Upload
lamdat
View
216
Download
1
Embed Size (px)
Citation preview
Kavita Bisht,MSc.
Anti-Inflammatory and Cell Signalling Effects of
Biliverdin and Biliverdin Reductase
Heart Foundation Research Centre, School of Medical Science
Griffith University
Submitted in fulfillment of the requirements of the degree of
Doctor of Philosophy
June 2014
Kavita Bisht
MSc.
ii
Despite advances in medical care and research, sepsis still poses a great threat to
the health of society and remains a major cause of mortality and morbidity throughout
the world. The progression of sepsis is driven by inflammatory processes. Stimuli,
including endotoxin, play a crucial role in the initiation of inflammation via their
interaction with molecules associated with the immune system. Among them, toll like
receptors, complement receptor 5 a (C5aR) and cytokines are key factors in both
promoting and aggravating inflammation. Therefore, compounds that can inhibit the
activation of these molecules could represent promising therapies for inflammatory
disorders, including sepsis. Bile pigments, including biliverdin (BV) and unconjugated
bilirubin (UCB) are tetrapyrroles and are derived from haem catabolism. Biliverdin is
rapidly converted to bilirubin by the action of biliverdin reductase (BVR). Although
BV, BVR and UCB induce beneficial effects in animal and cell culture models of injury
and transplantation, the anti-inflammatory potential of these molecules remains poorly
understood, particularly in humans. The main aims of this thesis were to explore the
effects of BV and BVR on cell signalling molecules, C5aR expression, pro- and anti-
inflammatory cytokines, macrophage polarisation and chemotaxis.
In the first study, RAW 264.7 and bone marrow derived macrophages
(BMDMs) were treated with BV in the presence or absence of lipopolysaccharide (LPS;
100 ng/mL) and gene and protein expression of C5aR were assessed. Biliverdin (50
µM) significantly decreased the gene and cell surface expression of C5aR in both
primary and immortalised macrophages (P < 0.05). To reveal the role of
phophatidylinositol 3-kinase (PI3K) and mammalian target of rapamycin (mTOR) in
BV’s effects on C5aR, RAW 264.7 cells were treated with BV in the presence or
absence of LY294002 (LY; PI3K inhibitor) or rapaymycin (mTOR inhibitor).
Biliverdin increased the phosphorylation of Akt and S6 (downstream of mTOR
pathway) in a time-dependent manner, which was inhibited after LY or rapamycin
treatment. The inhibitory effects of BV on C5aR expression were partially blocked by
rapamycin, suggesting that mTOR signalling is required to regulate BV’s effects on
C5aR. Furthermore, BV also decreased the expression of complement-associated pro-
inflammatory cytokines (TNF-α and IL-6) in LPS activated RAW 264.7 macrophages.
Therefore, the inhibitory effect of BV on C5aR expression supports an additional anti-
General Abstract
iii
inflammatory mechanism, which might partially explain BV’s anti-inflammatory and
cytoprotective effects in transplant rejection and endotoxin injury.
The second study attempted to investigate the impact of BVR deletion on
chemotaxis and macrophage phenotype and to explore whether blocking of C5aR would
modulate macrophage phenotype and chemotaxis. Bone marrow derived macrophages
from BVRfl/fl
(control) and CreLyz:BVRfl/fl
(conditional deletion of BVR in myeloid
cells) were treated with or without LPS (100 ng/mL) and IFN-γ (20 ng/mL) in the
presence or absence of neutralising antibody against C5aR (1 µg/mL). Macrophages can
be polarised into two different cell populations in response to endotoxin and cytokines
in vitro. LPS and IFN-γ drive macrophage polarisation towards M1 (classically
activated macrophages that promote inflammation) while IL-4 stimulation results in
development of M2 phenotype (alternatively activated macrophages that resolve
inflammation/assist in wound healing). BMDMs from both mice were also assessed for
chemotaxis and C5aR expression in the presence or absence of complement component
5a (C5a; 100 nM). Macrophages from CreLyz:BVRfl/fl
mice showed significant increase
in basal C5aR gene and protein expression and chemotaxis in response to C5a, which
was partially inhibited by C5aR antibody (P < 0.05). Furthermore, conditional deletion
of BVR promoted macrophage polarisation towards the M1 phenotype by increasing the
gene and protein expression of iNOS and TNF-α release into media (important markers
of M1 activation) after LPS and IFN-γ stimulation, which were partially blocked by
C5aR antibody. Therefore BVR plays a crucial role in regulating chemotaxis in
response to C5a and macrophage polarisation towards the M1 phenotype via modulation
of C5aR expression.
The strong anti-inflammatory and cyprotective potential of BV in in vitro and
murine models prompted the investigation of BV on LPS-induced cytokines and C5aR
gene expression in human blood. In the final study, whole human blood was treated ex
vivo with BV (10 and 50 µM) in the presence or absence of LPS (3 µg/mL). In addition,
serum samples from human subjects and wild type and Gunn rats (animal model of
hyperbilirubinaemia) were also collected to explore the relationship between baseline
circulating bilirubin and cytokines expression/release. Biliverdin at 50 µM significantly
decreased the gene expression of IL-1β, IL-6, IFN-γ, IL-1Ra and IL-8 in LPS stimulated
whole blood (P < 0.05). However, LPS significantly decreased C5aR gene expression
iv
(P < 0.05) and BV alone also tended to decrease C5aR expression (P = 0.08).
Furthermore, BV significantly reduced LPS-mediated release of IL-1β and IL-8 by
human leukocytes (P < 0.05). However, increasing baseline concentration of UCB (in
the absence of BV treatment) was significantly and positively associated with LPS-
mediated gene expression of IL- (R = 0.929), IFN- (R = 0.809), IL-1Ra (R = 0.786)
and IL-8 (R = 0.857; all P < 0.05). In addition, serum samples from naive Gunn rats had
significantly increased IL-1β concentrations (P < 0.05) compared to wild-type controls.
Furthermore, a positive and significant relationship existed between UCB
concentrations and IL-1β (R = 0.488 and P = 0.01) in Gunn rats. The inhibitory effects
of BV on the ex vivo response of human blood to LPS further support the anti-
inflammatory capacity of BV in a ‘first in human’ pre-clinical model of inflammation,
suggesting that BV could represent a promising target in the treatment of human septic
shock.
Key words: Sepsis, inflammation, bile pigment, BVR, C5aR, IL-1β, IL-8, macrophage
polarisation, chemotaxis.
v
This thesis describes original work conducted within the School of Medical Science
at the Griffith University, Australia from August 2010 to May 2014 and within the Beth
Israel Deaconess Medical Centre at Harvard Medical School (Boston, USA) from
February 2013 to October 2013. This thesis is to best of my knowledge and belief,
original and my own work and not written by another person where due reference is
made in the thesis itself. This work has not been previously submitted, in whole or part,
for any other degree at this or any other University.
I acknowledge that an electronic copy of my thesis must be lodged with the
Griffith University library and immediately made available for research and study.
Kavita Bisht
Statement of Originality
vi
Anti-Inflammatory and Cell Signalling Effects of Biliverdin and Biliverdin
Reductase .......................................................................................................................... i General Abstract ......................................................................................................... ii
Statement of Originality ............................................................................................. v
Table of Contents ...................................................................................................... vi
List of Figures ............................................................................................................ ix
List of Tables ............................................................................................................ xv
List of Abbreviations ............................................................................................... xvi
Acknowledgments .................................................................................................... xx
Statement of Contribution to Jointly Published Work............................................ xxii
Publications by the Candidate Contained in the Thesis ....................................... xxvii
Additional Publications by the Candidate During Ph.D. Candidature not Included in
the Thesis ............................................................................................................. xxviii
Conference Presentations by the Candidate During Ph.D. Candidature ............... xxix
Awards/Scholarship during Ph.D. Candidature ..................................................... xxxi
Chapter 1: Introduction ................................................................................................. 1 1.1 Thesis organisation ............................................................................................... 2
1.2 Haem catabolism: an evolutionary perspective .................................................... 2
1.3 Aims and Hypotheses ........................................................................................... 4
1.4 Results and summaries ...................................................................................... 6
1.4.1 In vitro study ................................................................................................. 6
1.4.2 In vivo study .................................................................................................. 6
1.4.3 Ex vivo study ................................................................................................. 7
Chapter 2: Literature Review ....................................................................................... 8 2.1 Immune responses to pathogens ........................................................................... 9
2.2 Inflammation ...................................................................................................... 10
2.3 Inflammatory cells .............................................................................................. 11
2.3.1 Neutrophils ................................................................................................... 11
2.3.2 Macrophages ............................................................................................... 15
2.3.3 Endothelial cells .......................................................................................... 16
2.4 Nuclear factor kappa B in inflammation ............................................................ 19
2.4 Nitric oxide and nitric oxide synthase in inflammation ..................................... 21
2.5 Toll like receptors in inflammation .................................................................... 23
2.6 Complement in inflammation ............................................................................. 25
2.6.1 Anaphylatoxin and their receptors .............................................................. 27
2.7 Role of cytokines in inflammation ..................................................................... 29
2.7.1 Tumour Necrosis Factor-α .......................................................................... 30
2.7.2 Interleukin-1 ................................................................................................. 31
2.7.3 Interleukin-6 ................................................................................................. 32
2.7.4 Interleukin-10 ............................................................................................... 32
2.8 Role of haem oxygenase and haem catabolism in inflammation ....................... 33
2.8.1 Carbon monoxide ......................................................................................... 36
2.8.2 Biliverdin and unconjugated bilirubin ......................................................... 38
Table of Contents
vii
2.8.3 Ferritin ......................................................................................................... 49
2.9 Biliverdin reductase ............................................................................................ 50
2.9.1 Structure of BVR .......................................................................................... 50
2.9.2 Functions of BVR ......................................................................................... 53
2.10 Phosphatidylinositol 3-kinase and inflammation ............................................. 57
2.11 Sepsis and inflammation ................................................................................... 60
Chapter 3 Biliverdin modulates the expression of C5aR in response to endotoxin in
part via mTOR signalling ............................................................................................ 64 3.1 Abstract ............................................................................................................... 65
3.2 Introduction ........................................................................................................ 66
3.3 Material and methods ......................................................................................... 67
3.3.1 Cell Culture and Treatment ......................................................................... 67
3.3.2 Isolation of Bone Marrow-Derived Macrophages ....................................... 67
3.3.3 RNA Extraction and qRT-PCR .................................................................... 68
3.3.4 qRT-PCR Calculation using Genorm Analysis ............................................ 68
3.3.5 Sources of Antibodies ................................................................................... 69
3.3.6 Flow Cytometry ............................................................................................ 69
3.3.7 Western Blot ................................................................................................. 69
3.3.8 ELISA Analysis ............................................................................................ 70
3.3.9 Statistical Analysis ....................................................................................... 70
3.4 Results ................................................................................................................ 71
3.4.1 Biliverdin inhibits the expression of C5aR in murine macrophages ........... 71
3.4.2 Biliverdin induces the phosphorylation of Akt and S6 and inhibits C5aR
expression in macrophages in part via mTOR signalling ........................................... 74
3.4.3 Biliverdin suppresses the release and expression of complement-associated
pro-inflammatory cytokines ........................................................................................ 76
3.5 Discussion ........................................................................................................... 78
Chapter 4 Conditional deletion of biliverdin reductase in myeloid cells promotes
chemotaxis by C5a dependent mechanism ................................................................. 81 4.1 Abstract ............................................................................................................... 82
4.2 Introduction ........................................................................................................ 83
4.3 Material and methods ......................................................................................... 85
4.3.1 Generation of BVRfl/fl
mice ........................................................................... 85
4.3.2 Stable transfection of RAW 264.7 cells with mir-bvr shRNA ..................... 85
4.3.3 Isolation of bone marrow-derived macrophages ......................................... 86
4.3.4 Source of antibodies ..................................................................................... 86
4.3.5 Animal treatment .......................................................................................... 87
4.3.5 RNA extraction and reverse transcriptase quantitative PCR ...................... 87
4.3.6 Flow cytometry analysis of CD88 ................................................................ 88
4.3.7 Immunohistochemistry ................................................................................. 88
4.3.8 Cell migration assay .................................................................................... 88
4.3.9 Immunoblotting ............................................................................................ 89
4.3.10 ELISA analysis ........................................................................................... 89
4.3.11 Statistical analysis ..................................................................................... 89
4.4 Results ................................................................................................................ 90
4.4.1 BVR deletion in CreLyZ:BVRfl/fl
mice .......................................................... 90
4.4.2 Conditional deletion of BVR in BMDM promotes C5aR expression both in
vitro and in vivo .......................................................................................................... 91
viii
4.4.3 Deletion of BVR induces migration of BMDMs towards C5a in part via
C5aR ........................................................................................................................... 97
4.4.4 Peritoneal cells from CreLyz:BVRfl/fl
show increase expression of C5aR and
influx of monocytes after in vivo LPS administration ............................................... 101
4.4.5 BMDM from CreLyz:BVRfl/fl
mice show M1 phenotype ............................ 102
4.5 Discussion ......................................................................................................... 106
Chapter 5 Endogenous tetrapyrroles influence leukocyte responses to
lipopolysaccharide in human blood: pre-clinical evidence demonstrating the anti-
inflammatory potential of biliverdin ........................................................................ 110 5.1 Abstract ............................................................................................................. 111
5.2 Introduction ...................................................................................................... 112
5.3 Material and methods ....................................................................................... 114
5.3.1 Human blood sample collection and ex vivo incubation with LPS and BV 114
5.3.2 Animal experiments .................................................................................... 115
5.3.3 RNA extraction and qRT-PCR ................................................................... 115
5.3.4 Cytokine analysis ....................................................................................... 117
5.3.5 Cell count, haem and bilirubin analysis .................................................... 117
5.3.6 Statistical analysis ..................................................................................... 117
5.4 Results .............................................................................................................. 118
5.4.1 Clinical parameters, haem and UCB concentration ................................. 118
5.4.2 Biliverdin and cytokine expression ............................................................ 119
5.4.3 Association between baseline UCB concentration and cytokine expression
.................................................................................................................................. 133
5.4.4 Unconjugated bilirubin, biliverdin and chemokine IL-8 expression ......... 140
5.4.5 Biliverdin and C5aR expression ................................................................ 143
5.5 Discussion ......................................................................................................... 145
Chapter 6 Thesis Summary and Conclusion ............................................................ 155 6.1 Introduction ...................................................................................................... 156
6.2 Project summary ............................................................................................... 156
6.3 Future research ................................................................................................. 159
6.4 Concluding remarks .......................................................................................... 161
Chapter 7 References ................................................................................................. 162
ix
Figure 2.1: Elimination of microorgansims by neutrophils. Neutrophils destroy
pathogens via three major pathways including engulfment of the pathogen
(phagocytosis), degranulation or production of NETs. Sourced from Nature
Publishing Group [43]. ............................................................................................ 14
Figure 2.2: Monocytes differentiate to macrophages under the influence of M-CSF/GM-
CSF. Macrophages are polarised in vitro by IFN-/LPS or IL-4/IL-13 into M1 or
M2 cells. M1 macrophages are considered pro-inflammatory and express TLRs,
complement receptors in addition to promoting the release of cytokines and
chemokines. M2 macrophages are considered anti-inflammatory and express anti-
inflammatory cytokines, nuclear receptors and prostaglandins. ............................. 16
Figure 2.3: Leukocytes and endothelium interaction. Leukocytes interact with ECs in
response to stimulation, which increases the expression of selectins on both
leukocytes and ECs. Leukocytes then attach to ECs firmly via integrin binding to
CAMs (VCAM-1/ICAM-1) and then migrate into tissues. In addition, cytokines,
chemokines and growth factors released by macrophages also activate endothelium.
................................................................................................................................. 19
Figure 2.4: Activation and translocation of NF-B from cytoplasm to nucleus, triggered
by phosphorylation of IkB in response to NF-B activating stimuli. Modified from
Abraham et al. and sourced from Oxford University Press [93]. ........................... 21
Figure 2.5: Important functions of the three isoforms of nitric oxide synthase (NOS).
Adapted from Forstermann et al. and sourced from Oxford University Press [94].
................................................................................................................................. 23
Figure 2.6: Toll like receptors, their ligands and signalling pathways. .......................... 25
Figure 2.7: Complement activation pathways. Complement is activated by classical,
lectin, alternative and extrinsic pathways. Each pathway generates small
anaphylatoxins called C3a, C5a and opsonins, including C3b and C5b. C5b
interacts with other complement components, leading to the formation of the
membrane attack complex (MAC). ......................................................................... 27
Figure 2.8: Role of cytokines in inflammation. Cytokines produced by macrophages,
including TNF-, IL-1, IL-6 and IL-8 are potent inducers of inflammation and also
promote the differentiation of naive Th0 cells into Th1 and Th2 cells. They also
activate ECs and SMCs. On the other hand, the anti-inflammatory cytokines IL-10
and TGF-β are produced by macrophages and promote Treg cell differentiation;
adapted from Ait-Outfella et al. and sourced from American Heart Association, Inc.
[124]. ....................................................................................................................... 30
List of Figures
x
Figure 2.9: Possible mechanisms contributing to the protective effects of haem
oxygenase-1. Haem is catabolised to BV, CO and Fe2+
by HO-1. Biliverdin is
rapidly reduced to UCB. Haem oxygenase-1 via BV and CO protects IRI-mediated
injury by inhibiting the expression of inducible nitric oxide synthase (iNOS),
cyclooxygenase (COX) and NADPH oxidase activity. Both CO and BV also inhibit
IRI-mediated expression of IL-6, IL-1β and ICAM-1. Adapted from Li Volti et al.
and sourced from S. Karger AG, Basel [153]. ........................................................ 36
Figure 2.10: Haem catabolism. Haem is oxidised by HO and produce two intermediate
compounds: α-meso-hydroxyhaem and verdohaem. These intermediates are then
metabolised to produce CO, BV and iron. Adapted from Montellano et al. and
sourced from Elsevier [147]. ................................................................................... 40
Figure 2.11: Formation of BR. BV IXα is reduced to BR IXα in the presence of BVR.
Adapted from Zhu et al. and sourced from John Wiley and Sons [199]. ............... 41
Figure 2.12: The cytoprotective and anti-inflammatory effects of BV and BR against
various disease models. Adapted from Wegiel et al. and sourced from Frontiers
[34]. ......................................................................................................................... 42
Figure 2.13: Structure of hBVR (human biliverdin reductase). hBVR contains one N-
terminal domain, which includes the sequences, required for catalytic function and
is also called the reduction domain. This domain catalyses the reduction of BV to
BR. The C-terminal domain contains the sequences crucial for kinase/cell
signalling activity of BVR, containing six residues with Zn-binding domains;
adapted from Gibbs et al. and sourced from Frontiers [262]. ................................. 52
Figure 2.14: Signalling cascade initiated by BVR in response to extracellular stimuli
and their role in induction of gene expression. BVR is a modulator of protein
kinase C and in response to oxidative stress it modulates two main branches of
insulin/insulin growth factor (IGF-1): MAPK (ERK1/2, JNK and p38) and PI3K
(PDK1/2, mTOR, PKB). Both MAPK and PI3K are crucial for stress-induced
transcription factor activation (c-Jun, c-Fos, ATF-2 and NF-κB). ......................... 56
Figure 2.15: PI3K and downstream kinases. GPCRs and TLRs present on immune cells
activate PI3K, which then phosphorylates phosphatidylinositol-4,5-bisphosphate
(Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns (3,4,5)P3),
leading activation of Akt. Akt activates mTOR, which regulates protein synthesis
by phosphorylating p70S6 kinase to S6 and inhibits initiation factor 4EBP-1. ...... 60
Figure 3.1: Biliverdin reduces C5aR expression and the effects were independent of
PI3K/Akt signaling. (A) Gene expression and (B) cell surface expression of C5aR
in RAW 264.7 cells, treated with BV (10 μM) ± LPS (100 ng/mL) for 24 h. (C and
D) Protein expression of pAkt and Akt in RAW 264.7 cells, pre-incubated with or
without LY prior to BV (50 μM) and LPS treatment. (E) Gene and (F) protein
expression of C5aR in RAW 264.7 cells, pre-incubated with LY and thereafter
treated with LPS or BV (50 μM) for 24 h. The data are representative of two
independent experiments. Value represents mean ± S.E., n=3/group. *P < 0.05
versus non LPS control (0.01% DMSO), &P < 0.05 versus LPS control and #P <
0.05 versus no LY LPS control. .............................................................................. 72
xi
Figure 3.2: Biliverdin inhibits C5aR expression. RAW M were treated BV (50 M) ±
LPS for 24 h. (A) Gene and (B) cell surface expression of C5aR in RAW M. (C)
Cell surface expression of C5aR in BMDM M treated with BV and LPS for 24
and 48 h. Data are representatives of three independent experiments. Value
represents mean ± S.E. n=3/group, *P < 0.05 vs. non LPS control (0.01 % DMSO)
at 24 h and 48 h and &
P < 0.05 vs. LPS control at 24 and 48 h. ............................. 73
Figure 3.3: Biliverdin enhances phosphorylation of Akt and S6. RAW 264.7 M were
treated with BV and LPS for different time points and protein expression of pAkt,
Akt (A and B) and pS6 (C and D) were analysed. Blots are representative of at least
two independent experiments. ................................................................................. 75
Figure 3.4: Biliverdin modulates C5aR expression in part via mTOR signalling. RAW
264.7 M were pre-incubated with rapamycin for 1 h and thereafter treated with
BV or LPS for 15 min or 24 h for pS6 and C5aR expression, respectively. (A)
Protein expression of pS6 and (B) cell surface expression of C5aR in RAW 264.7
cells. The data are representative of three independent experiments. Value
represents mean ± S.E. n=3/group, #P < 0.05 vs. no rapamycin control (0.01 %
DMSO), *P < 0.05 vs. no rapamycin and no LPS control (0.01 % DMSO), &
P <
0.05 vs. no rapamycin and LPS control and &#
P < 0.05 vs. no rapamycin BV + LPS
group. ...................................................................................................................... 76
Figure 3.5: Biliverdin attenuates complement associated pro-inflammatory cytokines.
mRNA expression of TNF- (A) and IL-6 (B) and protein concentration of TNF-
(C) and IL-6 (D) were analysed in RAW 264.7 macrophages, incubated with
BV±LPS for 24 h. The data are representative of two independent experiments.
Value represents mean ± S.E. n=3/group, *P < 0.05 vs. no LPS control (0.01 %
DMSO) and &
P < 0.05 vs. LPS control. .................................................................. 77
Figure 4.1: Deletion of BVR in BMDM from CreLyz:BVR
fl/fl. A) Plan of crossing of
BVRfl/fl
mice to CreLyz mice. The deletion of BVR in BMDMs was confirmed by
qPCR (B) and western blot (C). Results represent mean ± S.E. of three independent
experiments (n=3-5/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
. ......................... 91
Figure 4.2: Lack of BVR augments C5aR expression. RAW 264.7 cells were stably
transfected with shRNA against BVR (mir BVR) or shRNA control (mir C). Gene
(A) and protein expression (B) of BVR were analysed using qPCR and western
blot, respectively. Results are expressed as mean ± S.E. of three independent
experiments (n = 3/group (A)) *P < 0.05 vs mir C. Blots are representative of two
independent experiments (B). Gene expression (C) and cell surface expression (D)
of C5aR (CD88) were measured by qPCR and flow cytometry, respectively. The
data are representative of three independent experiments (n = 3/group). *P < 0.05
vs mir C. .................................................................................................................. 92
Figure 4.3: Increased gene and cell surface expression of C5aR in mice lacking BVR in
myeloid cells. A) C5aR (CD88) cell surface expression in differentiated BMDMs at
day 0-5 from C57BL/6 mice was measured by flow cytometry. Gene expression of
C5aR was analysed using qPCR (B) and the surface expression was assessed by
flow cytometry (C) in BMDMs from BVRfl/fl
and CreLyz:BVRfl/fl
. Results are
representative of three independent experiments (n=3/group). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. ....................................................................................... 94
xii
Figure 4.4: Increased protein expression of C5aR in organs isolated from mice lacking
BVR in myeloid cells. Liver, lung and spleen were harvested from BVRfl/fl
and
CreLyz:BVRfl/fl
mice and CD88 expression was analysed by immunohistochemistry.
Representative images are shown in A. Images were taken at 100X magnification
and quantitative analysis for CD88 positive cells in multiple fields of view is
shown in B. Results represent mean ± S.E. of four mice per group. *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. ....................................................................................... 96
Figure 4.5: BMDM from CreLyz:BVR
fl/fl are characterisd by increased chemotaxis
towards C5a. Representative images (A) and absorbance at 562 nM of BMDM
supernatant (B) from BVRfl/fl
and CreLyz:BVRfl/fl
mice that migrated through to the
lower chamber of transwell chambers in response to C5a after 24 h of culture in
serum free media. Results are presented as mean ± S.E. of three independent
experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
. C) BMDM from
BVRfl/fl
and CreLyz:BVRfl/fl
mice incubated with anti-mouse IgG or C5aR for 30 min
and cell surface expression of C5aR was analysed by flow cytometry. Results are
representative of three independent experiments (n = 3/group). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. ....................................................................................... 98
Figure 4.6: C5a mediated chemotaxis in CreLyz:BVR
fl/fl BMDMs is mediated by C5aR.
Representative images (A) and absorbance of BMDM supernatant (B) from BVRfl/fl
and CreLyz:BVRfl/fl
mice that migrated through to the lower chamber of the
transwell chamber in response to C5a after 24 h incubation in the presence or
absence of anti-mouse IgG or anti-mouse C5aR. Data are expressed mean ± S.E. of
three independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
and #P < 0.05 CreLyz:BVRfl/fl
anti-mouse C5aR vs CreLyz:BVRfl/fl
anti-mouse IgG.
............................................................................................................................... 100
Figure 4.7: Lack of BVR promotes C5aR expression and peritoneal monocyte
infiltration in CreLyz:BVRfl/fl
in response to LPS. Perionteal cells were isolated
from LPS injected BVRfl/fl
and CreLyz:BVRfl/fl
mice. Cell surface expression of
C5aR (A) and influx of granulocytes and monocytes (B) were analysed by flow
cytometry. Results are expressed as mean ± S.E. of three mice in each group. *P <
0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
. ............................................................................. 102
Figure 4.8: Induction of iNOS expression in M1 polarised BMDMs from
CreLyz:BVRfl/fl
is partially mediated by C5aR. BMDMs were incubated in the
presence or absence of LPS/IFN-γ for 24 and 72 h. Gene expression (A) was
assessed at 24 h and protein expression (B) was analysed at 72 h. Data are
representative of three independent experiments (n = 3/group (A)). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. Blots are representative of at least two independent
experiments (B). BMDMs were incubated with anti-mouse IgG or anti-mouse
C5aR prior to LPS/IFN-γ stimulation, and gene expression (C) and protein
expression (D) were assessed after 24 and 72 h, respectively. Results represent
mean ± S.E. of three independent experiments (n = 3/group (C)). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
and # P < 0.05 CreLyz:BVRfl/fl
anti-mouse C5aR vs
CreLyz:BVRfl/fl
anti-mouse IgG. Blots are representative of at least two independent
experiments (D). .................................................................................................... 103
xiii
Figure 4.9: Macrophages lacking BVR express increased levels of TNF-α. A) ELISA
was applied to measure TNF-α levels in the supernatant of cultured BMDMs from
BVRfl/fl
and CreLyz:BVRfl/fl
mice incubated with ± LPS/IFN-γ for 24 h. Data are
representative of three independent experiments (n = 3/group). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. B) TNF-α levels in supernatant from BMDMs pre-
incubated with anti-mouse IgG or anti-mouse C5aR prior to M1 polarisation for 24
h were measured by ELISA. Data are representative of three independent
experiments (n = 3/group. *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
and # P < 0.05
CreLyz:BVRfl/fl
anti-mouse C5aR vs CreLyz:BVRfl/fl
anti-mouse IgG.................. 105
Figure 5.1: Cytokine expression in each individual in response to LPS. The whole blood
of each subject was incubated with LPS (3 g/mL) for 4 h. The fold change of each
cytokine (A-F) was analysed using 2- ∆∆ C
T method. Data are presented as mean ±
S.E. ........................................................................................................................ 121
Figure 5.2: Cytokine gene expression in response to BV. The whole blood was
incubated with BV at different concentrations for 4 h and the mRNA expression
was assessed. The fold change of each cytokine (A-F) was analysed using 2- ∆∆ C
T
method. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with
control only (0 µM BV). ....................................................................................... 123
Figure 5.3: Cytokine gene expression in response to LPS and BV. The whole blood was
incubated with BV and LPS for 4 h and the mRNA expression was assessed. The
relative fold change of each cytokine (A-F) was analysed using 2- ∆∆ C
T method.
Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with LPS only
(0 µM). .................................................................................................................. 125
Figure 5.4: Cytokine protein concentration in each individual in response to LPS. The
whole blood of each subject was incubated with LPS (3 g/mL) for 8 h.
Concentration of each cytokine (A-F) was analysed using Milliplex human
cytokine kit. Data are presented as mean ± S.E (0 µM). ....................................... 128
Figure 5.5: Cytokine protein concentration in response to BV. The whole blood was
incubated with BV at different concentrations for 8 h. Concentration of each
cytokine (A-F) was analysed using Milliplex human cytokine kit. Data are
presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0 µM
BV). ....................................................................................................................... 130
Figure 5.6: Cytokine concentration in response to LPS and BV. The whole blood was
incubated with BV and LPS for 8 h and cytokine concentration was measured using
a Milliplex human cytokine kit. The relative change in each cytokine (A-F)
concentration is presented. Data are presented as mean ± S.E. n=7, P < 0.05 vs
sample treated with LPS only (0 µM). .................................................................. 132
Figure 5.7: UCB concentration and cytokine gene expression in response to LPS. Whole
blood was incubated with BV and LPS for 4 h and mRNA expression was assessed.
Figure shows the scatter plots and the correlation between baseline UCB
concentration and cytokine gene expression (A-F), n = 7. ................................... 135
xiv
Figure 5.8: UCB concentration and cytokine concentration in response to LPS. Whole
blood was incubated with BV and LPS for 8 h and plasma cytokine concentration
was measured using a Milliplex human cytokine kit. Figure shows scatter plots and
the correlation between baseline UCB concentration and plasma cytokine
concentrations (A-F), n=7. .................................................................................... 137
Figure 5.9: IL-1β concentration in blood samples of wild type control and Gunn rats. A.
Graph showing the body weight of Wistar (n=10) and Gunn rats (n=17). Data are
presented as mean ± S.E; P <0.05 vs control (non-jaundiced Wister rats). Box plot
showing the serum UCB concentration (B) and IL-1β concentration in Wistar and
Gunn rats (C). Data are presented as median (25-75% interquartile range); n=10 for
Wister and n =17 for Gunn rats and P <0.05 vs control (non-jaundiced Wister rats).
D. Scatter plot and the correlation between baseline UCB concentration and IL-1β
concentration; n=10 for Wister and n =17 for Gunn rats. ..................................... 139
Figure 5.10: IL-8 gene and protein expression in response to BV. IL-8 gene (A) and
protein (B) expression was analysed using 2- ∆∆ C
T method and ELISA kit,
respectively. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated
with control only (0 µM BV). ............................................................................... 141
Figure 5.11: IL-8 concentration in response to LPS and BV. IL-8 gene and protein
concentration was analysed using qPCR and high sensitivity ELISA kit,
respectively in blood samples incubated with BV and LPS for 4 or 8 h. IL-8 gene
(A) and protein (B) expression in response to BV + LPS. Data are presented as
mean ± S.E. n=7 and P < 0.05 vs sample treated with LPS only (0 µM). Scatter plot
showing the correlation between baseline UCB concentration and IL-8 gene (C)
and protein expression (D) in response to LPS, n=7. ............................................ 142
Figure 5.12: C5aR gene expression in response to BV±LPS. Gene expression of C5aR
was analysed using 2- ∆∆ C
T method (A and B). Data are presented as median (25-
75% interquartile range). n=7, *P < 0.05 vs control (C). .................................... 144
Figure 5.13: Possible mechanism of BV and UCB-triggered immune-modulatory
effects. Haem is catabolised into BV, iron (Fe++
) and carbon monoxide (CO) via
the action of haem oxygenase (HO). Biliverdin is rapidly reduced to UCB in the
presence of BVR. Pro-inflammatory mediators and endotoxin activate NF-B
p60/p65 dimer and promote its translocation to the nucleus, where it induces the
transcription and translation of pro-inflammatory genes. Biliverdin inhibits the
expression of pro-inflammatory mediators via inhibition of NF-B activation.
However UCB, similar to dioxins, may promote translocation of AhR from the
cytoplasm and binding to xenobiotics/dioxin responsive elements, which results in
activation of AhR. Activated form of AhR then leads to increase expression of
cytokines (TNF- and IL-1). .............................................................................. 152
xv
Table 3.1. Primer sequences and amplicon sizes of housekeeping (GAPDH and HPRT)
and target genes (C5aR, TNF-α and IL-6) expressed in RAW 264.7 cells. ............ 68
Table: 4.1 Primer sequences and amplicon sizes of housekeeping (β-actin) and target
genes (C5aR, BVR and iNOS) expressed in mouse BMDM cells.......................... 87
Table 5.1: Primer sequences and amplicon sizes of housekeeping (HPRT) and target
genes (IL-1β, IL-6, TNF-, IFN-γ, IL-1Ra IL-10, and C5aR) expressed in humans.
............................................................................................................................... 116
Table 5.2: Clinical characteristics of recruited subjects at baseline (n=7) ................... 118
Note: BMI (bone marrow index), WBC (white blood cell), RBC (red blood cell), HGB
(total haemoglobin), NE (neutrophil), LYM (lymphocyte), MO (monocytes), EO
(eosinophil), BA (basophil). .................................................................................. 118
Table 5.3: Unconjugated bilirubin (UCB) and haem concentrations in subjects after 0
(baseline), 4 and 8 h incubation with BV ± LPS (N=7/group). ............................ 119
Note: The effect of BV and haemolysis on haem and UCB concentration was performed
by repeated measures ANOVA. *P < 0.05 vs. baseline UCB or haem
concentrations and #P <0.05 vs. haem concentrations at 4 h. ............................... 119
List of Tables
xvi
ABCC2: ATP-binding cassette subfamily C member 2
Akt: Protein kinase B
APC: Antigen presenting cell
aPC: Activated protein C
ANOVA: Analysis of variance
AP-1: Activator protein-1
ARE: Antioxidant responsive element
ATF-2: Activated transcription factor-2
ATP: Adenosine triphosphate
BR: Bilirubin
BRT: Bilirubin ditaurate
BMDM: Bone marrow derived macrophage
BV: Biliverdin
BVR: Biliverdin reductase
CAM: Cell adhesion molecules
C3aR: Complement receptor 3a
C5aR (CD88): Complement receptor 5a
CB: Conjugated bilirubin
cGMP: Cyclic guanosine 3′,5′-monophosphate
CLP: Caecal ligation and puncture
cMyc: Myelocytomatosis viral oncogene
CO: Carbon monoxide
CoPPIX: Cobalt 7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-
dipropanoic acid
COX: Cyclooxygenase
DAF: Decay accelerating factor
DAMP: Damage associated molecular pattern
DC: Dendritic cell
DPBS: Dulbecco’s phosphate-buffered saline
DMSO: Dimethylsuphoxide
EAE: Experimental autoimmune encephalomyelitis
EC: Endothelial cell
List of Abbreviations
xvii
EDTA: Ethylenediaminetetra-acetic acid
ELISA: Enzyme-linked immunosorbent assay
ERK: Extracellular signal regulated kinase
eNOS: Endothelial nitric oxide synthase
FACS: Fluorescence-activated cell sorting
Foxp3: Forkhead box P3
FRAP: Ferric Reducing Ability of Plasma
GAPDH: Glyceraldehyde 3-phosphate dehydrogenase
GPCR: G-protein coupled receptor
G-CSF: Granulocyte colony stimulating factor
GM-CSF: Granulocyte-macrophage colony stimulating factor
GS: Gilbert’s syndrome
H2O2: Hydrogen peroxide
HO: Haem oxygenase
HOCl: Hypochlorous acid
HPLC: High-performance liquid chromatography
HPRT: Hypoxanthine-guanine phosphoribosyltransferase
HRP: Horseradish peroxidase
HSP: Heat shock protein
JNK: c-Jun N-terminal kinase
LDL: Low-density lipoprotein
LPS: Lipopolysaccharide
LTA: Lipoteichoic acid
LY294002: 2-(4-morpholinyl)-8-phenyl-chromone
ICAM: Intercellular cell adhesion molecule
IFN-γ: Interferon gamma
IL: Interleukin
IL-1Ra: interleukin receptor antagonist
IκB: Inhibitor of kappa B
IKK: IκB kinase
iNOS: inducible nitric oxide synthase
IGF: Insulin growth factor
IRI: Ischaemia-reperfusion injury
IRS: Insulin receptor substrate
xviii
PI3K: Phosphatidylinositol 3-kinase
MAPK: Mitogen activated kinase
M-CSF: Macrophage colony-stimulating factor
MCP-1: Monocyte chemoattractant protein-1
MDA: Malondialdehyde
MIP: Macrophage inflammatory protein
MMP: Matrix metalloproteinase
MHC: Major histocampatibility complex
MPO: Myeloperoxidase
MRP-2: Multrdrug resistant-related protein-2
mTOR: Mammalian target of rapamycin
NADH: Nicotinamide adenine dinucleotide
NADPH: Nicotinamide adenine dinucleotide phosphate
NET: Neutrophil extracellular trap
NF-κB: Nuclear factor kappa B
NO: Nitric oxide
nNOS: neuronal nitric oxide synthase
Nrf2: Nuclear factor-erythroid2 related factor
Ox-LDL: Oxidised LDL
PBMC: Peripheral blood mononuclear cell
PMN: Polymorphonuclear leukocytes
PRR: Pattern recognition receptor
qRT-PCR: Quantitative real-time quantitative polymerase chain reaction
RANTES: Regulated on activation normal T-cell expressed and secreted
RNS: Reactive nitrogen species
ROS: Reactive oxygen species
RPMI: Roswell Park Memorial Institute
siRNA: Small interfering RNA
SMC: Smooth muscle cell
SOD: Superoxide dismutase
StRE: Stress-responsive element
STZ: Streptozotocin
TCDD: 2,3,7,8-tetrachlorodibenzo-p-dioxin
TIR: Toll/interleukin-1 receptor
xix
TLR: Toll like receptorTGF-β: Transforming growth factor-beta
TNF-α: Tumour necrosis factor-alpha
TNF-α-R: Tumour necrosis factor-alpha receptor
TRAIL-R: Tumour necrosis factor-alpha related apoptosis-inducing ligand
Treg: Regulatory T-cells
TRIF: Toll receptor associated activator of interferon
VCAM: Vascular cell adhesion molecule
VSMC: Vascular smooth muscle cell
UCB: Unconjugated bilirubin
UGT1A1: Uridine diphosphate glucuronosyltransferase
XRE: Xenobiotic responsive element
xx
My first and sincere appreciation goes to the excellence guidance of my
principal supervisor Dr Andrew C. Bulmer, for all I have learned from him and for his
continuous help, support and encouragement throughout my PhD. Thanks for being an
open person to ideas and helping me shape my ideas and interests. Thanks, also for
supporting my scholarship applications and all the recommendations that helped me get
tuition fee relief and living allowances. Without a financial support, I would not be able
to pursue my PhD. I am deeply indebted to you for trusting my abilities and giving me
the golden opportunity to visit and complete my research projects in A/Prof Leo E.
Otterbein’s and Dr Barbara Wegiel’s lab in Beth Israel Deaconess Medical Centre at
Harvard Medical School (Boston, USA). I would also like to thank my secondary
supervisor Prof John P. Headrick for reviewing this thesis and the advice he has
provided for my thesis. I am very grateful to my external supervisor Dr Barbara Wegiel
for sharing her knowledge and ideas with me and explaining Molecular Biology and
Immunology to me. Thanks, for making my stay at Boston enjoyable and without her I
would not have become so enthusiastic about science. Thanks for your motivation, time
and friendship, which has been invaluable on both academic and personal level, for
which I am very grateful. I am also very thankful to Dr Jens Tampe, Prof Leo E.
Otterbein and Prof Karl Heinz for their guidance and suggestions that helped me finish
my research projects.
I would also like to acknowledge Austrian Science Fund (P21162-K.-H.W. and
A.B.), Julie Henry Fund, Eleanor Shore Foundation and NIH (HL-071797 and HL-
07616) and AHA (10SDG2640091) grants for providing financial contribution for this
thesis, without which this work would not have existed. I am very grateful to Griffith
University for providing me with a scholarship to pursue my study. I am also very
thankful to fellow lab members and postgraduate students; I met in Australia and
Boston. Special thanks to my friends: Connie Boon, Mailin Li and Amanda Galenkamp
for their friendship. We had lots of fun times and you helped me get through all the
struggles and frustrations I had in my PhD with your affection and friendship. I would
also like to thank Mrs Eva Csizmadia of Boston lab for teaching me
immunohistochemistry experiments. Special thanks to Mr Dave Gallo of Boston lab for
Acknowledgments
xxi
teaching me animal experiments and also for making mice experiments fun. I will never
forget the laughs and jokes we shared together that made lab environment friendly and
enthusiastic.
I would also like to thank Australian Society of Immunology and Griffith
University for supporting my research and providing me funding to attend both National
and International conferences.
My greatest appreciation goes to my closest friend Rajni Verma, who was
always willing to talk and gave her best suggestions, in spite of living in completely
different time zone. Thanks to my friends: Bishakha Roy, Paulina Janeczek, Akanksha
Upadhyaya, Victoria Ozberk, Avinash Kundur and Lana Bivol, who provided me a
much needed form of escape from my studies.
I would also like to thank my parents and brother for the continuous love and
their supports in my decisions, without whom I could not have made to do a PhD.
Finally, I would like to thank my Partner, Alister Punton, for all the support,
commitment and the patience you have shown me in our relationship. Thanks for being
with me during the good and hard times and encouraging me throughout my PhD, for
which mere expression of thanks does not suffice.
xxii
I have contributed to the papers that appear in the following chapter as follows:
Chapter 3 ─ Biliverdin modulates the expression of C5aR in response to endotoxin in
part via mTOR signalling. This chapter includes a co-authored paper and is published
by Biochemical and Biophysical Research Communication (please see below).
Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer A.
C. Biliverdin modulates the expression of C5aR in response to endotoxin in part via
mTOR signaling. Biochemical and Biophysical Research Communications. 449: 94-99
(2014).
Kavita Bisht (candidate)
Study design and development
RAW 264.7 cell culture
Isolation of macrophages from bone marrow from mice and culture of
macrophages
Treatment of cells with BV, LPS, PI3K/mTOR inhibitor
FACS, RNA isolation, qPCR, western blot and ELISA analysis of the cell
culture samples
Data entry and calculation of the outcome data
Statistical analysis
Preparation of the manuscript
Barbara Wegiel
Preparation of the ethics application
Financial support of the project
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
Statement of Contribution to Jointly Published Work
xxiii
Jens Tampe
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
Oliver Neubauer
Assistance in normalising gene expression data
Assistance in the revision and editing of the manuscript
Karl-Heinz Wagner
Financial support of the project
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
Leo E. Otterbein
Financial support of the project
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
Andrew C. Bulmer
Primary supervisor of the project
Financial support of the project
Assistance in the study design and development
Assistance in the interpretation of data and in statistical analysis
Assistance in the preparation, revision and editing of the manuscript
(corresponding author)
xxiv
Corresponding author of the paper: Dr. Andrew C. Bulmer
___________________________02/06/2014
Supervisor: Dr. Andrew C. Bulmer
____________________________02/06/2014
xxv
Chapter 5 ─ Endogenous tetrapyrroles influence leukocyte responses to
lipopolysaccharide in human blood: pre-clinical evidence demonstrating the anti-
inflammatory potential of biliverdin. This chapter includes a co-authored paper and is
published by Journal of Clinical and Cellular Immunology (please see below).
Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H., Bulmer
A. C. Endogenous tetrapyrroles influence leukocyte responses to lipopolysaccharide in
human blood: pre-clinical evidence demonstrating the anti-inflammatory potential of
biliverdin. Journal of Clinical and Cellular Immunology. 5: 1000218 (2014)
Kavita Bisht (candidate)
Study design and development
Preparation of ethics application and subject information package
Recruitment of the subjects
Blood cell analysis
Incubation of blood with LPS and BV
Isolation of RNA and plasma
qPCR, ELISA, HPLC analysis of human and rat samples
Data entry and calculation of the outcome data
Statistical analysis
Interpretation of the data
Preparation of the manuscript (corresponding author)
Jens Tampe
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
Cecilia shing
Assistance in the study design and development
Assistance in the revision and editing of the manuscript
xxvi
Bhavisha Bakrania
Preparation of animal ethics application
Collection of rat serum samples
Assistance in HPLC analysis of the rat serum samples
James Winearls
Preparation of manuscript
Assistance in the revision and editing of the manuscript
John Fraser
Assistance in the revision and editing of the manuscript
Karl-Heinz Wagner
Financial support of the project
Assistance in the revision and editing of the manuscript
Andrew C. Bulmer
Financial support of the project
Primary supervisor of the project
Assistance in the study design and development
Assistance in the interpretation of data and statistical analysis
Assistance in the preparation, revision and editing of the manuscript
Kavita Bisht __________________02/06/2014
Corresponding author of the paper: Kavita Bisht
____________________________02/06/2014
Supervisor: Dr. Andrew C. Bulmer
____________________________02/06/2014
xxvii
Articles in press or published
Original Investigation
1. Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer
A. C. Biliverdin modulates the expression of C5aR in response to endotoxin in part
via mTOR signaling. Biochemical and Biophysical Research Communications. 449:
94-99 (2014) (Chapter 3)
2. Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H.,
Bulmer A. C. Endogenous tetrapyrroles influence leukocyte responses to
lipopolysaccharide in human blood: pre-clinical evidence demonstrating the anti-
inflammatory potential of biliverdin. Journal of Clinical and Cellular Immunology.
5: 1000218 (2014) (Chapter 5).
Publications by the Candidate Contained in the Thesis
xxviii
Articles in press or published
1. Bisht K, Wagner K.-H., Bulmer A.C. Curcumin, resveratrol and flavonoids as anti-
inflammaotry, cyto- and DNA protective dietary compound. Toxicology 278: 88-100
(2010).
2. Boon A.C., Hawkins C.L., Bisht K., Coombes J.C., Bakrania B., Wagner K-H.,
Bulmer A.C. Reduced circulating oxidized LDL is associated with
hypocholesterolemia and enhanced thiol status in Gilbers syndrome. Free Radical
Biology and Medicine 52: 2120-2127 (2012).
Additional Publications by the Candidate During Ph.D. Candidature not Included in
the Thesis
xxix
Poster Presentations
1. Bisht K., Ziesal G., Boon A.C., Merrin W., Bulmer A.C. Bile pigments inhibits LPS-
induced inflammatory signals in RAW 264.7 by decreasing the expression of TLR-4
and complement receptor 5a. The Fifth International Conference on Medical
Mechanisms Of Actions Of Neutraceuticals (ICMAN 5), Brisbane, Australia,
October 13th
to October 15th
2011.
2. Bisht K., Boon A.C., Merrin W, Bulmer A.C. Bile pigments inhibit the expression of
inflammatory genes (TLR-4, C5aR, TNF-α and IL-6) but elevate anti-inflammatory
gene (IL-1Ra) in macrophages. 37th
Annual Scientific Meeting of the Australian
Atherosclerosis Society, Adelaide, Australia, October 19th
to October 21st 2011.
3. Bisht K., Boon A.C., Bulmer A.C. Biliverdin protects RAW 264.7 cells against LPS-
induced inflammation and the effects of biliverdin are mediated by
phosphatidylinositol 3-kinase. Gold Coast Health & Medical Research Conference,
Gold Coast, Australia, December 1st
to December 2nd
2011
4. Bisht K., Wegiel B., Wagner K-H, Otterbein L.E., Bulmer A.C. Biliverdin protects
RAW 264.7 cells against LPS-induced inflammation: a role for BVR induced PI3K
signaling? TLROZ, Melbourne, Australia, from May 2nd
to May 4th
2012
5. Bisht K., Wegiel B., Wagner K-H., Otterbein L.E., Bulmer A.C. Biliverdin protects
RAW 264.7 cells against LPS-induced inflammation: a role for BVR induced PI3K
signaling? 7th International Congress on Heme Oxygenases and Related Enzymes
Edinburgh, from May 28th
to June 1st 2012
6. Bisht K., Wegiel B., Tampe J., Wagner K-H., Otterbein L.E., Bulmer A.C.
Biliverdin attenuates LPS-induced pro-inflammatory cytokine expression in whole
human blood. Gold Coast Health & Medical Research Conference, Gold Coast,
Australia, November 29th
to November 30th
2012.
Conference Presentations by the Candidate During Ph.D. Candidature
xxx
7. Bisht K., Wegiel B., Tampe J., Shing C., Wagner K-H., Otterbein L.E., Bulmer A.C.
Biliverdin attenuates LPS-induced pro-inflammatory cytokine expression in whole
human blood. Experimental Biology, Boston, USA, from April 20th
to April 24th
2013.
8. Bisht K., Bulmer A.C., Otterbein L.E., Wegiel B. Biliverdin acting via biliverdin
reductase inhibits the expression of C5aR in macrophages. HMS Surgery Research
Day, Harvard Medical School, Boston, May 11th
2013.
Oral Presentations
1. Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.
conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by
C5a dependent mechanism. 43rd
Annual Scientific Meeting, Australasian Society for
Immunology, Wellington, New Zealand, from 2nd
to 5th
December 2013.
2. Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.
conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by
C5a dependent mechanism. 8th
International Conference on Heme Oxygenase,
BioIron & Oxidative Stress, Sydney, Australia from 8th
October to 11th
October
2014.
xxxi
1. Griffith University International Postgraduate Research Scholarship.
2. Travel bursary award from TLROZ Conference, Melbourne, Australia.
3. Griffith Graduate Research Scholarship Conference Travel Grant.
4. Publication of the year: Boon A.C., Hawkins C.L., Bisht K., Coombes J.C.,
Bakrania B., Wagner K-H., Bulmer A.C. Reduced circulating oxidized LDL is
associated with hypocholesterolemia and enhanced thiol status in Gilbert’s
syndrome. Free Radical Biology and Medicine 52: 2120-2127 (2012) at Gold Coast
Health and Medical Research Conference, 28th
to 29th
November 2013.
5. International Research Staff Exchange Scholarship (to Vienna, Austria) from EU 7th
Framework Initiative and Australian Academy of Science.
Awards/Scholarship during Ph.D. Candidature
1
Chapter 1: Introduction
2
1.1 Thesis organisation
This thesis has been divided into three main studies. Chapter 3 describes study one
(published) concerning the in vitro effects of biliverdin (BV) on signalling pathway
activation, complement receptor 5a (C5aR) expression and pro-inflammatory cytokine
expression. Chapter 4 contains study two (ready to submit for publication) that
investigated the role of biliverdin reductase (BVR) on C5aR and macrophage
polarisation using bone marrow derived macrophages (BMDMs) obtained from
knockout murine models. Chapter 5 contains the third study (published), which
addresses the anti-inflammatory potential of exogenous BV and endogenous
unconjugated bilirubin (UCB) in an ex vivo LPS-whole human blood model.
1.2 Haem catabolism: an evolutionary perspective
Biliverdin (BV) and bilirubin (unconjugated and conjugated) are tetrapyrrolic
compounds, which are derived from catabolism of precursors with porphyrin structure
[1] and are considered as pigments of life [2,3]. The evolution of photosynthetic
porphyrin chlorophyll is one of the central events in the development of life on Earth
[4,5]. Most of the oxygen in our atmosphere is produced by oxygenic photosynthetic
organisms, including plants, cyanobacteria and other prokaryotes, leading to the
development of an oxygenated environment [6]. Without chlorophyll, development of
advanced eukaryotic life would not have occurred on Earth due to the presence of an
anaerobic environment [4,7]. As evolution progressed towards eukaryotic life, another
oxygen carrying porphyrin, haem, evolved [8]. Haem is mainly utilised for its oxygen
carrying capacity when incorporated into haemoglobin within erythrocytes, myoglobin
in muscle cells, mitochondrial cytochromes and cytochrome P-450 in hepatocytes [1].
Haem is iron-bound and can be highly toxic due to its ability to participate in oxidation-
reductions [1]. To regulate the concentration of potentially toxic haem, organisms
developed a mechanism by which haem could be degraded and recycled [9]. The rate-
controlling enzyme in haem catabolism is haem oxygenase (HO), which is also essential
for iron neutralisation in mammals and synthesis of essential light harvesting pigments
in cyanobacteria and higher plants [10]. The first step in haem catabolism requires
NADPH-dependent reduction of ferric iron to ferrous iron, which is mediated by
cytochrome p450 [1,10]. Haem oxygenase then cleaves the porphyrin ring at its α-
methylene carbon to release carbon monoxide (CO) and iron, generating BV as the
remaining enzymatic product [11]. Interestingly, BV functions as a precursor for the
3
synthesis of light-harvesting bilins in cyanobacteria, algae and higher plants, [9,10].
Biliverdin also contributes to the blue-green colouration of eggs and feathers of birds
[1,9,12]. Biliverdin is excreted intact in birds, reptiles and fish [12]. However, humans
and other mammals express biliverdin reductase (BVR), which chemically reduces BV
to UCB and, therefore, BV is normally undetectable in human blood [13]. Recently, a
unique case of hyperbiliverdinaemia, due to a defect in the BVR gene, was reported
[14]. The patient presented with a blocked bile duct (due to gall stone formation) and
mutation in the BVR gene, which together resulted in green coloration of plasma and
urine [14]. Interestingly, this observation indicates that BVR may not be necessary for
survival. However, it still remains unknown why humans reduce BV to UCB, which is
largely considered a waste product and is responsible for the yellow colouration of the
skin and sclera of the eyes of jaundice pre-term neonates (due to hepatic immaturity)
[15,16]. Interestingly, UCB can become neurotoxic in these babies, if levels exceed the
binding capacity of circulating albumin [17]. Due to the constant formation of UCB
from haem, mechanisms to regulate UCB excretion are thus required to maintain UCB
at apparently non-toxic concentrations. Bilirubin is both passively and actively absorbed
into the liver and requires glucuronidation prior to excretion [16]. This
glucuronidation/conjugation reaction is catalysed by uridine diphosphate
glucuronosyltransferase (UGT1A1) in another energy consuming reaction [13].
Conjugated bilirubin is then actively transported into the bile against a concentration
gradient, by the canalicular ATP-dependent transport protein MRP-2 (multidrug
resistant-related protein 2, ABCC2) and is eventually eliminated from the body via the
faeces [1,13,16]. The uniqueness of haem catabolism in humans and higher vertebrates
suggests that development of multiple energy-consuming reactions is necessary to
produce UCB, which may provide a survival/reproductive advantage.
Recent findings show salutary effects of both BV and UCB in animal models of
transplantation, sepsis and ischaemia-reperfusion injury (IRI), supporting the
importance of antioxidant, anti-inflammatory and cytoprotective properties of these
compounds [18,19]. Furthermore, BVR has also emerged as a pleiotropic molecule with
strong cell signalling and cytoprotective capabilities [20,21]. In addition, mildly
elevated concentrations of circulating UCB (≥17.1 µM; due to a mutation in the gene
promoter of UGT1A1) in Gilbert’s Syndrome, correlate with decreased risk of
cardiovascular disease [22], chronic pulmonary disease [23] and all cause mortality
[24]. These data suggest that BV’s chemical reduction to UCB is important and imparts
4
biologically relevant antioxidant potential upon this molecule. The antioxidant capacity
of UCB in mammals may be responsible for protecting against oxidative stress and the
subsequent liberation of inflammatory stimuli. Interestingly, however, UCB
concentration in blood shows a ‘U’ shape relationship with IL-1β (a pro-inflammatory
molecule) in humans [25]. Individuals with a lower UCB concentration of <17.1 µM
have low baseline concentration of IL-1β, however, UCB concentration >17.1 µM is
associated with increased baseline plasma IL-1β release in Gilbert’s Syndrome [25],
suggesting that UCB at higher concentration may promote inflammation.
The documented preliminary beneficial effects of BV, UCB and BVR led to this
Ph.D. research project, which aimed to assess the anti-inflammatory potential of BV,
UCB and BVR, and their cell signalling effects. This thesis provides novel insights into
the role of these molecules in in vitro, in vivo and ex vivo models of LPS-induced
inflammatory challenge.
1.3 Aims and Hypotheses
The major objective of this research project was to investigate the role of BV/BVR
kinase activity in cell signalling pathways and their protective effects against endotoxin-
mediated inflammation. The thesis addresses the following aims and hypotheses.
1.3.1 Aim 1: To investigate the anti-inflammatory and cell signalling effects of BV in
RAW 264.7 and murine BMDMs by assessing the phosphorylation status of
intercellular signalling molecules, and gene and protein expression of inflammatory
molecules, including C5aR and pro-inflammatory cytokines, in the absence/presence of
LPS.
Studies have identified cytoprotective effects of BV in various in vitro and in vivo
models of vascular injury, transplantation and inflammation [21,26,27]. Biliverdin also
reduces gene expression of TLR-4 and cytokines in vitro [28]. However, the effect of
BV on complement receptor expression has not been studied previously. The roles of
C5aR in various pathologies, including IRI, neurodegenerative disorders, inflammatory
bowel disease, atherosclerosis, age-related macular degeneration, rheumatoid arthritis
and sepsis are well documented [29,30,31,32]. Therefore, we aimed to assess the effect
of BV on C5aR and reveal a novel mechanism whereby BV inhibits C5aR expression in
primary and immortalised macrophages.
5
Hypotheses: Biliverdin reduces gene and protein expression of C5aR and cytokines,
including TNF-α and IL-6 in response to LPS exposure. Biliverdin induces phosphor-
activation of Akt and S6, which partially inhibits LPS-mediated C5aR expression via the
mTOR pathway.
1.3.2 Aim 2: To investigate the role of BVR deletion on C5aR, and macrophage
chemotaxis and phenotype.
Growing evidence demonstrates that BVR is not merely an enzyme required for
haem catabolism but that it plays a crucial role in physiology, pathophysiology, cell
growth, apoptosis, metabolism, regulation of gene expression and cell signalling
[33,34]. Therefore, this study aimed to assess the effects of conditional deletion of BVR
using a Cre-recombinase system in mice to examine C5aR function, and macrophage
chemotaxis and macrophage phenotype.
Hypotheses: Conditional deletion of BVR in murine derived myeloid cells augments
C5aR expression, macrophage chemotaxis towards C5a and promotes the development
of an M1 macrophage phenotype after LPS and IFN- stimulation. The regulatory
effects of BVR are mediated in part by C5aR.
1.3.3 Aim 3: To investigate the effects of BV and UCB on LPS-induced cytokine
transcription and release in a pre-clinical ex vivo model of inflammatory challenge in
whole human blood.
Although, BV and UCB generally protect against inflammation and tissue injury
induced by LPS, transplantation and IRI in cell culture and rodent models [21,26,27]
there remains a paucity of information regarding the immuno-modulatory effects of BV
and UCB in humans. In this study, whole blood was drawn from human subjects and
treated with BV (50 µM) or solvent control in the presence or absence of LPS for 4-8 h.
Gene expression and secretion of both pro- and anti-inflammatory cytokines into plasma
were assessed. To confirm a possible effect of endogenous UCB on IL-1β release in
vivo, blood samples were also collected from mutant hyperbilirubinaemic Gunn rats.
Hypotheses: Exogenous BV decreases gene expression and secretion of pro-
inflammatory cytokines in response to whole blood LPS exposure. Increasing
concentration of endogenous UCB in humans and rats is associated with increased
expression and release of pro-inflammatory cytokines, including IL-1β.
6
2.4 Results and summaries
1.4.1 In vitro study
The first study, outlined in Chapter 3, investigated the impact of BV on C5aR gene
and protein expression and the mechanisms regulating this effect. In addition, the effect
of BV on cell signalling was also assessed. An immortalised mouse macrophage cell
line (RAW 264.7) and primary macrophages derived from murine bone marrow were
used in this study. The results suggest that BV (at 50 µM) reduces the expression of
C5aR in cultured primary and immortalised macrophages. Biliverdin and LPS also
induced the phosphorylation of Akt and S6 kinase (downstream kinases of mTOR
pathway). Biliverdin and LPS-induced phosphorylation of Akt and S6 was inhibited in
the presence of LY294002 (inhibitor of PI3K) and rapamycin (inhibitor of mTOR),
respectively. Biliverdin exerted inhibitory effects on LPS-mediated C5aR expression,
which were partially mediated via signalling through the mTOR pathway. Biliverdin
also mitigated the LPS-induced increase in cytokine expression and release, including
TNF-α and IL-6, suggesting additional anti-inflammatory effects of BV. In summary,
BV mitigates LPS-dependent expression of C5aR and associated pro-inflammatory
cytokines, with the inhibitory effect of BV on C5aR being partially dependent upon
activation of the mTOR signalling pathway.
1.4.2 In vivo study
The second study, outlined in detail in Chapter 4 describes work conducted at Beth
Israel Deaconess Medical Centre, Harvard Medical School, Harvard University,
(Boston, USA). This study aimed to assess whether BVR regulates macrophage
chemotaxis towards complement component C5a, and whether such an effect is
mediated by reduced C5aR expression, as documented in Chapter 3. The study also
investigated the effects of BVR deletion on macrophage phenotype. The study was
performed in primary macrophages isolated from BVRfl/fl
(control) and CreLyz:BVR
fl/fl
mice (conditional deletion of BVR in myeloid cells). Bone marrow derived
macrophages (BMDM) from CreLyz:BVRfl/fl
mice showed enhanced basal gene and
protein expression of C5aR. Furthermore, deletion of BVR in BVR competent BMDMs
promoted macrophage chemotaxis towards C5a, an effect that was abrogated after
blocking the C5aR using a neutralising antibody. Macrophages isolated from
CreLyz:BVRfl/fl
mice also had significantly increased pro-inflammatory iNOS gene and
7
protein expression and increased TNF-α release in response to LPS and IFN- exposure.
These effects were blocked in the presence of a neutralising antibody against C5aR,
curiously suggesting that C5aR plays an important role in macrophage chemotaxis and
polarisation towards M1 in CreLyz:BVRfl/fl
mice. In summary, this study showed that
deletion of BVR promotes macrophage chemotaxis in response to C5a and macrophage
polarisation towards the M1 phenotype and these effects appear to be mediated partially
via C5aR.
1.4.3 Ex vivo study
The third and final study outlined in Chapter 5 explored the effects of exogenous
BV and endogenous UCB on cytokine expression and release in a pre-clinical model of
LPS-induced inflammation in whole blood. This study is important because human
responses to BV have not been published thus far, and it extends the findings in
Chapters 3 and 4 regarding anti-inflammatory effects of BV/BVR by testing their
potential relevance in an ex vivo human blood model. Whole human blood was co-
incubated with BV LPS for 4 and 8 h. RNA was extracted for gene expression
analysis (4 h) and plasma was collected to quantitate cytokine release (8 h). The results
indicated that BV significantly decreased LPS-induced gene expression of IL-1, IL-6,
IFN-, IL-1Ra and IL-8. Biliverdin at 50 µM also reduced IL-1 and IL-8 release from
leukocytes in response to LPS. A further interesting finding was that increasing baseline
UCB concentration (in the absence of added BV) was associated with increased LPS-
mediated gene expression of IL-1, IFN-, IL-1Ra and IL-8. Furthermore, Gunn rats (an
animal model of endogenous hyperbilirubinaemia) exhibited higher baseline IL-1
serum concentrations compared to wild-type controls. In addition, gene expression of
C5aR was also assessed in human blood samples. Lipopolysaccharide stimulation
significantly decreased C5aR gene expression and BV alone also tended to reduce C5aR
expression. These findings further support the anti-inflammatory efficacy of BV in a
pre-clinical human model and suggest that UCB at higher concentrations may heighten
inflammatory responses to LPS by a mechanism which currently remains unknown.
8
Chapter 2: Literature Review
9
2.1 Immune responses to pathogens
All multi-cellular organisms, including humans protect themselves against invading
pathogens using dedicated immune defence systems (innate and adaptive immune
systems). The Innate immune system is responsible for coordinating the initial response
against pathogens and serves as first lines of defence. Adaptive immune responses are
required only when the innate defence is overwhelmed or evaded [35,36]. The innate
immune system is equipped with anatomic, physical and chemical barriers, effector
molecules (e.g. lysozyme, complement, acute phase proteins) and specialised cells with
phagocytic and lytic abilities [37,38]. The anatomic, physical and chemical barriers
provide the initial defence by secreting various soluble proteins, including sebum and
mucous, secreted by sebaceous glands of skin and goblet cells of small intestine,
respectively [39]. In addition, innate immune cells (e.g. neutrophils and macrophages)
sense pathogens by pattern recognition receptors (e.g. Toll like receptors; TLRs), which
recognise the molecular patterns unique to pathogens, leading to their internalisation
and elimination [40,41]. Furthermore, influx of phagocytic cells into tissue triggers
inflammation, characterised by the secretion of pro-inflammatory cytokines (e.g. TNF-
α, IL-1 and IL-6) [42,43,44,45].
Adaptive immunity also recognises and selectively eliminates foreign pathogens.
Unlike innate immune responses, adaptive responses are reactions to higly specific
antigens. Adaptive immunity mediates its effector functions, including specificity,
diversity, memory and recognition of self/non-self antigens via two major groups of
cells: lymphocytes and antigen presenting cells (APCs) [46]. The two major populations
of lymphocytes are B- and T-lymphocytes, and are both formed in bone marrow.
Notably, B-cells mature in bone marrow whereas T-cells migrate to the thymus gland to
mature and, therefore, are also called as thymocytes [47]. Interaction of B- and T-cells
with antigens generates humoral and cell mediated responses, respectively. In humoral
responses, interaction with an antigen promotes proliferation of B-cells and
differentiation into antibody-secreting plasma cells [48]. Generated antibodies then bind
to antigens and facilitate their elimination. However, T-lymphocytes can only recognise
antigens that are bound to major histocompatibility complex (MHC) I and II [49]. The
antigen presenting cells, including macrophages, B-cells and dendritic cells (DCs),
internalise antigens by phagocytosis and then display part of that antigen by expressing
MHC-II molecules on their surface [38]. In addition, APCs also deliver co-stimulatory
10
signals (CD80, CD86 and CD40) to activate T-lymphocytes [50]. T-lymphocytes are
composed of three-cell populations: T-helper (Th; CD4+ cells), T-cytotoxic cells (TC
cells; CD8+) and T-suppressor cells (T-regulatory cells) [36]. Once T-helper cells
recognise and interact with antigen-MHC-II complexes, they become activated and
secrete Th1, Th2 and
Th17 cytokines [47]. Cytotoxic T cells recognise antigen-MHC-I
molecules (present on all nucleated cells) under the influence of Th cytokines and
differentiate into cytotoxic T lymphocytes to eliminate the antigens, including virus
infected cells, tumor cells and cells from a foreign tissue graft [47,49]. However,
regulatory T cells (Treg), designated as CD25+
and forkhead box P3 (Foxp3) positive
cells inhibit the activation of T-cells and have been shown to protect from immune-
mediated disorders [47,51].
The innate and adaptive immune responses are tightly regulated and allow
maintenance of tissue homeostasis. However, failure to properly regulate these immune
responses may result in persistent pathological damage to the tissues due to the
induction of chronic inflammation [36].
2.2 Inflammation
Inflammation is a natural response of the host to tissue injury that is caused by
pathogen associated molecular patterns (e.g. bacterial and fungal infection) or by
damage associated molecule patterns (DAMP) that are generated in response to sterile
injury and necrosis, such as burn, hypoxia, heat shock proteins and chemical insult
[52,53]. The main purpose of inflammation is to restore tissue homeostasis/structure
and protect against noxious stimuli, including infection or sterile inflammation causing
agents [44]. There are two stages of inflammation: acute and chronic phase. Acute
inflammations is highly regulated process, involving both signals that initiate and
maintain inflammation as well as those that lead to resolution of the inflammatory
cascade and promote healing [54]. The main feature of acute inflammation is the
exudation of plasma and fluid proteins (oedema), followed by migration of leukocytes
from the circulation to the tissue [44,55]. In the first phase, leukocytes are recruited
from the circulation to the site of damage and by removing necrotic/apoptotic cells,
allow healing of the affected tissues that otherwise may cause excessive injury to the
host tissue [54,55].
11
Neutrophils are the first cells to extravasate to the site of injury (within mintues
to hours) and are followed by monocytes. Leukocytes interact with endothelial cells
(ECs) to transmigrate into the tissue, a process which is mediated by selectins, integrins
and cell adhesion molecules, including intercellular adhesion molecule-1 (ICAM-1) and
vascular cell adhesion molecule-1 (VCAM-1) [55]. Once in the tissue, leukocytes
release growth factors, cytokines, chemokines, lipid mediators and reactive oxygen
species (ROS), which further promote inflammation [44,55]. However, when acute
inflammation is uncontrolled and persists (e.g. when the pathogen cannot be destroyed),
inflammation can progress into a chronic phase. This phase of inflammation then
promotes persistent tissue damage, followed by tissue fibrosis, scarring and necrosis
and eventually may result in several pathological conditions such as neurodegenerative,
autoimmune, sepsis, respiratory and cardiovascular disorders [52].
2.3 Inflammatory cells
2.3.1 Neutrophils
Neutrophils are pivotal cells of the immune system and serve as a first line of
defence against pathogens during acute inflammation. They also play a key role in
activating other immune cells, including monocytes, macrophages, epithelial cells and
ECs [43,56]. Neutrophils were first identified by Elie Metchnikoff in starfish larvae
[56]. In this seminal work, it was demonstrated that injury of the larvae resulted in
recruitment of phagocytic cells. These cells were named as “polymorphonuclear
leukocytes (PMNs)” due to the presence of uniquely lobulated nucleus [56,57]. Further,
Paul Ehrlirch discovered that PMNs have a tendency to retain neutral dye (mixture of
basic and acid dyes) and, therefore, named them as neutrophils [58]. Neutrophils have
very short life span with a half-life in blood of approximately 11 h in mice and 6-8 h in
humans [59]. However, the results of Pillay et al. [60] recently challenged the previous
study regarding the short half life of neutrophils in humans, proposing that neutrophils
exist in the circulation for 5.4 days. The results of this study received criticism due to
the methodological approach used to estimate neutrophils life-span. For example,
deuterium-labeled water was given orally to human subjects, which also labels bone
marrow neutrophils, leading to overestimation of neutrophils longevity in blood [61,62].
Nevertheless, inflammatory reactions including the presence of pro-inflammatory
cytokines and bacterial compounds such as lipopolysaccharide (LPS) extend neutrophil
12
life, increasing the likelihood of damage occurring to host tissues [43,63]. Neutrophils
are continuously produced from their myeloid precursor in bone marrow under the
control of granulocyte colony stimulating factor (G-CSF). The daily production of
neutrophils in bone marrow varies from 5 x 1010
- 1 x 1011
cells with circulating
numbers approximating 2.5 x 109/L - 7.5 x 10
9/L. Neutrophil numbers increase
significantly under acute inflammatory conditions [64]. For example, the number of
neutrophils in blood increased from 1 x 109/L up to 11 x 10
9/L in mice challenged with
LPS (30 g/100L; i.p) [65]. Once activated, neutrophils release a plethora of
chemotactic factors that recruit other immune cells to the site of inflammation,
including macrophage inflammatory protein-1alpha (MIP-1α) and MIP-1β and
chemokine receptors such as CXCR-2 and CXCR-4 [59,64]. Neutrophils also synthesise
multiple complement components (C3a and C5a) and their receptors (C3aR and C5aR),
TLR-2 and TLR-4, pro-inflammatory cytokines including tumour necrosis factor-alpha
(TNF-α), interleukins (IL-1, IL-6 and IL-8) and generate ROS and bactericidal enzymes
(myeloperoxidase; MPO) to assist in pathogen removal and breakdown [56].
Neutrophils eliminate pathogens via three pathways: i) phagocytosis, ii)
formation of neutrophil extracellular traps (NETosis) and iii) degranulation (Figure 2.1)
[43,57]. During phagocytosis, the pathogen is first recognised by cell surface receptors
and is then internalised by the cell membrane into a vacuole called a phagosome. A
toxic environment to the pathogens is created via two mechanisms: i) the phagosome
undergoes maturation upon fusion with neutrophil granules, which results in the release
of anti-microbial content (cathepsins, defensins, lactoferrin and lysozyme) into the
phagosomal lumen and ii) the phagosomal membrane assembles with NADPH oxidase
that leads to superoxide radical generation [57]. Neutrophils also produce NETs to
eliminate dangerous stimuli, including microorganisms (e.g. Shigella flexeneri,
Streptococcus pyogenes, Bacillus anthraci, Mycobacterium tuberculosis and Candida
albicans) [56]. NETs are composed of decondensed chromatin DNA and granular
proteins, which are capable of trapping both gram-positive and gram-negative bacteria.
NET formation is dependent on the generation of ROS with the enzyme MPO being a
very important component. Myeloperoxidase is released by activated neutrophils to
mediate immobilisation/destruction of bacteria and plays an indispensable role in the
rapid generation of ROS, also referred to as the oxidative burst [57]. Degranulation is a
crucial event in neutrophil activation and is involved in several inflammatory disorders,
13
including septic shock, rheumatoid arthritis and acute lung injury [66]. Neutrophils are
composed of three types of granules: i) azurophilic (primary), which contain MPO, ii)
specific (secondary) granules containing lactoferrin and iii) gelatinase (tertiary)
granules, comprising of matrix metalloproteinase (MMP)-9 [56]. MMP-9 is a critical
extracellular matrix-digesting enzyme that promotes the removal of DAMP-containing
intracellular matrix proteins [43]. At the site of inflammation, activation of neutrophils
promotes mobilisation of primary and secondary granules. These granules either fuse
with the phagosome or with the plasma membrane to release their anti-microbial
contents into tissue to promote clearance of the bacteria [43,57]
14
Figure 2.1: Elimination of microorgansims by neutrophils. Neutrophils destroy
pathogens via three major pathways including engulfment of the pathogen
(phagocytosis), degranulation or production of NETs. Sourced from Nature Publishing
Group [43].
Induction of these three pathways requires activation of the NADPH-oxidase
complex to facilitate elimination of dangerous stimuli. The NAPDH oxidase complex
within the phagosome or plasma membrane initiates ROS production by reducing
molecular oxygen to superoxide [57]. Superoxide is rapidly converted to H2O2, a
damaging oxidant, by superoxide dismutase (SOD). Superoxide can also react with
nitric oxide (NO), which is generated at high levels at the site of inflammation by
inducible nitric oxide synthase (iNOS), to form the oxidant peroxynitrite [67,68]. In
addition, upon degranulation, MPO can also react with H2O2 and chloride to form
hypochlorus acid (HOCl), the active component of household bleach, which possesses
potent microbicidal activity [69].
15
2.3.2 Macrophages
Macrophages are essential constituents of the immune system and play a
multifaceted role in both the innate and adaptive immune responses [70]. These cells
were first discovered by Elie Metchnikoffas, who observed their phagocytic behaviour
in starfish larvae and were believed to be responsible for neutralisation and elimination
of pathogens [45]. Macrophages are mononuclear and heterogenous cells that
differentiate from monocytes under the influence of differentiation factors, including
granulocyte-macrophage colony stimulating factor (GM-CSF), macrophage colony
stimulating factor (M-CSF) and colony stimulating factor (CSF)-1 [71]. In addition, in
response to inflammation, monocytes are recruited to the tissues upon release of
chemoattractants at the site of injury (e.g. monocyte chemoattractant protein-1 (MCP-
1), MIP-1 and MIP-1) by neutrophils [57]. Macropahges are ubiquitously distributed
in every tissue and organ and are named according to the tissue they reside within. For
example, Kupffer cells in the liver, microglial cells in the brain, splenic macrophages in
the spleen, alveolar macrophages in the lungs, Langerhans cells in the skin and
osteoclasts in the bones, are all macrophages that are specifically differentiated, serving
as sentinel cells within tissues [45,70,71,72].
The function of macrophages is affected by their polarisation state, which is
influenced by local cytokine exposure. For example, IFN- induces classical (M1
polarisation) macrophage differentiation while IL-4 or IL-13 promotes alternative (M2
polarisation) macrophage formation (Figure 2.2) [45,55,73]. M1 macrophages are pro-
inflammatory cells with increased expression of pattern recognition receptors and pro-
inflammatory cytokines (TNF-α, IL-6 and IL-1; Figure 2.2). However, M2 cells are
characterised by an anti-inflammatory phenotypes and show enhanced production of IL-
10, transforming growth factor-β (TFG-), nuclear receptors (liver X receptors), and
prostaglandins (e.g prostaglandin E2; Figure 2.2) [74].
Once activated by stimuli, including LPS, interferons or other microbial products,
macrophages express a myriad of receptors; including TLRs, complement receptors,
cytokines, chemokines, growth factors and ROS. These molecules are required for the
major activities of macrophages, including phagocytosis or opsonisation of pathogens,
generation of cytokines and chemokines, chemotaxis and antigen presentation, leading
elimination of microbes and the healing of tissues [44,45]. However, continuous
16
activation of macrophages leads to the release of IFN-, IL-1 and TNF- that can
result in tissue fibrosis and injury, characterised by chronic inflammation.
Figure 2.2: Monocytes differentiate to macrophages under the influence of M-
CSF/GM-CSF. Macrophages are polarised in vitro by IFN-/LPS or IL-4/IL-13 into
M1 or M2 cells. M1 macrophages are considered pro-inflammatory and express TLRs,
complement receptors in addition to promoting the release of cytokines and
chemokines. M2 macrophages are considered anti-inflammatory and express anti-
inflammatory cytokines, nuclear receptors and prostaglandins.
2.3.3 Endothelial cells
The endothelium was previously considered merely an inert lining of blood
vessels, however, recent findings indicate that endothelial cells (ECs) are critical players
17
in inflammation and change their phenotypes to modulate inflammatory processes [75].
The endothelium controls a number of processes, including platelet adhesion and
aggregation, vascular tone, leukocyte entry and migration into tissues and the vascular
wall, in addition to regulating vascular smooth muscle cell (VSMC) proliferation
[76,77]. The endothelium normally acts as a barrier to the free entry of molecules and
separates the blood elements from the extra-vascular tissues. The endothelium can be
activated via a number of factors, including exposure to infectious pathogens, TLRs,
cytokines, LPS, complement, shear stress, ROS and by products of coagulation
pathways (thrombin and fibrinogen). Each of these factors increases endothelial
vascular permeability and leukocytes infiltration under pathological conditions,
including sepsis, atherosclerosis, trauma or adult respiratory distress syndrome [75].
The endothelium maintains vascular tone/homeostasis by releasing prostacyclins,
leukotrienes and generating NO from its precursor, L-arginine via the enzymatic action
of endothelial nitric oxide synthase (eNOS) [78,79]. Endothelial cells adhere to each
other through junctional structures, which are formed by trans-membrane cell adhesive
proteins. Three types of junctions are expressed by ECs: i) tight junctions (e.g.
occludins, claudins, junctional adhesion molecule), ii) adherence junctions (e.g.
cadherins and catenins) and iii) gap junctions (e.g. connexins) [77,80]. These juncitonal
proteins play a crucial role in regulating leukocyte extravasation, controlling the
exchange of plasma proteins from the blood to tissues, cell-to-cell communication,
endothelial cell growth and apoptosis [80,81].
Quiescent ECs do not interact with leukocytes and express low levels of cell
adhesion molecules (CAMs), such as P and L-selectin, ICAM-1 and VCAM-1 [79].
Failure of the organisms to appropriately regulate the normal function of ECs results in
endothelial dysfunction. Two important hallmarks of endothelial dysfunction include: i)
impaired NO production, which promotes vasoconstriction, platelet aggregation and
leukocyte-endothelial interaction [78] and ii) increased expression of CAMs, which
further promotes firm adhesion of leukocytes, leading to their migration into the
interstitium [55]. During inflammation, leukocytes migration into tissues relies upon
leukocyte interaction with ECs (Figure 2.3), which is mediated by the expression of
selectins (e.g. L-selectin is present on leukocytes and P- and E-selectins are present on
ECs) [82,83]. Activated leukocytes respond to chemoattractant molecules, including
C5a and IL-8 and platelet activated factors and result in up-regulated expression of
18
integrins on ECs [84]. Subsequently, integrins promote firm attachment of leukocytes to
ECs by binding to their ligands, including ICAM-1 and VCAM-1 (Figure 2.3).
Leukocytes roll on ECs (mediated by non-covalent interaction with selectins) until
activated integrins bind convalently with I/VCAM, where they can migrate into the
interstitium. Once leukocytes are attached via their integrins, they migrate into tissues
with the assistance of platelet endothelial cell adhesion molecules, which are present in
close association with endothelial intercellular junctions [55]. Therefore, the
endothelium is a key regulator of leukocyte extavasation into the tissues and
endothelium dysfunction can exacerbate inflammation and associated disorders via
promoting leukocyte migration.
19
Figure 2.3: Leukocytes and endothelium interaction. Leukocytes interact with ECs
in response to stimulation, which increases the expression of selectins on both
leukocytes and ECs. Leukocytes then attach to ECs firmly via integrin binding to CAMs
(VCAM-1/ICAM-1) and then migrate into tissues. In addition, cytokines, chemokines
and growth factors released by macrophages also activate endothelium.
2.4 Nuclear factor kappa B in inflammation
A major transcription factor that regulates leukocytes activation is nuclear factor
kappa B (NF-B). NF-B targets numerous genes, including pro-inflammatory
cytokines (TNF-, IL-6 and IL-1), inducible enzymes (cyclooxygenase (COX)-2 and
iNOS), pro-apoptotic (caspase-8, Bcl-Xs and TNF--related apoptotic inducing ligand)
and anti-apoptotic genes (Bcl-XL) and cell adhesion molecules (VCAM-1 and ICAM-1)
20
[85,86]. NF-B was first identified by Sen and Batimore [87] as a B-cell specific
transcription factor, which binds the B site in the Ig light chain enhancer. However,
recent studies show that NF-B is not exclusive to B-cells and can be induced by
classical and alternative pathways in many cell types, including macrophages and ECs
[88]. The classical pathway is triggered by pro-inflammatory cytokines, bacterial and
viral products (LPS, double stranded RNA, sphingomyelinase), physical stress (UV
light gamma irradiation and ROS) and growth factors (vascular endothelial growth
factor and platelet derived growth factor) [89]. The alternative pathway is activated in
response to TNF--family members (lymphotoxin-α and-β), B-cell activating factor
belonging to TNF--family receptor (BAFF-R) or CD40 ligand [90].
NF-B is a hetrodimer of NF-B1 (p50) and NF-B2 (p52), which are synthesised
from precursor p105 and p100, respectively and RelA (p65)/RelB/cRel [91]. NF-B is a
conserved transcription factor, with members of the NF-B family found in Drosophila
(Dorsal, Dif and Relish) and Cnidarians (Nv-NF-B). The most ubiquitous NF-B
dimer in mammalians is the p50/p65 heterodimer. To exert a transcriptional effect, NF-
B needs to be translocated to the nucleus from the cytoplasm (Figure 2.4). In an
unstimulated state, NF-B is held in cytoplasm in an inactive form, bound to the
inhibitor of κ B family (IB, IB, IB, IB and IB) [88,92]. Activation of NF-
B by classical stimuli and by the alternative pathway occurs by the activation of IB
kinase complex (IKK) (Figure 2.4) [89,90]. The activated IKK complex phosphorylates
IB and subsequently degrades it by ubiquitination via two homologous kinase subunits
(IKK and IKK, also known as IKK1 and IKK2, respectively) and one regulatory
subunit (IKK, also known as NEMO) [88,89,91]. The phosphorylation of IB releases
NF-B dimers (p50/p65) and leads to translocation of p50/p65 to the nucleus, where it
binds to DNA and activates transcription of several immuno-modulatory genes [92].
Excessive or prolonged activation of NF-B has been implicated in several immune
disorders, including sepsis, autoimmune disorders (e.g rheumatoid arthritis, multiple
sclerosis) and cardiovascular diseases [92]. Furthermore, NF-B promotes leukocytes
infiltration by increasing the expression of CAMs and chemokines on ECs, leading to
progression of inflammation in tissues [88].
21
Figure 2.4: Activation and translocation of NF-B from cytoplasm to nucleus,
triggered by phosphorylation of IkB in response to NF-B activating stimuli. Modified
from Abraham et al. and sourced from Oxford University Press [93].
2.4 Nitric oxide and nitric oxide synthase in inflammation
Nitric oxide is a gaseous bioactive product of mammalian cells and is produced
by three different isoforms of nitric oxide synthase (NOS), including neuronal (n)NOS,
eNOS and iNOS (Figure 2.5).
Both nNOS and eNOS are constitutively expressed. In the central nervous
system, nNOS maintains synaptic plasticity (i.e. phenomena such as long term
potentiation and long term inhibition), which plays an important role in modulating
functions, including memory, learning and neurogenesis (Figure 2.5) [94]. In the
peripheral nervous system, NO from nNOS acts as a neurotransmitter and induces
relaxation of smooth muscle cells (SMCs) [94]. Nitric oxide production from eNOS
plays a pivotal role in endothelial homeostasis as described in previous sections [77].
22
However, inflammation impairs NO production from eNOS and reverses NO-mediated
regulatory effects due to excessive NO generation by iNOS. Exposure of macrophages
to LPS or inflammatory cytokines (TNF-, IL-1 and IFN-) induces the production of
NO from iNOS [95,96]. Nitric oxide from iNOS reacts with superoxide anion and forms
the potent oxidant, peroxynitrite, which is an anti-microbial molecule. However,
excessive generation of peroxynitrite leads to oxidative cellular damage, nitration and
S-nitrosylation of proteins [94,97]. Nitric oxide from iNOS targets sulfhydryl groups on
proteins for oxidation and forms nitrosothiol compounds [98]. Nitric oxide also
activates poly-ADP-ribose polymerase (PARP) and results in single stranded DNA
breakage [99]. Furthermore, continuous generation of NO from iNOS contributes to
various inflammatory disorders, including septic shock (Figure 2.5) by promoting
arteriolar vasodilation, hypotension and microvascular damage [94,98].
23
Figure 2.5: Important functions of the three isoforms of nitric oxide synthase
(NOS). Adapted from Forstermann et al. and sourced from Oxford University Press
[94].
2.5 Toll like receptors in inflammation
Toll like receptors belong to the pattern recognition receptor (PRR) family of
receptors due to their ability to recognise highly conserved molecular patterns, which
are present on pathogens [40,41]. Toll like receptors were first identified in Drosophila
by Nusslein-Volhard [100]. Thus far, 10 human and 13 mouse TLRs have been
identified and are broadly expressed on neutrophils, macrophages, DCs, SMCs and ECs
[41]. The ligands of TLRs can be divided into two categories: exogenous and
endogenous (Figure 2.6) [100]. Microbial products including LPS, lipoteichoic acid,
peptidoglycan and lipopeptides represent exogenous ligands. Endogenous ligands
include minimally modified low-density lipoprotein (LDL), heat shock protein, nuclear
proteins, fibrinogen, heparan sulphate, hyaluronan, high-mobility group box 1
24
(HMGB1) protein, surfactant protein-A and haem [101,102,103]. Toll like receptors are
type I transmembrane receptors with highly conserved Toll/interleukin-1 (TIR) receptor
motifs [104]. All TLRs bind to a variety of ligands (Figure 2.6); e.g. TLR-1, 2, 4 and 6
recognise lipoproteins and lipoteichoic (LTA) acids from gram-positive bacteria and
lipoarabinomannan from mycobacteria. Double stranded RNA from viruses and gram
negative bacterial components including LPS serve as ligands for TLR-3 and TLR-4,
respectively. TLR-5 mediates responses to flagellin present in both gram positive and
negative bacteria. TLR-7 and 8 binds to single stranded RNA of viruses and TLR-9
recognises unmethylated CG dinucleotides (CpG motifs) [104,105].
Furthermore, TLRs also recognise DAMPs, which are important inflammatory
stimuli released by immune cells or tissues in response to infection or injury. These danger
signals stimulate release of pro-inflammatory mediators, including cytokines, growth factors
and ROS via TLR activation, promoting tissue injury and inflammation [106]. Toll like
receptors, with the exception of TLR-3, trigger a well defined signalling cascade (Figure 2.6)
in response to pathogen activation via a family of adaptor proteins, including myeloid
differentiation factor (MyD88), TIR domain containing adaptor protein (TIRAP), toll
receptor associated activator of interferon (TRIF), TRIF related adaptor molecule (TIRAP)
and toll-receptor associated activator (Figure 2.6). These adaptor proteins induce activation
of NF-B, phophatidylinositol 3-kinase (PI3-K) and mitogen activated kinases (MAPK),
which are crucial for transcription, mRNA stability and translation of pro-inflammatory
cytokine genes within leukocytes [101,104,105]. Toll like receptors serve as a link between
innate immunity and adaptive immunity via activating and promoting the maturation of DCs,
increasing expression of MHC, co-stimulatory molecules and amplifying DCs ability to
activate T-cells [104].
25
Figure 2.6: Toll like receptors, their ligands and signalling pathways.
2.6 Complement in inflammation
Complement is an important constituent of the innate immune system and was
first identified as a heat-sensitive factor in fresh serum that “complements” the killing of
bacteria [107]. Complement also plays an important role in adaptive immunity,
modulating both the humoral and cell-mediated immune responses [108]. The main
function of complement is to recognise pathogens and eliminate them either by their
opsonisation or permeabilisation. In addition, components of complement also
participate in the clearance of apoptotic and necrotic cells [109,110]. However,
excessive complement activation is associated with the development of many
pathological conditions including sepsis, neurodegenerative, cardiovascular and
autoimmune disorders (e.g. rheumatoid arthritis, multiple sclerosis) [107,111].
Complement is activated via four different pathways: the classical, lectin, alternative
26
and recently discovered extrinsic pathways (Figure 2.7). The classical, lectin and
alternative pathways share the common central component C3, whereas, the protease
pathway is independent of C3 [107,112]. Each pathway is activated by different
complement proteins. For example, the classical pathway is activated by component C1
after activation by immunoglobin (Ig)G, IgM immune complexes and C-reactive protein
(CRP). The lectin pathway is triggered by either mannose binding lectin or ficolin
[113]. The alternative pathway can be initiated by LPS or by carbohydrates, lipids or
proteins present on bacterial surface [110]. Complement activation by classical, lectin
and alternative pathways induce the formation of complement activation products
including anaphylatoxins (e.g. C3a and C5a) and their receptors (C3aR, C5aR and
C5L2) (Figure 2.7), which play critical roles in amplifying inflammation [114]. The
extrinsic pathway is activated by proteases (Figure 2.7), generated from neutrophils and
macrophages, which act with C5 to promote the release of C5a. In addition, thrombin,
component of the coagulation pathway, also generates C5a to link haemostatic
processes to inflammation [107,115].
27
Figure 2.7: Complement activation pathways. Complement is activated by classical,
lectin, alternative and extrinsic pathways. Each pathway generates small anaphylatoxins
called C3a, C5a and opsonins, including C3b and C5b. C5b interacts with other
complement components, leading to the formation of the membrane attack complex
(MAC).
2.6.1 Anaphylatoxin and their receptors
Stimulation of complement activation pathways generates complement
components, including C3, C4 and C5. In response to stimulation by infection or tissue
injury, complement activation is accelerated and results in the generation of two types
of fragments: i) small fragments (C3a, C4a and C5a) and ii) large fragments (C3b, C4b
and C5b). C3a, C4a and C5a are classified as anaphylatoxins due to induction of
systemic anaphylactic shock when produced in large amounts [116]. C3 is mainly
synthesised in the liver and is comprised of 110 kDa α- and 75kDa β-chains. As
indicated previously, C3a is a smaller complement fragment of C3 and is composed of
77-amino acids [117]. The second component C4 is also produced in the liver and is
synthesised as a single chain, which is consequently processed into three shorter
28
polypeptide chains (α, β and γ) [117]. The C5 component is an 188kDa protein and
comprised of 115kDa α- and 75kDa β-chains. C5 is mainly produced by hepatocytes;
however, other cells including neutrophils, macrophages and ECs also secrete C5
[111,113]. All of the previously mentioned anaphylatoxins contain a carboxyl-terminal
arginine residue, which is cleaved by serum carboxypeptidase to generate desarginine
(desArg). Both C3a and C5a are small polypeptides consisting of 77 and 74 amino-
acids, respectively [116,118], and C5a possesses immunomodulatory activities;
however, the function of C4a is not well described [117]. Both C3a and C5a target a
broad range of immune and non-immune cells and induce a multitude of inflammatory
responses. For example, anaphylatoxins mediate the oxidative burst in macrophages,
neutrophils and eosinophils, contraction of SMCs, histamine release from mast cells,
basophils, in addition to increasing vascular permeability [116,118]. Among the
anaphylatoxins, C5a is the most potent and also serves as a strong chemoattractant for
macrophages, neutrophils, activated B and T cells [118]. C5a signalling induces varied
effects on different cell types. For example, C5a induces phagocytosis by neutrophils
and macrophages, degranulation of leukocytes, H2O2 production via neutrophils,
chemokine and cytokine release from leukocytes and cell adhesion molecule (P-
selection) expression on ECs [117,119,120]. In addition, C5a also stimulates
coagulation in sepsis by increasing platelet counts and plasma fibrinogen levels [121]
The anaphylatoxins C3a and C5a exert their effects by binding to a family of
receptors, including C3a receptor (C3aR), C5a receptor (C5aR, CD88) and C5a
receptor-like 2 (C5L2). No specific receptor for C4a has been described thus far. C3aR
and C5aR belong to family of G-protein coupled receptors (GPCRs). C3aR, C5aR and
C5L2 are 54 kDa, 42kDa and 37kDa proteins, respectively [117]. All the three receptors
are expressed in myeloid cells, including monocytes/macrophages, eosinophils, mast
cells, dendritic cells, microglia and non-myeloid cells such as astrocytes, endothelial,
epithelial and SMCs [111,116]. C3aR and C5aR signalling lead to activation of
PI3K/Akt (protein kinase B), protein kinase C and MAPKs [122]. The excessive
generation of C5a and C5aR contribute to a number of pathologies, including IRI,
neurodegenerative disorders, inflammatory bowel disease, atherosclerosis, age-related
macular degeneration, rheumatoid arthritis and sepsis [29,30,31,32]. In contrast, the
roles of C5L2 are not well described; however, recent reports suggest that C5L2 might
act as an anti-inflammatory receptor [120]. Interestingly, mice lacking C5L2 receptor
release more TNF- and IL-6 in response to immune complex mediated injury
29
compared to wild types [120]. However, overexpresion of C5L2 inhibited LPS-induced
IL-6 production, suggesting anti-inflammatory potential of C5L2 [123].
2.7 Role of cytokines in inflammation
Cytokines are group of cell-signalling peptides that based on their functions
belong to different subgroups, including lymphokines, interleukins, monokines,
chemokines and interferons [124]. Generally, cytokines are classified as pro-
inflammatory or anti-inflammatory in function. Tumour necrosis factor-, interleukin
family (IL-1, 6, 8, 12, 15, 18 and 38), interferon (IFN)-γ and M-CSF are pro-
inflammatory cytokines while IL-10 and TGF-β are anti-inflammatory (Figure 2.8)
[125]. The main characteristics of all cytokines include that they: i) have a short life
span, ii) produced by various cells, iii) exhibit redundancy, iv) modulate immune
responses, v) are recognised by specific receptors, and vi) act synergistically with other
cytokines, often amplifying their activities [124].
30
Figure 2.8: Role of cytokines in inflammation. Cytokines produced by macrophages,
including TNF-, IL-1, IL-6 and IL-8 are potent inducers of inflammation and also
promote the differentiation of naive Th0 cells into Th1 and Th2 cells. They also activate
ECs and SMCs. On the other hand, the anti-inflammatory cytokines IL-10 and TGF-β
are produced by macrophages and promote Treg cell differentiation; adapted from Ait-
Outfella et al. and sourced from American Heart Association, Inc. [124].
2.7.1 Tumour Necrosis Factor-α
Tumour Necrosis Factor- is a pleiotropic cytokine that is expressed by different
cell types and shows diverse biologic effects [126]. TNF- is synthesised as pro-TNF-
and cleavage of mature TNF- from leukocytes relies on matrix metalloproteinase
(MMP) activation [127]. TNF- secretion is rapidly increased in response to LPS
exposure, infection and trauma, and is a prototypic pro-inflammatory molecule,
perpetuating the expression of other inflammatory cytokines including interleukins and
interferons [72]. TNF- acts via binding to two transmembrane receptors: TNF
receptor 1 (TNFR1) and TNF receptor 2 (TNFR2). TNFR1 is constitutively expressed
in mammalian tissue, whereas TNFR2 is mainly expressed in the cells of the immune
31
system. Both TNFR1 and 2 contribute to TNF--mediated cellular responses including
cytotoxicity, up-regulation of NF-B, increased proliferation of lymphoid cells and up-
regulation of adhesion molecules and cytokine genes [72,126].
TNFR signalling is suggested to play a role on LPS-induced production of iNOS by
macrophages, promoting macrophage migration to the site of inflammation [126]. TNF-
also prolongs macrophage survival in sepsis and increases MCSF-mediated
macrophage proliferation [126]. Furthermore, enhanced production of TNF-α
contributes to endothelial dysfunction by mitigating NO-mediated dilation of coronary
arterioles via activation of the c-Jun N-terminal kinases (JNK) pathway and increasing
production of superoxide via xanthine oxidase [128].
2.7.2 Interleukin-1
The term interleukin (IL)-1 refers to two cytokines: IL-1α and IL-1β. IL-1 was first
identified as a fever-inducing substance released by activated leukocytes. IL-1 is
secreted by various cells including monocytes, macrophages, ECs and SMCs and
induces a broad spectrum of biological responses [129,130]. Both IL-1 and IL- are
synthesised as precursors: pro IL-1 and pro IL-1 and can be cleaved to the mature
forms: mIL-1 and mIL-1 by calpain-like protease and caspase-1, respectively [131].
IL-1 promotes recruitment of inflammatory cells at the site of injury by increasing
expression of CAMs in addition to inducing fever, hypotension and production of NO
and prostaglandin E2 via increased iNOS and COX-2 activity [131].
The inflammatory action of IL-1α and IL-1β is mediated by binding to the IL-1
receptor type 1 (IL-1R1), which is expressed on the surface of various cell types (e.g
monocytes and macrophages) [131]. Mice lacking IL-1R1 showed no induction of
fever in response to LPS and exhibit a decreased acute phase response, suggesting that
IL-1 via its receptor IL-1R1 plays a crucial role in the generation of a febrile state [132].
The activities of IL-1α and IL-1β are regulated by the IL-1 receptor antagonist (IL-
1Ra), which competitively inhibits binding of IL-1 (IL-1α and IL-1β) to its receptor. IL-
1Ra is secreted by monocytes, macrophages and neutrophils [133]. The IL-1 and IL-
1Ra ratio plays a crucial role in the maintenance of normal physiology in various organs
and tissues. Under normal conditions, the circulating IL-1Ra concentration is seven-fold
higher than IL-1 [134]. However, IL-1Ra plasma concentrations are often elevated
32
(~100-fold higher than IL-1) in patients suffering from septic shock or infections. This
observation indicates that IL-1Ra production may be important in counter-regulating the
inflammatory effects of IL-1 in sepsis [133]. The importance of IL-1Ra in counter-
regulating IL-1’s pro-inflammatory effect is demonstrated in persons with genetic
deficiency of IL-1Ra due to mutation in IL-1RN (the gene that encodes IL-1Ra).
Infants that were born with non-functional IL-1Ra exhibited an auto-inflammatory
syndrome that leads to life threatening inflammation in the skin and bones [135].
Furthermore, mice lacking IL-1Ra experience excessive inflammation and are more
prone to develop inflammation in the joints and skin [131]. In addition, recombinant IL-
1Ra has been tested in phase II and phase III clinical trials and its administration has
shown promising therapeutic effects in patients with septic shock and rheumatoid
arthritis [134]. The clear role of IL-1Ra and IL-1 on inflammatory cascades strengthens
the importance of IL-1 signalling and therapies that influence it for disease treatment.
2.7.3 Interleukin-6
Interleukin (IL)-6 is a pleiotropic cytokine that regulates various immune responses,
including haematopoiesis and induction of acute phase protein, including CRP (an
important marker of inflammation), heptoglobin and fibrinogen synthesis [136]. IL-6
was initially designated as a B-cell differentiation factor, however, it is produced by
various cells, including macrophages, ECs, SMCs, neutrophils, T and B cells, glial cells
and osteoblasts [137,138]. IL-6 production by macrophages is mediated by TLR
activation. During infection-associated inflammation, stimulation of TLRs with
pathogen associated molecules increases IL-6 production, whereas in non-infectious
inflammation, danger associated molecules stimulate TLRs to induce IL-6 production
[139,140]. IL-6 acts as both an inflammatory and anti-inflammatory cytokine. When IL-
6 is produced transiently, it protects host tissue against infection and injury. However,
persistent production of IL-6 leads to chronic inflammatory and autoimmune diseases
[138]. In healthy humans, the IL-6 concentration is very low in serum (average < 3-4
pg/mL); however, during sepsis the IL-6 concentration can increase up to 10,000 fold of
the normal level and triggers inflammation by impairing endothelial function [141].
2.7.4 Interleukin-10
Interleukin (IL)-10 is secreted by monocytes, macrophages, eosinophils,
granulocytes, T-helper type 2 (Th2) cells, and dendritic cells. IL-10 is an important anti-
inflammatory cytokine and signals through two-receptor complexes: IL-10R1 and IL-
33
10R2 [142]. IL-10 is a potent inhibitor of macrophage activation and reduces the
secretion of pro-inflammatory cytokines, chemokines and MIP-1 [143]. Furthermore,
IL-10 augments the secretion of IL-1Ra in LPS-induced human monocytes [144]. IL-10
also inhibits the activation of NF-B by preventing the degradation of IB and
subsequent translocation of NF-κB from the cytoplasm to the nucleus [143]. IL-10 also
activates PI3K signalling and downstream molecules, Akt and p70S6 kinase that
promote cell proliferation [145].
IL-10 also mitigates the expression of COX-2 and metalloproteinases, such as
MMP-2 and MMP-9, which play significant roles in aggravating inflammation
[142,143]. Therefore; IL-10 plays a crucial role in the modulation of inflammatory
disorders. Mounting evidence suggests a therapeutic role for IL-10 in inflammatory and
infectious diseases and deficiency or dysregulation of IL-10 increases the risk of
immunopathology in response to infection in addition to inducing autoimmune
disorders [146].
In summary, cytokines are crucial players in inflammation and elevated levels of
pro-inflammatory/decreased production of anti-inflammatory cytokines are associated
with varied chronic inflammatory pathologies, including atherosclerosis, acute
myocardial infarction, coronary artery disease, chronic heart failure, rheumatoid
arthritis and sepsis [72,126,138]. It remains clear that a balance between pro- and anti-
inflammatory cytokines is critical to the maintenance of human health and that the
modulation of their release can have important implications for the prevention and
treatment of acute conditions, including sepsis.
2.8 Role of haem oxygenase and haem catabolism in inflammation
Haem oxygenase (HO) catalyses the rate limiting step of haem catabolism. There
are two isoforms of HO: HO-1and HO-2 [147,148]. HO-1 is an inducible enzyme that is
expressed ubiquitously in conditions of stress and serves as a protective gene by
inducing anti-inflammatory and anti-apoptotic effects [148,149,150]. However, HO-1
acts both as inhibitor and inducer of cell proliferation, inhibiting the proliferation of
SMCs [151] and promoting the proliferation of ECs [152]. HO-2 is constitutively
expressed and found in high concentrations in the brain and testes [153,154]. HO-1 and
HO-2 are encoded by hmox-1 and -2 genes, respectively, both of which catabolise haem
to biliverdin (BV), carbon monoxide (CO) and free iron (Fe2+
) (Figure 2.9).
34
Subsequently, BV is chemically reduced to unconjugated bilirubin (UCB) by biliverdin
reductase (BVR) [155].
HO-1 is a 32 kDa protein, present in microsomes, caveoli, mitochondria and
nuclei [149]. HO-1 belongs to a larger family of stress proteins and was first identified
as heat shock protein (Hsp32) due to its transcriptional responsiveness to hyperthermia
[155]. Furthermore, the promoter region of HO-1 gene contains similar heat regulatory
elements, which were originally discovered in the regulatory regions of various other
HSPs [155]. HO-1 expression is up-regulated in response to multiple stimuli, including
LPS, UV light, ethanol, H2O2, heat shock, cobalt protoporphyrin, pro-inflammatory
cytokines, heavy metals, NO and prostaglandins [149,155].
Accumulating evidence suggests that HO-1 possesses strong cytoprotective,
immuno-modulatory and anti-inflammatory properties both in vitro and in vivo. Both
human and murine studies show that hmox-1 deficiency results in severe pathologies,
including haemolysis, anaemia, nephritis, endothelial and monocytes/macrophages
injury and systemic inflammation [156,157]. Furthermore, HO-1 deficiency increases
vulnerability to infection and susceptibility to environmental toxins [158]. For example,
deletion of hmox-1 in mice induces anaemia, hypoferremia (low levels of iron in serum)
followed by iron deposition in tissue, chronic inflammation retarded growth and
splenomegaly [159]. Furthermore, hmox-1-/-
mice are highly susceptible to LPS-
mediated mortality and hepatic injury [158]. Splenocytes from HO-1 knockout mice
secrete higher levels of pro-inflammatory cytokines, including IL-1, TNF- α, IL-6 and
IFN- upon LPS stimulation compared to their wild type counterparts [160]. In addition,
HO-1 also contributes to the maintenance of endothelial homeostasis. Endothelial cells
isolated from hmox-1-/-
mice showed greater expression of cell adhesion molecules
(VCAM-1, ICAM-1 and E-selectin) and increased levels of ROS compared to wild-type
littermates [161]. In addition, HO-1 knockout mice show increased gene expression of
MCP-1 and NF-κB activation in kidney in response to haemoglobin (i.v. 90 mg/100 g
body weight) [162]. HO-1 deficiency has also been documented in humans and was first
published in 1999 [163]. The patient was a six-year boy and had been suffering from
growth retardation and severe haemolytic anaemia since the age of two. In addition, the
patient also showed erythrocyte fragmentation, iron deposition in the kidney and liver,
asplenia, abnormalities in coagulation/fibrinolysis, disturbance in endothelial function
35
and increased systemic inflammation and died at age of six [163]. Another case of HO-1
deficiency was reported in a 15-year old girl who suffered from a high-grade fever of
six-weeks duration. During the fifth week of illness, she developed haematouria,
proteinuria and hypertension, indicating nephritis. In spite of receiving treatment, the
patient died five months later due to uncontrolled haemolysis and nephritis [157].
The importance of HO-1 in protecting from inflammation can be demonstrated
by pharmacological induction of gene expression. For example, pharmacological
induction of HO-1 by CoPPIX (cobalt 7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-
porphine-2,18-dipropanoic acid) protects mice against Propionibacterium acnes/LPS
mediated liver injury by inhibiting the proliferation of CD4+ cells and reducing the
production of Th1cytokines (IL-2, TNF-α and IFN-). These data suggest that HO-1 is
crucial for the regulation of adaptive immune responses [164]. HO-1 is also involved in
regulating monocyte migration towards oxidised products. For example, induction of
HO-1 expression with mildly oxidised low-density lipoprotein (Ox-LDL) and haemin
attenuated monocytes chemotaxis towards Ox-LDL. However, inhibition of HO-1 with
Sn-protoporphyrin IX (SnPP IX) promoted monocytes migration [165].
HO-1 is induced by stimuli that are associated with oxidative stress (e.g.
depletion of cellular glutathione). Both ROS and reactive nitrogen species (RNS) induce
redox-dependent transcription factors, including Nrf2 (nuclear factor-erythroid2 (NF-
E2) related factor), NF-κB and activator protein (AP)-1 that can modulate HO-1
expression [148]. Once activated, these transcription factors translocate into the nucleus
to bind to consensus sequences on DNA, including haem-responsive elements (HREs),
antioxidant responsive elements (AREs), stress-responsive elements (StREs) and
xenobiotic responsive elements (XREs) [150,166]. These enhancer elements contain
binding sites for different transcription factors important for HO-1 regulation [166]. For
example, StREs contain binding sites for activator protein (AP-1) [167], AREs and
XREs regulate the activity of Nrf2 [166,168]. Therefore, stress-induced activation of
redox-sensitive transcription factors stimulates the transcription of HO-1 by binding to
enhancer elements. HO-1 is also regulated by cell signalling molecules, including
PI3K/Akt and MAPK and both pathways appear to mediate the cytoprotective, anti-
inflammatory and anti-oxidants effects of HO-1 [150,169].
The salutary effects of HO-1 are attributed mainly to the products of haem
36
degradation including CO, BV and UCB (Figure 2.9) [153], which are discussed below.
Figure 2.9: Possible mechanisms contributing to the protective effects of haem
oxygenase-1. Haem is catabolised to BV, CO and Fe2+
by HO-1. Biliverdin is rapidly
reduced to UCB. Haem oxygenase-1 via BV and CO protects IRI-mediated injury by
inhibiting the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase
(COX) and NADPH oxidase activity. Both CO and BV also inhibit IRI-mediated
expression of IL-6, IL-1β and ICAM-1. Adapted from Li Volti et al. and sourced from
S. Karger AG, Basel [153].
2.8.1 Carbon monoxide
Carbon monoxide (CO) is a ubiquitous air pollutant and abundantly generated
from the burning of organic matter, combustion of coal and tobacco. Carbon monoxide
shows strong affinity for haemoglobin and myoglobin and at high doses it decreases the
capacity of blood to deliver oxygen to tissues, leading to tissue hypoxia [11,170,171].
37
However, low doses of CO are safe and apparently protective [172]. Cells and tissues
also produce CO endogenously as an elimination product of haem catabolism via HO
system [153]. The production rate of CO is approximately 20 mol/h in humans [170].
Interestingly, increased exhaled CO concentrations have been reported in critically ill
patients suffering from severe inflammation of the respiratory tract, septic shock, or
patients who underwent cardiac surgery, oesophagetomy, laryngemtomy and liver
transplant, among others [171,173,174]. It is suggested that CO generated by HO can
diffuse out of the cells and then enter the blood to form carboxyhaemoglobin [173]. CO
is then transported to the lungs where it is offloaded from haemoglobin and exhaled.
Therefore the increased CO concentration in severely ill patients could reflect the
induction of HO-1 in various organs due to systemic stress, which promotes haem
breakdown and subsequently greater CO exhalation [173,174]. Therefore, measurement
of CO concentration in exhaled air may be useful to monitor the change in HO-1
enzymatic activity [175].
Recent studies show that CO is not only a toxic gas but also possesses strong
cyto-protective and anti-inflammatory properties, demonstrating strong therapeutic
potential for treatment of lung injury, endotoxin shock, liver injury, hypertension and
transplantation associated injury and rejection and prostate cancer at the dose range of
20-400 PPM [176,177,178]Further, CO inhibited LPS-mediated activation of NF-B
and production of pro-inflammatory cytokine, GM-CSF via attenuation of IB
degradation and phosphorylation in RAW 264.7 macrophages [179]. CO also
suppressed anti-CD3 or anti-CD28 antibody-induced T-cell proliferation and secretion
of IL-2 partially via inhibition of extracellular signal regulated kinase (ERK)/MAPK
[180].
Carbon monoxide may also induce anti-inflammatory effects via two signalling
pathways: guanylyl cyclase-cyclic (c)GMP and p38 MAPK pathways [150,172]. For
example, CO reduces production of TNF-α and induces IL-10 in macrophages via
MAPK and cGMP pathways [181]. However, CO primarily binds/stimulates proteins in
which haem acts as a prosthetic group, including haemoglobin [11], myoglobin [182],
COX, iNOS [183], cytochrome p450 oxidase [184], guanylyl cyclase [185] and
NADPH [184]. Carbon monoxide interacts with the central iron group of haem within
these proteins and induces conformational changes in their structures [172]. A number
of studies show that CO mediates cytoprotective effects by inducing preconditioning,
38
which is defined as a condition of transiently increased resistance to injury and can be
triggered by sub-lethal stimuli [186,187]. Reactive oxygen species are critical for
preconditioning and are mostly generated in mitochondria [184,188]. Carbon monoxide
increases mitochondrial ROS production both in vitro and in vivo and also transiently
activates the mitochondrial transition pore [189]. Carbon monoxide also inhibits
mitochondrial membrane permeabilisation, mitochondrial transmembrane potential
depolarisation and cytochrome c release, suggesting that CO triggers protective effects
by targeting mitochondria, further supporting its role as a cytoprotective molecule
[187,190].
2.8.2 Biliverdin and unconjugated bilirubin
2.8.2.1 Bile pigment metabolism and chemistry
Bile pigments are coloured compounds derived from haem catabolism, including
bilirubin (BR); conjugated and unconjugated) and BV [191]. Biliverdin and
unconjugated BR (UCB) belong to the porphyrin family of molecules and primarily
originate from HO-mediated haem break-down [192]. In adults, ~250-300 mg of BR is
produced daily from erythroid and non-erythroid sources [193]. Approximately, 80% of
total BR is produced from the breakdown of haemoglobin in reticuloendothelial cells
[194]. The remaining BR is produced in the liver by the catabolism of other
haemoproteins, including; cytochrome, catalase, peroxidise and tryptophan pyrrolase
[18,194,195]. The first step in the haem catabolic pathway requires oxidation of haem to
α–meso-hydroxyhaem by HO. α–meso-hydroxyhaem reacts with oxygen and produce
verdohaem and CO. Verdohaem in the presence of NADPH-cytochrome-P450-
reductase reacts with oxygen, converting verdohaem into BV and free iron (Figure 2.10)
[147]. Biliverdin is then chemically reduced to UCB in the presence of BVR (Figure
2.11) [33].
Bilirubin and BV exist in three isomers: IIIα, IXα and XIIIα, with the IXα
variant representing the principle isomer found in mammals [193,196]. The IXα isomer
results from the specific oxidative cleavage of the α-meso bring (-CH=) of the haem
molecule by HO [1]. Other isomers of BR also exist, including IXβ, which is present in
neonatal urine while IXβ and IXγ are found in the bile of Gunn rats [194]. Bilirubin is
poorly water soluble because of inter-molecular hydrogen bonding, and, therefore,
requires glucuronidation for its excretion. Unconjugated BR has a strong affinity for
39
albumin and once bound is transported to the liver for conjugation [191]. In the liver,
UCB is metabolised by uridine diphosphate glucuronosyltransferase (UGT1A1) to BR
mono and diglucuronide. Conjugated BR (CB) is water soluble and excreted into bile
against a concentration gradient through multidrug resistant-related protein-2 (MRP-2),
also called ABCC2 (ATP-binding cassette sub-family C member 2), active transport
[194,197]. In the bile, CB is incorporated into micelles (with bile acids, phospholipids
and cholesterols) and passes into the intestine where CB is degraded into urobilinogens
by the intestinal microbial flora [197]. Urobilinogens are reduced to urobilins, which
contribute to the colour of urine and faeces. However, a small fraction of UCB from
bile is partially reabsorbed from the intestine and undergoes for enterohepatic re-
circulation, which can contribute to elevated UCB levels, particularly in neonates
[194,195]. Unconjugated BR is light sensitive and exposure of the skin to light (as in
treatment of neonates with elevated UCB levels) also disrupts UCB’s internal hydrogen
bonding and leads to its excretion into the bile [195]. In contrast to UCB, BV is more
hydrophilic and can be excreted unconjuagated [198]. Biliverdin is widely distributed
throughout nature and is found in insects, lower organisms and vertebrates, including
humans [9]. For example, BV can also colour some bird eggs blue-green [12], whereas
in plants, cyanobacteria and algae, BV is a biosynthetic precursor for photoresponsive
bilins, including chlorophyll [9,10]. In mammals BV is rapidly reduced to UCB,
therefore, BV is undetectable even under extreme haemolytic conditions [9]. However,
a recent study by Gafvels et al. [14] reported a case of hyperbiliverdinaemia, caused by
mutation in BVR gene. The mutation in BVR gene resulted in green jaundice,
accompanied by greenish coloration of plasma and urine [14].
40
Haem α-meso-hydroxyhaem
Biliverdin Verdohaem
Figure 2.10: Haem catabolism. Haem is oxidised by HO and produce two intermediate
compounds: α-meso-hydroxyhaem and verdohaem. These intermediates are then
metabolised to produce CO, BV and iron. Adapted from Montellano et al. and sourced
from Elsevier [147].
41
Biliverdin IXα Biliverdin Reductase Bilirubin IX α
Figure 2.11: Formation of BR. BV IXα is reduced to BR IXα in the presence of BVR.
Adapted from Zhu et al. and sourced from John Wiley and Sons [199].
2.8.2.2 Therapeutic potential
Bile pigments (UCB and BV) were previously thought as potentially toxic haem
catabolites. For example, excessive accumulation of UCB (> 200 µM) in newborn
infants causes jaundice and if the UCB concentration remains elevated and continues to
increase, it can enter to the brain and cause neuronal toxicity [200,201]. However, a
landmark study by Stocker et al. showed that UCB at low, physiological plasma
concentrations act as potential antioxidants in vitro [202]. Since then, several studies
have described beneficial effects of BV and UCB in pre-clinical models of tissue injury
and diseases, including organ transplantation, IRI and animal models of sepsis (Figure
2.12) [18]. The antioxidant and anti-inflammatory effects of BV and UCB appear to
contribute to their cytoprotective activity [19,192,197,201].
42
Figure 2.12: The cytoprotective and anti-inflammatory effects of BV and BR
against various disease models. Adapted from Wegiel et al. and sourced from
Frontiers [34].
2.8.2.2.1 Biliverdin
i) Cytoprotective effects
Several in vivo and in vitro studies show that BV protects against vascular injury
and transplant rejection. For instance, in a rat model of angioplasty (balloon injury), BV
administration (50 mg/kg, i.p.) prevented the development of intimal hyperplasia after
vascular injury. Furthermore, BV also inhibited SMC migration in vitro and prevented
EC apoptosis via inhibition of JNK phosphorylation [26]. In vitro studies also show
anti-proliferative effects of BV on VSMCs, where BV caused cell cycle arrest at the
G0/G1 phase via reduced phosphorylation of p38 MAPK and JNK 1/2 [203]. Biliverdin
also suppresses the expression of regulators of cell cycle progression, including cyclin
A, D1, E and cycle dependent kinase (cdk) 1/2, resulting in hypo-phosphorylation of
retinoblastoma tumour suppressor protein (Rb) in VSMCs [204]. Furthermore, mice
receiving BV (35 mg/kg, i.p.) showed improved survival (80%) when challenged with
43
LPS/D-galactosamine in addition to showing decreased serum alanine aminotransferase
levels [21].
Accumulating evidence also shows the protective effects of BV in animal
models of diabetes [205]. For example, in a rat model of diabetes (induced by
streptozotocin; STZ), daily dosing of BV (100mg/100g body weight, i.p.) for six weeks
decreased EC sloughing. In addition, BV administration reduced the levels of urinary 8-
epi-isoprostane PGF2α concentrations, a major component of isoprostanes and an
indicator of lipid peroxidation/oxidative stress in hyperglycemia [206]. Oral
administration of BV (20 mg/kg body weight) to db/db mice (a rodent model of type 2
diabetes) for four weeks prevented hyperglycemia and glucose intolerance. In the same
study, BV also inhibited the expression of apoptosis-related gene (Bax) and oxidative
stress as measured by markers (8-hydroxy-2′-deoxyguansosine and dihydroethidium
staining) in pancreatic beta cells [207].
Many studies show beneficial effects of BV in organ transplantation and
associated IRI injury [176]. Ischaemia-reperfusion injury induces ROS generation,
inflammation and tissue damage in organ transplantation and affects the outcome of
transplantation via causing early dysfunction of transplanted grafts [27,208].
Investigation of cardiac, lung, kidney and liver transplantation shows that BV improves
tissue graft survival and associated IRI [176,209,210,211]. For example, daily dosing
with BV (31 mg/kg, i.p.) to donor and recipient mice induced tolerance to cardiac
allografts in addition to reducing CD4+ and CD8
+ cell infiltration and T cell
proliferation [212]. Livers treated with BV (10 M and 50 M) in an ex vivo model of
IRI showed greater portal vein flow that was associated with greater bile production
[209]. Furthermore, a recent study by Andria et al. [27] also supports the therapeutic
effect of BV in transplantation showing improved liver function in both the donor and
recipients pigs. The animals were injected with single dose of BV (31 mg/kg, i.p.),
which resulted in increased bile production, urea and ammonia clearance and decreased
levels of serum aspartate aminotransferase compared to control animals [27].
ii) Antioxidant effects
Biliverdin shows antioxidant effects both in vitro and in animal models,
scavenging both ROS and RNS, including lipid peroxyl and -tocopheroxyl radicals
[19,213]. Additionally, BV at very low dose (1 M) inhibits LPS and phorbol ester-
mediated oxidative burst in neutrophils, and also reduces mitochondrial superoxide
44
formation [214]. These data are supported by in vivo evidence demonstrating that BV
reduces a number of radical species formed in the Trolox Anti-oxidant Capacity
(TEAC) assay and the Ferric Reducing Ability of Plasma (FRAP) assays [215].
In animal models of transplantation, BV administration (50 mg/kg, i.p.) showed
down-regulation of SITx-induced expression of manganese superoxide dismutase
(MnSOD) in addition to decreasing tissue malondialdehyde (MDA) levels, indicating
protection from oxidative stress [208]. In lung grafts from brain dead rat donors, BV (35
mg/kg, i.p) significantly reduced MDA levels and MPO/SOD activities, improving the
outcome of lung transplantation [216].
iii) Anti-inflammatory effects
Biliverdin also plays an important role in inhibiting inflammatory process both
in vivo and in vitro. Administration of BV (35mg/kg) intraperitoneally prevented LPS-
induced lung and liver injury in rats by decreasing gene expression of TNF-α, IL-6 and
IFN-γ [217]. Biliverdin at 5 mg/kg abrogated CLP (caecal ligation and puncture)-
mediated mRNA induction of IL-6 and monocyte chemoattractant protein (MCP)-1 and
increased mRNA expression of IL-10 in the small intestine [218]. Intravenous
administration of BV (35 mg/kg) prior to haemorrhagic shock and resuscitation reduced
lung injury in rats via attenuation of TNF-α and iNOS gene expression [219].
Furthermore, BV (100 M) inhibited IL-2 and IFN- production by cultured mice
splenocytes in response to anti-CD3 and anti-CD28 [212]. In another study, BV (50
mg/kg, i.p.) significantly improved survival of recipients in a small intestinal transplant
(SITx) model in rats which was related to attenuation of mRNA expression of iNOS,
COX2, ICAM and pro-inflammatory cytokines (IL-6 and IL-1) [208]. Biliverdin-
induced protection in transplantation and sepsis is likely mediated by modulation of NF-
B expression in tissues, which contributes to the regulation/expression of the above
inflammatory modulators [26,210,212,216].
Growing evidence suggests the anti-inflammatory effects of BV in vitro,
protecting from endotoxin shock. For example, 10 M BV reduced LPS induced IL-6
production in RAW 264.7 macrophages and mouse lung ECs [217]. In addition, BV
also decreased the TNF-α induced transcriptional activity of NF-B and DNA binding
in human embryonic kidney cells in a concentration and time dependent manner [220].
45
Wegiel et al. showed [21] that BV (50 M) increases IL-10 production in RAW 264.7
cells partially via induction of cell surface BVR and phosphorylation of Akt.
Furthermore, BV significantly decreased TLR-4 mRNA expression in both RAW 264.7
and bone marrow derived macrophages, the effects were partially mediated via eNOS
activity [28], supporting the anti-inflammatory effects of BV.
In summary, both the in vitro and in vivo studies show that BV administration is
robustly associated with inhibition of inflammation and consequent pathology. Many of
these effects are lost when depletion of BVR is induced [21,28]. Therefore, it is
important to consider that BV might exert its cyto-protective effects either via BVR
activity or via secondary UCB generation.
2.8.2.2.2 Unconjugated bilirubin
i) Cytoprotective effects
Mildly elevated UCB concentrations in humans are associated with protection
from cardiovascular and other diseases underpinned by chronic inflammation. For
example, a large epidemiological study by Horsfall et al. [24] provides the most
convincing evidence of UCB protection showing that mortality rates in individuals with
Gilbert’s syndrome (GS; n=4,266) were half those a normobilirubinaemic comparison
cohort (n=21,968). Gilbert’s Syndrome is associated with a mildly elevated serum UCB
concentration ( 1mg/dL; 17.1 µM), which is caused by a mutation in the UGT1Al
gene promoter [22]. Horsfall et al. [23] also showed in another cohort study (> 500,000
participants) that each 0.1 mg/dL (1.71 M) increase in serum UCB levels in males was
associated with 8% and 6% decreased incidence of lung cancer and chronic obstructive
pulmonary disease, respectively, in addition to 2-3% reduction in all cause mortality.
Similar associations are also demonstrated in several additional epidemiological studies
showing that individuals with normal or mildly elevated plasma/serum UCB levels (>10
µM), including GS, have a reduced prevalence of atherosclerosis, diabetes, metabolic
syndrome and stroke compared to subjects with lower UCB concentrations
[22,221,222,223]. These observations have generated a hypothesis that UCB may be an
important haem catabolite, in contrast to earlier assumptions that it might be a useless or
toxic by-product in humans.
Animal and in vitro studies support cytoprotective functions of UCB. For
examples, higher blood concentrations of UCB (50-350 µM) in Gunn rats (an animal
46
model of hyperbilirubinaemia due to autosomal recessive deficiency of UGT1A1)
suppressed the development of neointimal hyperplasia after balloon injury compared to
wild type rats [204]. Furthermore, administration of UCB (10 M) before and during
IRI in the isolated perfused rat kidney system resulted in significant improvement in
vascular resistance, glomerular filtration rate and urine output in addition to increased
creatinine clearance and decreased fractional excretion of sodium [224]. Similarly,
infusion of isolated perfused hearts with 0.1 M UCB before ischaemia increased
cardiac functional recovery to 87% after 60 min reperfusion compared to 65% in
untreated hearts [225]. Unconjugated BR also suppresses proliferation of VSMCs in a
dose-dependent manner via inhibition of cell cycle progression and attenuation of p38
MAPK phosphorylation, suggesting that it might inhibit atherogenesis [204].
Many experimental and clinical studies support the salutary role of UCB in
diabetes and vascular complications associated with diabetes. For example, Gunn rats
showed improved glucose tolerance, decreased activation of NADPH oxidase
components (NOX4, p22phox and p67phox) and NO in the pancreas within the STZ
induced diabetic model [226]. Similarly, pre-treatment of the rat insulinoma cell line
(RIN-mF5) with 1.71 M UCB attenuated STZ-mediated apoptosis and H2O2
production [226]. Additionally, higher serum total BR levels were related to protection
from diabetes in a study performed by US National Health and Nutrition Survey in
16,000 subjects. In this study, subjects with serum total UCB levels above than 10 M
had a 20% reduced risk of developing diabetes compared to those with less than 10 M
[227]. In addition, administration of UCB using single (8.5 µmol/kg) or daily dose (17
µmol/kg/day) to islet donors (DBA/2 mice) improved long-term survival in islet
recipients (B6AF1 mice) [228]. Gunn rats are also protected from transplantation
mediated IRI and demonstrate improved survival of cardiac grafts. For example, 42 %
of cardiac grafts survived for >7 days in Gunn rats (serum UCB conc. 79 M) as
compared to 0% in controls (serum UCB conc. <2 M) [229].
ii) Antioxidant effects
An imbalance between oxidant production and anti-oxidant potential within
tissues results in oxidative stress. Unconjugated BR demonstrates potent antioxidant
activity against ROS generated by various oxidants, including metals (CoCl2, Cu2SO4
and CdCl2), UV radiation and drugs (menadione and acetaminophen) [202,230]. Both
47
UCB and BR ditaurate (BRT, synthetic analogue of BR diglucuronide) show
antioxidant capacity in in vitro systems, both of which inhibit peroxyl and peroxynitrite
radical-induced oxidation of human plasma, attenuating protein tyrosine nitration and
tryptophan oxidation [19,214,231,232].
Several in vivo studies demonstrate the translation of UCB’s antioxidant effects
in rodents and humans. For example, GS individuals with elevated UCB levels show
reduced susceptibility of serum to Cu2+
induced oxidation and improved antioxidant
status [192]. Further, GS individuals show reduced circulating Ox-LDL and protein
carbonyl concentrations and improved GSH:GSSG (reduced:oxidized glutathione) ratio
compared to non-GS controls [233]. Additionally, Gunn rats are also resistant to the
development of thiobarbituric acid-reactive substances (TBARS) and protein carbonyl
compared to their non-jaundiced counterparts after exposure to three days of hyperoxia
[234].
iii) Anti-inflammatory effects
An additional mechanism of UCB-induced cytoprotection might include its
strong anti-inflammatory and anti-apoptotic activity. For example, in vivo and in vitro
studies show that UCB protects against transplantat rejection and LPS challenge.
Unconjugated BR decreased mRNA expression of caspase-3 and -8, MCP-1, TNF-α,
iNOS, Fas, TNF-related apoptosis-inducing ligand (TRAIL-R), BID and IFN-γ inducing
protein-10 (CXCL10) in islet grafts [228]. In addition, the islets recipient mice treated
with UCB showed enhanced expression of TFG-, IL-10 and FoxP3 [235].
Furthermore, mice injected with single bolus injection of UCB (40 mg/kg, i.v.)
recovered from LPS (2 mg/mL)-mediated endotoxic shock compared to control mice.
Furthermore, LPS-induced expression of IL-1β and ICAM-1 and VCAM-1 expression
in mice were also reduced in UCB treated animals [236]. In addition, UCB (100 mg/kg,
i.p.) alleviated experimental autoimmune encephalomyelitis (EAE, a T-cell mediated
autoimmune disease) and halted disease progression in mice [237]. The same study also
showed that UCB suppressed T-cell proliferation and activation, accompanied by
decreased production of both Th1 and Th2 cytokines (IL-2, IL-10 and IFN-) and
reduced expression of co-stimulatory molecules (CD80 and CD86) in macrophages and
DCs of naive mice [237]. Gunn rats also show protection against LPS-induced
inflammation, reducing expression of iNOS in renal, myocardial and aortic tissues
48
[238]. In addition, the cardiac grafts transplanted to Gunn rats had significantly lower
levels of MDA and reduced mRNA expression of inflammatory mediators (TNF-α, IL-
6, iNOS, COX-2 and MCP-1) [229]. In contrast to this, a recent cohort study by
Wallner et al. [25] showed a concentration-dependent relationship between IL-1 levels
and UCB in both GS and control groups. For example, GS subjects with a UCB
concentration above than 17.1 M showed a marginal though, significant increase in
basal plasma levels of IL-1 (2.07 pg/mL in control vs. 2.21 pg/mL in GS) [25].
However, multiple regression analysis revealed that UCB concentrations up to 17.1 M
in control subjects were associated with decreased IL-1 concentration (r = -0.355, P <
0.05), suggesting that a UCB concentration ≥17.1 M might heighten inflammation in
vivo [25]. Similarly, neutrophils isolated from umbilical cord and adult blood showed
increase in IL-1 release at baseline when exposed to UCB (10-300 M) [239].
Unconjugated BR also induces immunosuppressive effects in leukocytes,
lymphocytes and granulocytes in vitro. Infusion of UCB decreased the number of
antibody (plaque)-forming cells in the mouse spleen when exposed to sheep
erythrocytes [240,241]. At higher concentrations (100-200 µM), UCB attenuates
cytotoxic T-lymphocyte activity in vitro and also inhibits concanacalin A (ConA) or
anti-CD-3 mAb-stimulated T-cell proliferation in mice splenocytes, via suppression of
costimuatory molecule CD28 and inhibition of NF-B activation [237]. In contrast to
this, UCB (30 mg/kg) protected rats from endotoxin-mediated hepatoxicity in part via
reduction of iNOS expression; however, this treatment had no effect on NF-κB
expression. The same study also reported inhibitory effects of UCB on iNOS and no
suppressing effect on NF-κB expression in LPS-stimulated RAW 264.7 macrophages
[242]. Furthermore, unbound UCB concentrations of 15 or 30 nM (prepared in serum
free media) inhibited TNF-α induced iNOS expression and reduced nitrite production in
murine heart ECs [243]. Similarly, UCB (50 M) ameliorated the expression of LPS-
induced iNOS and NO in RAW 264.7 macrophages compared to a vehicle treated group
[242]. In addition, monocytes isolated from umbilical cord blood and treated with UCB
at very high concentrations (102.6, 153.9, 220.6 and 307.8 μM) for one hour prior to
LPS stimulation showed reduced TLR-4 expression [244].
An additional inhibitory effect of UCB, relevant to inflammation, includes its
complement inhibitory activity [245]. Unconjugated UCB (0.3-2 mg/100 g), when
49
given to rats before infusion with sheep erythrocytes prevented complement haemolytic
activity in serum. In addition, UCB also attenuated the increase in haemoglobin
concentration in plasma and urine when compared to a control group [246].
Furthermore, UCB (10 M) also protects human umbilical vein ECs against
complement-mediated lysis by increasing the expression of decay accelerating factor
(DAF) [247]. DAF is a complement inhibitory protein that promotes the dissociation of
the C3 and C5 convertase complex, formed in classical and alternative pathway
activation and is found ubiquitously on the outer cell surface of epithelial and
endothelial cells [248].
2.8.3 Ferritin
Haem degradation by HO also leads to release of iron. Iron is a crucial molecule
and is involved in number of cellular process, including ATP generation, detoxification
and oxygen transport [155,158]. Dietary deficiency of iron causes anaemia, while
functional hypoferremia also results in anaemia, observed in chronic inflammatory
diseases [158]. However, free iron is a potent oxidant and induces toxicity to cellular
organisms due to its ability to generate free radicals. Iron in its free state (ferrous form;
Fe2+
) participates in Fenton or Haber-Weiss reactions (redox reactions), in which iron
reduces H2O2 to generate hydroxyl radicals [249]. Therefore, excess cellular iron needs
to be transformed into an inert form to prevent the formation of radical species, leading
to oxidative damage. Ferritin, an iron storage protein plays a crucial role in iron
regulation [250]. Ferritin is comprised of 24 symmetrically related subunits, including
a heavy ferritin chain and a light ferritin chain [251]. Iron is stored in its ferric form
(Fe3+
; oxidised form) in ferritin and can be released when cellular iron levels are low
[252]. Several studies show cytoprotective effects of ferritin. For example, exposure of
ECs to haem leads to heavy chain ferritin induction, which then protects ECs against
oxidative stress [253]. Furthermore, increased expression of ferritin induced by
haemoglobin also protected mice against hypoxia in a model of hyperoxic lung injury
[254]. Finally, rats treated with heavy chain ferritin were protected from liver
transplant-associated IRI and oxidative stress [251]. It should be noted that ferritin
studies show protection from haem overload. However, the relevance of ferritin
treatment in preventing/treating non-haemolytic diseases remains unknown.
50
2.9 Biliverdin reductase
Bilirverdin reductase (BVR) has been regarded for many years solely as an
enzyme responsible for conversion of BV to UCB. However, recent studies have
demonstrated new features of BVR, including a role for it in cytoprotection and cell
signalling [255]. Two isoforms of BVR: BVR A and B are expressed in adulthood and
embryogenesis, respectively [9]. BVR is abundantly present in all tissues with the
highest expression in macrophages of the spleen and liver under basal conditions.
Interestingly, BVR can also be induced by its substrate BV, in addition to endotoxin,
heavy metals, cytokines, hypothermia and ROS [21,33,256]. Therefore, BVR, similarly
to HO-1, is placed in the category of stress-responsive genes [33]. Biliverdin reductase
is localised in different cellular compartments, including cytoplasm, endoplasmic
reticulum (ER), mitochondria [257], nucleus [256], and cell membrane [21]. Reduction
of BV to UCB by BVR occurs in many cellular compartments; however, the majority of
this reactivity is detected in the ER and cell membrane [21]. Additionally, BVR present
on the cell membrane of macrophages and ECs is crucial for inducing both enzymatic
and cell signalling effects, which are regulated by phosphorylation or nitrosylation of
BVR [28,258]. Biliverdin reductase is not exclusive to mammals and is evolutionarily
conserved. For example, BVR is present in cyanobacteria and also present in metazoa,
and a homolog of mammalian form is also present in red algae, where BVR regulates
phycobilprotein synthesis [9,33]. Recently, Molzer et al. [259] showed the appearance
of UCB in agar plates in Salmonella reverse mutation assay, which were supplemented
with BV, suggesting that BVR must be expressed in Salmonella typhimurium bacteria.
2.9.1 Structure of BVR
As mentioned previously, BVR exists in two isoforms: A and B. The isoform
BVR A catalyses the regiospecific addition of hydrogen to –HC (10) = C-N = group of
BV-IX [9]. BVR A is a unique enzyme due to its ability to recognise one of two
cofactors for catalysis; NADH is used in the acidic pH range of 6.7-6.9 and NADPH is
used in the basic pH range of 8.7 [260]. Additionally, BVR A is a monomeric protein
and consists two structural domains: the N-terminal dinucleotide binding domain
(Rossmann fold), including the catalytic site for NADPH and NADH while the C-
terminal domain with six beta-strands and eight helices is cysteine rich and bind metals
ions, notably Zn2+
[9,260,261] and plays a crucial role in cell signalling (Figure 2.13)
[262]. BVR A reduces the -meso (C10) bridge of BV-IX by using two electrons from
51
a pyridine nucleotide cofactor, and forms a ternary complex with BV and NAD(P)H [9].
Human BVR A is encoded by a single copy of gene with four introns and five exons
and has a molecular mass of 33.5 kDa, consisting of 296 amino acids [261]. On the
contrary BVR B has a minor role in metabolism and catalyses the reduction of IX and
IX isomers of BV. Furthermore, BVR B also reduces BV-IX to UCB-IX, which
exists in significant concentrations within fetal bile, suggesting that haem catabolism is
different in utero than in adults [9,260].
52
Figure 2.13: Structure of hBVR (human biliverdin reductase). hBVR contains one
N-terminal domain, which includes the sequences, required for catalytic function and is
also called the reduction domain. This domain catalyses the reduction of BV to BR. The
C-terminal domain contains the sequences crucial for kinase/cell signalling activity of
BVR, containing six residues with Zn-binding domains; adapted from Gibbs et al. and
sourced from Frontiers [262].
53
2.9.2 Functions of BVR
Biliverdin reductase exhibits a diverse spectrum of functions including
apoptosis, metabolism, regulation of gene expression and cell signalling [33,34]. Recent
studies show that BVR has protective effects and promotes scavenging of free radicals
via generation of UCB. As little as 10 nM UCB efficiently protects against a 10,000
fold higher concentration (100 M) of H2O2 [263]. The high efficacy of UCB as an anti-
oxidant suggests a cytoprotective amplification loop exists in which UCB is oxidised to
BV by ROS, which is reduced back to UCB by BVR [264]). However, this concept was
recently questioned by McDonagh [265], who showed that BV is a minor product of
UCB in its reaction with alkylperoxyl radicals. These data suggest that UCB is
dehydrogenated to BV only under specific non-physiological conditions (e.g excess
H2O2, quinones, FeCl3 in strong mineral acid) [196,263,265].
However, several studies demonstrate cytoprotective effects of BVR, which are
lost after knockdown of BVR. For example, ablation of BVR by RNA interference leads
to cell death and oxidative stress in response to H2O2 and 2’, 7’-
dichlorodihydrofluorescein in HeLa and SH-SY5Y cells, respectively [263,266]. Lack
of BVR also promotes the development of a pro-inflammatory phenotype in
macrophages with increased expression of LPS-induced TNF-α and basal expression of
TLR-4 [28]. Biliverdin reductase is also involved in protection from hypoxia and
reoxygenation injury. For example, Song et al. [267] showed that hypoxia induces both
protein and mRNA expression of BVR in a time-dependent manner in pulmonary
arterial smooth muscle cells (PASMCs). Hypoxia-mediated BVR expression then
protected PASMCs from hypoxia-induced apoptosis, nuclear shrinkage, DNA
fragmentation and mitochondrial depolarisation in UCB-dependent manner via
activation of ERK ½ pathway. However, the protective effects of BVR/UCB were lost
after silencing BVR using small interfering RNA (siRNA) [267]. Furthermore, rats
treated with BVR i.t. (intrathecal injection) at different doses (2.5, 5 and 10 g/day)
showed delayed onset of EAE than rats treated with similar doses of traditional
antioxidant enzymes (SOD, HO-1, catalase, glutathione reductase), suggesting BVR is a
therapeutic molecule in autoimmune disorders [266].
Biliverdin reductase is a leucine zipper protein and acts as a transcription factor.
Biliverdin reductase has a similar structure to stress-induced transcription factors,
54
including AP-1 family of transcription factors such as c-jun, c-fos, myelocytomatosis
viral oncogene (cMyc) and activated transcription factor-2 (ATF-2) [33,268]. AP-1
forms homo- or hetro-dimers and binds to DNA in response to oxidative stress.
Biliverdin reductase similarly to AP-1 transcription factors drives HO-1 gene
transcription [269]. Additionally, Ahmed et al. showed that hBVR in its dimeric form
binds to a 100-mer DNA fragment of mouse HO-1 promoter region encompassing two
AP-1 sites [268]. The hBVR-DNA complex then activates the HO-1 gene. However,
COS (African green monkey kidney fibroblast-like cell line) cells transfected with
antisense hBVR showed decreased HO-1 gene expression in response to oxidative
stress, suggesting that hBVR plays a crucial role in HO-1 gene regulation [268].
Recently, Wegiel et al. [28] showed that BV inhibits TLR-4 expression via direct
interaction of BVR with AP-1 sites on TLR-4 promoter. The same study also showed
that BVR is rapidly S-nitrosylated in response to BV and LPS through eNOS derived
NO, dependent upon Ca2+
/calmodulin-dependent kinase activity. This modification of
BVR resulted in nuclear translocation of BVR and binding to the TLR-4 promoter and
repressesion of TLR-4 expression. This effect was lost in macrophages derived from
mice lacking eNOS, suggesting that S-nitrosylation of BVR is crucial for protective
effects of BV-BVR [28]. S-nitrosylation is one form of cysteine modification
(posttranslational modification), and modulates the function of various inflammatory
proteins including NF-B and TLR-4 [270,271].
Biliverdin reductase also influences cell-signalling pathways. Maines and
colleagues [33,258] showed that BVR is a theronine/serine/tyrosine phosphoprotein and
requires phosphorylation to reduce BV to UCB. In addition, the tyrosine198
-
methionine199
-lysine200
-methionine201
(YMKM) motif in BVR acts as a substrate for
insulin receptor tyrosine kinase (IRK) as well as phosphorylation of insulin receptor
substrate (IRS-1/2) proteins, regulating glucose uptake and insulin signalling [255].
Furthermore, BVR is a modulator of protein kinase C, which links the two arms of
insulin /insulin growth factor (IGF)-1 signalling: the MAPK and PI3K pathways (Figure
2.14). These kinases together play a crucial role in regulating proliferation, cell death
and survival, modulation of ion channels tumour development, mRNA stability and
translation of pro-inflammatory cytokines genes within leukocytes [104,255,272].
Recently, Wegiel et al. [21] showed that BVR is induced on the cell surface (referred as
BVRsurf) of macrophages in response to LPS stimulation. Cell surface BVR mediates
55
BV induced anti-inflammatory effects via activation of the PI3K pathway [21]. Wegiel
et al. [21] also suggested that the tyrosine198
motif of BVR present on cytosolic domain
resembles the binding motif of platelet derived growth factor for the receptor for the
p85 sub-unit of PI3K. Therefore, BV/BVRsurf cross phosphorylates within YMKM
motif, which enables BVRsurf to interact with PI3K-P85 to drive Akt phosphorylation
[21].
In conclusion, BVR has emerged as a remarkable molecule, playing an
important role in preventing oxidative stress and inflammation, in addition to
influencing transcription and cell signalling pathways. This molecule may, therefore,
provide a new target for therapeutic development.
56
Figure 2.14: Signalling cascade initiated by BVR in response to extracellular
stimuli and their role in induction of gene expression. BVR is a modulator of protein
kinase C and in response to oxidative stress it modulates two main branches of
insulin/insulin growth factor (IGF-1): MAPK (ERK1/2, JNK and p38) and PI3K
(PDK1/2, mTOR, PKB). Both MAPK and PI3K are crucial for stress-induced
transcription factor activation (c-Jun, c-Fos, ATF-2 and NF-κB).
57
2.10 Phosphatidylinositol 3-kinase and inflammation
Phosphatidylinositol 3-kinase is a crucial component of intracellular signalling
and is activated in response to TLR-ligands [273], G-protein coupled receptor
activation, including C5a and C5aR and growth factor coupled tyrosine kinases [274].
The PI3K family consists of three classes of kinases: I, II and III and is highly
conserved from yeast to mammals [275,276]. The class I PI3Ks are divided into two
subclasses: class IA and class IB PI3Ks. The IA class is composed of three isoforms;
PI3K, PI3K and PI3K whereas class IB PI3K has one isoform: PI3K [277]. PI3Ks
transmit signals via tyrosine kinase-coupled receptors and consist of a p110 catalytic
subunit associated with p85, p85, p55, p55 and p50 regulatory subunits.
However, class IB PI3K does not have a p85 subunit [275]. Class I PI3K plays an
important role in regulating many cellular functions, including cell proliferation, cell
survival, apoptosis, adhesion, cell migration and inflammatory responses [275]. All the
three isoforms (PI3K, PI3K and PI3K) are ubiquitously expressed by leukocytes, T-
cells, B-cells and mast cells among others [276]. However, the PI3K isoform is mainly
expressed by leukocytes [277,278]. To date, three mammalian isoforms, PI3KC,
PI3KC and PI3KC of the class II family have been identified. It is suggested that
PI3KC and PI3KC function downstream of receptor tyrosine kinases, cytokine
receptors and integrin receptor and are involved in cell signalling [279,280]. However, a
precise cellular function for PI3KC has not yet been discovered [275]. The class III of
PI3K has one catalytic subunit called vascular-protein-sorting protein (Vsp34p), which
appears to play a role in lysosomal membrane trafficking [281,282].
The PI3Ks catalyse the phosphorylation of phosphatidylinositol-4,5-
bisphosphate (Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns
(3,4,5)P3), which recruits downstream kinase, Akt (Figure 2.15) [276,283]. Both PI3K
and Akt are key players in leukocytes (e.g neutrophils and macrophages) signalling and
are involved in cell survival, cell migration and chemotaxis [276]. In addition, PI3K
also negatively or positively regulates the production of both pro- and anti-
inflammatory cytokines [284]. For example, ablation/inhibition of PI3K decreases
production of IL-10 and augments production of pro-inflammatory cytokines IL-1 and
IL-12 in monocytes and dendritic cells [284,285,286]. Additionally, inhibition of PI3K
decreases survival time in CLP-induced polymicrobial sepsis [287]. Mice lacking PI3K
activity also possessed elevated serum levels of IL-1, TNF-α, IL-6, IL-10, IL-12 in a
58
model of experimental sepsis [287]. Mice deficient in PI3Kγ or inhibition of PI3Kγ
reduces recruitment of neutrophils and macrophages towards peritonitis (induced by
bacterial injection), in addition to decreasing chemokine RANTES expression
[288,289]. In addition, C5a has been shown to activate phosphorylation of Akt in
murine macrophages [122]. Inhibition of PI3K with wortmannin or 2-(4-morpholinyl)-
8-phenyl-chromone (LY294002) inhibits macrophage chemotactic migration towards
C5a [122]. Moreover, inhibitors of PI3K have emerged as promising therapeutic targets
and have also entered clinical trials [274]. Several studies show that pharmacological
inhibition of PI3K prevents the progression of inflammatory and autoimmune disorders,
including rheumatoid arthritis, systemic lupus erythematosus and atherosclerosis
[274,276].
A number of signalling pathway also exist downstream of PI3K/Akt. For
example, mammalian target of rapamycin (mTOR) (Figure 2.15), a serine/threonine
kinase downstream of PI3K and is a central regulator of protein synthesis and cell
proliferation [290]. mTOR was identified and cloned after the findings of two genes:
TOR1 and TOR2 in the budding yeast Saccharomyces cerevisiae during a resistance
screen to rapamycin (immunosuppressant drug) [291]. mTOR initiates translation of
mRNA via activation of p70S6 kinase (p70S6K) and inhibition of initiation factor 4E-
binding protein 1 (4E-BP1) (Figure 2.15) [290,292]. p70S6 kinase then phosphorylates
the S6 protein of the 40S ribosomal subunit and initiates protein synthesis [293]. mTOR
and its downstream signalling molecules are activated by LPS whereas rapamycin
abolished their phosphorylation [290]. Studies by Weichhart et al. [290] showed that
inhibition of mTOR with rapamycin suppressed production of IL-10 and increased IL-
12 secretion in human peripheral blood mononuclear cells (PBMCs) in response to LPS
exposure, suggesting immuno-modulatory effects of mTOR. Rapamycin blocked the
LPS-mediated production of chemokine MCP-1 in monocytes [290], suggesting that the
mTOR pathway is also important for cell migration. Furthermore, mice treated with
rapamycin are protected against Listeria monocytogenes infection and these mice also
exhibit reduction in granulomatous lesions of the liver [290]. Rapamycin is a potent
immunosuppressant with both in vitro and in vivo studies showing that rapamycin
inhibits B- and T-cell proliferation in response to cytokines, alloantigen and mitogen
exposure [294,295]. Rapamycin also improves survival rates and reduces acute graft
rejection in animal and clinical studies [295,296], suggesting rapamycin maybe an
effective therapeutic target in organ transplantation.
59
In conclusion, PI3K and the associated downstream kinase mTOR are crucial
molecules that regulate inflammatory processes and associated inflammatory disorders.
60
Figure 2.15: PI3K and downstream kinases. GPCRs and TLRs present on immune
cells activate PI3K, which then phosphorylates phosphatidylinositol-4,5-bisphosphate
(Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns (3,4,5)P3), leading
activation of Akt. Akt activates mTOR, which regulates protein synthesis by
phosphorylating p70S6 kinase to S6 and inhibits initiation factor 4EBP-1.
2.11 Sepsis and inflammation
Sepsis is a disease caused by systemic infection and is characterised by exacerbated
inflammation [297]. Sepsis contributes to 1.5 % of deaths per year and is the 10th
most
common cause of mortality in the United States [298]. Sepsis can be caused by infection
of the lung, abdomen or genitourinary system that spreads to the blood stream and
61
contributes to ~80% of cases of sepsis [42]. Infection with gram-positive bacteria and
polymicrobial infections account for 30-50% and 25% of cases of sepsis, respectively
[299,300,301]. Patients with sepsis show delayed hypersensitivity, inability to clear
infection and increased levels of numerous pro-inflammatory cytokines in
serum/plasma, leading to the generation of a ‘cytokine storm’ and organ dysfunction
[42,302]. The uncontrolled inflammation and bacterial expansion in sepsis cause
injuries to host tissues by promoting the migration of leukocytes from blood stream to
inflamed tissues (e.g. lung), resulting in increased expression/production of TLRs and
complement receptors, cytokines, chemokines and their receptors [42,297]. This
inflammatory reaction is commonly associated with profound hypotension, which
threatens organ perfusion and is a leading cause of mortality in septic patients
[298,303]. in the later phase of sepsis plays a crucial role in sepsis-induced mortality.
The pathogenesis of sepsis involves several factors that interact in a chain of events
from pathogen recognition to overwhelming host response. Several studies show the
involvement of TLRs in sepsis and patients/animal with sepsis show increased
expression of TLR-2 and TLR-4 [304]. For example, CLP-induced experimental
peritonitis increases the expression of TLR-2 and TLR-4 in lung, liver and splenic
macrophages as compared to sham-operated mice [305,306]. In addition, TLR-4
expression in mouse alveolar ECs promotes neutrophil recruitment into the lungs after
LPS administration, leading to tissue injury [307]. Furthermore, TLRs promote sepsis
via inducing the production of pro IL-1, which is then activated by caspase-1 to its
active extracellular form IL-1 [297]. Caspases are crucial for apoptosis, cellular
regulation and inflammation and mice deficient in caspase-1 show protection against
sepsis [297], suggesting IL-1 activation via caspase-1 is critical for aggravating
inflammation in sepsis.
Toll like receptors also interact with the complement system, with complement
activation augmenting TLR ligand-mediated cytokines production [308], triggering
further inflammation in sepsis. The activation of TLRs leads to elevated expression of
both C3aR and C5aR [309]. Additionally, the engagement of complement in sepsis
increases the plasma and serum levels of C3a, C5a and C5b-C9 [310]. The excessive
generation of C5a in sepsis induces a number of effects on different immune cells. For
example, C5a paralyses neutrophils and increases the host’s susceptibility to infection
[32]. In the case of macrophages, C5a increases the secretion of pro-inflammatory
62
cytokines including TNF-α and IL-6 by macrophages, followed by increased production
of IL-8 and tissue factor by ECs [32,311]. Furthermore, C5a induces apoptosis of
thymocytes, resulting in deficiency of B-cells and CD4+ T-cells in septic patients [113].
C5a also promotes adverse effects in sepsis via binding to its receptor C5aR, the
expression of which is remarkably increased in several organs [114,118].
Accumulating evidence shows that increased expression of TLR-2, TLR-4 and
cytokines activates rapid movement of NF-B p50:p65 dimers to the nucleus, which
further increases production of pro-inflammatory cytokines and leads to multiple organ
failure in sepsis [93]. In addition, animals exposed to LPS or bacteria via
intraperitoneal, inhaled or intravenous routes show activation of NF-B in lung tissue,
which results in increased expression of iNOS and systemic hypotension [312,313].
Furthermore, increased activation of NF-κB and increased levels of NF-B dependent
cytokines (TNF-α, IL-1 and IL-8) have also been reported in patients with sepsis or
sepsis-mediated acute lung injury [314].
Following systemic inflammation, compensatory anti-inflammatory response
(CARS) occurs, which leads to dysfunction of immune cells in sepsis [315,316].
Current studies provide compelling evidence of sepsis-mediated immunosuppression
and changes in immune cell profiles [317], particularly during the later periods of sepsis
(72 h after diagnosis of sepsis) [318]. For example, splenocytes from septic patients
show decreased cytokine production compared to those from healthy controls after in
vitro stimulation with LPS or anti-CD3/anti-CD28 [319]. Furthermore, depletion of
CD4, CD8 T-cells and monocytes, and an increased percentage of Treg cells have been
reported in splenocytes and in cells isolated from the lungs of septic patients [319].
These studies indicate that patients who survive hyper-inflammatory phase of sepsis
undergo profound immunosuppression, which reduces the ability to combat invading
pathogens and promotes the development of secondary infections [320]. Accumulating
evidence suggests that nearly two-thirds of deaths from sepsis occur due to secondary
infections [315]. Therefore, immunosuppression occurring in the later phase of sepsis
plays a crucial role in sepsis-induced mortality.
Summarising, inflammation and immunosuppression are central to the pathologic
sequelae of sepsis and associated organ dysfunction, leading to the activation/release of
63
a myriad of inflammatory molecules and compounds. We hypothesise that BV/BVR
may inhibit the activation of many of these inflammatory molecules and therefore could
represent a promising therapeutic agent against sepsis.
64
This chapter has been published by Biochemical and Biophysical Research
Communications as an original investigation. The abbreviations, formatting and
referencing of this document have been changed slightly to more closely reflect the
formatting of other chapters in this thesis.
Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer A.
C. Biliverdin modulates the expression of C5aR in response to endotoxin in part via
mTOR signaling. Biochemical and Biophysical Research Communications. 449: 94-99
(2014).
Chapter 3 Biliverdin modulates the expression of C5aR in response to
endotoxin in part via mTOR signalling
65
3.1 Abstract
Macrophages play a crucial role in the maintenance and resolution of
inflammation and express a number of pro- and anti-inflammatory molecules in
response to stressors. Among them, the complement receptor 5a (C5aR) plays an
integral role in the development of inflammatory disorders. Biliverdin and bilirubin,
products of haem catabolism, exert anti-inflammatory effects and inhibit complement
activation. Here, we define the effects of biliverdin on C5aR expression in macrophages
and the roles of Akt and mammalian target of rapamycin (mTOR) in these responses.
Biliverdin administration inhibited lipopolysaccharide (LPS)-induced C5aR expression
(without altering basal expression), an effect partially blocked by rapamycin, an
inhibitor of mTOR signalling. Biliverdin also reduced LPS-dependent expression of the
pro-inflammatory cytokines TNF- and IL-6. Collectively, these data indicate that
biliverdin regulates LPS-mediated expression of C5aR via the mTOR pathway,
revealing an additional mechanism underlying biliverdin’s anti-inflammatory effects.
Key words: Macrophage, inflammation, mTOR
66
3.2 Introduction
Biliverdin (BV), a molecule with tetrapyrrole structure, is derived from haem
catabolism via haem oxygenase (HO) activity and is rapidly reduced to bilirubin (BR)
by biliverdin reductase (BVR) [21,198]. Both BV and BR are antioxidants [215],
though, have been regarded previously as waste products. Recent findings, however,
have begun to elucidate diverse protective roles for these molecules [34,233]. Biliverdin
shows strong cytoprotective activities in various in vitro and in vivo models of vascular
injury, ischemia-reperfusion injury and organ transplantation, demonstrating its
therapeutic potential [217,219]. We recently reported that BV reduces the expression of
toll like receptor-4 (TLR-4) in murine macrophages via nitric oxide-dependent
activation of BVR [28]. TLRs transmit signals to induce pro-inflammatory cytokine
expression via NF-B [321] and synergise with C5aR (CD88) to aggravate
inflammatory responses to endotoxin [322]. TLR-ligands are dependent on complement
activation and C5aR regulates TLR-4 signalling, supporting the importance of C5aR in
promoting inflammation [308].
Complement is a major component of innate and adaptive immunity. Similar to
TLRs, complement is also activated by pathogen associated molecular patterns,
including LPS, among many other mechanisms involved in classical, lectin and
alternative activation pathways [107,112]. Complement activation induces pathogen
opsonisation and generation of the anaphylatoxins: C3a and C5a, which stimulate
inflammatory responses by binding to respective C3aR and C5aR receptors [107].
Excessive inflammation mediated by complement activation contributes to various
diseases, including sepsis, asthma, Alzheimer’s disease and atherosclerosis
[29,107,112]. Therefore, it is important to identify molecules that regulate or attenuate
complement-mediated inflammation. Both BV and BR ameliorate complement-
mediated haemolysis by inhibiting the classical pathway of complement activation at
the C1 step via physically interacting with complement proteins [245,247]. However,
BV’s effect on the expression of complement receptors and mechanisms underlying this
regulation remains unknown.
The present study thus assessed the effects of BV and the PI3K/mTOR pathways
on C5aR expression in primary and immortalised macrophages. Data reveal that BV
inhibits LPS-dependent C5aR expression, in part via mTOR signalling.
67
3.3 Material and methods
3.3.1 Cell Culture and Treatment
RAW 264.7 mouse macrophage cell line was purchased from ATCC (USA). RAW
cells were cultured (<15 passages) in RPMI-1640 medium supplemented with 10% fetal
bovine serum, 100 U/mL penicillin and 100 µg/mL streptomycin (Life Technologies,
Grand Island, NY, USA; complete medium). Cells (1.5 X 105 cells/mL) were seeded on
60 mm Sterilin tissue culture plates or 6 well plates (Thermo Scientific, Logan, UT,
USA) in 3 mL of complete medium and incubated at 37 °C (5% CO2) for 24 h prior to
experimentation. Cells were then untreated or challenged with 100 ng/mL of LPS for 24
h in the absence or presence of freshly prepared biliverdin hydrochloride (10 or 50 µM;
Frontier Scientific, Logan UTA, USA) in 0.01 % DMSO as previously described [21].
Re595 LPS from Salmonella Minnesota (Sigma-Aldrich, St. Louis, MO, USA) was
dissolved in DPBS (Life Technologies) and used at a final concentration of 100 ng/mL.
Rapamycin (Sigma-Aldrich) was used as selective inhibitor of mTOR [291] and was
applied to sub-sets of cells (10 nM in 0.01 % DMSO final concentration) 1 h prior to
LPS or BV treatment. Biliverdin and related tetrapyrroles are photo sensitive, therefore,
all BV containing solutions were protected from light. Appropriate vehicle control
experiments were also completed.
For PI3K inhibiton, RAW 264.7 cells were pre-treated with LY294002 (LY, PI3K
inhibitor; Sigma Aldrich, USA) for 30 min. LY294002 was dissolved in DMSO at 10
µM in 0.01% DMSO final concentration. Samples were treated for 30 min with BV or
LPS after LY treatment for pAkt and for 24 h for C5aR expression.
3.3.2 Isolation of Bone Marrow-Derived Macrophages
7-8 week old C57BL/6 mice were purchased from Jackson Laboratories
(Jackson Laboratories, Bar Harbour, Maine, USA). All animals were held under
pathogen free conditions. Prior to completion, experiments were approved by the Beth
Israel Deaconess Medical Centre (BIDMC) Animal Care and Use Committee. Bone
marrow-derived macrophages (BMDMs) were isolated as previously described [21].
Macrophages were harvested after 5 days and were then cultured for 24 h in RPMI
medium supplemented with 10 % FBS and 5 % Antibiotic-Antimycotic (Life
68
Technologies) prior to experimentation. Cells were then treated with 50 M BV and
100 ng/mL LPS for 24 or 48 h.
3.3.3 RNA Extraction and qRT-PCR
Total RNA was isolated from cultured cells using RNeasy®
Plus Mini Kits
(Qiagen, Chadstone, VIC, Australia) according to manufacturer’s instructions. One
microgram of RNA was reverse transcribed into cDNA using a first strand cDNA
synthesis kit (Thermo Scientific). HPRT and GAPDH were used as reference genes
based on their stability of expression determined by geNorm analysis as described
below. Primers for mouse GAPDH, HPRT, C5aR, TNF-α, and IL-6 were designed
using Primer Quest Software (Table 3.1, Sigma-Aldrich). qRT-PCR was performed with
Applied Biosystems SteponeTM
and Stepone PlusTM
Real-Time PCR Systems (Life
Technologies). Each sample was run in triplicate and cycle threshold (CT) values were
imported into Microsoft Excel for geNorm analysis.
Gene
target
Forward sequence Reverse sequence Amplicon
size (bp)
GAPDH TCAACAGCAACTCCCACTCTTCCA ACCCTGTTGCTGTAGCCGTATTCA 115
HPRT AGGAGTCCTGTTGATGTTGCCAGT GGGACGCAGCAACTGACATTTCTA 134
C5aR TCATCCTGCTCAACATGTACGCCA TCTGACACCAGATGGGCTTGAACA 93
TNF-α TCTCATGCACCACCATCAAGGACT ACCACTCTCCCTTTGCAGAACTCA 92
IL-6 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT 134
Table 3.1. Primer sequences and amplicon sizes of housekeeping (GAPDH and HPRT)
and target genes (C5aR, TNF-α and IL-6) expressed in RAW 264.7 cells.
3.3.4 qRT-PCR Calculation using Genorm Analysis
qRT-PCR data was normalised by the use of geNorm algorithm as described by
Vandesompele et al. [323]. Briefly, the geNorm application determines the most stably
expressed and thus most accurate reference genes for the normalisation of qRT-PCR
data. The geometric mean of ∆CT expression for GAPDH and HPRT was calculated to
obtain the normalisation factor for each sample. The expression of each candidate gene
69
for each sample was normalised to the combined reference genes. The ∆CT (difference
between cycle threshold values) expression was then calculated for each gene in each
sample. The relative expression for each candidate gene was calculated by dividing the
∆CT of target gene for each sample by the normalisation factor of GAPDH and HPRT
within the same sample.
3.3.5 Sources of Antibodies
The following antibodies were used for western blotting analyses where
indicated: rabbit anti-phospho-Akt (Ser473), rabbit anti-Akt, rabbit anti-phospho-S6
Kinase (Ser235/236), anti-rabbit IgG and anti-mouse IgG (Cell Signalling, Beverly,
MA, USA) and mouse anti--actin (Sigma-Aldrich). For flow cytometry experiments,
PE-conjugated anti-mouse CD88 antibody (C5aR) and PE-labeled anti-rat IgG
(Biolegend, San Diego, CA, USA) were used.
3.3.6 Flow Cytometry
After harvesting and washing RAW 264.7 or BMDM cells with DPBS, cells
were stained with anti-mouse CD88 antibody or anti-rat IgG at 1 µg/106 cells for 30 min
at 4 °C. Cells were immediately analysed using a FACS Caliber flow cytometer (Becton
and Dickinson, San Jose, CA, USA) using the FL-2 channel. Mean fluorescence
intensity (MFI) was calculated using CellQuest ProTM
software (Becton and Dickinson).
3.3.7 Western Blot
Cell lysates were prepared in ice-cold RIPA buffer (50 mM Tris-HCl, [pH 7.4],
50 mM sodium fluoride, 150 mM NaCl, 1% Nonident P40, 0.5 M EDTA [pH 8.0]) and
the protease inhibitor cocktail Complete Mini (Roche, Indianapolis, IN, USA). Samples
were centrifuged at 14,000 g at 4 °C for 20 min and supernatants were collected. Protein
concentrations of supernatants were measured using a BCA protein assay kit (Thermo
Scientific). Forty micrograms of each protein sample was then electrophoresed on
NuPAGE 4-12% Bis-Tris Gel (Life Technologies) in NuPAGE MES SDS running
buffer (Life Technologies) for 90 min at 100 V. The membranes were blocked with 5%
non-fat dry milk in 1 x Tris buffered saline buffer (TBS; Boston Bio Products, Ashland,
MA, USA) for 1 h and then probed with appropriate primary antibodies (diluted at
1:1000 in 1 x TBS with 5 % non-fat milk) overnight at 4°C. Membranes were then
washed in 1 x TBS buffer and thereafter membranes were incubated with horseradish
70
peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:5000 in 1 x TBS
with 5 % non-fat milk for 1 h at room temperature. Membranes were visualised using
Super Signal West Pico chemiluminescent substrate (Thermo Scientific) or Femto
Maximum Sensitivity Substrate (Thermo Scientific), followed by exposure to
autobioradiography film (BioExpress, Kaysville, UT, USA). Precision Plus ProteinTM
KaleidoscopeTM
protein standard (Bio Rad, Hercules, CA, USA) was used to confirm
the molecular size of target proteins.
3.3.8 ELISA Analysis
The concentrations of cytokines were measured in cell culture media using
commercially available ELISA kits from eBioscience (Kensington, SA, Australia) for
IL-6 and R&D Systems (Gymea, NSW, Australia) for TNF- as per manufacturer’s
instructions.
3.3.9 Statistical Analysis
All data are reported as mean ± S.E. Statistical analysis was performed using
one-way repeated measures ANOVA (posthoc Tukey test; Sigmastat, Ver. 11.0). If the
data set lacked either normal distribution or equal variance, data were log10 transformed
to obtain normally distributed data. P < 0.05 was considered significant.
71
3.4 Results
3.4.1 Biliverdin inhibits the expression of C5aR in murine macrophages
qRT-PCR analysis showed that neither 10 or 50 µM BV modified basal expression
of C5aR in RAW 264.7 cells (Figure 3.1A and Figure 3.2A). However, the LPS-
dependent increase in C5aR gene expression at 24 h was significantly decreased by 50
M BV (Figure 3.2A; P < 0.05). Treatment with 10 µM BV at the time of LPS
stimulation failed to significantly block C5aR gene expression at 24 h (Figure 3.1A),
indicating a concentration-dependent inhibition of LPS induced C5aR expression by
BV.
Next, we tested whether BV inhibited C5aR protein expression. RAW 264.7 cells
were treated with 10 or 50 µM BV 100 ng/mL LPS for 24 h and cell surface
expression of C5aR was analysed. Biliverdin at 10 µM did not significantly affect LPS-
dependent C5aR gene and cell surface expression (Figure 3.1A and B), however, BV at
50 µM significantly inhibited LPS-induced C5aR expression (Figure 3.2B, P < 0.05).
These data are in agreement with other published reports showing that 50 µM BV is
necessary to induce anti-inflammatory effects [21,28]. Therefore, a concentration of 50
µM was chosen for investigating BV’s effect on cell signalling and LPS-mediated
inflammation. To confirm BV’s effects in primary macrophages, BMDMs from mice
were also incubated with 50 µM BV and 100 ng/mL LPS for 24 and 48 h. LPS
significantly increased C5aR expression by ~40 % at 48 h compared to control and BV
abrogated this effect (Figure 3.2C, P < 0.05). In summary, BV consistently decreased
both C5aR gene (24 h) and protein expression (24-48 h) in primary and immortalised
macrophages.
One mechanism by which BV exerts effects in macrophages is via PI3K/Akt
signalling [21]. We, therefore, next tested whether the inhibitory effect of BV on C5aR
expression was PI3K-dependent. To block PI3K signalling, cells were pre-incubated
with LY294002 (LY, 10 μM) for 30 min prior to 50 µM BV or LPS stimulation. To
confirm that LY inhibits downstream targets of PI3K, pAkt expression was determined
in RAW 264.7 cells treated with 50 µM BV or LPS for 30 min. As shown in Figure
3.1C and D, BV/LPS-induced phosphorylation of Akt was blocked by LY. To assess the
effects of LY on C5aR expression, experiments were performed over 24 h due to strong
effects of BV at this time point (Figure 3.2A and B). However, LY blocked the LPS-
dependent induction of C5aR gene and protein (Figure 3.1E and F), indicating PI3K
72
may play an integral role in mediating C5aR expression in response to LPS. The role of
PI3K on BV-mediated changes on C5aR gene and protein expression in the presence of
LPS could thus not be determined (Figure 3.1E and F; P = 0.286 and P = 0.083,
respectively).
Figure 3.1: Biliverdin reduces C5aR expression and the effects were independent
of PI3K/Akt signaling. (A) Gene expression and (B) cell surface expression of C5aR in
RAW 264.7 cells, treated with BV (10 μM) ± LPS (100 ng/mL) for 24 h. (C and D)
Protein expression of pAkt and Akt in RAW 264.7 cells, pre-incubated with or without
LY prior to BV (50 μM) and LPS treatment. (E) Gene and (F) protein expression of
C5aR in RAW 264.7 cells, pre-incubated with LY and thereafter treated with LPS or
BV (50 μM) for 24 h. The data are representative of two independent experiments.
Value represents mean ± S.E., n=3/group. *P < 0.05 versus non LPS control (0.01%
DMSO), &P < 0.05 versus LPS control and #P < 0.05 versus no LY LPS control.
73
Figure 3.2: Biliverdin inhibits C5aR expression. RAW M were treated BV (50 M)
± LPS for 24 h. (A) Gene and (B) cell surface expression of C5aR in RAW M. (C)
74
Cell surface expression of C5aR in BMDM M treated with BV and LPS for 24 and 48
h. Data are representatives of three independent experiments. Value represents mean ±
S.E. n=3/group, *P < 0.05 vs. non LPS control (0.01 % DMSO) at 24 h and 48 h and &
P
< 0.05 vs. LPS control at 24 and 48 h.
3.4.2 Biliverdin induces the phosphorylation of Akt and S6 and inhibits C5aR
expression in macrophages in part via mTOR signalling
Having established that BV activates the PI3K-Akt signalling axis [21], we next
evaluated the activation of pAkt and pS6 (downstream of mTOR) in response to BV in
RAW 264.7 macrophages. As shown in Figure 3.3A-D, both 50 M BV and 100 ng/mL
LPS increased Akt and S6 phosphorylation in a time-dependent manner.
75
Figure 3.3: Biliverdin enhances phosphorylation of Akt and S6. RAW 264.7 M
were treated with BV and LPS for different time points and protein expression of pAkt,
Akt (A and B) and pS6 (C and D) were analysed. Blots are representative of at least two
independent experiments.
Next, we sought to determine whether inhibition of the mTOR pathway with
rapamycin would modulate the effects of BV on C5aR expression. RAW 264.7 cells
were incubated with 10 nM rapamycin for 1 h prior to treatment with 50 μM BV or
LPS. As shown in Figure 3.4A, phosphorylation of S6 in response to BV and LPS was
blocked in the presence of rapamycin. Furthermore, rapamycin treatment increased the
basal expression of C5aR (Figure 3.4B), indicating the possibility that S6 negatively
regulates C5aR expression. LPS significantly increased C5aR expression and this effect
was not dependent on mTOR signalling (Figure 3.4B). However, BV decreased LPS-
induced C5aR expression in a rapamycin-dependent manner (Figure 3.4B), implicating
mTOR signalling in BV’s inhibitory effect. In summary, BV stimulates signalling
downstream of PI3K and mTOR. Although some similarities in LPS and BV signalling
exist, blocking mTOR signalling attenuates BV’s inhibitory effect on C5aR gene
expression.
76
Figure 3.4: Biliverdin modulates C5aR expression in part via mTOR signalling.
RAW 264.7 M were pre-incubated with rapamycin for 1 h and thereafter treated with
BV or LPS for 15 min or 24 h for pS6 and C5aR expression, respectively. (A) Protein
expression of pS6 and (B) cell surface expression of C5aR in RAW 264.7 cells. The
data are representative of three independent experiments. Value represents mean ± S.E.
n=3/group, #P < 0.05 vs. no rapamycin control (0.01 % DMSO), *P < 0.05 vs. no
rapamycin and no LPS control (0.01 % DMSO), &
P < 0.05 vs. no rapamycin and LPS
control and &#
P < 0.05 vs. no rapamycin BV + LPS group.
3.4.3 Biliverdin suppresses the release and expression of complement-
associated pro-inflammatory cytokines
We next evaluated the effects of BV on the expression of the pro-inflammatory
cytokines (TNF- and IL-6) in RAW 264.7 macrophages. LPS significantly increased
TNF- and IL-6 mRNA expression (~6- and ~200-fold, respectively) at 24 h, and these
responses were significantly inhibited by BV (Figure 3.5A and B, P < 0.05).
ELISA analysis of both cytokines showed that LPS significantly increased TNF-
and IL-6 concentrations in cell culture supernatants at 24 h (P < 0.05), while, BV only
reduced IL-6 levels in response to LPS (Figure 3.5D, P < 0.05).
77
Figure 3.5: Biliverdin attenuates complement associated pro-inflammatory
cytokines. mRNA expression of TNF- (A) and IL-6 (B) and protein concentration of
TNF- (C) and IL-6 (D) were analysed in RAW 264.7 macrophages, incubated with
BV±LPS for 24 h. The data are representative of two independent experiments. Value
represents mean ± S.E. n=3/group, *P < 0.05 vs. no LPS control (0.01 % DMSO) and
&P < 0.05 vs. LPS control.
78
3.5 Discussion
The present study provides novel insights into the anti-inflammatory effects of BV,
demonstrating that BV consistently decreases LPS-mediated C5aR gene and protein
expression in RAW 264.7 cells and BMDMs. This inhibitory effect of BV was partially
mediated via the mTOR pathway and was accompanied by decreased expression of
complement associated pro-inflammatory cytokines.
PI3K/Akt negatively regulates LPS signalling and inhibition of the PI3K pathway
augments LPS-induced responses, including the activation of NF-κB and TNF- gene
expression [324]. A novel and unexpected finding of this report is that pharmacological
inhibition of PI3K with LY attenuated LPS-induced increases in C5aR expression,
suggesting that PI3K signalling may be necessary for C5aR expression. Two studies
show that inhibition of PI3K with LY inhibits C5a induced chemotactic migration of
macrophages [122,325], which may be related to inhibition of C5aR expression as
reported here. However, LY’s inhibitory effects exist beyond PI3K signalling [326].
Therefore, it is also possible that LY blocked C5aR expression via a PI3K-independent
mechanism. Since LY’s effects are rather non-specific, we chose a more specific
downstream inhibitor of PI3K signalling [290,291], rapamycin, to determine whether
BV’s effect on C5aR was PI3K/mTOR dependent.
Rapamycin pre-treatment blocked BV and LPS-mediated phosphorylation of S6 (a
downstream signalling molecule of mTOR, which plays an important role in protein
synthesis) [290]. However, inhibition of mTOR signalling did not influence LPS-
induced C5aR expression, indicating that LPS likely regulates C5aR through a different
signalling pathway, such as NF-κB signalling [89]. On the other hand, BV inhibition of
LPS-induced C5aR was partially mitigated in the presence of rapamycin, suggesting
that BV inhibits C5aR in part via activation of the mTOR pathway.
The C5a-C5aR axis cross-talks with TLR-4 [308] and C5a via C5aR
concentration-dependently increases LPS-induced secretion of pro-inflammatory
cytokines, including IL-6 and TNF- in human monocytes [327]. Therefore, the effects
of BV on TNF- and IL-6 were also explored. While BV significantly downregulated
LPS-induced mRNA expression of both cytokines at 24 h, only IL-6 and not TNF-
protein levels were reduced by BV. TNF- gene expression and synthesis/release are
79
regulated via different pathways [328]. Activation of macrophages with LPS leads to
rapid cytosolic accumulation of TNF- mRNA via activation of the NF-κB pathway
[329]. However, TNF- is initially expressed as pro-TNF- and release of mature
TNF- from leukocytes relies on matrix metalloproteinase (MMP) activation, which
promotes cleavage of mature TNF- from pro-TNF- [127]. Furthermore, TNF-
mRNA is short-lived (~46 min) and does not contribute to rapid increases in TNF-
release by RAW macrophages upon LPS activation [328]. Therefore, it is likely that BV
inhibits TNF- transcription, via inhibition of NF-κB [212,217], yet does not prevent
activation of MMP-induced cleavage and release of TNF-. These data and conclusions
are consistent with reported in vivo findings, which show that BV only decreases
mRNA expression of TNF- and does not influence serum levels of TNF- in
endotoxin/transplantation challenged animals [217,219]. However, BV significantly
decreased IL-6 expression and secretion. We suggest that BV may decrease IL-6 by
inhibiting activation of C5aR since C5aR antagonists reportedly decrease LPS-mediated
release of cytokines including IL-6 by monocytes, macrophages and thymocytes
[327,330].
Both LPS and BV induce BVR, which rapidly converts BV to BR [21]. Both in
vitro and in vivo studies show rapid conversion of BV to BR over time [21,217].
Furthermore, in vivo studies suggest that BV may inhibit LPS-induced responses via BR
generation [217]. Furthermore, our group has previously shown that BR concentration
increases by 33% of the BV concentration after exogenous administration in rats [198].
Therefore, if future studies were to increase blood BV concentration to 50 M, blood
BR levels would likely increase ~ 15 M, approximating the range seen in Gilbert’s
syndrome (≤17 μM) [22]. Such an increase in BR may be associated with
immunomodulation, including reduced IL-6 and increased IL-1β expression [25,239].
However, whether BV’s anti-inflammatory effects are influenced by BR are still debated
and require further investigation. In this study, 50 µM BV consistently inhibited effects
of LPS on C5aR gene expression after 24 h of incubation, with effects of 50 µM BV
statistically significant. These effects are consistent with inhibition of C5aR protein
expression at 24 and 48 h. We speculate that the lower 10 µM concentration of BV is
more rapidly reduced to BR [21], reducing BV availability for BVR activity/signalling.
At the higher 50 µM concentration, BV induces prolonged S6 phosphorylation and
modulation of C5aR expression. These data suggest a threshold concentration of BV of
80
50 µM is necessary to activate kinase signalling and evoke changes in protein synthesis
[21,331].
Furthermore, several in vitro studies have shown that LPS increases expression of
C5aR in different cells, including rat alveolar epithelial cells [332], mouse endothelial
cells [333] and RAW264.7 macrophages [334], supporting the in vitro findings
presented in this chapter. Importantly, in vivo studies reported increase in C5 and C5a
levels in BAL and plasma, respectively after LPS infusion [335,336], suggesting that
LPS activates complement proteins. However, heating of serum inactivates complement
proteins, including C5a [337]. Therefore, any C5a generated in vitro must have been
derived from LPS-activated leukocytes. C5a via C5aR can then stimulate expression
and release of cytokines by leukocytes [309,327]. Therefore, future studies are required
to investigate the effect of co-incubation of BV and C5aR antagonists on LPS-induced
cytokine expression and release, to determine whether BV inhibits cytokine expression
and release via reducing C5aR expression. Although in vivo studies have shown
increased plasma levels of C5a after LPS administration future studies are required to
measure C5a concentrations in heat inactivated serum, to determine the importance of
leukocytes C5a release in supporting the inflammatory effect of LPS in vitro.
In conclusion, this is the first report to show that BV significantly inhibits LPS-
induced C5aR expression in primary and immortalized macrophage cell lines, an effect
that is partially mediated via mTOR signalling. Biliverdin also reduced pro-
inflammatory cytokine expression, which may be related to C5aR inhibition. We
propose that inhibition of C5aR by BV provides a previously unknown anti-
inflammatory mechanism, supporting BV’s role as an endogenous anti-inflammatory
molecule that serves to re-establish homeostasis and protect against transplant rejection
and endotoxic shock. Taken together, we propose that BV may offer unique therapeutic
avenues for treating sepsis and shock.
81
The work in this chapter is presented in an international conference in the form of an
oral presentation (please see below). This chapter is currently in the process of
submission.
Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.
Conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by
C5a dependent mechanism. 43rd
Annual Scientific Meeting, Australasian Society for
Immunology, Wellington, New Zealand, from 2nd
to 5th
December 2013.
Chapter 4 Conditional deletion of biliverdin reductase in myeloid cells
promotes chemotaxis by C5a dependent mechanism
82
4.1 Abstract
Biliverdin reductase (BVR) is a pleotropic enzyme, which has cytoprotective
and immunomodulatory effects in various cell types. In this study, we investigated the
role of BVR in regulating macrophage phenotype and function by assessing expression
of complement receptor 5a (C5aR), inducible nitric oxide synthase (iNOS) and TNF-
as well as chemotaxis in response to complement 5a (C5a). Bone marrow derived
macrophages (BMDMs) from BVRfl/fl
and CreLyz:BVRfl/fl
mice (conditional deletion of
BVR in myeloid cells) that were treated with endotoxin and IFN-γ or IL-4 in the
presence or absence of neutralising antibody against C5aR were studied.
Expression of C5aR was measured by flow cytometry and real-time PCR.
Macrophages isolated from CreLyz:BVRfl/fl
mice expressed higher cell surface and gene
expression of C5aR (P < 0.05) compared to BMDM from BVRfl/fl
(P < 0.05). In
addition, conditional deletion of BVR resulted in enhanced chemotaxis towards C5a.
Furthermore, endotoxin and IFN--induced macrophage polarisation towards the
classical phenotype (M1) was significantly increased in BMDM from CreLyz:BVRfl/fl
mice (P < 0.05) These effects were blocked in the presence of neutralising antibody
against C5aR, indicating an important role of C5aR in mediating the effects of BVR.
In summary, BVR deletion regulates macrophage chemotaxis in response to C5a
via the modulation of C5aR expression. In addition, macrophages lacking BVR express
an M1 phenotype with elevated gene and protein expression of iNOS and TNF-
release that depends, in part, on C5aR signalling.
Key words: Macrophage activation, C5aR, chemotaxis, and iNOS.
83
4.2 Introduction
Biliverdin reductase (BVR) is a multifunctional enzyme, which mediates the reduction
of biliverdin (BV) to bilirubin (BR) [9,33]. The conversion of BV to BR occurs in many
cellular compartments; however the majority of this reactivity is detected in the ER and
cell membrane [258]. Recently, we showed that BVR present on the surface of
macrophages is critical for mediating anti-inflammatory effects of BV through Akt-IL-
10 signalling [21]. Biliverdin and BVR induce cytoprotective effects in various cells
and in vivo models [28,266]. For example, deletion of BVR by RNA interference
promotes cell death and oxidative stress in response to 2’, 7’-dichlorodihydrofluorescein
diacetate in HeLa and SH-SY5Y cells [263,266]. Lack of BVR also leads to the
development of a pro-inflammatory phenotype in macrophages, characterised by
elevated production of TNF- due to increased basal expression of TLR-4 [28].
Complement is an important constituent of innate and adaptive immunity [108].
The main function of complement is to eliminate pathogens by opsonisation and
permeabilisation of foreign particles and is also involved in the clearance of apoptotic
and necrotic cells [109,110]. Activation of complement by one of the four pathways:
classical, lectin, alternative and protease generate anaphylatoxins (C3a and C5a) and
activate their receptors (C3aR, C5aR and C5L2) [114]. Among them, the C5a-C5aR
axis is important during inflammation-associated pathologies such as ischaemia
reperfusion injury (IRI), neurodegenerative disorders, atherosclerosis, rheumatoid
arthritis and sepsis [29,30,32]. Therefore, therapeutics that can regulate the activation of
C5a and its receptor could represent promising treatments against complement-
associated disorders. Biliverdin has shown cytoprotective effects in animal models of
IRI and sepsis [27,176,217]. It has been suggested that BV imparts anti-inflammatory
effects via BVR-mediated activation of IL-10 via phosphatidylinositol 3-kinase (PI3K)-
dependent mechanism [21]. We have recently shown that BV inhibits the expression of
C5aR in RAW 264.7 macrophages in part via mTOR [338]. Whether BV-BVR axis can
regulate functional activation of C5aR remains unknown.
Macrophages, first identified as phagocytic cells, are now well recognised as
regulators of both innate and adaptive immunity as well as crucial mediators of
haematopoiesis, apoptosis, malignancy, vasculogenesis and reproduction [339].
Macrophages can be polarised into two different phenotypes in response to LPS and
84
cytokines in vitro [340]. Stimulation of macrophages with LPS and IFN-γ results in
their polarisation towards the M1, classically activated, phenotype. Whereas, IL-4
drives macrophage polarisation towards the M2 phenotype [45,55,73,341]. M1
macrophages express high levels of iNOS and are associated with acute responses to
pathogen presentation and inflammation [342], while M2 macrophages are associated
with the wound healing process and chornic inflammation [341].
In the present study, we isolated the bone marrow derived macrophages
(BMDMs) from BVRfl/fl
and CreLyz:BVRfl/fl
mice and evaluated the expression of C5aR
and macrophage chemotaxis towards C5a. Furthermore, we investigated the effect of
BVR deletion on macrophage phenotype in response to M1 and M2 stimuli and whether
C5aR was critical for their phenotypic switch dictated by BVR. We show that
conditional deletion of BVR resulted in increased expression of C5aR and accelerated
chemotaxis towards C5a. Moreover, macrophages lacking BVR expressed an M1
phenotype, which induction was partially dependent C5aR activation. In summary, we
show that BVR and C5aR are crucial for regulating macrophage chemotaxis and
polarisation in response to inflammatory stimuli.
85
4.3 Material and methods
4.3.1 Generation of BVRfl/fl
mice
BVRfl/fl
mice were generated (Wegiel et al., recently presented in abstract form)
in the laboratory of Dr. Wegeil and Dr. Otterbein at BIDMC, Harvard Medical School,
Boston. Briefly, a targeting construct was designed based on a PGK Neo FRT/loxp
vector. A targeted sequence of exons IV and V of the mouse BVR gene was inserted
into the SacII site, which is located upstream of the neomycin resistance gene and that
are flanked by two loxp sites. The fragment of 3’ (part of intron IV) arm and 5’ (exon
V) arm of homology were inserted outside the loxp sites between Hpa-I and Sal-I sites,
respectively. The blunt-end cloning was applied for all of the inserts. The construct was
linearised with Not-I and electroporated into embryonic stem (ES) cells (Children’s
Hospital Core Facility, Harvard Medical School, Boston, MA). Six colonies were
determined to be positive (out of 192) for homologous recombination by southern blot
and PCR. Homozygote BVRfl/fl
mice were crossed with Cre-Lyz mice to generate a
myeloid linage with specific knockout of BVR. Deletion of BVR was confirmed by
qPCR and western blot. The primers sequeces for BVR are provided in Table 4.1 and
rabbit anti-BVR antibody was used for western blot.
4.3.2 Stable transfection of RAW 264.7 cells with mir-bvr shRNA
RAW 264.7 cells were stably transfected as described previously [28]. Briefly,
microRNA adapted short hairpin RNA (shRNA) against BVR was generated from a
pSM2 vector (Open Biosystems, USA). shRNA BVR was subcloned to MSCV-
LTRmir30-PIG (LMP) vector (Open Biosystems, USA) with XhoI and EcoRI
restriction enzymes (Life Technologies). Cloning was verified by restriction site
analysis and sequencing. For production of retrovirus, HEK293T cells were transiently
transfected with shRNA BVR-1-LMP, VSVG, and Gag-Pol plasmids by using
Lipofectamine 2000 (Life Technologies, USA). Medium with viruses were collected at
12 h and the supernatants were used for transduction of RAW 264.7 cells. After 14 h
incubation with viruses, RAW cells were selected with 5 g/ml of puromycin (Sigma-
Aldrich) for one week and the knockdown of BVR was tested by Western blot and
qPCR.
86
4.3.3 Isolation of bone marrow-derived macrophages
C57BL/6 (Jackson Laboratories, Bar Harbour, Maine, USA), BVRfl/fl
controls
and CreLyz: BVRfl/fl
(conditional deletion of BVR in myeloid cells) mice were used at 7-
8 weeks of age. All animals were held under specific pathogen free conditions and the
experiments were approved by the BIDMC Animal Care and Use Committee. BMDMs
were isolated as previously described [21]. Briefly, BMDMs were isolated from the
femur by cutting and washing the bones with RPMI medium (Thermo Scientific, Logan,
UT, USA) supplemented with 5% Antibiotic-Antimycotic (Anti-Anti; wash medium;
Life Technologies, Grand Island, NY, USA). Isolated cells were differentiated with
mouse recombinant M-CSF (ProSpec, East Brunswick, NJ, USA) at a final
concentration of 20 ng/mL in RPMI medium supplemented with 15 % FCS and
antibiotic and antifungal solution (Anti-Anti) for five days (M-CSF medium). The
medium was changed to fresh M-CSF medium on the third day of culture. Macrophages
were harvested after five days and were then cultured for 24 h in RPMI medium
supplemented with 10 % fetal calf serum (FCS; Atlanta Biologicals, Flowery Branch,
GA, USA) and 1 x Anti-Anti prior to experimentation. For macrophage polarisation
experiments, cells (1.5 x 105 cells/mL) were treated with LPS (100 ng/mL; E. Coli
Serotype 0127:B8, Sigma Aldrich, St. Louis, MO, USA) and IFN-γ (20 ng/mL;
Peprotech Inc. Rocky Hill, NJ, USA) for M1 polarisation or IL-4 (100 ng/mL;
Peprotech Inc.) for M2 polarisation for 24 or 72 h.
For blocking experiments with anti-mouse CD88 (C5aR); cells were pre-
incubated with LEAFTM
anti-mouse CD88 (1 g/mL; clone 20/70, Biolegend, San
Diego, CA, USA) or anti-mouse IgG (Cell Signalling, Beverly, MA, USA) for 30 min
and followed by treatment with M1 or M2 stimuli.
4.3.4 Source of antibodies
The following antibodies were used for western blot, rabbit anti-BVR (#OSA-
450, Stressgen, Victoria, BC, Canada), mouse anti--actin (Sigma-Aldrich), rabbit anti-
iNOS (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-mouse IgG (Cell
Signalling) or anti-rabbit IgG (Cell Signalling). For flow cytometry, PE anti-mouse
CD88 and PE rat IgG2a (Biolegend) were used. For immunohistochemistry, rat anti-
mouse CD88/C5aR antibody (clone 10/92, LifeSpan Biosciences, Seattle, WA, USA)
87
and biotinylated anti-rat IgG (Vector Laboratories. Burlingame, CA, USA) were
applied.
4.3.5 Animal treatment
BVRfl/fl
controls and CreLyz: BVRfl/fl
mice
were administrated LPS (5 mg/kg,
intraperitoneal) and were monitored for 24 h. Cell surface expression of C5aR and
influx of immune cells into the peritoneum was assessed. Peritoneal cells were isolated
by flushing the mouse peritoneum with 1 mL of PBS after euthanisation. Cells were
stained with anti-mouse CD88-PE or were immediately analysed for granulocyte and
monocyte cell count by FACS Caliber flow cytometer (Becton and Dickinson, San Jose,
CA, USA).
4.3.5 RNA extraction and reverse transcriptase quantitative PCR
Total RNA was isolated from cultured cells using RNeasy®
Plus Mini Kits
(Qiagen, Valencia, CA, USA) and qPCR was performed as previously described [28].
Primers BVR, C5aR and iNOS were purchased from Life Technologies (Table 4.1). -
actin was used a housekeeping gene. Briefly, RNA was reverse transcribed using
iScriptTM
cDNA synthesis kits (BioRad, Hercules, CA, USA) and qPCR was performed
with an Mx3000P QPCR system (Agilent Technologies, Santa Clara CA, USA). The
expression levels of BVR were quantified by using SYBR® Select Master Mix (Life
Technologies). The relative quantification of gene expression was analysed using the ∆
CT method, normalised to housekeeping gene and expressed as 2- ∆∆ CT
.
Gene
target
Forward sequence Reverse sequence Amplicon
size (bp)
-actin CCACAGGATTCCATACCCAAGA TAGACTTCGAGCAGGAGATGG 157
BVR ATTCTGCCACCATGGAAA CTCCAAGGACCCAGATTTGA 161
C5aR CATTGCTCCTCACCATTCCA CACCACTTTGAGCGTCTTGG 245
iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGGTTCG 95
Table: 4.1 Primer sequences and amplicon sizes of housekeeping (β-actin) and target
genes (C5aR, BVR and iNOS) expressed in mouse BMDM cells.
88
4.3.6 Flow cytometry analysis of CD88
After harvesting and washing BMDM cells with DPBS, cells were stained with
PE labeled anti-mouse CD88 antibody or IgG (1 µg/106 cells) for 30 min at room
temperature. Cells were immediately analysed using a flow cytometer using the FL-2
channel. The percentage of gated cells was derived and analysed using CellQuest
ProTM software (Becton and Dickinson).
4.3.7 Immunohistochemistry
Liver, lung and spleen tissue samples were formalin-fixed followed by paraffin
embedding and immunostaining of 5 m sections as previously described [178]. Mouse
antibody against CD88 (C5aR) was used at the concentration of 5 g/mL. Secondary
antibody (biotin-labeled anti-rat IgG) was used as negative control. Briefly, sections
were processed for antigen retrieval using high pressure cooker in 10 mM citrate buffer
for 1 h. Sections were then incubated for 30 min in a blocking buffer containing 7%
horse serum (Vector Laboratories) in PBS. Primary antibody against CD88 was then
applied to the sections overnight at 4C. Sections were then incubated with biotin-
labeled secondary antibody (1.5 g/mL in PBS) for 1 hour at room temperature,
followed by application a Vectastain Elite ABC kit (1:1 of ratio of reagent A and B) and
detection with ImmPact DAB (Vector Laboratories) as previously described [178].
Images were captured using a Nikon Eclipse E600 microscope and camera (Nikon
Instruments, Melville, NY, USA).
4.3.8 Cell migration assay
Chemotaxis was evaluated in cells maintained in 12-well Transwell plates
(Corning Inc. Corning, NY, USA) using polycarbonate membranes (8 m pore size).
BMDMs from BVRfl/fl
and CreLyz:BVRfl/fl
were suspended in serum free RPMI medium
at 1 x 106 cells/mL. 100 L of the cell suspension was added to the upper chamber and
500 L of serum free RPMI medium containing recombinant mouse C5a (100 nM; R &
D Systems, Minneapolis, MN, USA) was added to the lower wells of the chamber.
Cells were incubated for 24 h. Thereafter, the cells from the upper chamber were
removed and cells on the lower side of the chamber stained with Crystal Violet (Sigma
Aldrich) for 10 min, followed by extensive washing with water. Cells were dried and
those affixed to the bottom of the wells were visualised at 40X magnification. The
stained cells were then dissolved in 10 % acetic acid and absorbance was measured at
89
562 nm on a spectrophotometric plate reader. For blocking experiments with anti-mouse
CD88, cells were pre-incubated with LEAFTM
anti-mouse CD88 or anti-mouse IgG for
30 min, prior treatement with C5a.
4.3.9 Immunoblotting
Cell lysates were prepared in ice-cold RIPA buffer (50 mM Tris-HCl, [pH 7.4],
50 mM sodium fluoride, 150 mM NaCl, 1% Nonident P40, 0.5 M EDTA [pH 8.0]) and
the protease inhibitor cocktail Complete Mini (Roche, Indianapolis, IN, USA). Samples
were centrifuged at 14,000 g at 4 °C for 20 min and supernatants were collected. Protein
concentrations of supernatants were measured using a bicinchoninic acid protein assay
kit (BCA; Thermo Scientific). Forty µg of each protein sample was then
electrophoresed on NuPAGE 4-12% Bis-Tris Gel (Life Technologies) in NuPAGE
MES SDS running buffer (Life Technologies) for 90 min at 100 Volts. Membranes
were blocked with 5% non-fat dry milk in 1 x Tris buffered saline buffer (TBS; Boston
Bio Products, Ashland, MA, USA) for 1 hour and then probed with appropriate primary
antibodies (diluted at 1:1000 in 1 x TBS with 5 % non-fat milk) overnight at 4°C.
Membranes were then washed in 1 x TBS buffer and thereafter incubated with
horseradish peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:5000
in 1 x TBS with 5 % non-fat milk for 1 h at room temperature. The membranes were
visualised using Super Signal West Pico chemiluminescent substrate (Thermo
Scientific) or Femto Maximum Sensitivity Substrate (Thermo Scientific), followed by
exposure to autobioradiography film (BioExpress, Kaysville, UT, USA).
4.3.10 ELISA analysis
TNF-α cytokine was measured in cell culture medium using Quantikine
Immunoassays (R & D Systems) according to the manufacturer’s protocol.
4.3.11 Statistical analysis
All data are reported as mean ± standard error (S.E; n=3). Statistical analysis was
performed using student t-tests or one-way analysis of variance (ANOVA; Posthoc
Tukey test; Graph pad Prism).
90
4.4 Results
4.4.1 BVR deletion in CreLyZ:BVRfl/fl
mice
Investigating the effects of conditional deletion of specific genes within specific
cell types is crucial to understanding gene function [343]. Cre recombinase under
lysosome (Lyz) promoter control is constitutively expressed in myeloid cells [344].
The BVR gene was deleted by crossing the BVRfl/fl
mice to CreLyz mice to generate
myeloid specific deletion of BVR (recently presented in abstract form by Wegiel et al.).
We showed that basal BVR gene expression as well as protein levels were significantly
decreased in BMDMs from CreLyz:BVRfl/fl
mice as compared to BMDMs from control
mice (Figure 4.1B and C, P < 0.05).
91
Figure 4.1: Deletion of BVR in BMDM from CreLyz:BVRfl/fl
. A) Plan of crossing of
BVRfl/fl
mice to CreLyz mice. The deletion of BVR in BMDMs was confirmed by qPCR
(B) and western blot (C). Results represent mean ± S.E. of three independent
experiments (n=3-5/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
.
4.4.2 Conditional deletion of BVR in BMDM promotes C5aR expression both
in vitro and in vivo
We first tested whether knocking down of BVR in vitro using stable transfection
would affect C5aR expression. RAW cells tranfected with shRNA-BVR (mir BVR)
[28] showed significantly higher surface and gene expression of C5aR as compared to
control cells (mir C; Figure 4.2C-D, P < 0.05).
92
Figure 4.2: Lack of BVR augments C5aR expression. RAW 264.7 cells were stably
transfected with shRNA against BVR (mir BVR) or shRNA control (mir C). Gene (A)
and protein expression (B) of BVR were analysed using qPCR and western blot,
respectively. Results are expressed as mean ± S.E. of three independent experiments (n
= 3/group (A)) *P < 0.05 vs mir C. Blots are representative of two independent
experiments (B). Gene expression (C) and cell surface expression (D) of C5aR (CD88)
were measured by qPCR and flow cytometry, respectively. The data are representative
of three independent experiments (n = 3/group). *P < 0.05 vs mir C.
93
To confirm our findings in a primary cell line, we next tested whether the deletion
of BVR in primary myeloid cells using Cre recombinase under Lyz promoter control
would increase the expression of C5aR. Bone marrow derived macrophages were
isolated from C57BL/6, BVRfl/fl
and CreLyz:BVRfl/fl
mice. First, we assessed the effects
of M-CSF stimulation on C5aR expression in BMDMs from C57BL/6 mice, which
significantly increased C5aR surface expression over time (Figure 4.3A). BMDMs from
CreLyz:BVRfl/fl
mice showed significant increase on C5aR gene and protein expression
as compared to control BMDMs (Figure 4.3B and C, P < 0.05). To confirm our
observation from in vitro culture, we also evaluated C5aR protein expression in vivo in
various organs. Immunohistochemistry showed that CreLyz:BVRfl/fl
mice had enhanced
expression of C5aR as compared to control mice in liver, lung and spleen; however the
relative intensity of staining reached significance only in the spleen (Figure 4..4A and
B, P < 0.05).
94
Figure 4.3: Increased gene and cell surface expression of C5aR in mice lacking
BVR in myeloid cells. A) C5aR (CD88) cell surface expression in differentiated
95
BMDMs at day 0-5 from C57BL/6 mice was measured by flow cytometry. Gene
expression of C5aR was analysed using qPCR (B) and the surface expression was
assessed by flow cytometry (C) in BMDMs from BVRfl/fl
and CreLyz:BVRfl/fl
. Results are
representative of three independent experiments (n=3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
.
96
Figure 4.4: Increased protein expression of C5aR in organs isolated from mice
lacking BVR in myeloid cells. Liver, lung and spleen were harvested from BVRfl/fl
and
CreLyz:BVRfl/fl
mice and CD88 expression was analysed by immunohistochemistry.
Representative images are shown in A. Images were taken at 100X magnification and
quantitative analysis for CD88 positive cells in multiple fields of view is shown in B.
Results represent mean ± S.E. of four mice per group. *P < 0.05 CreLyz:BVRfl/fl
vs
BVRfl/fl
.
97
4.4.3 Deletion of BVR induces migration of BMDMs towards C5a in part via
C5aR
Complement component C5a is a strong chemoattractant and acts on C5aR,
which mediates C5a-induced chemotaxis [345]. Therefore, we next tested the effects of
BVR deletion on BMDM migration towards C5a and the role of C5aR on BVR-
regulated chemotaxis. BMDMs isolated from mice lacking BVR showed significantly
increased migration towards C5a at 24h (Figure 4.5A and B, P < 0.05) as compared to
control cells. To evaluate the role of C5aR in this effect, BMDMs were pre-incubated
with neutralising antibody against C5aR. We confirmed blockage of C5aR by flow
cytometry (Figure 4.5C). Induction of chemotaxis in CreLyz:BVRfl/fl
BMDMs towards
C5a was significantly inhibited by incubation with neutralising antibody against C5aR
(Figure 4.6A and B, P < 0.05), suggesting a functional role of increased expression of
the receptor in CreLyz:BVRfl/fl
BMDMs.
98
Figure 4.5: BMDM from CreLyz:BVRfl/fl
are characterisd by increased chemotaxis
towards C5a. Representative images (A) and absorbance at 562 nM of BMDM
99
supernatant (B) from BVRfl/fl
and CreLyz:BVRfl/fl
mice that migrated through to the lower
chamber of transwell chambers in response to C5a after 24 h of culture in serum free
media. Results are presented as mean ± S.E. of three independent experiments (n =
3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
. C) BMDM from BVRfl/fl
and
CreLyz:BVRfl/fl
mice incubated with anti-mouse IgG or C5aR for 30 min and cell
surface expression of C5aR was analysed by flow cytometry. Results are representative
of three independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
.
100
Figure 4.6: C5a mediated chemotaxis in CreLyz:BVRfl/fl
BMDMs is mediated by
C5aR. Representative images (A) and absorbance of BMDM supernatant (B) from
BVRfl/fl
and CreLyz:BVRfl/fl
mice that migrated through to the lower chamber of the
transwell chamber in response to C5a after 24 h incubation in the presence or absence of
anti-mouse IgG or anti-mouse C5aR. Data are expressed mean ± S.E. of three
101
independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
and #P <
0.05 CreLyz:BVRfl/fl
anti-mouse C5aR vs CreLyz:BVRfl/fl
anti-mouse IgG.
4.4.4 Peritoneal cells from CreLyz:BVRfl/fl
show increase expression of C5aR
and influx of monocytes after in vivo LPS administration
We next evaluated the effects of intraperitoneal LPS administration on C5aR
expression and immune cell infiltration in BVRfl/fl
and CreLyz:BVRfl/fl
mice. C5aR
expression was significantly greater in peritoneal cells isolated from CreLyz:BVRf/lfl
compared to BVRfl/fl
mice (Figure 4.7A, P < 0.05). Furthermore, LPS injection resulted
in significant increase in influx of monocytes into the peritoneum of CreLyz:BVRfl/fl
mice compared to BVRfl/fl
mice (Figure 4.7B, P < 0.05).
102
Figure 4.7: Lack of BVR promotes C5aR expression and peritoneal monocyte
infiltration in CreLyz:BVRfl/fl
in response to LPS. Perionteal cells were isolated from
LPS injected BVRfl/fl
and CreLyz:BVRfl/fl
mice. Cell surface expression of C5aR (A) and
influx of granulocytes and monocytes (B) were analysed by flow cytometry. Results are
expressed as mean ± S.E. of three mice in each group. *P < 0.05 CreLyz:BVRfl/fl
vs
BVRfl/fl
.
4.4.5 BMDM from CreLyz:BVRfl/fl
mice show M1 phenotype
Having shown that BMDMs from CreLyz:BVRfl/fl
mice have increased
expression of C5aR and chemotaxis, we next assessed the phenotype of BMDMs
isolated from BVRfl/fl
and CreLyz:BVRfl/fl
mice and whether the phenotype was dictated
by complement signalling. No difference in arginase expression (M2 marker) [341] in
BMDM from BVRfl/fl
and CreLyz:BVRfl/fl
mice existed after incubation with IL-4 (data
not shown). However, stimulation of BMDMs with LPS and IFN-γ lead to an increase
in iNOS gene and protein expression, a marker of M1 macrophages [342]. iNOS was
significantly increased in BMDMs from CreLyz:BVRfl/fl
mice compared to BMDM from
BVRfl/fl
mice (Figure 4.8A, P < 0.05). Furthermore, BMDMs from CreLyz:BVRfl/fl
mice
had significantly increasd protein expression of iNOS in M1 polarized macrophages
(Figure 4.8B). Finally, to confirm the role of C5aR in BVR-mediated modulation of
iNOS expression, we blocked C5aR expression in BMDMs with neutralising antibody
against C5aR. LPS and IFN-γ-induced iNOS expression in BMDM from BVRfl/fl
and
103
CreLyz:BVRfl/fl
was blunted after treatment with neutralising antibody against C5aR
(Figure 4.8C and D).
Figure 4.8: Induction of iNOS expression in M1 polarised BMDMs from
CreLyz:BVRfl/fl
is partially mediated by C5aR. BMDMs were incubated in the
presence or absence of LPS/IFN-γ for 24 and 72 h. Gene expression (A) was assessed at
24 h and protein expression (B) was analysed at 72 h. Data are representative of three
independent experiments (n = 3/group (A)). *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
. Blots
are representative of at least two independent experiments (B). BMDMs were incubated
with anti-mouse IgG or anti-mouse C5aR prior to LPS/IFN-γ stimulation, and gene
expression (C) and protein expression (D) were assessed after 24 and 72 h, respectively.
Results represent mean ± S.E. of three independent experiments (n = 3/group (C)). *P <
104
0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
and # P < 0.05 CreLyz:BVRfl/fl
anti-mouse C5aR vs
CreLyz:BVRfl/fl
anti-mouse IgG. Blots are representative of at least two independent
experiments (D).
Next, we tested the role of BVR deletion on TNF-α expression, which is another
marker of M1 macrophage phenotype [342]. M1 polarisation of BMDMs was induced
with LPS/IFN-γ and cytokine concentration of TNF-α in media was measured.
Treatment with LPS and IFN-γ elevated the levels of TNF-α, which was further induced
in BMDMs from CreLyz:BVRfl/fl
mice as compared to BMDM from BVRfl/fl
mice
(Figure 4.9A, P < 0.05). We next evaluated the effects of neutralising antibody against
C5aR on BVR-modulated TNF-α expression. Addition of anti-mouse C5aR prior M1
polarisation significantly suppressed the LPS/IFN-γ induced TNF-α release in BMDM
from BVRfl/fl
and CreLyz:BVRfl/fl
(Figure 4.9B, P < 0.05).
105
Figure 4.9: Macrophages lacking BVR express increased levels of TNF-α. A)
ELISA was applied to measure TNF-α levels in the supernatant of cultured BMDMs
from BVRfl/fl
and CreLyz:BVRfl/fl
mice incubated with ± LPS/IFN-γ for 24 h. Data are
representative of three independent experiments (n = 3/group). *P < 0.05
CreLyz:BVRfl/fl
vs BVRfl/fl
. B) TNF-α levels in supernatant from BMDMs pre-incubated
with anti-mouse IgG or anti-mouse C5aR prior to M1 polarisation for 24 h were
measured by ELISA. Data are representative of three independent experiments (n =
3/group. *P < 0.05 CreLyz:BVRfl/fl
vs BVRfl/fl
and # P < 0.05 CreLyz:BVRfl/fl
anti-mouse
C5aR vs CreLyz:BVRfl/fl
anti-mouse IgG.
106
4.5 Discussion
In the present study, we describe a novel finding showing that BVR maybe
important in mediating macrophage chemotaxis towards C5a and this occurs partially
via a C5aR-dependent manner. Conditional deletion of BVR increased expression of
C5aR in primary macrophages, which led to increased chemotaxis towards C5a. We
also demonstrate that lack of BVR promotes macrophage polarisation towards the M1
phenotype by amplifying the expression of LPS-induced iNOS and TNF-α, which was
regulated in part via C5aR. We suggest that the remarkable effects of BVR on
complement activation and macrophage polarisation are crucial in regulation of innate
immune responses, as demonstrated by increased peritoneal leukocyte influx after LPS
administration in mice lacking BVR.
BVR is a leucine zipper protein [268] and interacts with activator protein (AP)-1
sites in the promoter regions of haem oxygenase (HO)-1 and activated transcription
factor-2 (ATF-2) [269]. We have previously shown that BV inhibits TLR-4 expression
in part via BVR binding to AP-1 sites [28]. BVR is a modulator of cell signalling
pathways and is described as a theronine/serine/tyrosine kinase in the mitogen activated
kinase/insulin/insulin growth factor-1 signalling cascade [20]. Furthermore, silencing of
surface BVR with RNA interference abrogated BV-induced Akt (protein kinase B)
phosphorylation and IL-10 expression [21], suggesting that BVR also interacts with
Akt. Moreover, BVR is S-nitrosylated in response to BV and LPS through endothelial
nitric oxide synthase (eNOS) derived nitric oxide (NO), leading nuclear translocation of
BVR and binding to TLR-4 promoter and repression of TLR-4 expression [28].
Although, these studies support the cell signalling and immuno-modulatory capabilities
of BVR in in vitro models, the role of BVR in modulating inflammation in in vivo
models has not been well described. Recently, we discovered that conditional deletion
of BVR in murine myeloid cells increases resistance to acetaminophen (300mg/kg, i.p.)
injury and results in reduced inflammatory responses to TLR-9 ligands (CpG rich
region) both in vitro and in vivo (Wegiel et al., recently presented in abstract form).
However, the effects of BVR deletion on complement receptor and macrophage
phenotype were not tested. We hypothesised that lack of BVR promotes the
development of a pro-inflammatory macrophage phenotype, which drives acute
inflammation via increased in macrophage chemotaxis and induction of C5aR.
107
Increased expression of C5a and its receptor C5aR are strongly associated with
acute and chronic inflammation and inflammatory disorders [29,311]. The anti-
inflammatory effects of BV in models of sepsis [179,218], transplantation and IRI
[212,219] have previously been published. Moreover, BV induces inhibitory effects on
C5aR in vitro via mTOR signalling [338]; however, the role of BVR on C5aR
signalling remains unknown. C5aR is a G-protein coupled receptor and is expressed in
both myeloid and non-myeloid cells and increased expression of C5aR has been
observed in the inflamed tissues [29,30,116].
We first investigated the effect of BVR deletion on C5aR expression in
macrophages. Silencing of BVR with shRNA resulted in increased basal expression of
C5aR in RAW macrophages. Furthermore, BMDMs from CreLyz:BVRfl/fl
mice
(conditional deletion of BVR in myeloid cells) also showed enhanced gene and protein
expression of C5aR. Our in vitro findings are supported by in vivo studies, in which,
we reported higher C5aR expression in spleens isolated from CreLyz:BVRfl/fl
mice.
Increased expression of C5aR promotes recruitment of neutrophils and macrophages at
sites of infection, trauma and inflammation [346]. Studies by Soruri et al. showed that
blockage of C5aR by neutralising antibody against C5aR (clone 20/70) completely
inhibited the migration of rat basophilic leukemia RBL-2H3 cells towards C5a [345].
We discovered that BVR is an important molecule for regulating macrophage
chemotaxis towards C5a and deletion of BVR in macrophages promotes chemotaxis
towards C5a. We reported that the increased cell migration of BMDMs towards C5a in
CreLyz:BVRfl/fl
mice was suppressed after treatment with C5aR neutralising antibody,
implicating a role of C5aR on BVR-mediated modulation of chemtoaxis. However, we
only chose 24 hour time point to investigate the effect of C5a on chemotaxis and future
studies are required to investigate the effect of C5a on cell migration at different time-
points. Nevertheless, our in vitro findings are translated in vivo, where we observed that
peritoneal cells from LPS treated CreLyz:BVRfl/fl
mice expressed more C5aR compared
to BVRfl/fl
mice and are characterised by increased influx of monocytes after LPS
treatment, suggesting a potential role of BVR as a regulator of monocyte infiltration
towards endotoxin.
BVR is well described for modulating BV-mediated inflammatory responses,
including production of IL-10 in response to endotoxin [21] and NO generation [28] by
108
macrophages. However, the effects of BVR on macrophage polarisation have not been
elucidated. We reported that incubation of macrophages with LPS and IFN-γ stimulate
macrophage polarisation towards the M1 phenotype, which was characterised by
increased expression of iNOS and TNF-α in macrophages. Interestingly, macrophages
from CreLyz:BVRfl/fl
mice express higher levels of iNOS and TNF-α compared to
BVRfl/fl
mice after LPS/IFN-γ activation. Together, these data suggest that BVR is a
crucial molecule that modulates macrophage polarisation in response to inflammatory
stimuli.
Further, we investigated the effects of C5aR blocking on BVR-modulated iNOS
expression and TNF- α release. We reported significant reduction in LPS and IFN-
induced expression iNOS and TNF-α release after neutralising antibody against C5aR in
BMDMs from CreLyz:BVRfl/fl
and BVRfl/fl
mice. Although, it has been shown that C5aR
regulates the LPS-induced production of pro-inflammatory cytokines: IL-6 and IL-12
[308] the effects of C5aR on M1 markers were not previously described. Both TNF-α
and iNOS are key players in inflammation and upregulated expression of iNOS and
TNF-α have been observed in number of diseases, including sepsis [94] and
atherosclerosis [78,126]. C5aR also plays a key role in disrupting blood brain barrier
integrity via regulating mRNA expression of iNOS on brain endothelial cells [347]. Our
data suggest that C5aR is a crucial molecule in regulating BVR-modulated iNOS and
TNF expression on macrophages.
In summary, we show that BVR crosstalks with C5a complement signalling.
Deletion of BVR in myeloid cells induces complement activation by increasing C5aR
expression and leading to elevated chemotaxis towards C5a. BVR has known cell
signalling [33] and cytoprotective effects [263,266] and deletion of BVR promotes
inflammation [21]. The data in the present study further support for the role of BVR in
modulation of innate immune responses, by a previously unknown mechanism. We also
demonstrate that macrophages lacking BVR display an M1 phenotype with increased
expression of iNOS and TNF-. Moreover, increased expression of C5aR, macrophage
chemotaxis and polarisation towards M1 state were partially mediated by C5aR.
Collectively, we identified BVR as a target for regulating complement activation
and demonstrate that BVR modulates macrophage polarisation. We suggest that BVR-
109
mediated modulation of macrophage responses towards C5a, LPS and IFN-γ is
regulated in part by C5aR.
110
This chapter has been published by Journal of Clinical and Cellular Immunology as an
original investigation. The abbreviations, formatting and referencing of this document
have been changed slightly to more closely reflect the formatting of other chapters in
this thesis.
Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H., Bulmer
A. C. Endogenous tetrapyrroles influence leukocyte responses to lipopolysaccharide in
human blood: pre-clinical evidence demonstrating the anti-inflammatory potential of
biliverdin. Journal of Clinical and Cellular Immunology. 5: 1000218 (2014).
Chapter 5 Endogenous tetrapyrroles influence leukocyte responses to
lipopolysaccharide in human blood: pre-clinical evidence demonstrating the
anti-inflammatory potential of biliverdin
111
5.1 Abstract
Sepsis is associated with abnormal host immune function in response to pathogen
exposure, including endotoxin (lipopolysaccharide; LPS). Cytokines play crucial roles
in the induction and resolution of inflammation in sepsis. Therefore, the primary aim of
this study was to investigate the effects of endogenous tetrapyrroles, including
biliverdin (BV) and unconjugated bilirubin (UCB) on LPS-induced cytokines in human
blood. Biliverdin and UCB are by products of haem catabolism and have strong
cytoprotective, antioxidant and anti-inflammatory effects. In the present study, whole
human blood supplemented with BV and without was incubated in the presence or
absence of LPS for 4 and 8 h. Thereafter, whole blood was analysed for gene and
protein expression of cytokines, including IL-1β, IL-6, TNF-, IFN-γ, IL-1Ra and IL-8.
Biliverdin (50 M) significantly decreased the LPS-mediated gene expression of IL-1β,
IL-6, IFN-γ, IL-1Ra and IL-8 (P < 0.05). Furthermore, BV significantly decreased LPS-
induced secretion of IL-1 and IL-8 (P < 0.05). Serum samples from human subjects
and, wild type and hyperbilirubinaemic Gunn rats were also used to assess the
relationship between circulating bilirubin and cytokine expression/production.
Significant positive correlations between baseline UCB concentrations in human blood
and LPS-mediated gene expression of IL-1 (R = 0.929), IFN- (R = 0.809), IL-1Ra (R
= 0.786) and IL-8 (R = 0.857) were observed in blood samples (all P < 0.05). These
data were supported by increased baseline IL-1 concentrations in hyperbilirubinaemic
Gunn rats (P < 0.05). Blood samples were also investigated for complement receptor-5
(C5aR) expression. Stimulation of blood with LPS decreased gene expression of C5aR
(P < 0.05). Treatment of blood with BV alone and in the presence of LPS tended to
decrease C5aR expression (P = 0.08). These data indicate that supplemented BV
inhibits the ex vivo response of human blood to LPS. Surprisingly, however, baseline
UCB was associated with heighted inflammatory response to LPS. This is the first study
to explore the effects of BV in a pre-clinical human model of inflammation and
suggests that BV could represent an anti-inflammatory target for the prevention of LPS
mediated inflammation in vivo.
Key words: Cytokine, inflammation, tetrapyrroles, lipopolysaccharide.
112
5.2 Introduction
Sepsis, caused by systemic microbial infection, is a potentially life-threatening
condition and characterised by uncontrolled inflammation [297]. The pathogenesis of
sepsis involves several factors that interact in a chain of events from pathogen
recognition to an overwhelming host response [42]. Among the molecules involved, toll
like receptor (TLR) and complement receptor 5a (C5aR) are major contributors leading
to septic shock, coagulation abnormalities, tissue hypoperfusion and organ failure
[118,304]. Activation of TLRs and C5aR promote the production of pro- and anti-
inflammatory cytokines by immune cells, contributing to the ‘cytokine storm’ of acute
inflammation [297,303]. Several studies implicate the involvement of both pro- and
anti-inflammatory cytokines in initiation and aggravation of infectious and
inflammatory disorders, including sepsis, arthritis, and atherosclerosis [124,348]. Septic
patients and animals often experience increased circulating concentrations of tumour
necrosis factor (TNF)-, interleukin (IL)-1β, IL-6 and interferon (IFN)-, resulting in
exacerbated inflammation and, ultimately, organ dysfunction [124,349].
Discovery of new treatments for sepsis and the application of such treatments to
patients presenting with sepsis poses significant challenges to both researchers and
clinicians. Despite many years of exhaustive research and clinical trials the
pathophysiology of sepsis remains incompletely understood and specific anti-
inflammatory and immuno-modulatory therapies have not been translated into improved
patient outcomes [350]. A number of therapies (activated protein C (aPC), steroids and
cytokine blockade) have been investigated in both preclinical and clinical trials to target
the host response factors thought to play a significant role in the inflammatory response
to sepsis. None of these therapeutic approaches have translated into improved patient
outcomes despite promising early results [350]. Activated protein C has antithrombotic,
anticoagulant, anti-inflammatory and antifibrinolytic effects. Initial data suggested a
significant mortality benefit associated with the use of aPC in severe sepsis and septic
shock [351]. However, in a recent Cochrane Review the use of aPC found no evidence
to support the use of aPC in severe sepsis and in fact showed a trend to significant
haemorrhagic complications [351]. A number of trials investigating therapeutic targets
against TNF- and IL-1 showed promise in experimental models of sepsis, but again
these effects were not translated into beneficial outcomes for patients in clinical trials
[352,353,354]. The use of systemic steroids in severe sepsis and septic shock remains
controversial despite almost 50 years of research into the area. Again there is strong
113
biological rationale to support the use of steroids in severe sepsis but this has yet to be
translated into improved patient outcomes [355]. Therefore, the discovery of new and
effective anti-inflammatory therapeutics to reduce morbidity and mortality due to sepsis
and septic shock are necessary.
Endogenous tetrapyrroles, including biliverdin (BV) and unconjugated bilirubin
(UCB) are haem catabolites and are formed by the sequential action of haem oxygenase
and biliverdin reductase (BVR) forming BV and UCB, respectively, within cells of the
reticulo-endothelial system [198,356]. Unconjugated bilirubin is water insoluble and
must be conjugated by uridine diphosphate glucuronosyltransferase (UGT1A1) in
hepatocytes forming bilirubin mono and diglucuronides, which are then excreted into
the bile [194,356]. Several in vivo and in vitro studies report strong cytoprotective
effects of these compounds in various animal models of ischaemia-reperfusion injury
(IRI), transplantation, sepsis and endotoxic shock [21,26,27,228]. It is suggested that
these compounds induce cytoprotection via attenuation of inflammation and free radical
induced macromolecule oxidation [192,197].
Biliverdin inhibits the expression of TLR-4 and C5aR in vitro [28,338]. Our
groups and others have also shown that BV and UCB modulate the expression and
production of TNF-α, IL-6 and IL-1 in cell culture and animal models
[208,217,236,338]. However, whether anti-inflammatory effects of BV/UCB exist in
human models, remains unknown. Therefore, the primary aim of this study was to
investigate the effects of supplemented BV and baseline UCB on cytokine expression
and release after lipopolysaccharide (LPS) activation of whole human blood. Similar ex
vivo models have been applied to investigate the efficacy of lead anti-inflammatory
compounds with this system providing some advantages over in vitro assays, including
culture of isolated peripheral blood mononuclear cells (PBMCs) [349,357]. To reveal
whether UCB accumulation influences baseline cytokine production, we also obtained
baseline serum samples from Gunn rats (an animal model of hyperbilirubinaemia due to
autosomal recessive deficiency of UGT1A1) and control rats. We hypothesised that
BV/UCB would demonstrate anti-inflammatory effects by mitigating LPS-mediated
cytokine expression and release into whole blood.
114
5.3 Material and methods
5.3.1 Human blood sample collection and ex vivo incubation with LPS and BV
To assess the effects of BV on ex vivo cytokine expression, fasting blood was
collected from healthy male volunteers (25-52 years). Exclusion criteria for the subjects
included current smoking, recent (within two weeks) bacterial infection and/or
consumption of antioxidant supplements, consumption of >8 standard alcoholic
drinks/week, elevated glucose or serum liver enzyme activities or presence of
hyperlipidaemia. We also excluded subjects who showed less than a 10-fold increase in
IL-1β expression in response to LPS to ensure the homogeneity of responder phenotype
in participating subjects. The study was approved by the Human Ethics Research
Committee of Griffith University (MSC/02/10/HREC).
Whole blood was drawn from each subject into ethylenediaminetetra-acetic acid
(EDTA) (Becton and Dickinson, Australia; total 50 mL). Two millilitres of EDTA
blood was centrifuged at 1500 g for 15 min at 4 °C using a benchtop centrifuge
(Beckman Coulter, Australia) to obtain plasma for the measurement of UCB
concentration. The remaining EDTA blood samples were kept in the dark and were
prepared for ex vivo incubation with LPS and BV/control within one hour.
Two millilitres of EDTA blood was supplemented with BV (10 and 50 µM;
Frontier Scientific, Logan UTA, USA) dissolved in DMSO (solvent control), in the
presence or absence (control) of LPS (3 µg/mL) from Escherichia coli (K235, Sigma-
Aldrich, Australia). Lipopolysacchraide was chosen as a stimulant because it is a
specific TLR-4 ligand and stimulates cytokine release from immune cells [358]. Blood
samples were then incubated in closed eppendorff tubes, in a water bath at 37 °C for 4
and 8 h, with hourly mixing. Samples were continuously protected from light using
aluminium foil. Samples were collected for RNA extraction at 4 h from EDTA blood
samples, which is an appropriate time point for cytokine expression analysis within
whole blood [359]. Gene/mRNA expression was assessed using quantitative real-time
quantitative polymerase chain reaction (qRT-PCR) using cytokine primers as reported
in Table 1. Thereafter, blood was centrifuged at 4 and 8 h as previously described.
Plasma samples were then stored at -80 °C until the analysis of cytokine concentrations.
115
5.3.2 Animal experiments
Breeding pairs of heterozygote Gunn rats were imported from the Rat Research
and Resource Centre (Columbia, MO, USA) and non-jaundiced Wistar rats were used
as wild type controls. Animals were housed at Griffith University Animal Facility (12 h
light:dark cycle, constant temperature (22 °C) and humidity (60%)). All the animals had
continuous access to standard laboratory food pellets (Speciality Feeds, Glen Forest,
Australia) and fresh water. Male homozygous Gunn rats (jaundiced) were sourced from
an internal colony by breeding male homozygote Gunn rats with heterozygote females
(non-jaundiced) after weaning. Concentrations of UCB were measured in blood
collected from the tail tip of pups at the age of 21 days to confirm the presence of
jaundice. The pups were kept under brief isofluorane anaesthesia (3 % in O2; 1-2 L/min)
until blood collection was complete. Serum UCB was analysed using HPLC (see
below). For the present study, male rats were used (10 wild type controls and 17 Gunn
rats). Animals at 12 months of age were anaesthetised using an intraperitoneal injection
of thiobutabarbital sodium (concentration 60 mg/mL; 1 mL/kg). A mid-line laparotomy
was performed and ~ 5 mL of blood was collected from thoracic cavity as previously
described [233]. Serum samples were stored at -80 °C. All the animal experiments were
conducted after approval by Griffith University Animal Ethics Research Committee
(MSC/06/12).
5.3.3 RNA extraction and qRT-PCR
Total RNA was isolated from whole blood using QIAamp®
RNA Blood Mini Kit
(Qiagen, Australia) and qRT-PCR was performed as previously described [338].
Primers for human HPRT-1, IL-6, IL-1, TNF-α, IFN-γ, IL-1Ra IL-10, IL-8 and C5aR
were designed using Primer Quest Software (Table 1; Integrated DNA technologies,
Australia). Quantitative real time PCR was performed with Applied Biosystems
SteponeTM
and Stepone PlusTM
Real-Time PCR Systems (AB Applied Biosystem, USA)
using EvaGreen master mix (Integrated Biosciences, Australia). The relative
quantification of gene expression was analysed using 2- ∆∆ C
T method [360], normalised
to the housekeeping gene (HPRT) and expressed as fold expression.
116
Table 5.1: Primer sequences and amplicon sizes of housekeeping (HPRT) and target genes (IL-1β, IL-6, TNF-,
IFN-γ, IL-1Ra IL-10, and C5aR) expressed in humans.
Gene
target
Forward sequence Reverse sequence Amplicon
size (bp)
HPRT TGGAGTCCTATTGACATCGCCAGT AGTGCCTCTTTGCTGCTTTCACAC 197
IL-1β AACAGGCTGCTCTGGGATTCTCTT ATTTCACTGGCGAGCTCAGGTACT 92
IL-6 AAATTCGGTACATCCTCGACGGCA AGTGCCTCTTTGCTGCTTTCACAC 88
TNF- TGGGCAGGTCTACTTTGGGATCAT TTTGAGCCAGAAGAGGTTGAGGGT 128
IFN-γ ACTAGGCAGCCAACCTAAGCAAGA CATCAGGGTCACCTGACACATTCA 184
IL-1Ra AATCCATGGAGGGAAGATGTGCCT TGTCCTGCTTTCTGTTCTCGCTCA 110
IL-10 TCCTTGCTGGAGGACTTTAAGGGT TGTCTGGGTCTTGGTTCTCAGCTT 109
IL-8 CTTGGCAGCCTTCCTGATTT GGGTGGAAAGGTTTGGAGTATG 111
C5aR AGACATCCTGGCCTTGGTCATCTT TACCGCCAAGTTGAGGAACCAGAT 133
117
5.3.4 Cytokine analysis
Cytokines in plasma samples were analysed using a Milliplex Human
Cytokine Magnetic Panel kit for IL-6, IL-1, TNF-α, IFN-, IL-10 and IL-1Ra and Rat
Cytokine Magnetic Panel kit for IL-6, IL-1 and TNF-α (Abacus, Australia) according
to manufacturer’s instructions. The plasma concentration of each cytokine was detected
and quantified using a Bio-plex Multiplex system (BioRad, USA). Human IL-8
concentration was measured using a high sensitivity ELISA kit (R & D Systems,
Australia).
5.3.5 Cell count, haem and bilirubin analysis
Total blood cell counts were performed in fresh human EDTA blood samples
using a Beckman Coulter Counter (Beckman Coulter Inc. USA). Plasma UCB and haem
concentrations were quantified using HPLC and a photodiode array detector (Waters,
Australia) as previously described [198]. A C18 reverse-phase HPLC guard and
analytical column (4.6 x 150 mm, 3 µM; Phenomenex, Australia) was perfused at 0.7
mL/min using methanolic 0.1 M di-n-octylamine acetate (methanol:H2O 95:5 v/v)
mobile phase. The extracted samples were injected with a run time of 18 min and were
analysed in duplicate. Haem (max 400 nm) and UCB (max 450 nm) eluted at 8 and
13 mins, respectively. Haemin and UCB (Frontier Scientific, Logan UTA, USA) at a
concentration of 0-100 µM were used for external standards.
5.3.6 Statistical analysis
To detect any effect that varying BV concentrations (0, 10 and 50 µM) had on
LPS induced cytokine gene and protein expression, one way of analysis of variance
(ANOVA; post-hoc Tukey; Sigmastat, Ver. 11.0) was used. A repeated measures
ANOVA (post-hoc Bonferronni t-test) was used to determine the effects of incubation
time and BV treatment on haem and UCB concentrations. The relationship between
baseline UCB and cytokine expression was analysed using Pearson correlation
coefficient, or Spearman’s rank correlation coefficient in data sets lacking normal
distribution. Furthermore, un-paired t-tests were performed to detect differences in UCB
concentration, body weight and IL-1 concentration between Gunn and wild type
animals. When data was non-normally distributed, a Mann Whitney U-test was used. A
P-value of < 0.05 was considered significant. Data is expressed as either mean ± S.E. or
median (25-75% interquartile range), as appropriate.
118
5.4 Results
5.4.1 Clinical parameters, haem and UCB concentration
Healthy male subjects were recruited (37.1 ± 8.5 years old) for this study. All
total blood cell counts were within the normal range (Table 5.2). Haem and UCB
concentrations at both baseline and after 4 and 8 h of incubation were assessed in all
conditions. All samples underwent minor haemolysis after 4 and 8 h of incubation
(Table 3). The average UCB concentration of the subjects was 5.23 ± 1.41 mol/L at
baseline and significantly increased after 4 and 8 h of incubation with 50 µM BV only
(Table 3, P < 0.05). Furthermore, control samples showed a non-significant increase in
baseline UCB concentration after 4 and 8 h of incubation (Table 5.3).
Variable Result
Age (years) 37.1 ± 8.5
BMI (kg/m2) 24.7 ± 3.42
HGB (g/L) 148 ± 6.51
RBC (1012
/L) 5.14 ± 0.18
WBC (109/L) 6.01 ± 1.27
NE (109/L) 2.51 ± 0.78
LYM (109/L) 2.28 ± 0.51
MO (109/L) 0.86 ± 0.28
EO (109/L) 0.30 ± 0.11
BA (109/L) 0.05 ± 0.03
Table 5.2: Clinical characteristics of recruited subjects at baseline (n=7)
Note: BMI (bone marrow index), WBC (white blood cell), RBC (red blood cell), HGB
(total haemoglobin), NE (neutrophil), LYM (lymphocyte), MO (monocytes), EO
(eosinophil), BA (basophil).
119
Haem (baseline;
µM)
Treatment Haem (µM)
4 h 8 h
4.80 ± 0.63
Control 14.65 ± 0.90* 30.18 ± 3.89*#
BV (10 µM) 16.88 ± 1.59*
27.01 ± 1.94*#
BV (50 µM) 15.41 ± 1.38* 32.24 ± 3.43 *#
LPS 16.69 ± 1.82* 36.25 ± 2.93*#
LPS+BV (10 µM) 17.30 ± 2.77* 28.00 ± 3.34*
LPS+BV (50 µM) 16.14 ± 1.62* 33.86 ± 4.84*#
UCB (baseline; µM)
Treatment
UCB (µM)
4 h 8 h
5.23 ± 1.41
Control 11.32 ± 2.03 9.69± 2.32
BV (10 µM) 11.68 ± 1.98 12.85 ± 2.70*
BV (50 µM) 14.40 ± 2.93*
2.93*
15.56 ± 3.02*
LPS 10.14 ± 3.36 9.50 ± 1.73
LPS+BV (10 µM) 12.42 ± 4.11* 13.31 ± 4.30*
LPS+BV (50 µM) 12.56 ± 2.35* 13.72 ± 2.90*
Table 5.3: Unconjugated bilirubin (UCB) and haem concentrations in subjects after 0
(baseline), 4 and 8 h incubation with BV ± LPS (N=7/group).
Note: The effect of BV and haemolysis on haem and UCB concentration was performed
by repeated measures ANOVA. *P < 0.05 vs. baseline UCB or haem concentrations and
#P <0.05 vs. haem concentrations at 4 h.
5.4.2 Biliverdin and cytokine expression
The mRNA expression of pro- and anti-inflammatory cytokines from blood
samples incubated with BV ± LPS were assessed. Individual subjects’ response to LPS-
mediated cytokine expression can be found in Figures 5.1. Biliverdin treatment alone
had no effect on cytokine mRNA abundance (Figure 5.2). However, a dose dependent
decrease in the mRNA expression of IL-1, IL-6, IFN- and IL-1Ra occurred when
blood was stimulated with LPS and BV. Fifty micromolar BV was required to
significantly reduce the expression of these cytokines (Figure 5.3A, B, D and E, P <
0.05). Biliverdin had no effect on the expression of TNF- in the presence of LPS
(Figure 5.3C).
120
121
Figure 5.1: Cytokine expression in each individual in response to LPS. The whole
blood of each subject was incubated with LPS (3 g/mL) for 4 h. The fold change of
each cytokine (A-F) was analysed using 2- ∆∆ C
T method. Data are presented as mean ±
S.E.
122
123
Figure 5.2: Cytokine gene expression in response to BV. The whole blood was
incubated with BV at different concentrations for 4 h and the mRNA expression was
assessed. The fold change of each cytokine (A-F) was analysed using 2- ∆∆ C
T method.
Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0
µM BV).
124
125
Figure 5.3: Cytokine gene expression in response to LPS and BV. The whole blood
was incubated with BV and LPS for 4 h and the mRNA expression was assessed. The
relative fold change of each cytokine (A-F) was analysed using 2- ∆∆ C
T method. Data are
presented as mean ± S.E. n=7, P < 0.05 vs sample treated with LPS only (0 µM).
126
Plasma cytokine concentrations were measured 8 h after LPS incubation in accordance
with previous studies, which show a robust increase in IL-1β at this time point
[348,361]. Similar to the gene response, subjects showed variation in their response to
cytokine protein expression after LPS exposure (Figure 5.4). Therefore, inhibition of
cytokine release by BV is presented relative to each individual’s LPS response (Figure
5.6). Biliverdin alone did not affect cytokine release into plasma (Figure 5.5). However,
BV dose dependently and significantly decreased IL-1 plasma concentration in the
presence of LPS (Figure 5.6A, P < 0.05). Biliverdin did not significantly affect LPS-
induced IL-6, TNF-, IFN-, IL-1Ra and IL-10 cytokine release into plasma (Figure
5.6B-F).
127
128
Figure 5.4: Cytokine protein concentration in each individual in response to LPS.
The whole blood of each subject was incubated with LPS (3 g/mL) for 8 h.
Concentration of each cytokine (A-F) was analysed using Milliplex human cytokine kit.
Data are presented as mean ± S.E (0 µM).
129
130
Figure 5.5: Cytokine protein concentration in response to BV. The whole blood was
incubated with BV at different concentrations for 8 h. Concentration of each cytokine
(A-F) was analysed using Milliplex human cytokine kit. Data are presented as mean ±
S.E. n=7, P < 0.05 vs sample treated with control only (0 µM BV).
131
132
Figure 5.6: Cytokine concentration in response to LPS and BV. The whole blood
was incubated with BV and LPS for 8 h and cytokine concentration was measured using
a Milliplex human cytokine kit. The relative change in each cytokine (A-F)
concentration is presented. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample
treated with LPS only (0 µM).
133
5.4.3 Association between baseline UCB concentration and cytokine expression
We have previously shown that increasing concentrations of UCB in vivo are associated
with increased circulating IL-1β concentrations [25]. Therefore, we sought to investigate
whether baseline UCB concentration in our cohort study impacted upon the gene and protein
expression of cytokines in response to LPS (i.e. in solvent control samples not treated with BV).
A significant positive correlation between UCB and LPS-mediated IL-1β (R = 0.929; P <
0.001), IFN-γ (R = 0.809; P = 0.027) and IL-1Ra (R = 0.786; P = 0.025) gene expression
(Figure 5.7A, D and E) existed. However, no significant correlation between baseline UCB
concentration and gene expression of IL-6 and IL-10 after LPS exposure occurred (Figure 5.7B
and F). Furthermore, there were no significant correlations between baseline UCB
concentrations and LPS-mediated cytokine (IL-1β, IL-6, IFN-γ, IL-1Ra and IL-10) release into
plasma (Figure 5.8). Interestingly, increasing concentration of UCB tended to be associated
with increases gene and protein expression of TNF- (Figure 5.7C and Figure 5.8C, P < 0.1)
134
135
Figure 5.7: UCB concentration and cytokine gene expression in response to LPS.
Whole blood was incubated with BV and LPS for 4 h and mRNA expression was
assessed. Figure shows the scatter plots and the correlation between baseline UCB
concentration and cytokine gene expression (A-F), n = 7.
136
137
Figure 5.8: UCB concentration and cytokine concentration in response to LPS.
Whole blood was incubated with BV and LPS for 8 h and plasma cytokine
concentration was measured using a Milliplex human cytokine kit. Figure shows scatter
plots and the correlation between baseline UCB concentration and plasma cytokine
concentrations (A-F), n=7.
138
To confirm a possible effect of physiologically, severely elevated UCB (beyond that
seen in our human subjects) on physiological IL-1β concentrations in blood; serum
samples were collected from wild type and hyperbilirubinaemic Gunn rats. Gunn rats
had significantly reduced body mass compared to control animals (Figure 5.9A, P <
0.001) and had significantly increased UCB concentrations compared to their wild type
counterparts (Figure 5.9B, P < 0.05), as reported previously [233]. Gunn rats also had a
significantly elevated plasma IL-1 concentration compared to wild type controls
(Figure 5.9C, P < 0.001). Furthermore, a significant and positive relationship existed
between UCB and IL-1 concentrations (Figure 5.9D, R = 0.488 and P = 0.01).
139
Figure 5.9: IL-1β concentration in blood samples of wild type control and Gunn
rats. A. Graph showing the body weight of Wistar (n=10) and Gunn rats (n=17). Data
are presented as mean ± S.E; P <0.05 vs control (non-jaundiced Wister rats). Box plot
showing the serum UCB concentration (B) and IL-1β concentration in Wistar and Gunn
rats (C). Data are presented as median (25-75% interquartile range); n=10 for Wister
and n =17 for Gunn rats and P <0.05 vs control (non-jaundiced Wister rats). D. Scatter
plot and the correlation between baseline UCB concentration and IL-1β concentration;
n=10 for Wister and n =17 for Gunn rats.
140
5.4.4 Unconjugated bilirubin, biliverdin and chemokine IL-8 expression
Interleukin-8, the most abundant chemokine secreted by neutrophils, promotes
the migration of neutrophils towards the site of inflammation, encouraging the acute
phase of tissue damage/pathogen destruction [362,363]. Blood samples incubated with
BV ± LPS were analysed for IL-8 gene and protein expression. Biliverdin alone
significantly decreased IL-8 gene expression (Figure 5.10A). When BV was co-
incubated with LPS, IL-8 gene and protein expression also were decreased in a dose
dependent manner, with 50 µM BV being most effective (Figure 5.11A-B; P < 0.05).
We also analysed whether baseline UCB concentration affected IL-8 expression
in leukocytes after LPS activation. A positive correlation existed between UCB and IL-
8 gene expression (R = 0.857, P = 0.006; Figure 5.11C); however, no significant
relationship existed between UCB and IL-8 release (Figure 5.11D).
141
Figure 5.10: IL-8 gene and protein expression in response to BV. IL-8 gene (A) and
protein (B) expression was analysed using 2- ∆∆ C
T method and ELISA kit, respectively.
Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0
µM BV).
142
Figure 5.11: IL-8 concentration in response to LPS and BV. IL-8 gene and protein
concentration was analysed using qPCR and high sensitivity ELISA kit, respectively in
blood samples incubated with BV and LPS for 4 or 8 h. IL-8 gene (A) and protein (B)
expression in response to BV + LPS. Data are presented as mean ± S.E. n=7 and P <
0.05 vs sample treated with LPS only (0 µM). Scatter plot showing the correlation
between baseline UCB concentration and IL-8 gene (C) and protein expression (D) in
response to LPS, n=7.
143
5.4.5 Biliverdin and C5aR expression
We have recently shown that stimulation using LPS induces C5aR expression in
RAW 264.7 and bone marrow derived macrophages after 24 and 48 h incubation [338].
Biliverdin at 50 µM significantly reduced the LPS-mediated increase in C5aR in both
primary and immortalised macrophages [338]. Therefore, we investigated whether
incubation of whole blood with LPS would induce C5aR and whether BV would
mitigate this increase. Stimulation of whole blood with LPS significantly decreased
C5aR gene expression (P < 0.05; Figure 5.12A). However, BV + LPS failed to show
any additional significant reduction in C5aR expression (Figure 5.12A). The effect of
BV treatment alone on C5aR expression was also assessed. Biliverdin treatment tended
to decrease C5aR expression (ANOVA effect; P = 0.08; Figure 5.12B).
144
Figure 5.12: C5aR gene expression in response to BV±LPS. Gene expression of
C5aR was analysed using 2- ∆∆ C
T method (A and B). Data are presented as median (25-
75% interquartile range). n=7, *P < 0.05 vs control (C).
145
5.5 Discussion
The present study shows novel immuno-modulatory effects of supplemented BV
and physiological UCB concentrations on both pro- and anti-inflammatory cytokine
gene and protein expression in human blood, in response to whole blood LPS exposure.
Biliverdin, the precursor of UCB, mitigated ex vivo LPS-induced expression of IL-1β,
IL-6, IFN-γ and IL-1Ra at the transcriptional level. Biliverdin also attenuated LPS-
mediated IL-1 and IL-8 release into plasma. Increasing baseline concentrations of
UCB in human samples were associated with increased IL-1β, IFN-γ, IL-1Ra and IL-8
gene expression. Furthermore, increased baseline IL-1β concentrations in severely
hyperbilirubinaemic rat blood samples were positively correlated with bilirubin
concentrations.
Biliverdin and cytokine response: A significant body of evidence shows the anti-
inflammatory potential of BV in cell culture and in animal models of organ
transplantation and sepsis. For example, investigations in cardiac, lung, liver
transplantation and sepsis models show that BV treatment improves tissue graft
survival, function and tissue injury by inhibiting pro-inflammatory cytokine expression
[210,212,216,217,218]. Furthermore, a recent study in a rat model of haemorrhagic
shock and resuscitation reported that pre-treatment with BV attenuated lung injury via
decreased expression of IL-6, TNF- and iNOS in lung tissue [219]. Although these
studies show great promise, they have all been conducted in animal models, which have
limitations when predicting human responses. For example, Seok et al. [364] recently
demonstrated that mouse models of inflammation poorly correlate with human
inflammatory responses. Therefore, we conducted the first in human ex vivo assay to
assess the effect of exogenous BV on leukocyte responses to LPS exposure. We adopted
the whole blood ex vivo model of LPS stimulation without any culture media as used in
other studies [357,365]. Whole blood retains all blood components and provides a
normal working environment for cell to cell interactions [357].
The data presented here further strengthens the argument for an anti-inflammatory
role of BV, as reported in animal studies, by showing inhibitory effects of BV (50 µM)
on LPS-mediated mRNA abundance of IL-1 and IL-6. However, when cytokines were
analysed in plasma, BV only decreased LPS-mediated IL-1 release. The enhanced
146
production of cytokines, particularly IL-1β during acute inflammation is important for
resolution of inflammation/infectious diseases, including sepsis [303]. Furthermore,
animal studies show that the beneficial effects of anti-IL-1β neutralising antibody
(XOMA 052) in several acute and chronic inflammatory diseases, including type 2
diabetes, gout and ischaemia [366,367]. XOMA 052 antibody blocked the IL-1β
induced expression of IL-6 and IL-8 in human lung fibroblast cell line, suggesting the
importance of IL-1β in inflammation [366]. Therefore, BV’s inhibitory effect on IL-β
appears to be a very important finding and provides preliminary evidence in support of
BV’s anti-inflammatory potential in humans. These data are in agreement with BV’s
effects in experimental and in vitro studies [210,212,216,217,218]. Moreover,
experiments performed in animal models of transplantation and sepsis investigated
BV’s effects on pro-inflammatory cytokine gene expression only and reported that BV
consistently reduced the expression of pro-inflammatory cytokines. For example, BV
treatment prior to endotoxin shock or caecal ligation and puncture (CLP) or organ
transplantation significantly decreased the mRNA expression of pro-inflammatory
cytokines, including IL-1β, IL-6, TNF- and monocyte chemoattractant protein (MCP)-
1 [208,217,218] in injured tissues. In contrast to this, BV decreased both the gene and
protein expression of IL-6 in LPS-stimulated RAW macrophages; however, protein
expression of TNF- remained unchanged [217,338]. We also report here suppression
of LPS-induced IFN-γ and IL-1Ra gene expression. Biliverdin at a higher concentration
(100 µM) also suppresses IFN-γ release in anti-CD3 stimulated mice splenocytes [212].
The mechanism to explain the differential effects of BV on pro-inflammatory cytokine
expression remains unknown. However, the data presented here are valuable, in that
they document 1) inhibitory effects of BV on gene expression in human leukocytes and
2) confirm that some of these responses are accompanied by reductions in cytokine
release, which is rarely documented in cell culture and animal studies.
We suggest that BV’s inconsistent capacity to decrease the release of cytokines into
plasma may be mediated by the variations in human cytokine kinetics and release after
LPS stimulation. For example, the maximum mRNA levels for TNF- and IL-6 in
whole blood are reported between 2-4 h after LPS exposure and protein levels were
rapidly increased at 4-6 h after LPS stimulation and, thereafter, start to decrease
[361,368]. In contrast to this, IL-1β gene expression decreases slowly and protein levels
147
peak after 8 h after whole blood LPS stimulation [361]. Unfortunately, it was beyond
the scope of this manuscript to measure each cytokine at each of their optimal time
points, however, the data do provide very interesting and novel evidence to suggest that
BV can reduce IL-1β and IL-8 expression and their release in a human blood ex vivo
LPS model of inflammation.
In the present study, total cell counts showed that neutrophils represented the major
cell population of white blood cells in blood. Therefore, we also investigated BV’s
effects on IL-8. We reported a significant decrease in LPS-induced IL-8 gene and
protein expression by BV (50 M). This is the first study to show an effect of BV on
IL-8. Supportive data presented by Andria et al. [27] recently showed that BV treatment
prevented IRI-induced cell death and reduced infiltration of neutrophils by >50 % in the
pig livers [27]. In addition, rats pre-treated with BV showed reduced neutrophil
recruitment into bronchoalveolar lavage fluid and intestine after LPS and CLP
exposure, respectively [217,218], suggesting that BV might reduce the severity of sepsis
in various organs via inhibition of IL-8 mediated neutrophil infiltration. We suggest that
BV exerts these effects by suppressing leukocyte IL-8 expression and release, as
documented here.
Unconjugated bilirubin and cytokine response: A surprising finding of this study was
that in humans, higher baseline UCB concentrations were significantly associated with
greater LPS-mediated cytokine gene expression. Furthermore, serum samples from
hyperbilirubinaemic Gunn rats had increased baseline IL-1β concentrations. A previous
report indicates that baseline IL-1β concentration is elevated in hyperbilirubinaemic
humans [25]. We sought to determine whether elevated IL-1β in humans and rats might
be caused by increased IL-1β gene expression in whole blood. A positive correlation
between UCB concentration and expression of IL-1 in addition to IFN-, IL-1Ra and
IL-8 was found after LPS exposure; however, no significant correlation between UCB
concentration and LPS-induced IL-6, TNF- and IL-10 gene expression occurred.
Furthermore, when cytokines were measured in plasma samples, no significant
correlation existed between UCB concentrations and LPS-induced cytokine release.
Similar observations were reported in Gunn rats and RAW macrophages, in which,
UCB showed no effect on IL-6, TNF- and IL-10 concentrations after LPS exposure;
148
however UCB decreased the expression of LPS-mediated inducible nitric oxide
synthase (iNOS) [238]. These findings are supported by an in vivo study by Dorresteijn
et al. (recently presented in abstract form), showing no change in LPS-induced pro-
inflammatory cytokine concentrations in subjects receiving atazanavir (300 mg twice
daily for four days). Atazanavir induces hyperbilirubinaemia by inhibiting the enzyme
UGT1A1 [369]. However, in the same study, Dorresteijn et al. showed that atazanavir
significantly decreased LPS-mediated IL-10 concentration, suggesting immuno-
modulatory activities of UCB in humans.
Although studies have shown that individuals with mildly elevated
concentration of UCB in Gilbert’s Syndrome (GS) have low prevalence of
cardiovascular disease [221,222], excessive accumulation of UCB (> 200 µM) in
newborn infants causes jaundice [370,371]. Elevated UCB concentrations are clearly
toxic to neuronal tissues, promoting apoptosis in astrocytes and in brain endothelial
cells via induction of pro-inflammatory cytokines (IL-1, IL-6 and TNF-) [372,373].
Our human ex vivo and in vivo data from rat serum samples both support a hypothesis
that UCB increases IL-1β expression in leukocytes, which then excrete IL-1β into
plasma. IL-1β is synthesised as pro IL-1β and requires activation by caspase-1.
Caspase-1 together with caspase-3 and -9 induce apoptosis and DNA fragmentation
[297]. Studies show that UCB increases caspase-3 and caspase-9 activities in
hepatocytes and cardiomyocytes [374,375]. However, UCB’s effect on caspase-1
(which is strongly associated with septic responses) [297] remains unknown, clearly
warrants future investigation and represents a potentially very exciting area of future
research.
Unconjugated bilirubin’s effects on cytokine expression, reported here, are
interesting because Gunn rats and mice treated with UCB (8.5 µmol/kg) show improved
survival of cardiac and islets grafts, respectively via attenuation of mRNA expression of
TNF-, IL-6, MCP-1, iNOS and cyclooxygenase (COX)-2 [228,229]. However, none of
the above studies showed a relationship between baseline UCB concentrations and pro-
inflammatory cytokine expression. This suggests that UCB may have dichotomous
effects in rodents and humans. Importantly, the data presented here show that increasing
concentration of UCB is positively correlated with IL-1β expression and are in
149
agreement with a previous study that showed elevated circulating IL1β concentrations
in hyperbilirubinaemic humans [25]. We suggest that UCB concentration plays an
important role in modulating inflammatory responses with very low (<5 M) and
mildly elevated UCB (>17 M) concentrations associated with increased IL-1β
concentrations [25]. Furthermore, in support of our findings, human neutrophils treated
with UCB alone (10-300 µM) for 24 h showed increased IL-1β and IL-8 concentration
in media [239], implying that UCB at elevated concentrations may heighten
inflammation. However, no studies have thus far reported effects of UCB on LPS-
mediated cytokine gene and protein expression. We reported significant, positive
correlations between increasing baseline UCB concentration (up to 12 M) and LPS-
driven gene expression of IL-1, IFN-, IL-1Ra and IL-8. However, the baseline UCB
concentrations were not associated with the release of cytokines into plasma. These data
are in agreement with an in vitro study showing that UCB concentration (10-300 µM)
did not influence IL-1β and IL-8 release into media after LPS activation of human
neutrophils [239]. We suggest that a higher concentration (compared to 12 µM studied
here) of UCB is required to increase synthesis and release of baseline IL-1β [25,239],
which was confirmed in our hyperbilirubinaemic Gunn animals (UCB ~ 100 M).
It is possible that BV could be infused into Gunn rats and IL-1β concentrations
assessed. It should be noted, however, that BV is rapidly reduced to UCB [21,198],
which will result in further increase in the UCB concentration in Gunn rats and may
promote inflammation. However, a recent study by Kosaka et al. [219] have shown that
Sprague–Dawley rats administrated various doses of BV (0-100 mg/kg) were protected
haemorrhagic shock induced lung injury, further supporting the cytoprotective potential
of BV.
These data suggest that both BV and UCB induce differential effects on
inflammatory mediators expression after LPS exposure, which is interesting because
BV is rapidly reduced to UCB [21,198,217]. Our data confirms that leukocytes are
capable of such reduction, showing ~ a three-fold increase in UCB concentration after
addition of 50 µM BV. However, all the samples showed mild increase in haemolysis,
which resulted in a small increase in UCB concentrations in control samples. We
suggest that the BV (50 µM)-induced increase in UCB concentration is a consequence
150
of both haem and BV metabolism. This data is in agreement with in vivo data showing
that UCB increases by approximately 33 % of the exogenously administered circulating
BV concentration [198]. Cell culture and animal studies provide an insight into the
differential effects on BV and UCB. For example, BV inhibits the activation of nuclear
factor kappa B (NF-κB) in HEK293A cells and in animal models of sepsis and
transplantation [212,217,218,220]. On the contrary, UCB does not affect NF-κB
expression both in vivo and in vitro [242]. Therefore, we suggest that in humans, BV via
activation of transcription factor NF-κB may counter-regulate inflammation in the acute
phase (Figure 5.13). Accumulating evidence suggests that UCB is the potential activator
and ligand of transcription factor aryl hydrocarbon receptor (AhR) [197,376]. AhR was
first discovered as a mediator of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; dioxin)
toxicity and over the last decade it has emerged as a potential regulator of immune
system [377]. We suggest that UCB, similar to AhR agonist TCDD [378], may increase
the gene expression of IL-1β in the presence/absence of LPS stimulation (Figure 5.13).
Therefore, it is likely that BV and UCB induce their effects on inflammatory mediators
via different mechanisms.
151
152
Figure 5.13: Possible mechanism of BV and UCB-triggered immune-modulatory
effects. Haem is catabolised into BV, iron (Fe++
) and carbon monoxide (CO) via the
action of haem oxygenase (HO). Biliverdin is rapidly reduced to UCB in the presence of
BVR. Pro-inflammatory mediators and endotoxin activate NF-B p60/p65 dimer and
promote its translocation to the nucleus, where it induces the transcription and
translation of pro-inflammatory genes. Biliverdin inhibits the expression of pro-
inflammatory mediators via inhibition of NF-B activation. However UCB, similar to
dioxins, may promote translocation of AhR from the cytoplasm and binding to
xenobiotics/dioxin responsive elements, which results in activation of AhR. Activated
form of AhR then leads to increase expression of cytokines (TNF- and IL-1).
153
Biliverdin and C5aR expression: Having established that BV decreases LPS-dependent
C5aR expression in primary and immortalised macrophages [338], we aimed to assess
whether LPS/BV would also modulate C5aR gene expression in human blood.
Lipopolysaccharide significantly inhibited C5aR expression at 4 h. Although, blood
leukocytes from patients with severe septic shock show a remarkable increase in C5aR
gene expression compared to healthy individuals [379], incubation of human monocytes
with LPS (6-12 h) significantly decreased C5aR mRNA expression [327,380],
suggesting counter-regulatory role of LPS on C5aR in human leukocytes. However, BV
+ LPS had no additional significant effect on C5aR expression vs. LPS control.
Biliverdin treatment alone tended to decrease C5aR expression (ANOVA effect; P =
0.08) in agreement with our previous published reports indicating that BV treatment of
macrophages decreases C5aR expression [338]. Assessment of C5aR expression in a
larger group of individuals may be necessary to reveal a statistically significant effect of
BV.
Limitations: Although we recruited a relatively small sample of volunteers, we
reduced between subject responses by investigating healthy individuals and limited
recruitment to male subjects, eliminating possible variation introduced by the oestrous
cycle in women [381]. By investigating human subjects who showed > 10 fold IL-1β
expression our findings are limited to those individuals with a strong host response to
LPS. In addition, all samples experienced mild haemolysis at 4 and 8 h, which
contributed to a non-significant increase in UCB in control samples. Haemolysis is
frequently observed in patients with sepsis after acute infection [382]. However,
haemolysis did not contribute to inflammation in the present study as indicated by low
levels of cytokines in non-LPS treated samples. It is also reported that LPS positively or
negatively regulates HO-1 expression in different cell lines and species [383,384,385].
For example, LPS induces HO-1 induction in leukemia cell lines; however, LPS does
not increase HO-1 expression in primary monocytes because they express a substantial
amount of HO-1 basally compared to immortalised monocytes [386]. Furthermore
during extensive haemolysis, free haemoglobin promotes release of free haem and
accumulation in the cell membrane [387]. Our ex vivo data showed ~ 4 and ~ 7-fold
increase in haem content in plasma after 4 and 8 h of incubation, respectively. In
addition, in vitro studies show that incubation with haem (10 μM) for 24 h promotes
HO-1 induction [388]. We suggest that haemolysis reported after 4 and 8 h incubation
154
may increase HO-1 expression, however, future studies are required to investigate the
effect of haemolysis on HO-1 induction and the effect of this within ex vivo models of
LPS stimulation. Only one time point was used to measure the release of cytokines in
this study (8 h) and it is possible that measurement at other time points (4-6 h)
[361,368] might reveal additional significant effects of BV and UCB. Despite this, the 8
h time point was appropriate for LPS-mediated IL-1 and IL-8 release into plasma,
which were decreased after BV treatment. Clearly, the kinetics of cytokine release
differs between targets and, therefore, this likely accounted partly for the lack of
congruence between gene and protein data. Although previous in vitro studies showed
suppressive effects of BV on both gene and protein expression of pro-inflammatory
cytokines (IL-6), these studies were performed using a single cell type. The present
study has benefit of studying inflammatory responses in a complex, yet appropriate
matrix composing of multiple cell lineages and, most importantly, these responses were
tested in human cells.
Summary: Collectively, these data show that BV inhibits whole human blood responses
to LPS, by reducing mRNA expression of IL-1, IL-6, IFN-, IL-1Ra and IL-8.
Biliverdin also attenuated the LPS-induced excretion of IL-1 and IL-8 into plasma.
Interestingly, UCB at increasing baseline concentrations was correlated with greater
transcription of cytokines in response to LPS, suggesting UCB has pro-inflammatory
potential. In summary, in this report we demonstrate that both BV and UCB are
immuno-modulatory compounds and that BV could represent potential therapeutic
target against inflammatory disorders, including sepsis, based upon its potent ability to
potently inhibit IL-1 and IL-8 transcription and release in leukocytes.
155
Chapter 6 Thesis Summary and Conclusion
156
6.1 Introduction
Despite extensive research on BV’s protective mechanisms against
transplantation-related pathology [27,176,209,211], vascular injury [26], endotoxic
shock [217], polymicrobial sepsis/caecal ligation puncture [218], the effects of BV on
C5aR, a major contributor to inflammatory pathology [29,30,31,32], is essentially
unknown.
Biliverdin reductase influences a diverse spectrum of functions, including cell
signalling and induces antioxidant cytoprotection [255,263]. For example, deletion of
BVR by RNA interference leads to the development of a pro-inflammatory phenotype
in macrophages, increasing TLR-4 gene expression [28]. The beneficial effects of
BV/BVR against inflammation-mediated injury prompted this thesis topic, which aimed
to investigate the potential impacts of exogenous BV and endogenous BVR on C5aR,
pro-inflammatory cytokine expression, macrophage chemotaxis and phenotype in cell
culture and animal models. In addition, the project also aimed to translate the effects of
exogenous BV observed in animal studieson on pro- and anti-inflammatory cytokine
gene expression in an ex vivo human model of LPS stimulation. These data might assist
in revealing the therapeutic potential of BV administration in sepsis and septic shock.
6.2 Project summary
The first study (Chapter 3) explored the anti-inflammatory effects of BV in
immortalised and primary macrophages. It was hypothesised that: i) BV would reduce
LPS-induced gene and protein expression of C5aR in both macrophage populations, ii)
effects of BV would be mediated via the PI3K/mTOR signalling pathway and iii) BV
would inhibit LPS-mediated gene expression and production of TNF-α and IL-6. The
hypotheses were partially supported in that BV at 50 µM inhibited the LPS (100
ng/mL)-dependent increase in C5aR gene and protein expression in RAW 264.7 and
bone marrow derived macrophages. Furthermore, BV and LPS increased the
phosphorylation of Akt (downstream of PI3K) and S6 (downstream of mTOR), which
was inhibited by treatment with LY294002 (LY) and rapamycin, respectively. However,
LY also blocked LPS-induced C5aR expression in addition to Akt phosphorylation.
Since LY may exert non-specific inhibitory effects beyond the PI3K pathway [326],
rapamycin was chosen (a specific inhibitor of pS6) [291] to specifically investigate
whether BV’s activation of mTOR signalling inhibits LPS-induced C5aR expression.
157
Interestingly, the mTOR inhibitor did not influence LPS-effects on C5aR, although,
BV’s inhibitory effect on LPS-induced C5aR was abrogated, suggesting that BV
mitigates LPS-mediated C5aR expression in part via mTOR signalling. Biliverdin also
significantly decreased gene expression of TNF-α and IL-6 after 24 h incubation with
LPS. However, when cytokine release was measured, BV only significantly decreased
LPS-triggered IL-6 release.
These data suggest that inhibition of C5aR expression by BV is an important
anti-inflammatory mechanism. Therefore, the next study of this project aimed to explore
the effect of BVR (which BV activates) deletion on C5aR, chemotaxis and macrophage
polarisation.
The second study (Chapter 4) of this project investigated the role of BVR on
C5aR expression, macrophage phenotype and function. Macrophages from BVRfl/fl
and
CreLyz: BVRfl/fl
mice (conditional deletion of BVR in myeloid cells) were employed and
treated with LPS (100 ng/mL) and IFN-γ (20 ng/mL) or control for 24 or 72 h ± a
neutralising antibody against C5aR. Stimulation with LPS and IFN-γ promoted
macrophage polarisation towards the M1 phenotype, resulting in increased iNOS
expression and TNF-α production [342]. Macrophages from CreLyz:BVRfl/fl
mice
showed a significant increase in C5aR gene and protein expression at baseline, and
exhibited increased chemotaxis in response to C5a (100 nM). Furthermore, the increase
in C5aR protein and chemotaxis in CreLyz:BVRfl/fl
was blocked by pre-incubation with
a C5aR neutralising antibody. Deletion of BVR in CreLyz:BVRfl/fl
mice promoted
macrophage polarisation towards the M1 phenotype, which was accompanied by a
significant increase in iNOS gene and protein expression and TNF-α production.
Interestingly, blocking C5aR with the neutralising antibody abrogated the LPS and IFN-
γ dependent increase in iNOS expression and TNF-α levels in CreLyz:BVRfl/fl
mice. In
conclusion, these data suggested that deletion of BVR in myeloid cells induces
complement activation by increased expression of C5aR and chemotaxis in response to
C5a. Furthermore, BVR regulates macrophage activation and phenotype, and deletion
of BVR results in increased expression of iNOS and TNF-α (M1 polarisation). The
increased expression of C5aR, chemotaxis and expression of M1 markers in
macrophages from CreLyz:BVRfl/fl
mice were abrogated by treatment with anti-mouse
158
C5aR, suggesting that C5aR plays a crucial role in regulating BVR’s mediated immune
responses.
The data from Chapter 3 and 4 suggest that both BV and BVR play an important
role in regulating inflammation by reducing the expression of C5aR, cytokine gene
expression, release and macrophage phenotype in cellular and murine models. These
data further support the possibility that BV/BVR mediates cytoprotection against
transplantation, endotoxic shock and sepsis-mediated inflammation in rodent models via
its anti-inflammatory mechanisms of action. However, the effect of BV
supplementation in a humanised model of inflammation remains unknown. Therefore,
the next study aimed to investigate the anti-inflammatory potential of BV after ex vivo
LPS activation of whole human blood.
The third and final study (Chapter 5) of this thesis investigated the effects of
exogenous BV and endogenous UCB on C5aR and cytokine gene expression and
release of pro-and anti-inflammatory cytokines in human blood after LPS stimulation.
Interestingly, stimulation of human blood with LPS significantly decreased C5aR gene
expression, therefore, BV’s effect on C5aR could not be verified in this ex vivo human
model. However, in vitro studies show that LPS increases C5aR expression in
epithelial, endothelial and mouse macrophage cell lines [332,334]. However, acute
incubation of human monocytes with LPS (6-12 h) reduced C5aR mRNA expression
[327,380], suggesting LPS induces counter-regulatory expression of C5aR in human
leukocytes. Recently, Dorrestejein et al. [389] reported no significant effect of LPS
administration on the complement cascade, including C1 esterase and C4 proteins in
humans. Furthermore, Furebring et al. [390] showed that ex vivo incubation of whole
blood with LPS (0.1-1000 ng/mL) decreased the C5aR protein expression in leukocytes,
agreeing with gene expression data presented in this thesis. In addition, reduced
expression of C5aR was reported in patients with sepsis [391] and in an animal model
of caecal ligation puncture [392]. However, an ~ 5-fold increase in serum
concentrations of C5a and ~ 2-fold increase in C5b-9 (membrane attack complex) were
reported in septic shock patients [392]. These studies indicate that a decrease in C5aR
during sepsis or after LPS exposure could be mediated via excessive activation of
complement proteins, including C5a. In contrast to this, Tschering et al. [393] showed
that in mice and rats, C5aR was exclusively expressed by infiltrated leukocytes but was
undetectable in parenchymal cells, including epithelial cells, smooth muscle cells and
159
endothelial cells after LPS-induced pneumonitis. However, in vitro that LPS induces
C5aR expression in cultured epithelial and endothelial cells [332,333], suggesting that
LPS increases C5aR expression in murine leukcoytes and cultured myeloid and non-
myeloid cells. These studies indicate that LPS positively or negatively regulates C5aR
expression, depending on cell types investigated, species studied and severity of
inflammation. Therefore, future studies are required to investigate the effect of ex vivo
LPS at different time-points in large animal (ovine and porcine) models. These
observations also suggest that another stimulus will be required to induce C5aR
expression in an ex vivo human model to study BV’s inhibitory effect.
Although BV had non-significant effects on C5aR expression, supplementation
of human blood with 50 µM BV significantly reduced LPS-induced gene expression of
IL-1β, IL-6, IFN-γ, IL-1Ra and IL-8. Furthermore, BV decreased leukocyte IL-1β and
IL-8 release in response to LPS. Surprisingly, increasing concentration of baseline
UCB (in the absence of BV) was positively associated with LPS-mediated gene
expression of IL-1β, IFN-γ, IL-1Ra and IL-8. In addition, hyperbilirubinaemic Gunn
rats showed an increase in baseline IL-1β concentrations compared to
normobilirubinaemic Wistar rats. These data indicate that supplemented BV inhibits
LPS-dependent cytokine gene expression and release in whole human blood, supporting
BV’s anti-inflammatory potential in humans. However, endogenous UCB at higher
concentrations appears to promote LPS-mediated cytokine gene expression, suggesting
UCB acts as an immuno-modulatory agent in humans.
6.3 Future research
Revealing the effects of BV and BVR on C5aR in cellular and murine models of LPS
stimulation will facilitate and inform further exploration of the efficacy of BV and BVR
as anti-inflammatory agents in larger animal models of complement associated
inflammatory pathology, including ovine and porcine models of inflammation. Large
animal models represent more appropriate models to translate the efficacy of anti-
inflammatory compounds to the human organism. It is acknowledged that significant
challenges will exist in the translation of BV as an anti-inflammatory drug for use in
humans suffering severe inflammatory disorders. This may exist because BV is rapidly
reduced to UCB [21,198,217], which is likely to induce acute jaundice within human
recipients. Furthermore, as indicated in this thesis, UCB appears to exert pro-
inflammatory effects, which may promote inflammatory responses after BV has been
160
metabolised/excreted. Therefore, future studies are clearly required to further
investigate the effects of BV supplementation in large animal and human ex vivo whole
blood culture models with additional inflammatory stimuli, including damage
associated molecules (e.g. mitochondrial DNA, heat shock protein, high mobility group
box1, burn and hypoxia) to determine the viability and utility of BV as a viable clinical
therapeutic.
Despite these limitations, the inhibitory effects of BV on C5aR suggest that BV
may reduce the severity of complement-associated disorders, including sepsis, arthritis
and possibly atherosclerosis. The data within this thesis also suggest that BV inhibits
IL-8 gene expression and release by leukocytes, supporting a hypothesis that BV may
reduce neutrophil infiltration after organ damage/transplantation, which is an important
finding. The beneficial effects of BV on neutrophils and on chemokine release,
including IL-8 and MCP-1 should also be tested in ovine and porcine models to
determine the viability of BV to improve clinical outcomes after transplant/trauma.
Several studies have documented BVR-mediated protective effects in hypoxia
[267], oxidative stress [263,266] and endotoxin-induced injuries [28] in cell culture and
murine models. The data documented here further support BVR’s anti-inflammatory
and cytoprotective potential using Cre:BVRfl/fl
mice. BVR is also available as a
recombinant protein and cytoprotective effects of exogenous BVR have been
demonstrated against experimental induced encephalomyelitis in rats [266]. Data from
Chapter 4 suggest that the lack of BVR or mutation in the BVR gene is likely to induce
sensitisation to inflammatory stimuli (i.e. C5a). BVR mutation is prevalent (although
very rare) [14], however, data exist to indicate that reduced haem turnover (which forms
BV) may fail to activate BVR sufficiently to mediate anti-inflammatory effects. Haem
catabolism decreases with age [394], consistent with reduced UCB levels in the elderly
[395] and suggests that BVR is less metabolically active in aged individuals. It is likely
that the reduction in haem catabolism and BVR activity with age may increase the risk
of chronic inflammation occurring, which overwhelms host responses in age-associated
diseases [394]. Furthermore, data from Chapter 5 also suggested that UCB at
concentrations above normal levels (>17.1 µM) [192,233] may activate inflammatory
responses by increasing the expression and production of IL-1β [25]. Although, we
speculated that UCB at mildly elevated concentrations may promote inflammation via
161
aryl hydrocarbon receptor activation, future studies are required to establish this mode
of action.
6.4 Concluding remarks
Recently, a growing body of research has demonstrated cytoprotective effects of
BV, suggesting that BV imparts protection via its combined anti-oxidant and anti-
inflammatory effects. The data in this thesis further support the importance of BV/BVR
in mediating protection against inflammation and suggest that BV/BVR may reduce the
severity of inflammation-associated pathologies in humans, by reducing C5aR and
cytokine expression. Reporting these beneficial effects of BV/BVR will hopefully
attract research funding agencies to support research on the therapeutic potential of
BV/BVR, which may benefit the health of general public.
162
Chapter 7 References
163
[1] L. Vitek, J.D. Ostrow, Bilirubin chemistry and metabolism; harmful and protective
aspects. (2009) Curr Pharm Des 15: 2869-2883.
[2] A.E. O'Connor, W.M. Gallagher, A.T. Byrne, Porphyrin and nonporphyrin
photosensitizers in oncology: preclinical and clinical advances in photodynamic
therapy. (2009) Photochem Photobiol 85: 1053-1074.
[3] H.L. Bonkovsky, J.T. Guo, W. Hou, T. Li, T. Narang, M. Thapar, Porphyrin and
heme metabolism and the porphyrias. (2013) Compr Physiol 3: 365-401.
[4] R.E. Blankenship, H. Hartman, The origin and evolution of oxygenic
photosynthesis. (1998) Trends Biochem Sci 23: 94-97.
[5] F.L. Sousa, L. Shavit-Grievink, J.F. Allen, W.F. Martin, Chlorophyll biosynthesis
gene evolution indicates photosystem gene duplication, not photosystem merger, at
the origin of oxygenic photosynthesis. (2013) Genome Biol Evol 5: 200-216.
[6] M.F. Hohmann-Marriott, R.E. Blankenship, Evolution of photosynthesis. (2011)
Annu Rev Plant Biol 62: 515-548.
[7] A.R. Battersby, Biosynthesis of the pigments of life. (1988) J Nat Prod 51: 629-642.
[8] D.C. Mauzerall, Evolution of porphyrins. (1998) Clin Dermatol 16: 195-201.
[9] A.F. McDonagh, Turning green to gold. (2001) Nat Struct Biol 8: 198-200.
[10] A. Wilks, Heme oxygenase: evolution, structure, and mechanism. (2002) Antioxid
Redox Signal 4: 603-614.
[11] C.A. Piantadosi, Biological chemistry of carbon monoxide. (2002) Antioxid Redox
Signal 4: 259-270.
[12] R. Zhao, G.Y. Xu, Z.Z. Liu, J.Y. Li, N. Yang, A study on eggshell pigmentation:
biliverdin in blue-shelled chickens. (2006) Poult Sci 85: 546-549.
[13] A.F. McDonagh, Controversies in bilirubin biochemistry and their clinical
relevance. (2010) Semin Fetal Neonatal Med 15: 141-147.
[14] M. Gafvels, P. Holmstrom, A. Somell, F. Sjovall, J.O. Svensson, L. Stahle, U.
Broome, P. Stal, A novel mutation in the biliverdin reductase-A gene combined
with liver cirrhosis results in hyperbiliverdinaemia (green jaundice). (2009) Liver Int
29: 1116-1124.
[15] J.W. Painter, Jaundice in the newborn. IV. The treatment of hyperbilirubinemia at
Mary Washington Hospital. (1959) Va Med Mon (1918) 86: 97-98.
[16] R.L. Watson, Hyperbilirubinemia. (2009) Crit Care Nurs Clin North Am 21: 97-
120, vii.
[17] H. Ihara, N. Hashizume, N. Shimizu, T. Aoki, Threshold concentration of unbound
bilirubin to induce neurological deficits in a patient with type I Crigler-Najjar
syndrome. (1999) Ann Clin Biochem 36 ( Pt 3): 347-352.
[18] S.W. Ryter, Bile pigments in pulmonary and vascular disease. (2012) Front
Pharmacol 3: 39.
[19] R. Stocker, Antioxidant activities of bile pigments. (2004) Antioxid Redox Signal
6: 841-849.
[20] N. Lerner-Marmarosh, J. Shen, M.D. Torno, A. Kravets, Z. Hu, M.D. Maines,
Human biliverdin reductase: a member of the insulin receptor substrate family
with serine/threonine/tyrosine kinase activity. (2005) Proc Natl Acad Sci U S A
102: 7109-7114.
[21] B. Wegiel, C.J. Baty, D. Gallo, E. Csizmadia, J.R. Scott, A. Akhavan, B.Y. Chin,
E. Kaczmarek, J. Alam, F.H. Bach, B.S. Zuckerbraun, L.E. Otterbein, Cell surface
biliverdin reductase mediates biliverdin-induced anti-inflammatory effects via
phosphatidylinositol 3-kinase and Akt. (2009) J Biol Chem 284: 21369-21378.
164
[22] L. Vitek, M. Jirsa, M. Brodanova, M. Kalab, Z. Marecek, V. Danzig, L. Novotny,
P. Kotal, Gilbert syndrome and ischemic heart disease: a protective effect of
elevated bilirubin levels. (2002) Atherosclerosis 160: 449-456.
[23] L.J. Horsfall, G. Rait, K. Walters, D.M. Swallow, S.P. Pereira, I. Nazareth, I.
Petersen, Serum bilirubin and risk of respiratory disease and death. (2011) JAMA
305: 691-697.
[24] L.J. Horsfall, I. Nazareth, S.P. Pereira, I. Petersen, Gilbert's syndrome and the risk
of death: a population-based cohort study. (2013) J Gastroenterol Hepatol.
[25] M. Wallner, A.C. Bulmer, C. Molzer, E. Mullner, R. Marculescu, D. Doberer, M.
Wolzt, O.F. Wagner, K.H. Wagner, Haem catabolism: a novel modulator of
inflammation in Gilbert's syndrome. (2013) Eur J Clin Invest 43: 912-919.
[26] A. Nakao, N. Murase, C. Ho, H. Toyokawa, T.R. Billiar, S. Kanno, Biliverdin
administration prevents the formation of intimal hyperplasia induced by vascular
injury. (2005) Circulation 112: 587-591.
[27] B. Andria, A. Bracco, C. Attanasio, S. Castaldo, M.G. Cerrito, S. Cozzolino, D. Di
Napoli, R. Giovannoni, A. Mancini, A. Musumeci, E. Mezza, M. Nasti, V.
Scuderi, S. Staibano, M. Lavitrano, L.E. Otterbein, F. Calise, Biliverdin protects
against liver ischemia reperfusion injury in swine. (2013) PLoS One 8: e69972.
[28] B. Wegiel, D. Gallo, E. Csizmadia, T. Roger, E. Kaczmarek, C. Harris, B.S.
Zuckerbraun, L.E. Otterbein, Biliverdin inhibits Toll-like receptor-4 (TLR4)
expression through nitric oxide-dependent nuclear translocation of biliverdin
reductase. (2011) Proc Natl Acad Sci U S A 108: 18849-18854.
[29] H.D. Manthey, A.C. Thomas, I.A. Shiels, A. Zernecke, T.M. Woodruff, B. Rolfe,
S.M. Taylor, Complement C5a inhibition reduces atherosclerosis in ApoE-/- mice.
(2011) FASEB J 25: 2447-2455.
[30] R. Oksjoki, P.T. Kovanen, S. Meri, M.O. Pentikainen, Function and regulation of
the complement system in cardiovascular diseases. (2007) Front Biosci 12: 4696-
4708.
[31] S. Khandhadia, V. Cipriani, J.R. Yates, A.J. Lotery, Age-related macular
degeneration and the complement system. (2012) Immunobiology 217: 127-146.
[32] P.A. Ward, Role of C5 activation products in sepsis. (2010) ScientificWorldJournal
10: 2395-2402.
[33] M.D. Maines, New insights into biliverdin reductase functions: linking heme
metabolism to cell signaling. (2005) Physiology (Bethesda) 20: 382-389.
[34] B. Wegiel, L.E. Otterbein, Go green: the anti-inflammatory effects of biliverdin
reductase. (2012) Front Pharmacol 3: 47.
[35] T.R. Kollmann, O. Levy, R.R. Montgomery, S. Goriely, Innate immune function
by Toll-like receptors: distinct responses in newborns and the elderly. (2012)
Immunity 37: 771-783.
[36] R.S. Goldszmid, G. Trinchieri, The price of immunity. (2012) Nat Immunol 13:
932-938.
[37] C.C. Santos, H. Zhang, M. Liu, A.S. Slutsky, Bench-to-bedside review: Biotrauma
and modulation of the innate immune response. (2005) Crit Care 9: 280-286.
[38] M. Cruvinel Wde, D. Mesquita, Jr., J.A. Araujo, T.T. Catelan, A.W. de Souza, N.P.
da Silva, L.E. Andrade, Immune system - part I. Fundamentals of innate immunity
with emphasis on molecular and cellular mechanisms of inflammatory response.
(2010) Rev Bras Reumatol 50: 434-461.
[39] P. Bourlioux, B. Koletzko, F. Guarner, V. Braesco, The intestine and its microflora
are partners for the protection of the host: report on the Danone Symposium "The
Intelligent Intestine," held in Paris, June 14, 2002. (2003) Am J Clin Nutr 78: 675-
683.
165
[40] A.M. Lundberg, G.K. Hansson, Innate immune signals in atherosclerosis. (2010)
Clin Immunol 134: 5-24.
[41] W.K. den Dekker, C. Cheng, G. Pasterkamp, H.J. Duckers, Toll like receptor 4 in
atherosclerosis and plaque destabilization. (2010) Atherosclerosis 209: 314-320.
[42] D. Annane, E. Bellissant, J.M. Cavaillon, Septic shock. (2005) Lancet 365: 63-78.
[43] E. Kolaczkowska, P. Kubes, Neutrophil recruitment and function in health and
inflammation. (2013) Nat Rev Immunol 13: 159-175.
[44] N. Fujiwara, K. Kobayashi, Macrophages in inflammation. (2005) Curr Drug
Targets Inflamm Allergy 4: 281-286.
[45] J.M. Cavaillon, M. Adib-Conquy, Monocytes/macrophages and sepsis. (2005) Crit
Care Med 33: S506-509.
[46] T.J. Kindt, Osborne, Barbara A., Goldsby, Richard A, Kuby Immunology (6th
edition). (2006).
[47] D. Mesquita Junior, J.A. Araujo, T.T. Catelan, A.W. Souza, M. Cruvinel Wde, L.E.
Andrade, N.P. Silva, Immune system - part II: basis of the immunological response
mediated by T and B lymphocytes. (2010) Rev Bras Reumatol 50: 552-580.
[48] J.A. Alberts B, Lewis J, Raff M, Roberts K, Walter P, Molecular Biology of the
Cell. 5th edition. (2007).
[49] A.W. de Souza, D. Mesquita Junior, J.A. Araujo, T.T. Catelan, M. Cruvinel Wde,
L.E. Andrade, N.P. da Silva, Immune system: part III. The delicate balance of the
immune system between tolerance and autoimmunity. (2010) Rev Bras Reumatol
50: 665-679.
[50] J. Parkin, B. Cohen, An overview of the immune system. (2001) Lancet 357: 1777-
1789.
[51] E.M. Shevach, CD4+ CD25+ suppressor T cells: more questions than answers.
(2002) Nat Rev Immunol 2: 389-400.
[52] L.P. Sousa, A.L. Alessandri, V. Pinho, M.M. Teixeira, Pharmacological strategies
to resolve acute inflammation. (2013) Curr Opin Pharmacol 13: 625-631.
[53] P. Kubes, W.Z. Mehal, Sterile inflammation in the liver. (2012) Gastroenterology
143: 1158-1172.
[54] C.N. Serhan, S.D. Brain, C.D. Buckley, D.W. Gilroy, C. Haslett, L.A. O'Neill, M.
Perretti, A.G. Rossi, J.L. Wallace, Resolution of inflammation: state of the art,
definitions and terms. (2007) FASEB J 21: 325-332.
[55] A.L. Alessandri, L.P. Sousa, C.D. Lucas, A.G. Rossi, V. Pinho, M.M. Teixeira,
Resolution of inflammation: Mechanisms and opportunity for drug development.
(2013) Pharmacol Ther 139: 189-212.
[56] V. Kumar, A. Sharma, Neutrophils: Cinderella of innate immune system. (2010)
Int Immunopharmacol 10: 1325-1334.
[57] B. Amulic, C. Cazalet, G.L. Hayes, K.D. Metzler, A. Zychlinsky, Neutrophil
function: from mechanisms to disease. (2012) Annu Rev Immunol 30: 459-489.
[58] N. Borregaard, J.B. Cowland, Granules of the human neutrophilic
polymorphonuclear leukocyte. (1997) Blood 89: 3503-3521.
[59] C.D. Sadik, N.D. Kim, A.D. Luster, Neutrophils cascading their way to
inflammation. (2011) Trends Immunol 32: 452-460.
[60] J. Pillay, I. den Braber, N. Vrisekoop, L.M. Kwast, R.J. de Boer, J.A. Borghans, K.
Tesselaar, L. Koenderman, In vivo labeling with 2H2O reveals a human
neutrophil lifespan of 5.4 days. (2010) Blood 116: 625-627.
[61] P.S. Tofts, T. Chevassut, M. Cutajar, N.G. Dowell, A.M. Peters, Doubts
concerning the recently reported human neutrophil lifespan of 5.4 days. (2011)
Blood 117: 6050-6052; author reply 6053-6054.
166
[62] K.W. Li, S.M. Turner, C.L. Emson, M.K. Hellerstein, D.C. Dale, Deuterium and
neutrophil kinetics. (2011) Blood 117: 6052-6053; author reply 6053-6054.
[63] S. Caielli, J. Banchereau, V. Pascual, Neutrophils come of age in chronic
inflammation. (2012) Curr Opin Immunol 24: 671-677.
[64] C. Summers, S.M. Rankin, A.M. Condliffe, N. Singh, A.M. Peters, E.R. Chilvers,
Neutrophil kinetics in health and disease. (2010) Trends Immunol 31: 318-324.
[65] F. Walker, H.H. Zhang, V. Matthews, J. Weinstock, E.C. Nice, M. Ernst, S. Rose-
John, A.W. Burgess, IL6/sIL6R complex contributes to emergency granulopoietic
responses in G-CSF- and GM-CSF-deficient mice. (2008) Blood 111: 3978-3985.
[66] P. Lacy, The role of Rho GTPases and SNAREs in mediator release from
granulocytes. (2005) Pharmacol Ther 107: 358-376.
[67] C.S. Baker, R.J. Hall, T.J. Evans, A. Pomerance, J. Maclouf, C. Creminon, M.H.
Yacoub, J.M. Polak, Cyclooxygenase-2 is widely expressed in atherosclerotic
lesions affecting native and transplanted human coronary arteries and colocalizes
with inducible nitric oxide synthase and nitrotyrosine particularly in macrophages.
(1999) Arterioscler Thromb Vasc Biol 19: 646-655.
[68] C. Bogdan, M. Rollinghoff, A. Diefenbach, Reactive oxygen and reactive nitrogen
intermediates in innate and specific immunity. (2000) Curr Opin Immunol 12: 64-
76.
[69] D.I. Pattison, M.J. Davies, C.L. Hawkins, Reactions and reactivity of
myeloperoxidase-derived oxidants: differential biological effects of hypochlorous
and hypothiocyanous acids. (2012) Free Radic Res 46: 975-995.
[70] S. Gordon, P.R. Taylor, Monocyte and macrophage heterogeneity. (2005) Nat Rev
Immunol 5: 953-964.
[71] A. Parihar, T.D. Eubank, A.I. Doseff, Monocytes and macrophages regulate
immunity through dynamic networks of survival and cell death. (2010) J Innate
Immun 2: 204-215.
[72] C. Zhang, The role of inflammatory cytokines in endothelial dysfunction. (2008)
Basic Res Cardiol 103: 398-406.
[73] F.O. Martinez, L. Helming, S. Gordon, Alternative activation of macrophages: an
immunologic functional perspective. (2009) Annu Rev Immunol 27: 451-483.
[74] I. Tabas, Macrophage death and defective inflammation resolution in
atherosclerosis. (2010) Nat Rev Immunol 10: 36-46.
[75] M. Pate, V. Damarla, D.S. Chi, S. Negi, G. Krishnaswamy, Endothelial cell
biology: role in the inflammatory response. (2010) Adv Clin Chem 52: 109-130.
[76] P. Libby, Inflammation and cardiovascular disease mechanisms. (2006) Am J Clin
Nutr 83: 456S-460S.
[77] M. Toborek, S. Kaiser, Endothelial cell functions. Relationship to atherogenesis.
(1999) Basic Res Cardiol 94: 295-314.
[78] J. Davignon, P. Ganz, Role of endothelial dysfunction in atherosclerosis. (2004)
Circulation 109: III27-32.
[79] J.S. Pober, W.C. Sessa, Evolving functions of endothelial cells in inflammation.
(2007) Nat Rev Immunol 7: 803-815.
[80] G. Bazzoni, E. Dejana, Endothelial cell-to-cell junctions: molecular organization
and role in vascular homeostasis. (2004) Physiol Rev 84: 869-901.
[81] J.S. Pober, W. Min, J.R. Bradley, Mechanisms of endothelial dysfunction, injury,
and death. (2009) Annu Rev Pathol 4: 71-95.
[82] P. Kubes, The complexities of leukocyte recruitment. (2002) Semin Immunol 14:
65-72.
[83] B. Petri, M. Phillipson, P. Kubes, The physiology of leukocyte recruitment: an in
vivo perspective. (2008) J Immunol 180: 6439-6446.
167
[84] F. Sallusto, M. Baggiolini, Chemokines and leukocyte traffic. (2008) Nat Immunol
9: 949-952.
[85] M. Barkett, T.D. Gilmore, Control of apoptosis by Rel/NF-kappaB transcription
factors. (1999) Oncogene 18: 6910-6924.
[86] T.M. Baetu, H. Kwon, S. Sharma, N. Grandvaux, J. Hiscott, Disruption of NF-
kappaB signaling reveals a novel role for NF-kappaB in the regulation of TNF-
related apoptosis-inducing ligand expression. (2001) J Immunol 167: 3164-3173.
[87] R. Sen, D. Baltimore, Multiple nuclear factors interact with the immunoglobulin
enhancer sequences. (1986) Cell 46: 705-716.
[88] S. Ghosh, M.S. Hayden, New regulators of NF-kappaB in inflammation. (2008)
Nat Rev Immunol 8: 837-848.
[89] Z. Sun, R. Andersson, NF-kappaB activation and inhibition: a review. (2002)
Shock 18: 99-106.
[90] G. Bonizzi, M. Karin, The two NF-kappaB activation pathways and their role in
innate and adaptive immunity. (2004) Trends Immunol 25: 280-288.
[91] A.M. Mabb, S. Miyamoto, SUMO and NF-kappaB ties. (2007) Cell Mol Life Sci
64: 1979-1996.
[92] J. Dabek, A. Kulach, Z. Gasior, Nuclear factor kappa-light-chain-enhancer of
activated B cells (NF-kappaB): a new potential therapeutic target in
atherosclerosis? (2010) Pharmacol Rep 62: 778-783.
[93] E. Abraham, Nuclear factor-kappaB and its role in sepsis-associated organ failure.
(2003) J Infect Dis 187 Suppl 2: S364-369.
[94] U. Forstermann, W.C. Sessa, Nitric oxide synthases: regulation and function.
(2012) Eur Heart J 33: 829-837, 837a-837d.
[95] K. Bian, F. Murad, Diversity of endotoxin-induced nitrotyrosine formation in
macrophage-endothelium-rich organs. (2001) Free Radic Biol Med 31: 421-429.
[96] K. Bian, F. Ghassemi, A. Sotolongo, A. Siu, L. Shauger, A. Kots, F. Murad, NOS-
2 signaling and cancer therapy. (2012) IUBMB Life 64: 676-683.
[97] R.B. Mikkelsen, P. Wardman, Biological chemistry of reactive oxygen and
nitrogen and radiation-induced signal transduction mechanisms. (2003) Oncogene
22: 5734-5754.
[98] V.W. Liu, P.L. Huang, Cardiovascular roles of nitric oxide: a review of insights
from nitric oxide synthase gene disrupted mice. (2008) Cardiovasc Res 77: 19-29.
[99] L.A. Ridnour, D.D. Thomas, D. Mancardi, M.G. Espey, K.M. Miranda, N.
Paolocci, M. Feelisch, J. Fukuto, D.A. Wink, The chemistry of nitrosative stress
induced by nitric oxide and reactive nitrogen oxide species. Putting perspective on
stressful biological situations. (2004) Biol Chem 385: 1-10.
[100] G. Foldes, S. von Haehling, S.D. Anker, Toll-like receptor modulation in
cardiovascular disease: a target for intervention? (2006) Expert Opin Investig
Drugs 15: 857-871.
[101] H. Bjorkbacka, Multiple roles of Toll-like receptor signaling in atherosclerosis.
(2006) Curr Opin Lipidol 17: 527-533.
[102] M.F. Tsan, B. Gao, Endogenous ligands of Toll-like receptors. (2004) J Leukoc
Biol 76: 514-519.
[103] R.T. Figueiredo, P.L. Fernandez, D.S. Mourao-Sa, B.N. Porto, F.F. Dutra, L.S.
Alves, M.F. Oliveira, P.L. Oliveira, A.V. Graca-Souza, M.T. Bozza,
Characterization of heme as activator of Toll-like receptor 4. (2007) J Biol Chem
282: 20221-20229.
[104] L.C. Parker, L.R. Prince, I. Sabroe, Translational mini-review series on Toll-like
receptors: networks regulated by Toll-like receptors mediate innate and adaptive
immunity. (2007) Clin Exp Immunol 147: 199-207.
168
[105] R.P. Gomariz, A. Arranz, Y. Juarranz, I. Gutierrez-Canas, M. Garcia-Gomez, J.
Leceta, C. Martinez, Regulation of TLR expression, a new perspective for the role
of VIP in immunity. (2007) Peptides 28: 1825-1832.
[106] L.R. Prince, M.K. Whyte, I. Sabroe, L.C. Parker, The role of TLRs in neutrophil
activation. (2011) Curr Opin Pharmacol 11: 397-403.
[107] J.V. Sarma, P.A. Ward, The complement system. (2011) Cell Tissue Res 343:
227-235.
[108] M.C. Carroll, The complement system in regulation of adaptive immunity. (2004)
Nat Immunol 5: 981-986.
[109] U. Kishore, R.B. Sim, Factor H as a regulator of the classical pathway activation.
(2012) Immunobiology 217: 162-168.
[110] M.V. Carroll, R.B. Sim, Complement in health and disease. (2011) Adv Drug
Deliv Rev 63: 965-975.
[111] H.D. Manthey, T.M. Woodruff, S.M. Taylor, P.N. Monk, Complement
component 5a (C5a). (2009) Int J Biochem Cell Biol 41: 2114-2117.
[112] C. Ehrnthaller, A. Ignatius, F. Gebhard, M. Huber-Lang, New insights of an old
defense system: structure, function, and clinical relevance of the complement
system. (2011) Mol Med 17: 317-329.
[113] P.A. Ward, The dark side of C5a in sepsis. (2004) Nat Rev Immunol 4: 133-142.
[114] P.A. Ward, Functions of C5a receptors. (2009) J Mol Med (Berl) 87: 375-378.
[115] M. Huber-Lang, J.V. Sarma, F.S. Zetoune, D. Rittirsch, T.A. Neff, S.R. McGuire,
J.D. Lambris, R.L. Warner, M.A. Flierl, L.M. Hoesel, F. Gebhard, J.G. Younger,
S.M. Drouin, R.A. Wetsel, P.A. Ward, Generation of C5a in the absence of C3: a
new complement activation pathway. (2006) Nat Med 12: 682-687.
[116] W. Zhou, The new face of anaphylatoxins in immune regulation. (2012)
Immunobiology 217: 225-234.
[117] P.J. Haas, J. van Strijp, Anaphylatoxins: their role in bacterial infection and
inflammation. (2007) Immunol Res 37: 161-175.
[118] A. Klos, A.J. Tenner, K.O. Johswich, R.R. Ager, E.S. Reis, J. Kohl, The role of
the anaphylatoxins in health and disease. (2009) Mol Immunol 46: 2753-2766.
[119] K.E. Foreman, A.A. Vaporciyan, B.K. Bonish, M.L. Jones, K.J. Johnson, M.M.
Glovsky, S.M. Eddy, P.A. Ward, C5a-induced expression of P-selectin in
endothelial cells. (1994) J Clin Invest 94: 1147-1155.
[120] H. Lee, P.L. Whitfeld, C.R. Mackay, Receptors for complement C5a. The
importance of C5aR and the enigmatic role of C5L2. (2008) Immunol Cell Biol
86: 153-160.
[121] I.J. Laudes, J.C. Chu, S. Sikranth, M. Huber-Lang, R.F. Guo, N. Riedemann, J.V.
Sarma, A.H. Schmaier, P.A. Ward, Anti-c5a ameliorates coagulation/fibrinolytic
protein changes in a rat model of sepsis. (2002) Am J Pathol 160: 1867-1875.
[122] H.R. Tsai, L.M. Yang, W.J. Tsai, W.F. Chiou, Andrographolide acts through
inhibition of ERK1/2 and Akt phosphorylation to suppress chemotactic migration.
(2004) Eur J Pharmacol 498: 45-52.
[123] N.J. Chen, C. Mirtsos, D. Suh, Y.C. Lu, W.J. Lin, C. McKerlie, T. Lee, H.
Baribault, H. Tian, W.C. Yeh, C5L2 is critical for the biological activities of the
anaphylatoxins C5a and C3a. (2007) Nature 446: 203-207.
[124] H. Ait-Oufella, S. Taleb, Z. Mallat, A. Tedgui, Recent advances on the role of
cytokines in atherosclerosis. (2011) Arterioscler Thromb Vasc Biol 31: 969-979.
[125] A. Tedgui, Z. Mallat, Cytokines in atherosclerosis: pathogenic and regulatory
pathways. (2006) Physiol Rev 86: 515-581.
[126] N. Parameswaran, S. Patial, Tumor necrosis factor-alpha signaling in
macrophages. (2010) Crit Rev Eukaryot Gene Expr 20: 87-103.
169
[127] A.J. Gearing, P. Beckett, M. Christodoulou, M. Churchill, J. Clements, A.H.
Davidson, A.H. Drummond, W.A. Galloway, R. Gilbert, J.L. Gordon, et al.,
Processing of tumour necrosis factor-alpha precursor by metalloproteinases.
(1994) Nature 370: 555-557.
[128] C. Zhang, T.W. Hein, W. Wang, Y. Ren, R.D. Shipley, L. Kuo, Activation of
JNK and xanthine oxidase by TNF-alpha impairs nitric oxide-mediated dilation of
coronary arterioles. (2006) J Mol Cell Cardiol 40: 247-257.
[129] Y. Kamari, A. Shaish, S. Shemesh, E. Vax, I. Grosskopf, S. Dotan, M. White, E.
Voronov, C.A. Dinarello, R.N. Apte, D. Harats, Reduced atherosclerosis and
inflammatory cytokines in apolipoprotein-E-deficient mice lacking bone marrow-
derived interleukin-1alpha. (2011) Biochem Biophys Res Commun 405: 197-203.
[130] C.A. Dinarello, IL-1: discoveries, controversies and future directions. (2010) Eur
J Immunol 40: 599-606.
[131] C. Gabay, C. Lamacchia, G. Palmer, IL-1 pathways in inflammation and human
diseases. (2010) Nat Rev Rheumatol 6: 232-241.
[132] L.R. Leon, Invited review: cytokine regulation of fever: studies using gene
knockout mice. (2002) J Appl Physiol 92: 2648-2655.
[133] W.P. Arend, The balance between IL-1 and IL-1Ra in disease. (2002) Cytokine
Growth Factor Rev 13: 323-340.
[134] B.D. Freeman, T.G. Buchman, Interleukin-1 receptor antagonist as therapy for
inflammatory disorders. (2001) Expert Opin Biol Ther 1: 301-308.
[135] I. Aksentijevich, S.L. Masters, P.J. Ferguson, P. Dancey, J. Frenkel, A. van
Royen-Kerkhoff, R. Laxer, U. Tedgard, E.W. Cowen, T.H. Pham, M. Booty, J.D.
Estes, N.G. Sandler, N. Plass, D.L. Stone, M.L. Turner, S. Hill, J.A. Butman, R.
Schneider, P. Babyn, H.I. El-Shanti, E. Pope, K. Barron, X. Bing, A. Laurence, C.C.
Lee, D. Chapelle, G.I. Clarke, K. Ohson, M. Nicholson, M. Gadina, B. Yang, B.D.
Korman, P.K. Gregersen, P.M. van Hagen, A.E. Hak, M. Huizing, P. Rahman, D.C.
Douek, E.F. Remmers, D.L. Kastner, R. Goldbach-Mansky, An autoinflammatory
disease with deficiency of the interleukin-1-receptor antagonist. (2009) N Engl J
Med 360: 2426-2437.
[136] A.R. Brasier, The nuclear factor-kappaB-interleukin-6 signalling pathway
mediating vascular inflammation. (2010) Cardiovasc Res 86: 211-218.
[137] M. Madan, B. Bishayi, M. Hoge, S. Amar, Atheroprotective role of interleukin-6
in diet- and/or pathogen-associated atherosclerosis using an ApoE heterozygote
murine model. (2008) Atherosclerosis 197: 504-514.
[138] T. Tanaka, T. Kishimoto, Targeting interleukin-6: all the way to treat autoimmune
and inflammatory diseases. (2012) Int J Biol Sci 8: 1227-1236.
[139] C.A. Janeway, Jr., R. Medzhitov, Innate immune recognition. (2002) Annu Rev
Immunol 20: 197-216.
[140] P. Matzinger, The danger model: a renewed sense of self. (2002) Science 296:
301-305.
[141] K. Eder, N. Baffy, A. Falus, A.K. Fulop, The major inflammatory mediator
interleukin-6 and obesity. (2009) Inflamm Res 58: 727-736.
[142] D.M. Mosser, X. Zhang, Interleukin-10: new perspectives on an old cytokine.
(2008) Immunol Rev 226: 205-218.
[143] L.M. Williams, G. Ricchetti, U. Sarma, T. Smallie, B.M. Foxwell, Interleukin-10
suppression of myeloid cell activation--a continuing puzzle. (2004) Immunology
113: 281-292.
[144] J.K. Jenkins, M. Malyak, W.P. Arend, The effects of interleukin-10 on
interleukin-1 receptor antagonist and interleukin-1 beta production in human
monocytes and neutrophils. (1994) Lymphokine Cytokine Res 13: 47-54.
170
[145] J.B. Crawley, L.M. Williams, T. Mander, F.M. Brennan, B.M. Foxwell,
Interleukin-10 stimulation of phosphatidylinositol 3-kinase and p70 S6 kinase is
required for the proliferative but not the antiinflammatory effects of the cytokine.
(1996) J Biol Chem 271: 16357-16362.
[146] S.S. Iyer, G. Cheng, Role of interleukin 10 transcriptional regulation in
inflammation and autoimmune disease. (2012) Crit Rev Immunol 32: 23-63.
[147] P.R. Montellano, The mechanism of heme oxygenase. (2000) Curr Opin Chem
Biol 4: 221-227.
[148] A. Paine, B. Eiz-Vesper, R. Blasczyk, S. Immenschuh, Signaling to heme
oxygenase-1 and its anti-inflammatory therapeutic potential. (2010) Biochem
Pharmacol 80: 1895-1903.
[149] A. Grochot-Przeczek, J. Dulak, A. Jozkowicz, Haem oxygenase-1: non-canonical
roles in physiology and pathology. (2012) Clin Sci (Lond) 122: 93-103.
[150] R. Gozzelino, V. Jeney, M.P. Soares, Mechanisms of cell protection by heme
oxygenase-1. (2010) Annu Rev Pharmacol Toxicol 50: 323-354.
[151] C. Taille, A. Almolki, M. Benhamed, C. Zedda, J. Megret, P. Berger, G. Leseche,
E. Fadel, T. Yamaguchi, R. Marthan, M. Aubier, J. Boczkowski, Heme oxygenase
inhibits human airway smooth muscle proliferation via a bilirubin-dependent
modulation of ERK1/2 phosphorylation. (2003) J Biol Chem 278: 27160-27168.
[152] L. Malaguarnera, M.R. Pilastro, S. Quan, M.H. Ghattas, L. Yang, A.V.
Mezentsev, T. Kushida, N.G. Abraham, A. Kappas, Significance of heme
oxygenase in prolactin-mediated cell proliferation and angiogenesis in human
endothelial cells. (2002) Int J Mol Med 10: 433-440.
[153] G. Li Volti, L.F. Rodella, C. Di Giacomo, R. Rezzani, R. Bianchi, E. Borsani, D.
Gazzolo, R. Motterlini, Role of carbon monoxide and biliverdin in renal
ischemia/reperfusion injury. (2006) Nephron Exp Nephrol 104: e135-139.
[154] M.D. Maines, The heme oxygenase system: past, present, and future. (2004)
Antioxid Redox Signal 6: 797-801.
[155] S.W. Ryter, J. Alam, A.M. Choi, Heme oxygenase-1/carbon monoxide: from
basic science to therapeutic applications. (2006) Physiol Rev 86: 583-650.
[156] S. Koizumi, Human heme oxygenase-1 deficiency: a lesson on serendipity in the
discovery of the novel disease. (2007) Pediatr Int 49: 125-132.
[157] N. Radhakrishnan, S.P. Yadav, A. Sachdeva, P.K. Pruthi, S. Sawhney, T. Piplani,
T. Wada, A. Yachie, Human heme oxygenase-1 deficiency presenting with
hemolysis, nephritis, and asplenia. (2011) J Pediatr Hematol Oncol 33: 74-78.
[158] K.D. Poss, S. Tonegawa, Reduced stress defense in heme oxygenase 1-deficient
cells. (1997) Proc Natl Acad Sci U S A 94: 10925-10930.
[159] K.D. Poss, S. Tonegawa, Heme oxygenase 1 is required for mammalian iron
reutilization. (1997) Proc Natl Acad Sci U S A 94: 10919-10924.
[160] M.H. Kapturczak, C. Wasserfall, T. Brusko, M. Campbell-Thompson, T.M. Ellis,
M.A. Atkinson, A. Agarwal, Heme oxygenase-1 modulates early inflammatory
responses: evidence from the heme oxygenase-1-deficient mouse. (2004) Am J
Pathol 165: 1045-1053.
[161] M.P. Seldon, G. Silva, N. Pejanovic, R. Larsen, I.P. Gregoire, J. Filipe, J.
Anrather, M.P. Soares, Heme oxygenase-1 inhibits the expression of adhesion
molecules associated with endothelial cell activation via inhibition of NF-kappaB
RelA phosphorylation at serine 276. (2007) J Immunol 179: 7840-7851.
[162] K.A. Nath, G.M. Vercellotti, J.P. Grande, H. Miyoshi, C.V. Paya, J.C. Manivel,
J.J. Haggard, A.J. Croatt, W.D. Payne, J. Alam, Heme protein-induced chronic
renal inflammation: suppressive effect of induced heme oxygenase-1. (2001)
Kidney Int 59: 106-117.
171
[163] A. Yachie, Y. Niida, T. Wada, N. Igarashi, H. Kaneda, T. Toma, K. Ohta, Y.
Kasahara, S. Koizumi, Oxidative stress causes enhanced endothelial cell injury in
human heme oxygenase-1 deficiency. (1999) J Clin Invest 103: 129-135.
[164] Q. Gu, Q. Wu, M. Jin, Y. Xiao, J. Xu, C. Mao, F. Zhao, Y. Zhang, Y. Zhang,
Heme oxygenase-1 alleviates mouse hepatic failure through suppression of
adaptive immune responses. (2012) J Pharmacol Exp Ther 340: 2-10.
[165] K. Ishikawa, M. Navab, N. Leitinger, A.M. Fogelman, A.J. Lusis, Induction of
heme oxygenase-1 inhibits the monocyte transmigration induced by mildly
oxidized LDL. (1997) J Clin Invest 100: 1209-1216.
[166] K. Srisook, C. Kim, Y.N. Cha, Molecular mechanisms involved in enhancing
HO-1 expression: de-repression by heme and activation by Nrf2, the "one-two"
punch. (2005) Antioxid Redox Signal 7: 1674-1687.
[167] A.M. Choi, J. Alam, Heme oxygenase-1: function, regulation, and implication of
a novel stress-inducible protein in oxidant-induced lung injury. (1996) Am J
Respir Cell Mol Biol 15: 9-19.
[168] Y.C. Kim, Y. Yamaguchi, N. Kondo, H. Masutani, J. Yodoi, Thioredoxin-
dependent redox regulation of the antioxidant responsive element (ARE) in
electrophile response. (2003) Oncogene 22: 1860-1865.
[169] A.S. Pachori, A. Smith, P. McDonald, L. Zhang, V.J. Dzau, L.G. Melo, Heme-
oxygenase-1-induced protection against hypoxia/reoxygenation is dependent on
biliverdin reductase and its interaction with PI3K/Akt pathway. (2007) J Mol Cell
Cardiol 43: 580-592.
[170] L. Rochette, Y. Cottin, M. Zeller, C. Vergely, Carbon monoxide: mechanisms of
action and potential clinical implications. (2013) Pharmacol Ther 137: 133-152.
[171] M. Hayashi, T. Takahashi, H. Morimatsu, H. Fujii, N. Taga, S. Mizobuchi, M.
Matsumi, H. Katayama, M. Yokoyama, M. Taniguchi, K. Morita, Increased
carbon monoxide concentration in exhaled air after surgery and anesthesia. (2004)
Anesth Analg 99: 444-448, table of contents.
[172] L.E. Otterbein, M.P. Soares, K. Yamashita, F.H. Bach, Heme oxygenase-1:
unleashing the protective properties of heme. (2003) Trends Immunol 24: 449-
455.
[173] H. Morimatsu, T. Takahashi, K. Maeshima, K. Inoue, T. Kawakami, H. Shimizu,
M. Takeuchi, M. Yokoyama, H. Katayama, K. Morita, Increased heme catabolism
in critically ill patients: correlation among exhaled carbon monoxide, arterial
carboxyhemoglobin, and serum bilirubin IXalpha concentrations. (2006) Am J
Physiol Lung Cell Mol Physiol 290: L114-119.
[174] M.J. Dorresteijn, P. Pickkers, Carboxyhemoglobin levels during human
inflammation. (2012) Crit Care 16: 24.
[175] H. Morimatsu, T. Takahashi, T. Matsusaki, M. Hayashi, J. Matsumi, H. Shimizu,
M. Matsumi, K. Morita, An increase in exhaled CO concentration in systemic
inflammation/sepsis. (2010) J Breath Res 4: 047103.
[176] A. Nakao, J.S. Neto, S. Kanno, D.B. Stolz, K. Kimizuka, F. Liu, F.H. Bach, T.R.
Billiar, A.M. Choi, L.E. Otterbein, N. Murase, Protection against
ischemia/reperfusion injury in cardiac and renal transplantation with carbon
monoxide, biliverdin and both. (2005) Am J Transplant 5: 282-291.
[177] Y. Akamatsu, M. Haga, S. Tyagi, K. Yamashita, A.V. Graca-Souza, R. Ollinger,
E. Czismadia, G.A. May, E. Ifedigbo, L.E. Otterbein, F.H. Bach, M.P. Soares,
Heme oxygenase-1-derived carbon monoxide protects hearts from transplant
associated ischemia reperfusion injury. (2004) FASEB J 18: 771-772.
[178] B. Wegiel, D. Gallo, E. Csizmadia, C. Harris, J. Belcher, G.M. Vercellotti, N.
Penacho, P. Seth, V. Sukhatme, A. Ahmed, P.P. Pandolfi, L. Helczynski, A.
172
Bjartell, J.L. Persson, L.E. Otterbein, Carbon monoxide expedites metabolic
exhaustion to inhibit tumor growth. (2013) Cancer Res 73: 7009-7021.
[179] J.K. Sarady, S.L. Otterbein, F. Liu, L.E. Otterbein, A.M. Choi, Carbon monoxide
modulates endotoxin-induced production of granulocyte macrophage colony-
stimulating factor in macrophages. (2002) Am J Respir Cell Mol Biol 27: 739-745.
[180] H.O. Pae, G.S. Oh, B.M. Choi, S.C. Chae, Y.M. Kim, K.R. Chung, H.T. Chung,
Carbon monoxide produced by heme oxygenase-1 suppresses T cell proliferation
via inhibition of IL-2 production. (2004) J Immunol 172: 4744-4751.
[181] S.W. Ryter, L.E. Otterbein, Carbon monoxide in biology and medicine. (2004)
Bioessays 26: 270-280.
[182] R.F. Coburn, L.B. Mayers, Myoglobin O2 tension determined from measurement
of carboxymyoglobin in skeletal muscle. (1971) Am J Physiol 220: 66-74.
[183] T.H. Stevenson, A.F. Gutierrez, W.K. Alderton, L. Lian, N.S. Scrutton, Kinetics
of CO binding to the haem domain of murine inducible nitric oxide synthase:
differential effects of haem domain ligands. (2001) Biochem J 358: 201-208.
[184] C.A. Piantadosi, Carbon monoxide, reactive oxygen signaling, and oxidative
stress. (2008) Free Radic Biol Med 45: 562-569.
[185] N. Christodoulides, W. Durante, M.H. Kroll, A.I. Schafer, Vascular smooth
muscle cell heme oxygenases generate guanylyl cyclase-stimulatory carbon
monoxide. (1995) Circulation 91: 2306-2309.
[186] H.L. Vieira, C.S. Queiroga, P.M. Alves, Pre-conditioning induced by carbon
monoxide provides neuronal protection against apoptosis. (2008) J Neurochem
107: 375-384.
[187] C.S. Queiroga, A.S. Almeida, C. Martel, C. Brenner, P.M. Alves, H.L. Vieira,
Glutathionylation of adenine nucleotide translocase induced by carbon monoxide
prevents mitochondrial membrane permeabilization and apoptosis. (2010) J Biol
Chem 285: 17077-17088.
[188] U. Dirnagl, A. Meisel, Endogenous neuroprotection: mitochondria as gateways to
cerebral preconditioning? (2008) Neuropharmacology 55: 334-344.
[189] C.A. Piantadosi, M.S. Carraway, H.B. Suliman, Carbon monoxide, oxidative
stress, and mitochondrial permeability pore transition. (2006) Free Radic Biol
Med 40: 1332-1339.
[190] C.S. Queiroga, A.S. Almeida, P.M. Alves, C. Brenner, H.L. Vieira, Carbon
monoxide prevents hepatic mitochondrial membrane permeabilization. (2011)
BMC Cell Biol 12: 10.
[191] A.C. Bulmer, J.T. Blanchfield, J.S. Coombes, I. Toth, In vitro permeability and
metabolic stability of bile pigments and the effects of hydrophilic and lipophilic
modification of biliverdin. (2008) Bioorg Med Chem 16: 3616-3625.
[192] A.C. Bulmer, J.T. Blanchfield, I. Toth, R.G. Fassett, J.S. Coombes, Improved
resistance to serum oxidation in Gilbert's syndrome: a mechanism for
cardiovascular protection. (2008) Atherosclerosis 199: 390-396.
[193] K.A. Kirkby, C.A. Adin, Products of heme oxygenase and their potential
therapeutic applications. (2006) Am J Physiol Renal Physiol 290: F563-571.
[194] J. Fevery, Bilirubin in clinical practice: a review. (2008) Liver Int 28: 592-605.
[195] S. Wang, J.R. Chowdhury, N.R. Chowdhury, Bilirubin metabolism: Applied
physiology. (2006) Current Paediatrics 16: 70-74.
[196] A.F. McDonagh, L.A. Palma, Preparation and properties of crystalline biliverdin
IX alpha. Simple methods for preparing isomerically homogeneous biliverdin and
[14C[biliverdin by using 2,3-dichloro-5,6-dicyanobenzoquinone. (1980) Biochem J
189: 193-208.
173
[197] S. Jangi, L. Otterbein, S. Robson, The molecular basis for the immunomodulatory
activities of unconjugated bilirubin. (2013) Int J Biochem Cell Biol 45: 2843-2851.
[198] A.C. Bulmer, J.S. Coombes, J.T. Blanchfield, I. Toth, R.G. Fassett, S.M. Taylor,
Bile pigment pharmacokinetics and absorption in the rat: therapeutic potential for
enteral administration. (2011) Br J Pharmacol 164: 1857-1870.
[199] Z. Zhu, A.T. Wilson, B.A. Luxon, K.E. Brown, M.M. Mathahs, S.
Bandyopadhyay, A.P. McCaffrey, W.N. Schmidt, Biliverdin inhibits hepatitis C
virus nonstructural 3/4A protease activity: mechanism for the antiviral effects of
heme oxygenase? (2010) Hepatology 52: 1897-1905.
[200] J. Kapitulnik, Bilirubin: an endogenous product of heme degradation with both
cytotoxic and cytoprotective properties. (2004) Mol Pharmacol 66: 773-779.
[201] S.W. Ryter, D. Morse, A.M. Choi, Carbon monoxide and bilirubin: potential
therapies for pulmonary/vascular injury and disease. (2007) Am J Respir Cell Mol
Biol 36: 175-182.
[202] R. Stocker, A.N. Glazer, B.N. Ames, Antioxidant activity of albumin-bound
bilirubin. (1987) Proc Natl Acad Sci U S A 84: 5918-5922.
[203] R. Ollinger, K. Yamashita, M. Bilban, A. Erat, P. Kogler, M. Thomas, E.
Csizmadia, A. Usheva, R. Margreiter, F.H. Bach, Bilirubin and biliverdin
treatment of atherosclerotic diseases. (2007) Cell Cycle 6: 39-43.
[204] R. Ollinger, M. Bilban, A. Erat, A. Froio, J. McDaid, S. Tyagi, E. Csizmadia,
A.V. Graca-Souza, A. Liloia, M.P. Soares, L.E. Otterbein, A. Usheva, K.
Yamashita, F.H. Bach, Bilirubin: a natural inhibitor of vascular smooth muscle
cell proliferation. (2005) Circulation 112: 1030-1039.
[205] M. Mishra, J.F. Ndisang, A critical and comprehensive insight on heme
oxygenase and related products including carbon monoxide, bilirubin, biliverdin
and ferritin in type-1 and type-2 diabetes. (2014) Curr Pharm Des 20: 1370-1391.
[206] L. Rodella, B.D. Lamon, R. Rezzani, B. Sangras, A.I. Goodman, J.R. Falck, N.G.
Abraham, Carbon monoxide and biliverdin prevent endothelial cell sloughing in
rats with type I diabetes. (2006) Free Radic Biol Med 40: 2198-2205.
[207] N. Ikeda, T. Inoguchi, N. Sonoda, M. Fujii, R. Takei, E. Hirata, H. Yokomizo, J.
Zheng, Y. Maeda, K. Kobayashi, R. Takayanagi, Biliverdin protects against the
deterioration of glucose tolerance in db/db mice. (2011) Diabetologia 54: 2183-
2191.
[208] A. Nakao, L.E. Otterbein, M. Overhaus, J.K. Sarady, A. Tsung, K. Kimizuka,
M.A. Nalesnik, T. Kaizu, T. Uchiyama, F. Liu, N. Murase, A.J. Bauer, F.H. Bach,
Biliverdin protects the functional integrity of a transplanted syngeneic small
bowel. (2004) Gastroenterology 127: 595-606.
[209] C. Fondevila, M. Katori, C. Lassman, I. Carmody, R.W. Busuttil, F.H. Bach, J.W.
Kupiec-Weglinski, Biliverdin protects rat livers from ischemia/reperfusion injury.
(2003) Transplant Proc 35: 1798-1799.
[210] C. Fondevila, X.D. Shen, S. Tsuchiyashi, K. Yamashita, E. Csizmadia, C.
Lassman, R.W. Busuttil, J.W. Kupiec-Weglinski, F.H. Bach, Biliverdin therapy
protects rat livers from ischemia and reperfusion injury. (2004) Hepatology 40:
1333-1341.
[211] L.M. Tang, Y.P. Wang, K. Wang, L.Y. Pu, F. Zhang, X.C. Li, L.B. Kong, B.C.
Sun, G.Q. Li, X.H. Wang, Exogenous biliverdin ameliorates ischemia-reperfusion
injury in small-for-size rat liver grafts. (2007) Transplant Proc 39: 1338-1344.
[212] K. Yamashita, J. McDaid, R. Ollinger, T.Y. Tsui, P.O. Berberat, A. Usheva, E.
Csizmadia, R.N. Smith, M.P. Soares, F.H. Bach, Biliverdin, a natural product of
heme catabolism, induces tolerance to cardiac allografts. (2004) Faseb Journal 18:
765-767.
174
[213] H. Kaur, M.N. Hughes, C.J. Green, P. Naughton, R. Foresti, R. Motterlini,
Interaction of bilirubin and biliverdin with reactive nitrogen species. (2003) Febs
Letters 543: 113-119.
[214] T. Jansen, M. Hortmann, M. Oelze, B. Opitz, S. Steven, R. Schell, M. Knorr, S.
Karbach, S. Schuhmacher, P. Wenzel, T. Munzel, A. Daiber, Conversion of
biliverdin to bilirubin by biliverdin reductase contributes to endothelial cell
protection by heme oxygenase-1-evidence for direct and indirect antioxidant
actions of bilirubin. (2010) J Mol Cell Cardiol 49: 186-195.
[215] C. Molzer, H. Huber, A. Steyrer, G. Ziesel, A. Ertl, A. Plavotic, M. Wallner, A.C.
Bulmer, K.H. Wagner, In vitro antioxidant capacity and antigenotoxic properties
of protoporphyrin and structurally related tetrapyrroles. (2012) Free Radic Res 46:
1369-1377.
[216] J. Wang, H.C. Zhou, P. Pan, N. Zhang, W.Z. Li, Exogenous biliverdin improves
the function of lung grafts from brain dead donors in rats. (2010) Transplant Proc
42: 1602-1609.
[217] J.K. Sarady-Andrews, F. Liu, D. Gallo, A. Nakao, M. Overhaus, R. Ollinger,
A.M. Choi, L.E. Otterbein, Biliverdin administration protects against endotoxin-
induced acute lung injury in rats. (2005) Am J Physiol Lung Cell Mol Physiol 289:
L1131-1137.
[218] M. Overhaus, B.A. Moore, J.E. Barbato, F.F. Behrendt, J.G. Doering, A.J. Bauer,
Biliverdin protects against polymicrobial sepsis by modulating inflammatory
mediators. (2006) Am J Physiol Gastrointest Liver Physiol 290: G695-703.
[219] J. Kosaka, H. Morimatsu, T. Takahashi, H. Shimizu, S. Kawanishi, E. Omori, Y.
Endo, N. Tamaki, M. Morita, K. Morita, Effects of biliverdin administration on
acute lung injury induced by hemorrhagic shock and resuscitation in rats. (2013)
PLoS One 8: e63606.
[220] P.E. Gibbs, M.D. Maines, Biliverdin inhibits activation of NF-kappaB: reversal of
inhibition by human biliverdin reductase. (2007) Int J Cancer 121: 2567-2574.
[221] L. Novotny, L. Vitek, Inverse relationship between serum bilirubin and
atherosclerosis in men: a meta-analysis of published studies. (2003) Exp Biol Med
(Maywood) 228: 568-571.
[222] J.P. Lin, C.J. O'Donnell, J.P. Schwaiger, L.A. Cupples, A. Lingenhel, S.C. Hunt,
S. Yang, F. Kronenberg, Association between the UGT1A1*28 allele, bilirubin
levels, and coronary heart disease in the Framingham Heart Study. (2006)
Circulation 114: 1476-1481.
[223] L. Vitek, The role of bilirubin in diabetes, metabolic syndrome, and
cardiovascular diseases. (2012) Front Pharmacol 3: 55.
[224] C.A. Adin, B.P. Croker, A. Agarwal, Protective effects of exogenous bilirubin on
ischemia-reperfusion injury in the isolated, perfused rat kidney. (2005) Am J
Physiol Renal Physiol 288: F778-784.
[225] J.E. Clark, R. Foresti, P. Sarathchandra, H. Kaur, C.J. Green, R. Motterlini, Heme
oxygenase-1-derived bilirubin ameliorates postischemic myocardial dysfunction.
(2000) Am J Physiol Heart Circ Physiol 278: H643-651.
[226] Y.Y. Fu, K.J. Kang, J.M. Ahn, H.R. Kim, K.Y. Na, D.W. Chae, S. Kim, H.J.
Chin, Hyperbilirubinemia reduces the streptozotocin-induced pancreatic damage
through attenuating the oxidative stress in the Gunn rat. (2010) Tohoku J Exp Med
222: 265-273.
[227] P. Cheriyath, V.S. Gorrepati, I. Peters, V. Nookala, M.E. Murphy, N. Srouji, D.
Fischman, High Total Bilirubin as a Protective Factor for Diabetes Mellitus: An
Analysis of NHANES Data From 1999 - 2006. (2010) J Clin Med Res 2: 201-206.
175
[228] H.J. Wang, S.S. Lee, C. Dell'Agnello, V. Tchipashvili, J. D'Avilla, E. Czismadia,
B.Y. Chin, F.H. Bach, Bilirubin can induce tolerance to islet allografts (vol 147,
pg 762, 2006). (2006) Endocrinology 147: 4842-4842.
[229] S. Lee, T. Yamada, T. Osako, D.B. Stolz, M. Abe, K.R. McCurry, N. Murase, J.
Kotani, A. Nakao, Recipient hyperbilirubinaemia protects cardiac graft in rat
heterotopic heart transplantation. (2013) Eur J Cardiothorac Surg.
[230] M.L. Tomaro, A.M. Batlle, Bilirubin: its role in cytoprotection against oxidative
stress. (2002) Int J Biochem Cell Biol 34: 216-220.
[231] R. Stocker, B.N. Ames, Potential role of conjugated bilirubin and copper in the
metabolism of lipid peroxides in bile. (1987) Proc Natl Acad Sci U S A 84: 8130-
8134.
[232] M. Minetti, C. Mallozzi, A.M. Di Stasi, D. Pietraforte, Bilirubin is an effective
antioxidant of peroxynitrite-mediated protein oxidation in human blood plasma.
(1998) Arch Biochem Biophys 352: 165-174.
[233] A.C. Boon, C.L. Hawkins, K. Bisht, J.S. Coombes, B. Bakrania, K.H. Wagner,
A.C. Bulmer, Reduced circulating oxidized LDL is associated with
hypocholesterolemia and enhanced thiol status in Gilbert syndrome. (2012) Free
Radic Biol Med 52: 2120-2127.
[234] P.A. Dennery, A.F. McDonagh, D.R. Spitz, P.A. Rodgers, D.K. Stevenson,
Hyperbilirubinemia results in reduced oxidative injury in neonatal Gunn rats
exposed to hyperoxia. (1995) Free Radic Biol Med 19: 395-404.
[235] S.S. Lee, W. Gao, S. Mazzola, M.N. Thomas, E. Csizmadia, L.E. Otterbein, F.H.
Bach, H. Wang, Heme oxygenase-1, carbon monoxide, and bilirubin induce
tolerance in recipients toward islet allografts by modulating T regulatory cells.
(2007) FASEB J 21: 3450-3457.
[236] A. Kadl, J. Pontiller, M. Exner, N. Leitinger, Single bolus injection of bilirubin
improves the clinical outcome in a mouse model of endotoxemia. (2007) Shock
28: 582-588.
[237] Y. Liu, P. Li, J. Lu, W. Xiong, J. Oger, W. Tetzlaff, M. Cynader, Bilirubin
possesses powerful immunomodulatory activity and suppresses experimental
autoimmune encephalomyelitis. (2008) J Immunol 181: 1887-1897.
[238] S. Lanone, S. Bloc, R. Foresti, A. Almolki, C. Taille, J. Callebert, M. Conti, D.
Goven, M. Aubier, B. Dureuil, J. El-Benna, R. Motterlini, J. Boczkowski,
Bilirubin decreases NOS2 expression via inhibition of NAD(P)H oxidase:
implications for protection against endotoxic shock in rats. (2005) Faseb Journal
19: 1890-+.
[239] B. Weinberger, F.E. Archer, S. Kathiravan, D.S. Hirsch, A.M. Kleinfeld, A.M.
Vetrano, T. Hegyi, Effects of bilirubin on neutrophil responses in newborn infants.
(2013) Neonatology 103: 105-111.
[240] I. Miler, P. Sima, V. Vetvicka, M. Indrova, M. Slavikova, The potential
immunosuppressive effect of bilirubin. (1988) Allerg Immunol (Leipz) 34: 177-
184.
[241] P. Sima, J. Mala, I. Miler, R. Hodr, E. Truxova, The suppressive effect of
continuous infusion of bilirubin on the immune response in mice. (1980) Folia
Microbiol (Praha) 25: 483-490.
[242] W.Z.W. Wang, D.L.H. Smith, S.D. Zucker, Bilirubin inhibits iNOS expression
and NO production in response to endotoxin in rats. (2004) Hepatology 40: 424-
433.
[243] G.L. Mazzone, I. Rigato, C. Tiribelli, Unconjugated bilirubin modulates nitric
oxide production via iNOS regulation. (2010) Biosci Trends 4: 244-248.
176
[244] H.L. Liu, C.H. Chen, M. Chen, Q. Wu, M.J. Li, [Effect of bilirubin on expression
of toll-like receptor 4 in cord blood monocytes]. (2011) Zhongguo Dang Dai Er
Ke Za Zhi 13: 153-156.
[245] C.L. Basiglio, S.M. Arriaga, F. Pelusa, A.M. Almara, J. Kapitulnik, A.D. Mottino,
Complement activation and disease: protective effects of hyperbilirubinaemia.
(2010) Clinical Science 118: 99-113.
[246] S. Arriaga, A. Almara, A. Mottino, In vivo anti-complement effect of bilirubin-
IXalpha. (2002) Biochem Pharmacol 64: 741-744.
[247] A.R. Kinderlerer, I. Pombo Gregoire, S.S. Hamdulay, F. Ali, R. Steinberg, G.
Silva, N. Ali, B. Wang, D.O. Haskard, M.P. Soares, J.C. Mason, Heme
oxygenase-1 expression enhances vascular endothelial resistance to complement-
mediated injury through induction of decay-accelerating factor: a role for
increased bilirubin and ferritin. (2009) Blood 113: 1598-1607.
[248] W.C. Song, Complement regulatory proteins and autoimmunity. (2006)
Autoimmunity 39: 403-410.
[249] W.H. Koppenol, The Haber-Weiss cycle--70 years later. (2001) Redox Rep 6:
229-234.
[250] R. Evstatiev, C. Gasche, Iron sensing and signalling. (2012) Gut 61: 933-952.
[251] P.O. Berberat, M. Katori, E. Kaczmarek, D. Anselmo, C. Lassman, B. Ke, X.
Shen, R.W. Busuttil, K. Yamashita, E. Csizmadia, S. Tyagi, L.E. Otterbein, S.
Brouard, E. Tobiasch, F.H. Bach, J.W. Kupiec-Weglinski, M.P. Soares, Heavy
chain ferritin acts as an antiapoptotic gene that protects livers from ischemia
reperfusion injury. (2003) FASEB J 17: 1724-1726.
[252] K.J. Hintze, E.C. Theil, Cellular regulation and molecular interactions of the
ferritins. (2006) Cell Mol Life Sci 63: 591-600.
[253] G. Balla, H.S. Jacob, J. Balla, M. Rosenberg, K. Nath, F. Apple, J.W. Eaton,
G.M. Vercellotti, Ferritin: a cytoprotective antioxidant strategem of endothelium.
(1992) J Biol Chem 267: 18148-18153.
[254] J.L. Taylor, M.S. Carraway, C.A. Piantadosi, Lung-specific induction of heme
oxygenase-1 and hyperoxic lung injury. (1998) Am J Physiol 274: L582-590.
[255] J. Kapitulnik, M.D. Maines, Pleiotropic functions of biliverdin reductase: cellular
signaling and generation of cytoprotective and cytotoxic bilirubin. (2009) Trends
Pharmacol Sci 30: 129-137.
[256] M.D. Maines, J.F. Ewing, T.J. Huang, N. Panahian, Nuclear localization of
biliverdin reductase in the rat kidney: response to nephrotoxins that induce heme
oxygenase-1. (2001) J Pharmacol Exp Ther 296: 1091-1097.
[257] D.P. Converso, C. Taille, M.C. Carreras, A. Jaitovich, J.J. Poderoso, J.
Boczkowski, HO-1 is located in liver mitochondria and modulates mitochondrial
heme content and metabolism. (2006) FASEB J 20: 1236-1238.
[258] M. Salim, B.A. Brown-Kipphut, M.D. Maines, Human biliverdin reductase is
autophosphorylated, and phosphorylation is required for bilirubin formation.
(2001) J Biol Chem 276: 10929-10934.
[259] C. Molzer, H. Huber, K. Diem, M. Wallner, A.C. Bulmer, K.H. Wagner,
Extracellular and intracellular anti-mutagenic effects of bile pigments in the
Salmonella typhimurium reverse mutation assay. (2013) Toxicol In Vitro 27: 433-
437.
[260] A. Kikuchi, S.Y. Park, H. Miyatake, D. Sun, M. Sato, T. Yoshida, Y. Shiro,
Crystal structure of rat biliverdin reductase. (2001) Nat Struct Biol 8: 221-225.
[261] U.M. Florczyk, A. Jozkowicz, J. Dulak, Biliverdin reductase: new features of an
old enzyme and its potential therapeutic significance. (2008) Pharmacol Rep 60: 38-
48.
177
[262] P.E. Gibbs, C. Tudor, M.D. Maines, Biliverdin reductase: more than a namesake -
the reductase, its Peptide fragments, and biliverdin regulate activity of the three
classes of protein kinase C. (2012) Front Pharmacol 3: 31.
[263] D.E. Baranano, M. Rao, C.D. Ferris, S.H. Snyder, Biliverdin reductase: a major
physiologic cytoprotectant. (2002) Proc Natl Acad Sci U S A 99: 16093-16098.
[264] T.W. Sedlak, S.H. Snyder, Bilirubin benefits: cellular protection by a biliverdin
reductase antioxidant cycle. (2004) Pediatrics 113: 1776-1782.
[265] A.F. McDonagh, The biliverdin-bilirubin antioxidant cycle of cellular protection:
Missing a wheel? (2010) Free Radic Biol Med 49: 814-820.
[266] Y. Liu, J. Liu, W. Tetzlaff, D.W. Paty, M.S. Cynader, Biliverdin reductase, a
major physiologic cytoprotectant, suppresses experimental autoimmune
encephalomyelitis. (2006) Free Radic Biol Med 40: 960-967.
[267] S. Song, S. Wang, J. Ma, L. Yao, H. Xing, L. Zhang, L. Liao, D. Zhu, Biliverdin
reductase/bilirubin mediates the anti-apoptotic effect of hypoxia in pulmonary
arterial smooth muscle cells through ERK1/2 pathway. (2013) Exp Cell Res 319:
1973-1987.
[268] Z. Ahmad, M. Salim, M.D. Maines, Human biliverdin reductase is a leucine
zipper-like DNA-binding protein and functions in transcriptional activation of
heme oxygenase-1 by oxidative stress. (2002) J Biol Chem 277: 9226-9232.
[269] P.J. Lee, S.L. Camhi, B.Y. Chin, J. Alam, A.M. Choi, AP-1 and STAT mediate
hyperoxia-induced gene transcription of heme oxygenase-1. (2000) Am J Physiol
Lung Cell Mol Physiol 279: L175-182.
[270] J. Sun, C. Steenbergen, E. Murphy, S-nitrosylation: NO-related redox signaling to
protect against oxidative stress. (2006) Antioxid Redox Signal 8: 1693-1705.
[271] T. Into, M. Inomata, M. Nakashima, K. Shibata, H. Hacker, K. Matsushita,
Regulation of MyD88-dependent signaling events by S nitrosylation retards toll-
like receptor signal transduction and initiation of acute-phase immune responses.
(2008) Mol Cell Biol 28: 1338-1347.
[272] P.E. Gibbs, T. Miralem, N. Lerner-Marmarosh, C. Tudor, M.D. Maines,
Formation of ternary complex of human biliverdin reductase-protein kinase
Cdelta-ERK2 protein is essential for ERK2-mediated activation of Elk1 protein,
nuclear factor-kappaB, and inducible nitric-oxidase synthase (iNOS). (2012) J
Biol Chem 287: 1066-1079.
[273] H. Fan, J.A. Cook, Molecular mechanisms of endotoxin tolerance. (2004) J
Endotoxin Res 10: 71-84.
[274] A. Fougerat, S. Gayral, N. Malet, F. Briand-Mesange, M. Breton-Douillon, M.
Laffargue, Phosphoinositide 3-kinases and their role in inflammation: potential
clinical targets in atherosclerosis? (2009) Clin Sci (Lond) 116: 791-804.
[275] R. Katso, K. Okkenhaug, K. Ahmadi, S. White, J. Timms, M.D. Waterfield,
Cellular function of phosphoinositide 3-kinases: implications for development,
homeostasis, and cancer. (2001) Annu Rev Cell Dev Biol 17: 615-675.
[276] C. Rommel, M. Camps, H. Ji, PI3K delta and PI3K gamma: partners in crime in
inflammation in rheumatoid arthritis and beyond? (2007) Nat Rev Immunol 7:
191-201.
[277] B. Vanhaesebroeck, S.J. Leevers, K. Ahmadi, J. Timms, R. Katso, P.C. Driscoll,
R. Woscholski, P.J. Parker, M.D. Waterfield, Synthesis and function of 3-
phosphorylated inositol lipids. (2001) Annu Rev Biochem 70: 535-602.
[278] D.A. Fruman, L.C. Cantley, Phosphoinositide 3-kinase in immunological systems.
(2002) Semin Immunol 14: 7-18.
178
[279] A. Arcaro, M.J. Zvelebil, C. Wallasch, A. Ullrich, M.D. Waterfield, J. Domin,
Class II phosphoinositide 3-kinases are downstream targets of activated
polypeptide growth factor receptors. (2000) Mol Cell Biol 20: 3817-3830.
[280] R.A. Brown, J. Domin, A. Arcaro, M.D. Waterfield, P.R. Shepherd, Insulin
activates the alpha isoform of class II phosphoinositide 3-kinase. (1999) J Biol
Chem 274: 14529-14532.
[281] P.V. Schu, K. Takegawa, M.J. Fry, J.H. Stack, M.D. Waterfield, S.D. Emr,
Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein
sorting. (1993) Science 260: 88-91.
[282] A.E. Wurmser, J.D. Gary, S.D. Emr, Phosphoinositide 3-kinases and their FYVE
domain-containing effectors as regulators of vacuolar/lysosomal membrane
trafficking pathways. (1999) J Biol Chem 274: 9129-9132.
[283] P. Gunzl, K. Bauer, E. Hainzl, U. Matt, B. Dillinger, B. Mahr, S. Knapp, B.R.
Binder, G. Schabbauer, Anti-inflammatory properties of the PI3K pathway are
mediated by IL-10/DUSP regulation. (2010) J Leukoc Biol 88: 1259-1269.
[284] N. Molnarfi, L. Gruaz, J.M. Dayer, D. Burger, Opposite regulation of IL-1beta
and secreted IL-1 receptor antagonist production by phosphatidylinositide-3
kinases in human monocytes activated by lipopolysaccharides or contact with T
cells. (2007) J Immunol 178: 446-454.
[285] T. Fukao, S. Koyasu, PI3K and negative regulation of TLR signaling. (2003)
Trends Immunol 24: 358-363.
[286] T.T. Antoniv, L.B. Ivashkiv, Interleukin-10-induced gene expression and
suppressive function are selectively modulated by the PI3K-Akt-GSK3 pathway.
(2011) Immunology 132: 567-577.
[287] D.L. Williams, C. Li, T. Ha, T. Ozment-Skelton, J.H. Kalbfleisch, J. Preiszner, L.
Brooks, K. Breuel, J.B. Schweitzer, Modulation of the phosphoinositide 3-kinase
pathway alters innate resistance to polymicrobial sepsis. (2004) J Immunol 172:
449-456.
[288] E. Hirsch, V.L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S.
Sozzani, A. Mantovani, F. Altruda, M.P. Wymann, Central role for G protein-
coupled phosphoinositide 3-kinase gamma in inflammation. (2000) Science 287:
1049-1053.
[289] C. Ferrandi, V. Ardissone, P. Ferro, T. Ruckle, P. Zaratin, E. Ammannati, E.
Hauben, C. Rommel, R. Cirillo, Phosphoinositide 3-kinase gamma inhibition
plays a crucial role in early steps of inflammation by blocking neutrophil
recruitment. (2007) J Pharmacol Exp Ther 322: 923-930.
[290] T. Weichhart, G. Costantino, M. Poglitsch, M. Rosner, M. Zeyda, K.M.
Stuhlmeier, T. Kolbe, T.M. Stulnig, W.H. Horl, M. Hengstschlager, M. Muller,
M.D. Saemann, The TSC-mTOR signaling pathway regulates the innate
inflammatory response. (2008) Immunity 29: 565-577.
[291] N. Hay, N. Sonenberg, Upstream and downstream of mTOR. (2004) Genes Dev
18: 1926-1945.
[292] L.S. Steelman, W.H. Chappell, S.L. Abrams, R.C. Kempf, J. Long, P. Laidler, S.
Mijatovic, D. Maksimovic-Ivanic, F. Stivala, M.C. Mazzarino, M. Donia, P.
Fagone, G. Malaponte, F. Nicoletti, M. Libra, M. Milella, A. Tafuri, A. Bonati, J.
Basecke, L. Cocco, C. Evangelisti, A.M. Martelli, G. Montalto, M. Cervello, J.A.
McCubrey, Roles of the Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR pathways in
controlling growth and sensitivity to therapy-implications for cancer and aging.
(2011) Aging (Albany NY) 3: 192-222.
179
[293] O.H. Iwenofu, R.D. Lackman, A.P. Staddon, D.G. Goodwin, H.M. Haupt, J.S.
Brooks, Phospho-S6 ribosomal protein: a potential new predictive sarcoma marker
for targeted mTOR therapy. (2008) Mod Pathol 21: 231-237.
[294] M.M. Bertagnolli, L. Yang, S.H. Herrmann, R.L. Kirkman, Evidence that
rapamycin inhibits interleukin-12-induced proliferation of activated T
lymphocytes. (1994) Transplantation 58: 1091-1096.
[295] R.N. Saunders, M.S. Metcalfe, M.L. Nicholson, Rapamycin in transplantation: a
review of the evidence. (2001) Kidney Int 59: 3-16.
[296] D.S. Collier, R.Y. Calne, S.G. Pollard, P.J. Friend, S. Thiru, Rapamycin in
experimental renal allografts in primates. (1991) Transplant Proc 23: 2246-2247.
[297] I. Cinel, S.M. Opal, Molecular biology of inflammation and sepsis: a primer.
(2009) Crit Care Med 37: 291-304.
[298] M.W. Merx, C. Weber, Sepsis and the heart. (2007) Circulation 116: 793-802.
[299] G.S. Martin, D.M. Mannino, S. Eaton, M. Moss, The epidemiology of sepsis in
the United States from 1979 through 2000. (2003) N Engl J Med 348: 1546-1554.
[300] D. Annane, P. Aegerter, M.C. Jars-Guincestre, B. Guidet, Current epidemiology
of septic shock: the CUB-Rea Network. (2003) Am J Respir Crit Care Med 168:
165-172.
[301] C. Alberti, C. Brun-Buisson, H. Burchardi, C. Martin, S. Goodman, A. Artigas, A.
Sicignano, M. Palazzo, R. Moreno, R. Boulme, E. Lepage, R. Le Gall,
Epidemiology of sepsis and infection in ICU patients from an international
multicentre cohort study. (2002) Intensive Care Med 28: 108-121.
[302] R.S. Hotchkiss, I.E. Karl, The pathophysiology and treatment of sepsis. (2003) N
Engl J Med 348: 138-150.
[303] P.A. Ward, New approaches to the study of sepsis. (2012) EMBO Mol Med 4:
1234-1243.
[304] H. Tsujimoto, S. Ono, P.A. Efron, P.O. Scumpia, L.L. Moldawer, H. Mochizuki,
Role of Toll-like receptors in the development of sepsis. (2008) Shock 29: 315-321.
[305] H. Tsujimoto, S. Ono, T. Majima, N. Kawarabayashi, E. Takayama, M.
Kinoshita, S. Seki, H. Hiraide, L.L. Moldawer, H. Mochizuki, Neutrophil elastase,
MIP-2, and TLR-4 expression during human and experimental sepsis. (2005) Shock
23: 39-44.
[306] D.L. Williams, T. Ha, C. Li, J.H. Kalbfleisch, J. Schweitzer, W. Vogt, I.W.
Browder, Modulation of tissue Toll-like receptor 2 and 4 during the early phases
of polymicrobial sepsis correlates with mortality. (2003) Crit Care Med 31: 1808-
1818.
[307] G. Andonegui, C.S. Bonder, F. Green, S.C. Mullaly, L. Zbytnuik, E. Raharjo, P.
Kubes, Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-
induced neutrophil sequestration into lungs. (2003) J Clin Invest 111: 1011-1020.
[308] X. Zhang, Y. Kimura, C. Fang, L. Zhou, G. Sfyroera, J.D. Lambris, R.A. Wetsel,
T. Miwa, W.C. Song, Regulation of Toll-like receptor-mediated inflammatory
response by complement in vivo. (2007) Blood 110: 228-236.
[309] N.C. Riedemann, R.F. Guo, P.A. Ward, A key role of C5a/C5aR activation for the
development of sepsis. (2003) J Leukoc Biol 74: 966-970.
[310] C. Yan, H. Gao, New insights for C5a and C5a receptors in sepsis. (2012) Front
Immunol 3: 368.
[311] P.A. Ward, The harmful role of c5a on innate immunity in sepsis. (2010) J Innate
Immun 2: 439-445.
[312] S.F. Liu, X. Ye, A.B. Malik, In vivo inhibition of nuclear factor-kappa B
activation prevents inducible nitric oxide synthase expression and systemic
hypotension in a rat model of septic shock. (1997) J Immunol 159: 3976-3983.
180
[313] T.S. Blackwell, T.R. Blackwell, E.P. Holden, B.W. Christman, J.W. Christman,
In vivo antioxidant treatment suppresses nuclear factor-kappa B activation and
neutrophilic lung inflammation. (1996) J Immunol 157: 1630-1637.
[314] M.D. Schwartz, E.E. Moore, F.A. Moore, R. Shenkar, P. Moine, J.B. Haenel, E.
Abraham, Nuclear factor-kappa B is activated in alveolar macrophages from
patients with acute respiratory distress syndrome. (1996) Crit Care Med 24: 1285-
1292.
[315] K.M. Sundar, M. Sires, Sepsis induced immunosuppression: Implications for
secondary infections and complications. (2013) Indian J Crit Care Med 17: 162-
169.
[316] R.S. Hotchkiss, G. Monneret, D. Payen, Immunosuppression in sepsis: a novel
understanding of the disorder and a new therapeutic approach. (2013) Lancet
Infect Dis 13: 260-268.
[317] P.A. Ward, Immunosuppression in sepsis. (2011) JAMA 306: 2618-2619.
[318] M.K. Brunialti, P.S. Martins, H. Barbosa de Carvalho, F.R. Machado, L.M.
Barbosa, R. Salomao, TLR2, TLR4, CD14, CD11B, and CD11C expressions on
monocytes surface and cytokine production in patients with sepsis, severe sepsis,
and septic shock. (2006) Shock 25: 351-357.
[319] J.S. Boomer, K. To, K.C. Chang, O. Takasu, D.F. Osborne, A.H. Walton, T.L.
Bricker, S.D. Jarman, 2nd, D. Kreisel, A.S. Krupnick, A. Srivastava, P.E.
Swanson, J.M. Green, R.S. Hotchkiss, Immunosuppression in patients who die of
sepsis and multiple organ failure. (2011) JAMA 306: 2594-2605.
[320] N.A. Hutchins, J. Unsinger, R.S. Hotchkiss, A. Ayala, The new normal:
immunomodulatory agents against sepsis immune suppression. (2014) Trends Mol
Med 20: 224-233.
[321] A. Vink, D.P. de Kleijn, G. Pasterkamp, Functional role for toll-like receptors in
atherosclerosis and arterial remodeling. (2004) Curr Opin Lipidol 15: 515-521.
[322] B. Holst, A.C. Raby, J.E. Hall, M.O. Labeta, Complement takes its Toll: an
inflammatory crosstalk between Toll-like receptors and the receptors for the
complement anaphylatoxin C5a. (2012) Anaesthesia 67: 60-64.
[323] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F.
Speleman, Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. (2002) Genome Biol 3:
RESEARCH0034.
[324] M. Guha, N. Mackman, The phosphatidylinositol 3-kinase-Akt pathway limits
lipopolysaccharide activation of signaling pathways and expression of inflammatory
mediators in human monocytic cells. (2002) J Biol Chem 277: 32124-32132.
[325] M.C. Perianayagam, V.S. Balakrishnan, A.J. King, B.J. Pereira, B.L. Jaber, C5a
delays apoptosis of human neutrophils by a phosphatidylinositol 3-kinase-
signaling pathway. (2002) Kidney Int 61: 456-463.
[326] S.I. Gharbi, M.J. Zvelebil, S.J. Shuttleworth, T. Hancox, N. Saghir, J.F. Timms,
M.D. Waterfield, Exploring the specificity of the PI3K family inhibitor
LY294002. (2007) Biochem J 404: 15-21.
[327] V. Seow, J. Lim, A. Iyer, J.Y. Suen, J.K. Ariffin, D.M. Hohenhaus, M.J. Sweet,
D.P. Fairlie, Inflammatory responses induced by lipopolysaccharide are amplified
in primary human monocytes but suppressed in macrophages by complement
protein C5a. (2013) J Immunol 191: 4308-4316.
[328] T. Mijatovic, L. Houzet, P. Defrance, L. Droogmans, G. Huez, V. Kruys, Tumor
necrosis factor-alpha mRNA remains unstable and hypoadenylated upon stimulation
of macrophages by lipopolysaccharides. (2000) Eur J Biochem 267: 6004-6012.
181
[329] A.N. Shakhov, M.A. Collart, P. Vassalli, S.A. Nedospasov, C.V. Jongeneel,
Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional
activation of the tumor necrosis factor alpha gene in primary macrophages. (1990) J
Exp Med 171: 35-47.
[330] N.C. Riedemann, R.F. Guo, I.J. Laudes, K. Keller, V.J. Sarma, V. Padgaonkar,
F.S. Zetoune, P.A. Ward, C5a receptor and thymocyte apoptosis in sepsis. (2002)
FASEB J 16: 887-888.
[331] M.D. Maines, Potential application of biliverdin reductase and its fragments to
modulate insulin/IGF-1/MAPK/PI3-K signaling pathways in therapeutic settings.
(2010) Curr Drug Targets 11: 1586-1594.
[332] N.C. Riedemann, R.F. Guo, V.J. Sarma, I.J. Laudes, M. Huber-Lang, R.L.
Warner, E.A. Albrecht, C.L. Speyer, P.A. Ward, Expression and function of the
C5a receptor in rat alveolar epithelial cells. (2002) J Immunol 168: 1919-1925.
[333] I.J. Laudes, J.C. Chu, M. Huber-Lang, R.F. Guo, N.C. Riedemann, J.V. Sarma, F.
Mahdi, H.S. Murphy, C. Speyer, K.T. Lu, J.D. Lambris, F.S. Zetoune, P.A. Ward,
Expression and function of C5a receptor in mouse microvascular endothelial cells.
(2002) J Immunol 169: 5962-5970.
[334] J.R. Hunt, C.B. Martin, B.K. Martin, Transcriptional regulation of the murine C5a
receptor gene: NF-Y is required for basal and LPS induced expression in
macrophages and endothelial cells. (2005) Mol Immunol 42: 1405-1415.
[335] M.S. Bolger, D.S. Ross, H. Jiang, M.M. Frank, A.J. Ghio, D.A. Schwartz, J.R.
Wright, Complement levels and activity in the normal and LPS-injured lung.
(2007) Am J Physiol Lung Cell Mol Physiol 292: L748-759.
[336] G. Smedegard, L.X. Cui, T.E. Hugli, Endotoxin-induced shock in the rat. A role
for C5a. (1989) Am J Pathol 135: 489-497.
[337] R.D. Soltis, D. Hasz, M.J. Morris, I.D. Wilson, The effect of heat inactivation of
serum on aggregation of immunoglobulins. (1979) Immunology 36: 37-45.
[338] K. Bisht, B. Wegiel, J. Tampe, O. Neubauer, K.H. Wagner, L.E. Otterbein, A.C.
Bulmer, Biliverdin modulates the expression of C5aR in response to endotoxin in
part via mTOR signaling. (2014) Biochem Biophys Res Commun 449: 94-99.
[339] D. Tugal, X. Liao, M.K. Jain, Transcriptional control of macrophage polarization.
(2013) Arterioscler Thromb Vasc Biol 33: 1135-1144.
[340] P.J. Murray, T.A. Wynn, Protective and pathogenic functions of macrophage
subsets. (2011) Nat Rev Immunol 11: 723-737.
[341] F.Y. McWhorter, T. Wang, P. Nguyen, T. Chung, W.F. Liu, Modulation of
macrophage phenotype by cell shape. (2013) Proc Natl Acad Sci U S A 110:
17253-17258.
[342] M.J. Davis, T.M. Tsang, Y. Qiu, J.K. Dayrit, J.B. Freij, G.B. Huffnagle, M.A.
Olszewski, Macrophage M1/M2 polarization dynamically adapts to changes in
cytokine microenvironments in Cryptococcus neoformans infection. (2013) MBio
4: e00264-00213.
[343] R. Kuhn, F. Schwenk, M. Aguet, K. Rajewsky, Inducible gene targeting in mice.
(1995) Science 269: 1427-1429.
[344] I. Goren, N. Allmann, N. Yogev, C. Schurmann, A. Linke, M. Holdener, A.
Waisman, J. Pfeilschifter, S. Frank, A transgenic mouse model of inducible
macrophage depletion: effects of diphtheria toxin-driven lysozyme M-specific cell
lineage ablation on wound inflammatory, angiogenic, and contractive processes.
(2009) Am J Pathol 175: 132-147.
[345] A. Soruri, S. Kim, Z. Kiafard, J. Zwirner, Characterization of C5aR expression on
murine myeloid and lymphoid cells by the use of a novel monoclonal antibody.
(2003) Immunol Lett 88: 47-52.
182
[346] J. Godau, T. Heller, H. Hawlisch, M. Trappe, E. Howells, J. Best, J. Zwirner, J.S.
Verbeek, P.M. Hogarth, C. Gerard, N. Van Rooijen, A. Klos, J.E. Gessner, J.
Kohl, C5a initiates the inflammatory cascade in immune complex peritonitis.
(2004) J Immunol 173: 3437-3445.
[347] A. Jacob, B. Hack, E. Chiang, J.G. Garcia, R.J. Quigg, J.J. Alexander, C5a alters
blood-brain barrier integrity in experimental lupus. (2010) FASEB J 24: 1682-
1688.
[348] J.E. Wang, R. Solberg, C. Okkenhaug, P.F. Jorgensen, C.D. Krohn, A.O. Aasen,
Cytokine modulation in experimental endotoxemia: characterization of an ex vivo
whole blood model. (2000) Eur Surg Res 32: 65-73.
[349] M.J. Dorresteijn, A. Draisma, J.G. van der Hoeven, P. Pickkers,
Lipopolysaccharide-stimulated whole blood cytokine production does not predict
the inflammatory response in human endotoxemia. (2010) Innate Immun 16: 248-
253.
[350] M. Aziz, A. Jacob, W.L. Yang, A. Matsuda, P. Wang, Current trends in
inflammatory and immunomodulatory mediators in sepsis. (2013) J Leukoc Biol 93:
329-342.
[351] A.J. Marti-Carvajal, I. Sola, C. Gluud, D. Lathyris, A.F. Cardona, Human
recombinant protein C for severe sepsis and septic shock in adult and paediatric
patients. (2012) Cochrane Database Syst Rev 12: CD004388.
[352] C.J. Fisher, Jr., S.M. Opal, J.F. Dhainaut, S. Stephens, J.L. Zimmerman, P.
Nightingale, S.J. Harris, R.M. Schein, E.A. Panacek, J.L. Vincent, et al., Influence
of an anti-tumor necrosis factor monoclonal antibody on cytokine levels in
patients with sepsis. The CB0006 Sepsis Syndrome Study Group. (1993) Crit
Care Med 21: 318-327.
[353] F. Zeni, B. Freeman, C. Natanson, Anti-inflammatory therapies to treat sepsis and
septic shock: a reassessment. (1997) Crit Care Med 25: 1095-1100.
[354] J. Cohen, J. Carlet, INTERSEPT: an international, multicenter, placebo-controlled
trial of monoclonal antibody to human tumor necrosis factor-alpha in patients with
sepsis. International Sepsis Trial Study Group. (1996) Crit Care Med 24: 1431-
1440.
[355] A. National Health and Medical Research Council, A.a.N.Z.I.C.S.C.T. Group,
ADjunctive coRticosteroid trEatment iN criticAlly ilL Patients With Septic Shock.
(2012) ClinicalTrials.gov.identifier.
[356] A.C. Bulmer, H.J. Verkade, K.H. Wagner, Bilirubin and beyond: a review of lipid
status in Gilbert's syndrome and its relevance to cardiovascular disease protection.
(2013) Prog Lipid Res 52: 193-205.
[357] P. Myrianthefs, S. Karatzas, K. Venetsanou, E. Grouzi, P. Evagelopoulou, E.
Boutzouka, G. Fildissis, I. Spiliotopoulou, G. Baltopoulos, Seasonal variation in
whole blood cytokine production after LPS stimulation in normal individuals.
(2003) Cytokine 24: 286-292.
[358] H. Shiratsuch, M.D. Basson, Differential regulation of monocyte/macrophage
cytokine production by pressure. (2005) Am J Surg 190: 757-762.
[359] L. Rainen, U. Oelmueller, S. Jurgensen, R. Wyrich, C. Ballas, J. Schram, C.
Herdman, D. Bankaitis-Davis, N. Nicholls, D. Trollinger, V. Tryon, Stabilization
of mRNA expression in whole blood samples. (2002) Clin Chem 48: 1883-1890.
[360] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. (2001) Methods 25:
402-408.
[361] M.G. Netea, J.P. Drenth, N. De Bont, A. Hijmans, M. Keuter, E. Dharmana, P.N.
Demacker, J.W. van der Meer, A semi-quantitative reverse transcriptase
183
polymerase chain reaction method for measurement of MRNA for TNF-alpha and
IL-1 beta in whole blood cultures: its application in typhoid fever and exentric
exercise. (1996) Cytokine 8: 739-744.
[362] D.G. Remick, Interleukin-8. (2005) Crit Care Med 33: S466-467.
[363] O. Neubauer, S. Sabapathy, K.J. Ashton, B. Desbrow, J.M. Peake, R. Lazarus, B.
Wessner, D. Cameron-Smith, K.H. Wagner, L.J. Haseler, A.C. Bulmer, Time
course-dependent changes in the transcriptome of human skeletal muscle during
recovery from endurance exercise: from inflammation to adaptive remodeling.
(2014) J Appl Physiol (1985) 116: 274-287.
[364] J. Seok, H.S. Warren, A.G. Cuenca, M.N. Mindrinos, H.V. Baker, W. Xu, D.R.
Richards, G.P. McDonald-Smith, H. Gao, L. Hennessy, C.C. Finnerty, C.M.
Lopez, S. Honari, E.E. Moore, J.P. Minei, J. Cuschieri, P.E. Bankey, J.L. Johnson,
J. Sperry, A.B. Nathens, T.R. Billiar, M.A. West, M.G. Jeschke, M.B. Klein, R.L.
Gamelli, N.S. Gibran, B.H. Brownstein, C. Miller-Graziano, S.E. Calvano, P.H.
Mason, J.P. Cobb, L.G. Rahme, S.F. Lowry, R.V. Maier, L.L. Moldawer, D.N.
Herndon, R.W. Davis, W. Xiao, R.G. Tompkins, Genomic responses in mouse
models poorly mimic human inflammatory diseases. (2013) Proc Natl Acad Sci U
S A 110: 3507-3512.
[365] C. Marie, C. Fitting, J. Muret, D. Payen, J.M. Cavaillon, Interleukin 8 production
in whole blood assays: Is interleukin 10 responsible for the downregulation
observed in sepsis? (2000) Cytokine 12: 55-61.
[366] A.M. Owyang, H. Issafras, J. Corbin, K. Ahluwalia, P. Larsen, E. Pongo, M.
Handa, A.H. Horwitz, M.K. Roell, M. Haak-Frendscho, L. Masat, XOMA 052, a
potent, high-affinity monoclonal antibody for the treatment of IL-1beta-mediated
diseases. (2011) MAbs 3: 49-60.
[367] C.A. Dinarello, Interleukin-1 in the pathogenesis and treatment of inflammatory
diseases. (2011) Blood 117: 3720-3732.
[368] L.E. DeForge, D.G. Remick, Kinetics of TNF, IL-6, and IL-8 gene expression in
LPS-stimulated human whole blood. (1991) Biochem Biophys Res Commun 174:
18-24.
[369] S. Rodriguez-Novoa, L. Martin-Carbonero, P. Barreiro, G. Gonzalez-Pardo, I.
Jimenez-Nacher, J. Gonzalez-Lahoz, V. Soriano, Genetic factors influencing
atazanavir plasma concentrations and the risk of severe hyperbilirubinemia. (2007)
AIDS 21: 41-46.
[370] P.A. Dennery, D.S. Seidman, D.K. Stevenson, Neonatal hyperbilirubinemia.
(2001) N Engl J Med 344: 581-590.
[371] J.F. Watchko, Neonatal hyperbilirubinemia--what are the risks? (2006) N Engl J
Med 354: 1947-1949.
[372] A. Fernandes, A.S. Falcao, R.F. Silva, A.C. Gordo, M.J. Gama, M.A. Brito, D.
Brites, Inflammatory signalling pathways involved in astroglial activation by
unconjugated bilirubin. (2006) J Neurochem 96: 1667-1679.
[373] E. Akin, B. Clower, R. Tibbs, J. Tang, J. Zhang, Bilirubin produces apoptosis in
cultured bovine brain endothelial cells. (2002) Brain Res 931: 168-175.
[374] J.M. Seubert, A.J. Darmon, A.O. El-Kadi, S.J. D'Souza, J.R. Bend, Apoptosis in
murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin.
(2002) Mol Pharmacol 62: 257-264.
[375] D.S. Kim, S.W. Chae, H.R. Kim, H.J. Chae, CO and bilirubin inhibit
doxorubicin-induced cardiac cell death. (2009) Immunopharmacol Immunotoxicol
31: 64-70.
184
[376] K.W. Bock, C. Kohle, Contributions of the Ah receptor to bilirubin homeostasis
and its antioxidative and atheroprotective functions. (2010) Biol Chem 391: 645-
653.
[377] C.A. Beamer, D.M. Shepherd, Role of the aryl hydrocarbon receptor (AhR) in
lung inflammation. (2013) Semin Immunopathol 35: 693-704.
[378] P.S. Wong, C.F. Vogel, K. Kokosinski, F. Matsumura, Arylhydrocarbon receptor
activation in NCI-H441 cells and C57BL/6 mice: possible mechanisms for lung
dysfunction. (2010) Am J Respir Cell Mol Biol 42: 210-217.
[379] M. Kalkoff, R.T. Cursons, J.W. Sleigh, G.M. Jacobson, The use of real time
rtPCR to quantify inflammatory mediator expression in leukocytes from patients
with severe sepsis. (2004) Anaesth Intensive Care 32: 746-755.
[380] A.C. Raby, B. Holst, J. Davies, C. Colmont, Y. Laumonnier, B. Coles, S. Shah, J.
Hall, N. Topley, J. Kohl, B.P. Morgan, M.O. Labeta, TLR activation enhances
C5a-induced pro-inflammatory responses by negatively modulating the second
C5a receptor, C5L2. (2011) Eur J Immunol 41: 2741-2752.
[381] J. Evans, L.A. Salamonsen, Inflammation, leukocytes and menstruation. (2012)
Rev Endocr Metab Disord 13: 277-288.
[382] R.E. Goyette, N.S. Key, E.W. Ely, Hematologic changes in sepsis and their
therapeutic implications. (2004) Semin Respir Crit Care Med 25: 645-659.
[383] S.A. Rushworth, X.L. Chen, N. Mackman, R.M. Ogborne, M.A. O'Connell,
Lipopolysaccharide-induced heme oxygenase-1 expression in human monocytic
cells is mediated via Nrf2 and protein kinase C. (2005) J Immunol 175: 4408-
4415.
[384] N. Wijayanti, S. Huber, A. Samoylenko, T. Kietzmann, S. Immenschuh, Role of
NF-kappaB and p38 MAP kinase signaling pathways in the lipopolysaccharide-
dependent activation of heme oxygenase-1 gene expression. (2004) Antioxid
Redox Signal 6: 802-810.
[385] G.A. Ricchetti, L.M. Williams, B.M. Foxwell, Heme oxygenase 1 expression
induced by IL-10 requires STAT-3 and phosphoinositol-3 kinase and is inhibited
by lipopolysaccharide. (2004) J Leukoc Biol 76: 719-726.
[386] T. Miyazaki, Y. Kirino, M. Takeno, S. Samukawa, M. Hama, M. Tanaka, S.
Yamaji, A. Ueda, N. Tomita, H. Fujita, Y. Ishigatsubo, Expression of heme
oxygenase-1 in human leukemic cells and its regulation by transcriptional
repressor Bach1. (2010) Cancer Sci 101: 1409-1416.
[387] Y.M. Kim, H.O. Pae, J.E. Park, Y.C. Lee, J.M. Woo, N.H. Kim, Y.K. Choi, B.S.
Lee, S.R. Kim, H.T. Chung, Heme oxygenase in the regulation of vascular biology:
from molecular mechanisms to therapeutic opportunities. (2011) Antioxid Redox
Signal 14: 137-167.
[388] J.A. Moraes, P. Barcellos-de-Souza, G. Rodrigues, V. Nascimento-Silva, S.V.
Silva, J. Assreuy, M.A. Arruda, C. Barja-Fidalgo, Heme modulates smooth
muscle cell proliferation and migration via NADPH oxidase: a counter-regulatory
role for heme oxygenase system. (2012) Atherosclerosis 224: 394-400.
[389] M.J. Dorresteijn, T. Visser, L.A. Cox, M.P. Bouw, J. Pillay, A.H. Koenderman,
P.F. Strengers, L.P. Leenen, J.G. van der Hoeven, L. Koenderman, P. Pickkers,
C1-esterase inhibitor attenuates the inflammatory response during human
endotoxemia. (2010) Crit Care Med 38: 2139-2145.
[390] M. Furebring, L. Hakansson, P. Venge, J. Sjolin, Differential expression of the
C5a receptor and complement receptors 1 and 3 after LPS stimulation of
neutrophils and monocytes. (2004) Scand J Immunol 60: 494-499.
185
[391] M. Furebring, L.D. Hakansson, P. Venge, B. Nilsson, J. Sjolin, Expression of the
C5a receptor (CD88) on granulocytes and monocytes in patients with severe
sepsis. (2002) Crit Care 6: 363-370.
[392] H. Unnewehr, D. Rittirsch, J.V. Sarma, F. Zetoune, M.A. Flierl, M. Perl, S. Denk,
M. Weiss, M.E. Schneider, P.N. Monk, T. Neff, M. Mihlan, H. Barth, F. Gebhard,
P.A. Ward, M. Huber-Lang, Changes and regulation of the C5a receptor on
neutrophils during septic shock in humans. (2013) J Immunol 190: 4215-4225.
[393] T. Tschernig, Z. Kiafard, C. Dibbert, D. Neumann, J. Zwirner, Use of monoclonal
antibodies to assess expression of anaphylatoxin receptors in rat and murine
models of lung inflammation. (2007) Exp Toxicol Pathol 58: 419-425.
[394] H. Atamna, Heme, iron, and the mitochondrial decay of ageing. (2004) Ageing
Res Rev 3: 303-318.
[395] M. Greabu, R. Olinescu, F.A. Kummerow, D.O. Crocnan, The levels of bilirubin
may be related to an inflammatory condition in patients with coronary heart
disease. (2001) Acta Pol Pharm 58: 225-231.