars depict peaks called by MACS2 (a) Chromosomes 1-5, top

to bottom. Peaks are distributed mainly on chromosomes arms, and are absent from condensed

chromatin regions such as centromeres (red circles). Peaks exhibit low distribution in the vicinity

of NORs (red lines, chromosomes 2 and 4, short arms) (b) Chloroplastic (top) and mitochondrial

(bottom) genomes. No peaks were identified on either organelle genomes.

a

b

32

Figure 12 Validation of HOP2 binding peaks by qPCR. (a) Peak coordinates on the TAIR10

genome and the genes the peaks overlap with. Blue arrows represent a HOP2 binding peak; black

blocks depict genes; red lines depict the approximate region amplified by the primer sets. The

absolute summit is represented by a blue vertical line that runs through the peak. The signal

value for each peak is indicated above the peak (b) The HOP2 locus exhibits a significant

enrichment in HOP2 binding. The rest of the primer sets (except for the TPR1 region) do not

show any significant enrichment in the 831 sample (experimental) over the Ler sample (negative

control). Error bars depict the ± SD (standard deviation).

0

1

2

3

4

5

6

Fold

en

rich

me

nt

Ler

831

a

b

33

3.3.2 HOP2 binding peaks associate with open chromatin features

Arabidopsis thaliana CO hotspots preferentially occur at gene promoters and terminators and

associate with A-rich and CTT/CCN repeat regions (Choi et al., 2013; Shilo et al., 2015). The

HOP2 binding peaks were further classified according to their location on chromosomes; and

the majority of peaks were found to reside in genic regulatory regions such as promoters

(70.12%) and terminators (15.50%), suggesting that HOP2 preferentially binds open chromatin

that is easily accessible (Figure 13). Moreover, using the MEME program, I have identified A-

rich (Figure 14a, E-value=2.8e-065, 100 sites) and two variations of the CTT (Figure 14b, E-

value=6.6e-146, 91 sites; Figure 14c, E-value=1.2e-038, 84 sites) motifs as being enriched in the

HOP2 binding regions, suggesting that HOP2 binding follows the pattern of CO occurrence in

Arabidopsis.

Figure 13 Distribution of HOP2 binding peaks over genomic regions. The majority of the

peaks (70.12%) reside in the promoter regions (includes -1000 bp from TSS) of genes.

Remaining peaks are found in terminator (includes +1000 bp from transcription terminator site

(TTS)) regions (15.50%), intergenic regions (5.14%), exons (4.29%), 5’ UTRs (2.33%), 3’ UTRs

(2.24%), with the lowest percentage found in introns (0.37%).

0

10

20

30

40

50

60

70

80

Promoters Terminators 5' UTR 3' UTR Exons Introns Intergenic Region

% d

istr

ibu

tio

n

34

Figure 14 Motifs enriched at regions bound by HOP2. MEME analysis of top 100 scoring

HOP2 binding peaks identified an enrichment of the A-rich motif and two variations of the CTT

motif.

4 Discussion

4.1 Functionality of the hop2-1/HOP2::3xHA complementation system

To more fully investigate the role of the Arabidopsis thaliana HOP2 gene, we have isolated a

hop2-1 Arabidopsis mutant that is complemented by a HOP2::3xHA gene construct driven by

the HOP2 endogenous promoter. The introduction of the construct into the mutant rescues the

sterility phenotype suggesting that the construct is fully functional and it is sufficient to bypass

the deficiency of HOP2. The hop2-1/HOP2::3xHA complementation system provided a great

opportunity to assess in vivo interactions involving HOP2 in Arabidopsis. Given that the

35

complementation line is indistinguishable from its WT background and that endogenous

expression of the protein construct is observed, the working biological conditions were presumed

as being comparable to the WT organism.

4.2 Analysis of in vivo HOP2-protein interactions

4.2.1 HOP2 interacts with MND1 in vivo

HOP2 interaction with MND1 has been extensively documented by previous studies. In yeast,

HOP2 was shown to co-immunoprecipitate in vivo with MND1 from meiotic extracts (Tsubouchi

& Roeder, 2002). In plants, the interaction of HOP2 with MND1 was demonstrated through Y2H

(Kerzendorfer, 2006) and coupled transcription/translation assays followed by co-IP (Vignard et

al., 2007). In accordance with previous findings, my experiments showed that MND1

precipitated with HOP2::3xHA via co-IP, thus confirming a functional interaction between the

two proteins in vivo. Moreover, while HOP2 was the most abundant protein identified by MS (52

spectra), MND1 was a close second (45 spectra). Previously, Pezza et al., (2006) showed that in

mice, aside from forming a stable complex with MND1, HOP2 forms homodimers and tetramers.

The fact that more HOP2 was identified than MND1 suggests that this may be the case in

Arabidopsis as well. Alternatively, the system is designed to selectively purify HOP2 via the

3xHA tag, and therefore it is more efficient for binding HOP2 rather than MND1.

4.2.2 Weak interaction of HOP2/MND1 with DMC1 and RAD51

Several research groups have shown that HOP2/MND1 interacts with DMC1 and RAD51.

Petukhova et al., (2005) reported that MND1 co-immunoprecipitates with DMC1 from testes

extracts and provided Surface Plasmon Resonance (SPR) evidence that HOP2/MND1 interacts

with DMC1 and RAD51, although with DMC1 to a higher extent. In Arabidopsis, Vignard et al.,

(2007) inferred a functional interaction between HOP2/MND1, DMC1 and RAD51 from in vitro

transcription/translation studies. Unfortunately, in my study, an interaction between

HOP2/MND1, DMC1 and RAD51 was not detected as neither of the two recombinases co-

immunoprecipitated with HOP2::3xHA. Potentially, the set-up of my experiment may not favour

these interactions. Zhao & Sung (2015) showed that the C-termini of both the mammalian HOP2

and MND1 are required for the interaction with DMC1 and RAD51. Moreover, crystal structure

studies in Giardia lamblia showed that the C-terminus of the HOP2/MND1 complex folds unto

36

itself to form a helical bundle that is sufficient for stabilization of DMC1-ssDNA filaments,

hence for its interaction with DMC1 (Kang et al., 2015).Thus, the introduction of the 3xHA tag

at the C-terminus in the construct may have created steric constraints that may have impeded the

interaction of HOP2/MND1 with DMC1 and RAD51. However, such a scenario is not supported

by my data, since the HOP2::3xHA construct is sufficient to rescue the sterility phenotype of the

hop2-1 mutant.

It is possible that the affinity of HOP2/MND1 complex towards DMC1 is weak as suggested by

Kang et al., (2015) which results in short-lived interactions that are difficult to identify by the co-

IP assay. Such an interaction would consist of constant association and dissociation of the

dsDNA bound HOP2/MND1 complex from the DMC1/RAD51 nucleofilament, which in turn

may facilitate the homology search process (Kang et al., 2015). Indeed, several groups

demonstrated that in order to promote D-loop formation by DMC1, HOP2/MND1 must be

incubated with dsDNA prior to the addition of ssDNA and DMC1 (Chen et al., 2004; Enomoto et

al., 2004). Moreover, in both yeast and Arabidopsis, MND1 does not co-localize with DMC1 on

meiotic chromosomes (Tsubouchi & Roeder, 2002; Vignard et al., 2007) raising the possibility

that HOP2/MND1 complex is loaded onto the intact dsDNA while DMC1 is loaded at DSB sites.

If this is the case, the HOP2/MND1 complex could interact with DMC1 only during the process

of homology pairing to initiate strand invasion which would consist of constant homology

sampling between the invading ssDNA and dsDNA promoted by the continuous association and

dissociation of HOP2/MND1 complex from DMC1. This is in agreement with the recent finding

that the HOP2/MND1 interaction with DMC1 is highly dynamic, and the complex undergoes

rapid turnover from the DMC1-ssDNA nucleofilament in comparison to other components of the

presynaptic filament such as DMC1, RAD51, HED1, RAD52 and RAD54 which are more stably

bound to the ssDNA or DMC1/RAD51-ssDNA (Crickard et al., 2018).

4.3 Analysis of in vivo HOP2-chromatin interactions

4.3.1 HOP2 binding generates a broad peak pattern

The interaction of HOP2 with bulk DNA is well-documented. Several research groups

demonstrated that HOP2 has a strong affinity towards DNA mediated by the N-termini of the

HOP2/MND1 complex in a sequence non-specific manner (Kang et al., 2015; Uanschou et al.,

2013; Zhao et al., 2014). Accordingly, my ChIP-seq experiments revealed that HOP2 binding

37

generates broad peaks up to 7 kb in length suggesting non-sequence preference of HOP2. This is

in contrast to binding patterns of transcription factors (TF), which generate sharp peaks

corresponding to targeted binding to DNA (Bailey et al., 2013). Unfortunately, the broadness of

the peaks made the confirmation of the ChIP-seq data by qPCR trickier. Only 2 from the 5 top

scoring peaks show a clear enrichment over the negative control. Interestingly, the most enriched

region as per sequencing and qPCR analysis maps to the HOP2 locus on chromosome 1 (region

4562888:4570568). Since T-DNA insertion was used to introduce the HOP2::3xHA construct

into hop2-1 plants, it is possible that several copies of the T-DNA have inserted in the genome.

Due to the random nature of the insertion, this could create regions of non-homology if only one

chromosome of the homologous pair would be hit (i.e. the T-DNA inserted in the maternal

chromosome at a specific location, but not in the paternal chromosome). Consistent with its

function in homologous pairing, HOP2 may recognize the non-homologous stretch and may stall

in these regions, resulting in more efficient cross linking of HOP2 to this region, thus

precipitating the associated chromatin that is mapped back to the HOP2 locus.

4.3.2 Distribution of HOP2 binding peaks coincides with regions of high recombination rates

In Arabidopsis, recombination rates are higher along the gene rich chromosomal arms and

recombination is inhibited in repetitive regions such as centromeres (Demirci et al., 2018;

Underwood et al., 2018). Surprisingly, heterochromatic pericentromeric regions of Arabidopsis

chromosomes show a higher DSB frequency than expected. These regions contain nucleosome-

depleted transposable elements that contain DSB hotspots (Choi et al., 2018). Bioinformatic

analysis of the ChIP-seq data revealed an enrichment of HOP2 binding sites along the arms of

the 5 chromosomes, consistent with HOP2’s role in facilitating recombination. Correspondingly,

HOP2 peaks are absent from centromeric regions of all chromosomes but a small number of

binding peaks are observed at pericentromeric regions of chromosomes 2,3 and 4, in agreement

with previous findings (Choi et al., 2018)

The short arms of the acrocentric chromosomes 2 and 4 contain NORs which span several

million basepair regions and are directly capped by telomeric repeats (Copenhaver & Pikaard,

1996). HOP2 binding was less prominent in the NORs compared to rest of the chromosomes 2

and 4, suggesting that HOP2 interacts sparsely with the NORs. This supports the observation by

Stronghill et al., (2010) that in the absence of HOP2, NORs are able to undergo extensive

38

homologous alignment, suggesting that these regions do not require HOP2 for proper

homologous pairing and/or that there may exist a second pairing mechanism that does not

depend on HOP2. For example, in species lacking HOP2 such as Drosophila melanogaster and

Caenorhabditis elegans, synapsis between homologous chromosomes happens in a

recombination independent manner (Naranjo, 2012; Pezza et al., 2007). The presence of pairing

centers at one end of each chromosome in C. elegans is required for proper synapsis, while the

synapsis of sex chromosomes (but not autosomes) in D. melanogaster depends on the homology

between a cluster of rDNA found on the X and Y chromosomes (reviewed in Tsai & McKee,

2011). Similarly, the rDNA repeats in the NORs may mediate homologous alignment between

the short arms of chromosomes 2 and 4 in a HOP2 independent manner. Alternatively, due to the

repetitive nature of the DNA in the NORs, recombination may be inhibited in these regions in

order to prevent genomic instability due to non-allelic recombination events resulting in less

HOP2 binding to these regions (Underwood et al., 2018).

4.3.3 Distribution of HOP2 binding peaks follows CO occurrence patterns

In Arabidopsis, the distribution of COs across the genome is regulated by genetic and epigenetic

factors. As is the case with DSB hotspots, CO hotspots are enriched in euchromatic regions of

chromosomes and are suppressed at centromeres (Shilo et al., 2015). At a finer scale,

Arabidopsis COs are concentrated in gene promoters and terminators which are associated with

open chromatin features (Choi & Henderson, 2015). Promoter and terminator regions have A-

rich sequences that make it harder for the DNA to be packaged into nucleosomes, causing LND

regions which are critical for the DNA accessibility by the transcriptional and recombination

machineries (Choi et al., 2013; Field et al., 2008). Concordantly, HOP2 binding is strongest at

gene promoters followed by gene terminators, although to a much lesser extent. Moreover, the

A-rich sequence motif was present in all 100 regions that were used for motif search reinforcing

the fact that HOP2 requires open state chromatin as a binding interface.

In addition to the A-rich sequence, Arabidopsis COs overlap with CTT/CCN motifs which are

found intermittently across the genome, however the motifs that associate with COs are enriched

at TSS and gene bodies, respectively (Choi et al., 2013; Shilo et al., 2015). At the TSS, CO

levels peak over +1 nucleosome which is occupied by the H2A.Z histone which was shown to

mediate recombination as loss of factors that promote H2A.Z deposition, such as the arp6

39

mutant, results in lower recombination rates as shown by decreased DSB formation, RAD51 and

DMC1 foci and thus CO occurrence (Choi et al., 2013). Consequently, H2A.Z levels peak at the

+1 nucleosome and overlap with the CTT motifs and high levels of COs (Choi et al., 2013).

Although the enrichment of the CTT motif was not detected in my analysis (rather a variation of

it), HOP2 binding levels peaked over the TSS (Figure 15) suggesting that HOP2 interaction with

chromatin follows CO occurrence patterns.

Figure 15 Distribution of aggregated peaks around TSS. Each HOP2 peak was binned into

200 bp and classified in accordance to where it resides around the TSS. HOP2 binding levels

peak over the TSS (FeatureStart) and decrease farther into gene bodies. Upstream the TSS,

HOP2 binding levels decrease drastically after -1000 which delineates the promoter region.

As mentioned above, the CO associated CCN motif is found within gene bodies (Shilo et al.,

2015). In mammals, PRDM9 is a zinc finger protein that contains a SET histone

methyltransferase domain (Myers et al., 2010). PRDM9 protein targets CO formation to

degenerate CCN sequences within intergenic regions and introns through deposition of

H3K4me3 modification that reorganizes nucleosomes and drives recombination (Baker et al.,

2014). Indeed, the H3K4me3 modification positively correlates with CO levels in Arabidopsis

(Choi et al., 2013). This suggests that in plants, the sequence specific CO occurrence might have

persisted, despite a lack of the PRDM9 protein. Interestingly, the loss of the PRDM9 protein in

40

mice led to a global remodeling of the recombination landscape, where the CO occurrence

reverted to promoter regions (Brick et al., 2012). This implies that CO occurrence in LND

regions is an ancestral form of recombination, and the PRDM9 protein has evolved as a

secondary mechanism for CO formation.

5 Future directions

In conclusion, I have established protocols suitable for the study of HOP2 interaction with

proteins and chromatin. However, further experimentation is required in order to further the

findings of my study.

The co-IP experiment identified only 52 HOP2 spectra. This raises the possibility that I did not

isolate enough HOP2 in order to capture weaker or rarer interactions. As such, in order to

confirm and expand the initial co-IP results, another co-IP experiment will be performed using a

higher amount of starting material to maximize the amount of HOP2 isolated. If more proteins

are detected, their interactions may be validated by employing Y2H assays and/or BiFC assays.

In addition, the possibility that HOP2 might be directed towards chromatin and histone

modifications on recombination prone chromatin will be examined. Histone modifications could

be identified by employing LC-MS/MS; however, such an assay requires a large amount of

isolated chromatin, and the ChIP assay is limited by minuscule amounts of DNA recovered

following precipitation. As mentioned previously, the H2A.Z histone is responsible for proper

levels of recombination. If this is indeed the case, I speculate that in an arp6 mutant which

exhibits lower levels of H2A.Z deposition on nucleosomes, HOP2 levels are decreased which

could be visualized by immunocytochemistry. Alternatively, I will examine publicly available

chromatin state maps of the DNA sequences where strongest binding signals are observed in

order to identify common chromatin and histone modifications among them