Analysis of resistance in rice (Oryza sativa L.) genotypes LD24 and

Khao Pahk Maw to root-knot nematodes (Meloidogyne spp.) and root

lesion nematode (Pratylenchus zeae)

Radisras Nkurunziza

Student number: 01600780

Supervisor(s): Prof. Dr. Godelieve Ghyesen, MS Zobaida Lahari

A dissertation submitted to Ghent University in partial fulfilment of the requirements for the

degree of International Master of Science in Agro- and Environmental Nematology

Academic year: 2017 - 2018

Analysis of resistance in rice (Oryza sativa L.) genotypes LD24 and Khao Pahk

Maw to root-knot nematodes (Meloidogyne spp.) and root lesion nematode

(Pratylenchus zeae)

Radisras NKURUNZIZA 1,2

1, Department of Biology, Ghent University, B-9000 Ghent, Belgium

2 Department of Molecular Biotechnology, Ghent University, B-9000 Ghent, Belgium

* Corresponding author, e-mail: godelieve.gheysen@ugent.be

Summary – In this study we investigated resistance in Meloidogyne graminicola-resistant rice,

Oryza sativa genotypes LD24 and Khao Pahk Maw (KPM), and O. glaberrima genotype TOG5674

to M. javanica, M. incognita and Pratylenchus zeae alongside the model rice genotype Nipponbare.

Effects on penetration and post-infection development and reproduction were evaluated at different

time points to identify the stage at which resistance occurs. Our results indicate that genotype KPM

confers strong broad-spectrum resistance to M. javanica and P. zeae. Whereas TOG5674 showed

strong resistance to P. zeae, and moderate resistance to M. javanica, LD24 was moderately

resistant to M. javanica but susceptible to P. zeae. Resistance to M. incognita conferred by LD24,

KPM and TOG5674 could not be confirmed in this study due to the low infectivity of the nematode

population on the susceptible Nipponbare. Additionally, resistance to M. javanica and M. incognita

in LD24 and KPM was not linked to OsPAL4 gene expression profile. The decision on host status

was based on the consistency in the series of experimental results. M. javanica J2s equally

penetrated all genotypes at early time point, one day after inoculation. However, at three days after

inoculation, KPM and TOG5674 inhibited further penetration suggesting early defence responses.

Besides, genotypes LD24, KPM and TOG5674 but not Nipponbare suppressed development of M.

javanica suggesting that resistance responses in LD24 occur later than in KPM and TOG5674. All

genotypes inhibited penetration of M. incognita second-stage juveniles (J2s) but suppressed post-

infection development responses were observed in LD24, KPM and TOG5674 but not Nipponbare.

Penetration of P. zeae was non-significantly inhibited among genotypes, however, suppressed

reproduction was observed in KPM and TOG5674. LD24 and Nipponbare supported substantial P.

zeae reproduction demonstrating their susceptibility. In conclusion, it was evident that KPM

showed strong resistance to M. javanica and P. zeae indicating its potential for use in breeding

programs to introduce broad-spectrum resistance in high yielding and commercial O. sativa

cultivars.

Key words – Broad-spectrum resistance, Development, Meloidogyne graminicola, Penetration,

Phenylalanine ammonia lyase, Reproductive factor.

Rice (Oryza sativa) is an important cereal crop world-wide particularly in tropical and subtropical

regions where it plays nutritional and food security roles (Calpe, 2006; Seck et al., 2012). The

crop is grown in diverse agroecosystems such as lowland, upland and deep-water (Bridge et al.,

2005; Bouman et al., 2007; Conen et al., 2010). Although most of the rice has been produced from

irrigated and/or flooded lowland, due to the problem of water scarcity cultivation has shifted to

rain-fed lowland and upland rice production systems (Prasad, 2011). Rice (O. sativa) is highly

susceptible to plant parasitic nematodes. Root-knot nematodes (Meloidogyne spp.) and root lesion

nematodes (Pratylenchus spp.) cause substantial damage in non-flooded (dry) lowland and upland

rice systems (Bridge et al., 2005). Among the root-knot nematodes, M. graminicola, M. incognita

and M. javanica are important parasites of rice (Babatola, 1980; Diomandé, 1984; Bridge et al.,

2005; Kyndt et al., 2014). While M. graminicola is important both in flooded/irrigated and upland

systems, M. incognita and M. javanica are important in non-flooded lowland and upland systems

(Bridge et al., 2005; Kyndt et al., 2014). The root lesion nematode, Pratylenchus zeae also causes

substantial damage to rice in upland production systems (Fortuner & Merny, 1979; Babatola,

1984; Prot & Rahman, 1994; Bridge et al., 2005; Pili et al., 2016). Furthermore these nematodes

have a wide distribution and broad host range (Bridge et al., 2005). Consequently, inoculum levels

in the upland soil still remain high under rotation with other crops. Besides, reports on continuous

rice production under dry lowland or upland conditions have indicated yield decline due to

nematode infection (George et al., 2002; Peng et al., 2006; Kreye et al., 2009).

Under suitable conditions, Meloidogyne spp. infective second stage juveniles (J2) hatch from eggs

and orient towards the host root, and then penetrate the root just behind the tips by mechanical

wounding using their stylet and enzymatic dissolution of the root surfaces (Jones et al., 2013). The

J2s move intercellularly towards the root apex and make a U-turn into the central cylinder where

they select parenchyma cells and release secretions to induce feeding sites (Kyndt et al., 2014).

Each feeding site consists five to eight metabolically active and multinucleated cells, also called

giant cells enclosed in a gall (root-knot) (Cabasan et al., 2012; Nguyễn et al., 2014). These cells

function as specialized sinks to supply nutrients to the J2. After brief feeding, the J2 swell and

successively moult three times to reach the reproductive adult stage. The J3 and J4 stages lack a

functional stylet and do not feed. Males are only formed under unfavourable conditions; they are

non-feeding, vermiform and leave the root. The females start feeding and extract nutrients from

the giant cells for the rest of their life (Gheysen & Mitchum, 2011; Jones et al., 2013; Kyndt et al.,

2013). During feeding, the adult females enlarge and become pear-shaped, and lay eggs to start a

new reproductive cycle. Eggs are laid in clusters usually enclosed in a gelatinous matrix on the

surface of the root (M. incognita and M. javanica) or inside the gall (M. graminicola) (Karssen et

al., 2013). According to Bridge et al. (2005), the biology and life cycle of M. incognita and M.

javanica on rice are similar to those described on other hosts. Indeed M. incognita and M.

javanica showed the same optimal life cycles at temperatures between 27 oC and 30 oC (Trudgill,

1995).

In contrast to the sedentary behaviour of Meloidogyne spp., Pratylenchus zeae is a migratory root

endoparasite with hit and run feeding behaviour on cortical cells (Duncan et al., 2006). Like

Meloidogyne spp., P. zeae undergoes a typical lifecycle of six life stages such as egg, four juvenile

stages and adult stage (Castillo & Vovlas, 2007). After embryogenesis, the J1 develops inside the

egg, within which it moults to J2. Under suitable conditions, J2s hatch from eggs and locate the

host plant and penetrate at any site of the root (Kyndt et al., 2014). After penetration into the host

root, J2s start feeding on cortical cells and successively moult into J3, J4 and adult stages (Duncan

et al., 2006; Castillo & Vovlas, 2007). The J2, J3, J4 and adult all are migratory and can infect the

host root (Castillo & Vovlas, 2007). P. zeae feeds by puncturing the root cells and sucking the cell

contents resulting in a series of dead cells, which culminates into visible necrotic lesions. The

extent of tissue damage depends on the duration of feeding. Cell death occurs during migration

and prolonged feeding, but cell recovery may occur following brief feeding (Duncan et al., 2006).

The lifecycle of P. zeae takes about three weeks (21 days) at 30 oC (Olowe & Corbett, 1976). On

susceptible hosts, P. zeae causes retarded growth, reduced root size and lateral roots, reduced

number of tillers and panicles (Plowright et al., 1990).

Development and reproduction of these nematodes depends on host status. Susceptible hosts

support the highest level of development and reproduction while resistant hosts inhibit

development and reproduction (Trudgill, 1991). Plants deploy a complex network of constitutive

and inducible defence barriers to invading pathogens. Constitutive defences comprise many

preformed barriers including rigid cell walls and phytoanticipins which protect the plant from

pathogen penetration (Freeman & Beattie, 2008) thus conferring pre-infection resistance. In post-

infection resistance, plants are able to recognise and react to pathogens by activating a range of

defence responses (Gheysen & Jones, 2013) which are expressed and conditioned in a variety of

mechanisms (Starr et al., 2013). Inducible plant defence consists of two layers triggered by

microbial recognition (Jones & Dangl, 2006). The first layer triggered by pathogen associated

molecular patterns (PAMPs) is termed as PAMP-triggered immunity (PTI) and confers broad-

spectrum resistance (Chen & Ronald, 2011). The second layer, effector-triggered immunity (ETI)

is mediated by products of resistance genes which confer specific resistance (Cook, 1998).

Interactions between ETI and PTI result in production of secondary metabolites which play a role

in defence against plant-parasitic nematodes (Fujimoto et al., 2015; Ji et al., 2015; Kumari et al.,

2016). The phenylpropanoid pathway is an important secondary metabolic pathway in plants.

Phenylpropanoid metabolism produces constitutive and inducible compounds that function as

structural barrier (lignin), protectants (phytoanticipin and phytoalexins), toxins (coumarins) and

signalling (salicylic acid) molecules in plant defence against a spectrum of invaders (Weisshaar &

Jenkins, 1998; Vogt, 2010). Phenylpropanoid biosynthesis is controlled by phenylalanine

ammonia lyase (PAL), the first enzyme in the pathway that is encoded by multigene families in

plants (Reichert et al., 2009). In rice, the PAL genes are activated by an array of rice pathogens

during inducible plant immunity (Gupta et al., 2011; Li et al., 2013).

Options to control Meloidogyne spp. and Pratylenchus zeae in rice are limited due to drawbacks

associated with most chemical, biological, physical and cultural practices (Seid et al., 2015). Thus

host’s innate immunity provides the most feasible, eco-friendly and cheap method to control plant-

parasitic nematodes in rice. Lack of resistance to plant-parasitic nematodes in Asian rice (O.

sativa) has limited its genetic improvement (Diomandé, 1984; Plowright et al., 1999; Soriano et

al., 1999; Cabasan et al., 2015). Resistance was initially only found in African rice (O.

glaberrima). Efforts to improve nematode resistance through interspecific breeding between O.

sativa and O. glaberrima are usually hindered by challenges of sterility among F1 progenies

(Ghesquière et al., 1997). However, little success has resulted into fertile progenies by back

crossing with O. sativa parents (Jones et al., 1997; Cabasan et al., 2018). Some of these progenies

have demonstrated partial resistance to M. graminicola (Cabasan et al., 2018). Recent studies have

discovered resistant O. sativa cultivars, for instance LD24 and Khao Pahk Maw (Dimkpa et al.,

2015), Abhishek (Mhatre et al., 2017) and Zhonghua 11 (Thi Phan et al., 2017) with strong

resistance to the root-knot nematode M. graminicola. These findings provide a great potential for

improving nematode resistance in high yielding and commercial O. sativa cultivars. Cultivars

LD24 and Khao Pahk Maw have been crossed with an Italian rice cultivar (O. sativa cv. Vialone

nano) resulting in a progeny segregating for the resistance to M. graminicola (Lahari et al., in

preparation). However, understanding the underlying resistance mechanism in these cultivars is

necessary for successful and durable rice breeding programs. Additionally, investigating resistance

to other root-knot nematodes and root-lesion nematodes would provide insights on the broadness

of the resistance conferred by these rice genotypes.

Therefore the aim of this study was to investigate penetration and development or reproduction of

other root-knot nematodes such as M. javanica and M. incognita, and root-lesion nematode P.

zeae on genotypes LD24 and Khao Pahk Maw. Comparisons were made with a M. graminicola

resistant reference genotype TOG5674 (O. glaberrima) (Cabasan et al., 2012) and the susceptible

genotype Nipponbare (O. sativa) (Nguyễn et al., 2014).

Materials and methods

Rice genotypes and growth conditions

Four rice genotypes were used in this study. The genotypes LD 24 (O. sativa ssp. indica), KPM

(O. sativa ssp. aus), TOG5674 (O. glaberrima) are resistant to M. graminicola (Cabasan et al.,

2012; Dimkpa et al., 2015) while Nipponbare (O. sativa ssp. temperate japonica) is susceptible.

The seeds were germinated in petri dishes having moist tissue paper at 300C for 4 days. Then each

seedling was transplanted into a PVC tube containing sand and absorbent polymer (Reversat et al.,

1999). The plants were grown at 28 oC, 12/12 hours day/night regime at 70-75 % relative

humidity. Plants were fertilized with Hoagland’s nutrient solution by applying 10 ml per plant for

three times per week.

Nematode cultures

Two root-knot nematodes species (Meloidogyne incognita and Meloidogyne javanica) and one

root-lesion nematode (Pratylenchus zeae) were used in this study. The root-knot nematode

cultures were obtained from INRA, France. The cultures were separately multiplied and

maintained on susceptible tomato cv. Moneymaker in plastic pots containing soil. The P. zeae

culture was established from the population obtained from a rice field in Tanzania. The pure P.

zeae culture was obtained by inoculation of a single gravid female nematode on a carrot disc

(Kagoda et al., 2010) and then subcultured, multiplied and maintained on carrot discs in petri

dishes at 27 oC.

Infection experiments

For Meloidogyne spp., tomato roots infected with either M. incognita or M. javanica were

removed from pots and carefully washed with tap water. Egg masses from both species were

picked and placed onto 200 µm sieves separately. Additionally, the infected roots with galls were

cut into very small pieces and placed onto the 200 µm sieve having moist tissue paper. Both the

egg masses and cut roots were incubated for 72 hours at room temperature. The nematodes were

extracted using modified Baermann’s method (Coyne, 2007). Each 14-day old rice plant was

inoculated with approximately 200 J2s. Likewise for P. zeae, inoculum was collected from

cultures by washing nematodes from the carrot discs. The mixed vermiform stages were counted

and each 14-day old rice plant was inoculated with approximately 300 nematodes.

Penetration and development assays

The penetration and development or reproduction of both root-knot nematode species (M. javanica

and M. incognita), and root-lesion nematode (P. zeae) on rice genotypes Nipponbare, LD24, KPM

and TOG5674 were monitored by analysing the infected plants at different time points. For

penetration studies, infected root samples were collected at early time points, 1 and 3 days after

inoculation (DAI). Whereas to study nematode development or reproduction, samples were

collected at a later time point, 24 DAI. During sample collection at each time point, plants were

carefully removed from PVC tubes and root systems were gently washed with tap water. To

increase visibility of nematodes inside the roots, the infected root samples were stained in boiling

acid fuchsin solution for 3 minutes. The samples were later de-stained in acid glycerol (1 ml conc.

HCl : 1000 ml glycerol) for at least 14 days. Nematodes inside the roots were observed and

counted using a microscope (Leica Microsystems, Germany). For penetration assay, the number of

galls and the number of J2s per plant were counted at 1 and 3 DAI for both M. javanica and M.

incognita while for P. zeae total number of nematodes (J2, J3, J4 and adults) per plant were

counted. For development assay, the number of galls, juveniles (J3/J4), young females (without

egg masses) and egg-laying females were counted per plant for both root-knot nematode species at

24 DAI. Likewise, to assess reproduction of P. zeae, the total number of nematodes per plant was

counted and the reproductive factor was calculated from RF=Pf/Pi (Pf = final population, Pi =

initial population) (Pili et al., 2016).

Sample preparation for gene expression analysis

Gene expression analysis was conducted on the samples with root knot nematode infection (M.

javanica and M. incognita) on Nipponbare, LD24 and KPM genotypes. Four-day old seedlings

were transplanted in PVC tubes, each containing two seedlings. At fourteen days after

transplanting, each plant was inoculated with approximately 200 J2s of either nematode species.

Samples were collected at 3, 7, 14 and 21 DAI. At each time point, plants of respective genotypes

were separately removed from PVC tubes, carefully washed and the excess water was patted from

the root system using clean tissue paper. Non-infected plants were used as controls. Two

biological replicates comprising a pool of 6 root systems were considered per treatment at 3 DAI

and 4 plants at later time points. Samples were collected into RNAse free 5 ml Eppendorf tubes

and immediately frozen in liquid nitrogen and stored at -80 oC.

RNA extraction and cDNA synthesis

The frozen root samples were grinded to fine powder. The RNA was extracted using mercapto-

ethanol diluted with RLT buffer and RPE buffer following the protocol of the Qiagen RNeasy

mini kit (Qiagen, Germany). RNA concentration and purity were determined using a NanoDrop

2000 Spectrophotometer. Just before first strand cDNA synthesis, the RNA was pre-treated with

RNAse inhibitor and DNAse and treated samples were incubated at 37oC for 30 minutes and 65oC

for 10 minutes in 25mM EDTA to activate and stop reactions respectively. First strand cDNA

synthesis was performed by addition of the following to 12µl of RNA sample: 1µl of the 10µM

oligo dT primer, 1µl of 10 mM deoxyribonucleotide triphosphates (dNTP), 4 µl 5xRT buffer, 1µl

RiboSafe RNA inhibitor, 1µl Tetro Reverse Transcriptase ((200 units/µl). The reaction mixture

was then incubated for 2 hours at 45°C followed by reaction termination at 85oC for 5 minutes.

qRT-PCR

Rice phenylalanine ammonia lyase 4 (OsPAL4) expression was analysed using qRT-PCR. The

20µl reaction mixture contained 2µl cDNA, 1µl forward primer (10mM) (5’

TAACGTTTACCTGGTCACTGC 3’), 1µl reverse primer (10mM) (5’

CGTCCTGGTTGTGCTGC 3’), 10µl Hiloxpremix and 6µl sterile milli-Q water. All reactions

were performed in three technical replicates and two independent biological replicates. The

reactions were performed in Bio Rad CFX Connect Real-Time system and results were generated

by BIO-RAD CFX Manager 3.1. PCRs were performed under following conditions: 3 mins at

95oC and 39 cycles (15 secs at 95oC, 30 secs at 58oC) and 0.05 sec at 65oC. After the PCR

reaction, a melting curve was generated by gradually increasing the temperature to 95 degrees to

test the amplicon specificity. The same procedure was done for OsEXP, the reference gene

(forward primer: 5’ TGTGAGCAGCTTCTCGTTTG, reverse primer:

TGTTGTTGCCTGTGAGATCG).

Data analysis

The data was entered, processed in Microsoft excel and was later exported into statistical

analytical systems (SAS). Prior to analysis of variance, data was subjected to “proc univariate

normal plot” and “proc glm” procedures to test for normality and homogeneity of variance

respectively. The data set that did not fulfil the assumptions of normality and homogeneity of

variance were subjected to log(X+1) transformation. The data were then subjected to a one-way

analysis of variance (ANOVA). To determine differential responses among genotypes to

nematode infection, means were compared and separated using Fisher’s least significance

difference (LSD) at 0.05 significance level (P ≤ 0.05). The qRT-PCR data was analysed using the

REST 2009 software (Pfaffl et al., 2002). This software uses a permutation analysis to compare

the relative expression between a sample and a control group and to determine the statistical

significance of the results.

Results

Analysis of penetration of M. javanica in rice genotypes

Penetration of M. javanica in LD24, KPM, TOG5674 and Nipponbare was investigated at 1 and 3

days after inoculation (DAI). M. javanica penetrated all genotypes and induced galls. At 1 DAI,

there were no galls observed on LD24 and KPM. However, few galls were observed on some

plants of Nipponbare and TOG5674 (Figure 1). At 3 DAI, galls of various sizes and shapes were

observed on the roots tips of all genotypes. At this time point, gall formation was significantly

(P=0.01) different among genotypes. Nipponbare had significantly (P<0.05) higher number of

galls than other genotypes such as LD24, KPM and TOG5674 (Figure 1). The galls were more

swollen and rounded in Nipponbare compared to other genotypes (Figure 3).

To get insight on the number of M. javanica J2s penetrating the roots, the stained roots were split

longitudinally and J2s were counted. At both time points (1 and 3 DAI), J2s were found inside the

roots of all genotypes. The J2 numbers increased from 1 DAI to 3 DAI across genotypes. At 1

DAI, J2s were found mostly in root tips, without visible gall formation, of all genotypes. The

number of J2s was not significantly different among genotypes. However, slightly greater number

of J2s was found in genotypes Nipponbare and LD24 compared to KPM and TOG5674 (Figure 2).

At 3 DAI, the number of J2s was significantly (P=0.0125) different among the genotypes. The

number of J2s was significantly (P<0.05) higher in both Nipponbare and LD24 than in KPM and

TOG5674 (Figure 2). At 3 DAI, J2s were not only found in galls but also in root tips without

visible galls, mostly in genotypes LD24, KPM and TOG5674. At both time points, some J2s were

observed partly imbedded in roots with others in the cortex still migrating towards the root cap.

More migrating juveniles were however observed at 1 DAI. The J2s that U-turned into the central

cylinder induced galls of various phenotypes in the vascular cylinder (Figure 3). The visual

observations indicated that size of galls was not dependent on number of J2s inside the galls.

Figure 1: Number of galls induced on rice genotypes following penetration of M. javanica at 1 and 3 days

after inoculation (DAI). Rice seedlings were inoculated with approximately 200 J2s per plant. Bars

represent the means and standard error of the mean (Mean ± SEM). Different letters indicate statistically

significant (P≤0.05) differences according to Fisher’s least significant difference (LSD).

Figure 2: Penetration of M. javanica juveniles (J2s) in rice genotypes at 1 and 3 DAI. Rice

seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means and

standard error of the mean (Mean ± SEM). Different letters indicate statistically significant

(P≤0.05) differences according to Fisher’s least significant difference (LSD).

Figure 3: Gall phenotypes induced on rice genotypes following M. javanica infection at 3 DAI.

Any letter followed by 1 and 2 indicate intact galls while any letter followed by 3 indicates opened

galls with J2s in respective genotypes. Pictures were captured using camera connected to the

microscope, Leica Biosystems.

Analysis of the development of M. javanica on rice genotypes

The development of M. javanica on rice genotypes was studied at 24 DAI. The number of galls

was significantly (P<0.0001) different among the genotypes (Figure 4). The number of galls was

significantly higher on Nipponbare but comparable with TOG5674. The genotype LD24 had

lower number of galls than TOG5674 but the difference was not statistically significant. KPM had

the lowest number of galls of genotypes (Figure 4). Nipponbare had enormously large galls in

which one or several nematodes were completely enclosed. In LD24, KPM and TOG5674, small

galls enclosing one to few nematodes were observed. Some nematodes were observed hanging

outside on the root surface with no gall at all (Figure 7).

Total number of nematodes per plant was calculated as the summation of all developmental stages

(J3/J4, young females and egg-laying females) observed in the roots. The number of total

nematodes was significantly (P<0.0001) higher in Nipponbare compared to other genotypes.

LD24 and TOG5674 had a comparable number of nematodes. KPM had the least number of

nematodes compared to all other genotypes (Figure 5). Interestingly, the number of nematodes

varied greatly among developmental stages (Figure 6). The number of nematodes in each stage

increased successively in Nipponbare towards egg-laying females. In Nipponbare, the majority

were egg-laying females (37.22 %) and females without egg masses (young females) (41.10 %)

and only 21.68 % were in juvenile stages (J3/J4). In LD24, greater numbers were still J3/J4 (42.73

%) and young females (35.41 %). Only 21.86 % developed into egg-laying females. In KPM, the

highest percentage was J3/J4 (48.57 %), while 36.19 % was young females and very few (15.24

%) were egg-laying females. Whereas in TOG5674, J3/J4 (55.56 %) were very high compared to

young females (32.32 %) and egg-laying females (12.12 %).

Figure 4: Number of galls found on rice genotypes at 24 days after inoculation with M. javanica.

Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means

and standard error of the mean (Mean ± SEM). Different letters indicate statistically significant

(P≤0.05) differences according to Fisher’s least significant difference (LSD).

Figure 5: Total number of nematodes (M. javanica) developed on rice genotypes at 24 days after

inoculation. Total number of nematodes was calculated as the summation of developmental stages

per genotype. Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent

the means and standard error of the mean (Mean ± SEM). Different letters indicate statistically

significant (P≤0.05) differences according to Fisher’s least significant difference (LSD).

Figure 6: Variation in M. javanica developmental stages on rice genotypes at 24 days after inoculation.

Rice seedlings were inoculated with approximately 200 J2s per plant. Bars represent the means

and standard error of the mean (Mean ± SEM). Different letters on each genotype indicate

statistically significant (P≤0.05) differences according to Fisher’s least significant difference

(LSD).

Figure 7: Gall phenotypes and developmental stages found on rice genotypes following M.

javanica infection at 24 days after inoculation. Pictures were captured using a camera connected

to the microscope, Leica Biosystems.

Analysis of penetration of M. incognita in rice genotypes

Penetration of M. incognita was studied at 1 and 3 DAI. At 1 DAI, assessment of roots for galls

indicated that there were no galls on any genotype. At 3 DAI, galls were observed in few

replicates of Nipponbare, KPM and TOG5674. LD24 had no galls at both time points (Table 1).

When roots were assessed for penetration, it was observed that no juveniles (J2s) had penetrated

the rice roots of all genotypes at 1 DAI. At 3 DAI however, some J2s were found in galls and gall-

less root tips of all genotypes (Figure 8). On average, a larger number of J2s was found in KPM

followed by Nipponbare and TOG5674 while the lowest number was recorded in LD24. However,

variation among replicates for a given genotype was high, some samples had no J2s at all (Table

1).

Table 1: Number of M. incognita juveniles (J2s) penetrated and galls induced on the root

Time points Genotype Number of galls Number of juveniles (J2)

1 DAI Nippon 0 0

LD24 0 0

KPM 0 0

TOG5674 0 0

3 DAI Nippon 2.125 (0 - 5) 4 (0 - 11)

LD24 0 1.25 (0 - 7)

KPM 0.85 (0 - 2) 8.50 (0 - 19)

TOG5674 0.625 (0 - 2) 2.25 (0 - 6)

Values are means and ranges. Mean (range = Minimum-Maximum values) of number of J2s and

galls at 1 and 3 days after infection. Rice genotypes were infected with approximately 200 J2s of

M. incognita.

Figure 8: Juveniles (J2s) or galls induced on rice genotypes following infection by M. incognita at

3 days after inoculation (DAI). Pictures were captured using camera connected to the microscope,

Leica Biosystems.

Development of M. incognita in rice genotypes

At 24 DAI, genotypes were assessed for development of M. incognita. Assessment of galling

indicated very few galls on all genotypes following inoculation with M. incognita. However on

average, one gall per plant was observed in Nipponbare and LD24, while two galls per plant were

observed in KPM. There were no galls on TOG5674 (Table 2).

Evaluation of rice genotypes for developmental stages indicated few nematodes across genotypes.

All genotypes appeared immune to M. incognita infection. Despite the low infection, differences

in responses to infection were observed among genotypes. All developmental stages (J3/J4, young

females and egg-laying females) were observed in Nipponbare, LD24 and KPM unlike in

TOG5674 (Table 2). In TOG5674, the nematodes were still in juvenile (J3/J4) stages. In LD24

and KPM, some nematodes were observed in roots without visible galls. Egg-laying females

observed on rice genotypes were larger in size in Nipponbare than in other genotypes, with the

eggs protected in a thick gelatinous matrix on root surfaces (Figure 9).

Table 2: Number of galls and developmental stages of M. incognita at 24 DAI

Genotype

Number of

galls Juveniles (J3/J4)

Young

females

Egg-laying

females

Nippon 1.125 (0 - 3) 0.375 (0 - 1) 0.25 (0 - 2) 1.125 (0 - 3)

LD24 0.50 (0 - 1) 0.75 (0 - 4) 0.625 (0 - 2) 0.50 (0 - 1)

KPM 1.375 (0 - 6) 0.50 (0 - 1) 0.25 (0 - 1) 1.00 (0 - 5)

TOG5674 0 0.125 (0 - 1) 0 0

Values are means and ranges. Mean (range = Minimum-Maximum values) of number of J2s and

galls at 24 days after inoculation (DAI). Rice genotypes were infected with approximately 200 J2s

of M. incognita.

Figure 9: Gall phenotypes and development observed on rice genotypes following infection by M.

incognita at 24 days after inoculation. Pictures were captured using camera connected to the

microscope, Leica Biosystems.

Expression analysis of PAL as a possible regulator of resistance

Expression of OsPAL4 was studied in Nipponbare, LD24 and KPM. All genotypes were infected

with M. javanica and M. incognita. Non-infected plants were used as control. For individual

genotypes, pairwise analysis was performed between controls and infected plants. According to

the algorithm of Rest2009 software, upregulation is when the relative expression is above 1 (>1)

and down regulation when less than one (<1). Results showed that the relative expression of

OsPAL4 was slightly down regulated in all genotypes following nematode infection at early time

point, 3 DAI (Figure 10A). At later time points, the result showed that both M. javanica and M.

incognita consistently down regulated OsPAL4 in the susceptible genotype Nipponbare at all time

points (7, 14 and 21). On contrary, non-significant upregulation was observed at 21 DAI in M.

incognita infected plants (Figure 10). In LD24 and KPM, there was no distinct expression pattern

of OsPAL4 due to infection of either M. javanica or M. incognita at 7, 14 and 21 DAI (Figure 10).

However, in LD24 PAL4 was slightly upregulated at 7 DAI by M. javanica (Figure 10B) and very

strongly upregulated by both root-knot nematodes at 14 DAI (Fig. 10C).

Figure 10: Expression level of PAL4 at 3, 7, 14, and 21 days after inoculation (DAI) of either M.

javanica or M. incognita. CTRL = non-infected plants (Controls), Mj = M. javanica and Mi = M.

incognita. A = Relative expression of PAL4 at 3 DAI, B = Relative expression of PAL4 at 7 DAI,

C = Relative expression of PAL4 at 14 DAI, D = Relative expression of PAL4 at 21 DAI. Pairwise

comparison was performed between controls and nematode infected plants for individual

genotypes. Statistical significance is indicated by asterisks (*).

Analysis of penetration of P. zeae in rice genotypes

Penetration of P. zeae in rice roots was studied in Nipponbare, LD24, KPM and TOG5674 at 1

and 3 DAI. Nematodes were observed to penetrate the roots of all genotypes. At 1 DAI,

penetration of P. zeae was not significantly (P=0.9039) different among genotypes. Likewise, at

3DAI nematode penetration was also not significantly (P=0.4529) different among genotypes, but

relatively higher numbers of nematodes penetrated in Nipponbare and LD24 genotypes (Figure

10). Nematode penetration increased from 1DAI to 3DAI across the genotypes (Figure 11).

However, increase in nematode numbers between 1 DAI and 3 DAI was significant (P<0.05) only

in Nipponbare and LD24 (Figure 10). In samples of both time points it was observed that before

penetration, nematodes punctured root surfaces over a wide area which resulted in an extended

necrosis on the root surfaces. Across genotypes, nematodes were observed in the root cortex while

others were still penetrating, with their bodies partly hanging outside the root. Many nematodes

were observed to penetrate at the same site. After penetration, nematodes started feeding on plant

root cortical cells but necrosis was not clearly visible in all genotypes at both time points (Figure

12). At 3 DAI females had already started laying eggs in the root cortex.

Figure 11: Penetration of P. zeae in rice genotypes at 1 and 3 days after inoculation (DAI). Rice

seedlings were inoculated with approximately 300 mixed stages per plant. Bars represent the

means and standard error of the mean (Mean ± SEM). Different letters indicate statistically

significant (P≤) differences according to Fisher’s least significant difference (LSD).

Figure 12: Penetration of P. zeae mixed stages in rice genotypes at 1 day after inoculation (DAI).

Similar penetration behaviour was observed at 3 DAI. Pictures were captured using a camera

connected to the microscope, Leica Biosystems.

Reproduction of P. zeae on rice genotypes

Reproduction of Pratylenchus zeae on rice genotypes was studied at 24 DAI. P. zeae reproduction

significantly (P<0.0001) differed among the genotypes (Table 3). Nipponbare had the greatest

number of nematodes (range, 805-1597) compared to other genotypes. LD24 was significantly

different and intermediate (range, 409-774) between Nipponbare and KPM and TOG5674. The

average nematode numbers were not statistically different in KPM and TOG5674. Across

genotypes, P. zeae was observed both in the main roots and lateral roots. While greater numbers

were observed in the main roots of Nipponbare, higher numbers of nematodes were observed in

the lateral roots of other genotypes. Despite the differences in the number of nematodes, eggs were

observed in the necrotic tissues of all genotypes. Furthermore, a reproduction factor (RF) was

calculated based on final population (Pf) divided by the initial population (Pi). Nipponbare and

LD24 had RF greater than one (RF>1) and were thus classified as susceptible to P. zeae infection.

Likewise, genotypes KPM and TOG5674 had RF less than one (RF<1) and were thus resistant to

P. zeae infection (Table 3).

Table 3: Reproduction of P. zeae on rice genotypes 21 days after inoculation

Genotypes Number of nematodes RF Host status

Nipponbare 1157.13 ± 251.54a 3.857083 S

LD24 617.63 ± 121.50b 2.05875 S

KPM 175.00 ± 55.29c 0.583333 R

TOG5674 222.13 ± 69.03c 0.740417 R

Mean ± SEM (SEM is standard error of the mean). RF=Pf/Pi (Pf = final population, Pi = initial

population of 300 mixed stages). R and S are depicted resistant and susceptible genotypes

respectively. Means with different letters in the column are significantly (P<0.05) different

according to Fisher’s least significant difference (LSD).

Discussion

Root-knot nematodes (Meloidogyne spp.) and root-lesion nematodes (Pratylenchus spp.) are the

most important plant-parasitic nematodes infecting rice (Bridge et al., 2005). Previous studies

showed that O. sativa genotypes LD24 and KPM confer resistance to the root-knot nematode M.

graminicola (Dimkpa et al., 2015). Genotypes TOG5674 (O. glaberrima) and Nipponbare (O.

sativa) have been used in rice-M. graminicola interactions as resistant and susceptible references

respectively (Cabasan et al., 2012; Nguyễn et al., 2014). Lack of information on the mechanism of

resistance and broadness of resistance in these genotypes triggered our motivation for a further

investigation using different nematodes. In this study, we analysed resistance of rice genotypes

LD24, KPM and TOG5674 to M. javanica, M. incognita and P. zeae alongside the model

susceptible genotype Nipponbare. To gain insights on whether the resistance conferred by the rice

genotypes is pre- or post-infection, we investigated penetration at 1 and 3 days after inoculation

(DAI) and development/reproduction at 24 DAI. Analysis of penetration and development of root-

knot nematodes: M. incognita and M. javanica on rice genotypes indicated different patterns.

In our study, the genotype KPM was found highly resistant to M. javanica while LD24 and

TOG5674 were moderately resistant. M. javanica juveniles (J2s) penetrated and reproduced on all

genotypes in varying degrees. At 1 DAI, only few galls were observed on Nipponbare and

TOG5674 and none on LD24 and KPM, and the number of J2s found was not different among

genotypes. This observation is in conformity with equal penetration rate of M. graminicola J2s

between resistant and susceptible rice genotypes (Jena & Rao, 1977). Similarly, Ditylenchus

angustus a leaf parasitic nematode, equally penetrated both resistant and susceptible rice

genotypes (Khanam et al., 2018). Besides, few J2s were found in the vascular cylinder but many

were found in the cortex of gall-less roots in all genotypes suggesting that many J2s were still

migrating. The fact that M. javanica J2s penetrated all rice genotypes equally at 1 DAI suggests

that penetration is not restricted at this early time point. However, at 3 DAI, galls were clearly

visible in all genotypes but the size and number of galls were significantly higher in Nipponbare

than LD24, KPM and TOG5674. M. graminicola-induced galls on roots of susceptible genotype

were also more than in the resistant genotypes at 3 DAI Cabasan et al. (2014). In their study,

sections through galls showed hypertrophied giant cells in the susceptible but in resistant genotype

an early hypersensitive reaction was observed in cell around the J2s. After penetration, J2s migrate

to vascular cylinder and initiate formation of permanent feeding sites by releasing oesophageal

secretions (Hassan et al., 2010). Galls are formed following extensive nuclear cell division

without cytokinesis which results into multinucleate and hypertrophied giant cells in the vascular

parenchyma (Williamson & Hussey, 1996; Kyndt et al., 2013). Therefore, the observation of J2s

in gall-less roots at 1 DAI could be attributed to the early stages of nuclear cell divisions that were

not enough to cause significant increase in the size of the selected parenchyma cells surrounding

the nematode.

To gain insights on the number of J2s that penetrated at 3 DAI, the roots were dissected. The

results indicated that J2s were significantly more numerous in Nipponbare and LD24 than in KPM

and TOG5674. The lower number of J2s in KPM and TOG5674 might be attributed to early

defence responses that inhibited further nematode penetration. Similar observations were reported

by Cabasan et al. (2012) who observed differences in penetration of M. graminicola between

susceptible and resistant rice genotypes. In other studies, the observed difference in penetration of

Meloidogyne spp. between resistant and susceptible genotypes were as a result of movement out

or death of J2s in the resistant roots after initial penetration due to the failure to initiate feeding

sites in tobacco (Schneider, 1991) and soybean (Moura et al., 1993). In resistant rice roots

however, invading J2s were arrested by early hypersensitive-like reaction that was observed

around J2s in the hypodermis, cortex and appeared distorted (Cabasan et al., 2014). Therefore, the

J2s we found in galls-less roots of KPM and TOG5674 at 3 DAI could have been arrested by early

hypersensitive responses. Late penetration or early penetration with a delay or failure to initiate

feeding site are also possibilities.

To analyse in detail the effect of rice genotypes on post-infection development of M. javanica, the

assessments were done at 24 DAI. It was observed that after penetration nematodes developed to

reproductive stage or egg-laying females in all genotypes. However, strong resistance responses

were observed in genotypes LD24, KPM and TOG5674 where the numbers of total nematodes

were lower with a reduced development into the egg-laying females. Nipponbare had the highest

number of gall development compared to all other genotypes. Galls on Nipponbare were more

swollen and contained many nematodes suggesting suitable host for this nematodes. Genotypes

LD24, KPM and TOG5674 had few and small galls, each containing mostly one nematode.

Moreover, the most nematodes were found as part of their body hanging on the root surfaces

without visible galls. This unique phenotype suggests that nematodes failed to maintain feeding

cells in these genotypes, leading to collapsed cells and subsequently galls dissolution occurred.

However, this trait was more pronounced in genotype KPM signifying stronger resistance. Few

galls observed in this study of LD24, KPM and TOG5674 could be due to similar resistance

mechanism against M. graminicola infection (Dimkpa et al., 2015). Similar resistance responses

were also found among rice germplasm collected from Tanzania (Nzogela et al., In preparation).

Slow development in LD24, KPM and TOG5674 was attributed to the relatively higher number of

juveniles and lower adult females whereas in Nipponbare the development pattern was opposite,

with high number of females. Similar development trend was observed between resistant and

susceptible rice genotypes following infection with M. graminicola (Cabasan et al., 2012). The

same observation was also reported in other crops infected with M. incognita, for instance soybean

(Moura et al., 1993) and cotton (McCLURE et al., 1974). The low number of J3/J4 observed in

Nipponbare comparable to that in LD24 and TOG5674 could be due to deferential penetration or

delayed development resulting from competition among many nematodes confined in single large

galls. However, the number of J3/J4 were lower in KPM compared to Nipponbare. Additionally,

significantly few young females with a very small proportion of egg-laying females was observed

in LD24, KPM and TOG5674 compared to Nipponbare. In tomatoes, M. incognita juveniles were

found smaller in resistant genotypes than the susceptible ones (Dropkin, 1969). Diomandé (1984)

also observed higher percetage of M. incognita females in susceptible rice genotypes than in

resistant genotypes at four weeks (28 dys) after infection. Earlier studies demonstrated that M.

graminicola penetration and development were highly reduced in genotypes LD24 and KPM

(Dimkpa et al., 2015). Therefore, resistance responses towards M. javanica and M. graminicola

might be different. Several reports have reported that the suppressed nemarode development was

attributed to poorly developed and highly vacuolated giant cells in resistant genotypes, for

instance in cotton against M. incognita (McCLURE et al., 1974), in cowpea against M. incognita

(Das et al., 2008) and in coffee against M. exigua (Anthony et al., 2005). Accumulation of toxins

and hydrolases are usually associated with vacuolation of giant cells, consquently resulting into

cell degeneration (Jones, 2001). Plant hormones have also been reported to affect nematode

development in rice (Nahar et al., 2011).

To further investigate the resistance conferred by LD24, KPM and TOG5674, the genotypes were

infected with M. incognita alongside the model susceptible rice genotype Nipponbare. According

to our results, it was unexpected that Nipponbare, the model genotype for studying rice-pathogen

interactions showed low penetration of M. incognita. The low penetration was also observed in

LD24, KPM and TOG5674. The very low infection was not due to inactive nematodes because the

inoculum (J2s) were very active at the time of inoculation. Preliminary infection experiments

showed penetration and development following M. incognita inoculation. However, due to delay

to sub-culture, the culture was lost and new culture was obtained from INRA, France. It is

therefore probable that the cultures used during preliminary infection and the one used in this

study could be different populations with differences in pathogenicity. Nevertheless, some of the

few J2s that managed to penetrate developed to egg-laying females on the genotypes except

TOG5674. However, an indication of suppressed development was observed on genotypes LD24,

KPM and TOG5674. Suppressed development suggests post-infection resistance responses in

these genotypes. Previous studies demonstrated that M. incognita penetrated rice genotype

Nipponbare and galls were visible at 6 DAI (Nguyễn et al., 2014). However, information on the

number of M. incognita J2s penetrating rice roots is limited. Dutta et al. (2011) investigated

penetration and development following inoculation of approximately 200 J2s of M. incognita in

rice genotype Balilla (O. sativa) at different time points. Their result indicated the maximum

penetration of about four J2s per plant at 4 DAI and no reproduction was observed at 25 DAI.

Conversely, Diomandé (1984) studied penetration and development of M. incognita and observed

higher penetration (at 4 DAI) and reproduction (at 28 DAI) in susceptible O. sativa genotypes

compared to resistant O. glaberrima. Despite discrepancies in the information about M. incognita-

rice interactions, further investigation is necessary to make any conclusions.

Despite low infection of M. incognita, the observed resistance responses of LD24, KPM and

TOG5674 were similar to responses observed following M. javanica. To elucidate the possible

regulators of resistance to M. javanica and M. incognita, expression of phenylalanine ammonia

lyase (OsPAL4) was investigated in LD24 and KPM in reference to Nipponbare. Our result

indicated that, OsPAL4 was consistently down regulated in Nipponbare following infection of M.

javanica and M. incognita at early time points (3, 7 and 14) days after inoculation. Similarly,

down regulation of OsPAL4 was observed in LD24 and KPM at 3 days after M. javanica and M.

incognita inoculation. In contrast, the OsPAL4 gene expression in LD24 and KPM showed no

distinct pattern at 7, 14 and 21 DAI. However, at 14 DAI, the expression in LD24 was strongly

upregulated by both root-knot nematodes. Continuous suppression of OsPAL4 in Nipponbare

suggests that the gene plays a key role in plant defence and has to be kept as low as possible

throughout nematodes lifecycle. Additionally, the observed suppression at 3 DAI followed by

low-up pattern in resistant genotypes could be attributed to trigger of interacting molecules

responsible for plant defence. Furthermore, resistance in KPM could be constitutive and early as

indicated by significantly lower penetration and development than susceptible genotype

Nipponbare. In LD24 the strong upregulation observed at 14 DAI could be related to late induced

resistance as indicated by high penetration and lower development than Nipponbare. Recent

studies on rice-pathogen interactions have shown that OsPAL genes are similarly or differentially

expressed in different tissues. For example, OsPAL4, OsPAL1, OsPAL5 and OsPAL2 showed

similar expression pattern in different tissues following infection with biotrophic pathogens

(Tonnessen et al., 2015). Moreover, these OsPAL genes play different or similar roles with

probably additive effects during phenylpropanoid metabolism. For example, OsPAL1, a key gene

in salicylic acid biosynthesis was suppressed consistently in Nipponbare but highly upregulated in

resistant genotype at different time points following infection with Ditylenchus angustus (Khanam

et al., 2018) but neither upregulation nor down regulation was observed in M. graminicola

infected plants (Kyndt et al., 2012). Therefore, the observed up-low pattern in resistant genotypes

LD24 and KPM could have been due to interplay of many factors contributing to the resistance

but more experiments are required to determine actual contributors to the resistance.

To gain insight on the broadness of resistance in LD24, KPM and TOG5674, the genotypes were

tested against P. zeae with migratory lifestyle. Analysis of nematode numbers showed a non-

significant difference in invasion of P. zeae among the genotypes at 1 DAI as well as 3 DAI. This

result suggests pre-infection resistance as reported in KPM and LD24 against M. graminicola

(Dimkpa et al., 2015) not to be effective against P. zeae. Equal penetration rates between resistant

and susceptible genotypes were also observed in wheat against P. thornei (Linsell et al., 2014), in

rice against Ditylenchus angustus (Khanam et al., 2018), and in beans against P. scribneri

(Thomason et al., 1976). Analysis of reproduction indicated that Nipponbare supported a very

high reproduction of about 4-fold increase in final population in 24 days, compared to a 2-fold

increase in LD24. However, the final population decreased in KPM and TOG5674. Our study

supports the susceptibility of Nipponbare to P. zeae as was observed by Pili et al. (2016). The

genotype LD24 showed a moderate level of resistance to P. zeae with two-fold increase in initial

population. Thus, LD24 was found to be susceptible to P. zeae, while KPM and TOG5674 were

resistant. Our result is in agreement with the observation made by Nzogela et al. (in preparation)

for resistance in TOG5674 following infection with 300 mixed stages of P. zeae. Suppressed

reproduction in resistant genotypes, but no difference in penetration was also observed between

resistant and susceptible wheat genotypes (Talavera, 2001; Linsell et al., 2014), as in our study.

The fact that TOG5674 and KPM suppressed P. zeae reproduction indicates their mechanism of

resistance might be post-infection.

In conclusion, this study found that rice (O. sativa) genotype KPM has a strong and broad

resistance to root-knot nematodes (M. javanica) and root-lesion nematodes (P. zeae). LD24 and

TOG5674 are moderately resistant to M. javanica. Additionally, analysis of OsPAL4 did not

demonstrate to be linked to resistance against M. javanica and M. incognita in LD24 and KPM.

However, further studies are required especially to test the resistance under field conditions.

Variation in host responses (resistance vs susceptibility) were reported between indoor growth

chambers and outdoor raised beds (Cabasan et al., 2018). Therefore careful identification of

uniformly infested fields (hotspots) is paramount for testing stability of resistance in rice. In depth

molecular and biochemical analyses are being carried out to reveal the underlying resistance

mechanism of these genotypes against M. graminicola infection. Expression analysis of some

phenylpropanoid pathway genes in different rice genotypes upon infection by M javanica and M.

incognita should be repeated to confirm the result obtained during this study.

Acknowlwedgement

The author wishes to thank the Flemish Interuniversity Council (VLIR-UOS) for providing the

scholarship. To my supervisor Mst. Zobaida Lahari, thanks for guiding me all through the research

period. A word of sincere gratitude is extended to my promoter Prof. Godelieve Gheysen, thank

you for allowing me do my thesis research under your supervision. To all members of the applied

molecular biotechnology research groups, thank you for all the support and guidance through my

thesis period. Willem Desmedt and Yasinta Nzogela are highly acknowledged for providing the

Meloidogyne incognita and Pratylenchus zeae cultures respectively. Lander Bauters and Jonas De

Kesel are highly acknowledged for their assistance in molecular work. I am grateful to Inge

Dehennin and Prof. Wim Bert for the great administrative work that has made the program a

success. Finally to all professors, thank you all for sharing with us your expertise in the fields of

nematology, pathology and biotechnology.

References

Anthony, F., Topart, P., Martinez, A., Silva, M. & Nicole, M. (2005). Hypersensitive‐like reaction

conferred by the Mex‐1 resistance gene against Meloidogyne exigua in coffee. Plant

Pathology 54, 476-482.

Babatola, J. (1980). Reactions of some rice cultivars to the root-knot nematode, Meloidogyne

incognita. Nematropica 10, 5-9.

Babatola, J. (1984). Rice nematode problems in Nigeria: their occurrence, distribution and

pathogenesis. International Journal of Pest Management 30, 256-265.

Bouman, B., Humphreys, E., Tuong, T. & Barker, R. (2007). Rice and water. Advances in

agronomy 92, 187-237.

Bridge, J., Plowright, R. A. & Peng, D. (2005). Nematode parasites of rice. Plant parasitic

nematodes in subtropical and tropical agriculture 87.

Cabasan, M., Fernandez, L. & De Waele, D. (2015). Host response of Oryza glaberrima and O.

sativa rice genotypes to the rice root-knot nematode Meloidogyne graminicola in a

hydroponic system under growth chamber. Archives of Phytopathology and Plant

Protection 48, 740-750.

Cabasan, M. T. N., Kumar, A., Bellafiore, S. & De Waele, D. (2014). Histopathology of the rice

root-knot nematode, Meloidogyne graminicola, on Oryza sativa and O. glaberrima.

Nematology 16, 73-81.

Cabasan, M. T. N., Kumar, A. & De Waele, D. (2012). Comparison of migration, penetration,

development and reproduction of Meloidogyne graminicola on susceptible and resistant

rice genotypes. Nematology 14, 405-415.

Cabasan, M. T. N., Kumar, A. & De Waele, D. (2018). Evaluation of resistance and tolerance of

rice genotypes from crosses of Oryza glaberrima and O. sativa to the rice root-knot

nematode, Meloidogyne graminicola. Tropical Plant Pathology 43, 230-241.

Calpe, C. (2006). Rice international commodity profile. Rome: Food and Agricultural

Organization of the United Nations.

Castillo, P. & Vovlas, N. (2007). Biology and ecology of Pratylenchus. Pratylenchus (Nematoda:

Pratylenchidae): diagnosis, biology, pathogenicity and management 6, 305-310.

Chen, X. & Ronald, P. C. (2011). Innate immunity in rice. Trends in Plant Science 16, 451-459.

Conen, F., Smith, K. A. & Yagi, K. (2010). Rice cultivation. Methane and climate change, 1st

edn. Earthscan, Washington, DC, 115-135.

Cook, R. J. (1998). The molecular mechanisms responsible for resistance in plant–pathogen

interactions of the gene-for-gene type function more broadly than previously imagined.

Proceedings of the National Academy of Sciences 95, 9711-9712.

Coyne, D. (2007). Practical plant nematology: a field and laboratory guide. IITA, pp.

Das, S., Demason, D. A., Ehlers, J. D., Close, T. J. & Roberts, P. A. (2008). Histological

characterization of root-knot nematode resistance in cowpea and its relation to reactive

oxygen species modulation. Journal of experimental botany 59, 1305-1313.

Dimkpa, S. O., Lahari, Z., Shrestha, R., Douglas, A., Gheysen, G. & Price, A. H. (2015). A

genome-wide association study of a global rice panel reveals resistance in Oryza sativa to

root-knot nematodes. Journal of experimental botany 67, 1191-1200.

Diomandé, M. (1984). Response of upland rice cultivars to Meloidogyne species. Revue

Nématologie 7, 57-63.

Dropkin, V. (1969). Necrotic reaction of tomatoes and other hosts resistant to Meloidogyne:

reversal by temperature. Phytopathology.

Duncan, L., Moens, M. & Perry, R. (2006). Migratory endoparasitic nematodes. Plant

nematology, 123-152.

Fortuner, R. & Merny, G. (1979). Root-parasitic nematodes of rice. Revue de Nematologie. 2, 79-

102.

Freeman, B. C. & Beattie, G. A. (2008). An overview of plant defenses against pathogens and

herbivores. The Plant Health Instructor.

Fujimoto, T., Mizukubo, T., Abe, H. & Seo, S. (2015). Sclareol induces plant resistance to root-

knot nematode partially through ethylene-dependent enhancement of lignin accumulation.

Molecular Plant-Microbe Interactions 28, 398-407.

George, T., Magbanua, R., Garrity, D. P., Tubana, B. S. & Quiton, J. (2002). Rapid yield loss of

rice cropped successively in aerobic soil. Agronomy Journal 94, 981-989.

Ghesquière, A., Séquier, J., Second, G. & Lorieux, M. (1997). First steps towards a rational use of

African rice, Oryza glaberrima, in rice breeding through a ‘contig line’concept. Euphytica

96, 31-39.

Gheysen, G. & Jones, J. T. (2013). Molecular Aspects of Plant-Nematode Interacctions. Plant

Nematology, 2nd edn (eds, Perry, R.N. and Moens, M), Wallingford, UK, CAB

International, , 274-298.

Gheysen, G. & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways

for infection. Current opinion in plant biology 14, 415-421.

Gupta, S. K., Rai, A. K., Kanwar, S. S., Chand, D., Singh, N. K. & Sharma, T. R. (2011). The

single functional blast resistance gene Pi54 activates a complex defence mechanism in rice.

Journal of experimental botany 63, 757-772.

Hassan, S., Behm, C. A. & Mathesius, U. (2010). Effectors of plant parasitic nematodes that re-

program root cell development. Functional Plant Biology 37, 933-942.

Jena, R. N. & Rao, Y. S. (1977). Nature of resistance in rice (Oryza sativa L) to the root-knot

nematode (Meloidogyne graminicola Golden and birchheld). II. Mechanisms of resistance.

Proceedings of the Indian Academy of Sciences-Section B. Springer.

Ji, H., Kyndt, T., He, W., Vanholme, B. & Gheysen, G. (2015). β-Aminobutyric acid–induced

resistance against root-knot nematodes in rice is based on increased basal defense.

Molecular Plant-Microbe Interactions 28, 519-533.

Jones, A. M. (2001). Programmed cell death in development and defense. Plant physiology 125,

94-97.

Jones, J. D. & Dangl, J. L. (2006). The plant immune system. Nature 444, 323-329.

Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T.,

Manzanilla‐López, R., Palomares‐Rius, J. E. & Wesemael, W. M. (2013). Top 10 plant‐

parasitic nematodes in molecular plant pathology. Molecular Plant Pathology 14, 946-961.

Jones, M. P., Dingkuhn, M., Aluko, G. K. & Semon, M. (1997). Interspecific Oryza sativa L. x O.

glaberrima Steud. progenies in upland rice improvement. Euphytica 94, 237-246.

Kagoda, F., Coyne, D., Mbiru, E., Derera, J. & Tongoona, P. (2010). Monoxenic culture of

Pratylenchus zeae on carrot discs. Nematologia Mediterranea 38.

Karssen, G., Wesemael, W. & Moens, M. (2013). Root-knot nematodes. Plant nematology. CABI,

pp. 73-108.

Khanam, S., Bauters, L., Singh, R. R., Verbeek, R., Haeck, A., Sultan, S. M., Demeestere, K.,

Kyndt, T. & Gheysen, G. (2018). Mechanisms of resistance in the rice cultivar

Manikpukha to the rice stem nematode Ditylenchus angustus. Molecular Plant Pathology

19, 1391-1402.

Kreye, C., Bouman, B., Reversat, G., Fernandez, L., Cruz, C. V., Elazegui, F., Faronilo, J. &

Llorca, L. (2009). Biotic and abiotic causes of yield failure in tropical aerobic rice. Field

Crops Research 112, 97-106.

Kumari, C., Dutta, T. K., Banakar, P. & Rao, U. (2016). Comparing the defence-related gene

expression changes upon root-knot nematode attack in susceptible versus resistant cultivars

of rice. Scientific reports 6, 22846.

Kyndt, T., Fernandez, D. & Gheysen, G. (2014). Plant-parasitic nematode infections in rice:

molecular and cellular insights. Annual Review of Phytopathology 52, 135-153.

Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2012).

Comparing systemic defence‐related gene expression changes upon migratory and

sedentary nematode attack in rice. Plant biology 14, 73-82.

Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites:

unique organs in plant roots. Planta 238, 807-818.

Li, B., Liu, B., Shan, C., Ibrahim, M., Lou, Y., Wang, Y., Xie, G., Li, H. Y. & Sun, G. (2013).

Antibacterial activity of two chitosan solutions and their effect on rice bacterial leaf blight

and leaf streak. Pest Management Science 69, 312-320.

Linsell, K. J., Riley, I. T., Davies, K. A. & Oldach, K. H. (2014). Characterization of resistance to

Pratylenchus thornei (Nematoda) in wheat (Triticum aestivum): attraction, penetration,

motility, and reproduction. Phytopathology 104, 174-187.

Mcclure, M. A., Ellis, K. & Nigh, E. L. (1974). Resistance of cotton to the root-knot nematode,

Meloidogyne incognita. Journal of Nematology 6, 17.

Mhatre, P. H., Pankaj, A. S., Singh, A. K., Ellur, R. K. & Kumar, P. (2017). Molecular mapping of

rice root-knot nematode (Meloidogyne graminicola) resistance gene in Asian rice (Oryza

sativa L.) using STMS markers. Indian J. Genet 77, 163-165.

Moura, R., Davis, E., Luzzi, B., Boerma, H. & Hussey, R. (1993). Post-infectional development of

Meloidogyne incognita on susceptible and resistant soybean genotypes. Nematropica 23,

7-13.

Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate

pathway is a key player in systemically induced defense against root knot nematodes in

rice. Plant physiology 157, 305-316.

Nguyễn, P. V., Bellafiore, S., Petitot, A.-S., Haidar, R., Bak, A., Abed, A., Gantet, P., Mezzalira,

I., De Almeida Engler, J. & Fernandez, D. (2014). Meloidogyne incognita-rice (Oryza

sativa) interaction: a new model system to study plant-root-knot nematode interactions in

monocotyledons. Rice 7, 23.

Olowe, T. & Corbett, D. (1976). Aspects of the biology of Pratylenchus brachyurus and P. zeae.

Nematologica 22, 202-211.

Peng, S., Bouman, B., Visperas, R. M., Castañeda, A., Nie, L. & Park, H.-K. (2006). Comparison

between aerobic and flooded rice in the tropics: agronomic performance in an eight-season

experiment. Field Crops Research 96, 252-259.

Pfaffl, M. W., Horgan, G. W. & Dempfle, L. (2002). Relative expression software tool (REST©)

for group-wise comparison and statistical analysis of relative expression results in real-

time PCR. Nucleic acids research 30, e36-e36.

Pili, N. N., Kyndt, T., Gheysen, G., Janssen, T., Couvreur, M., Bert, W. & Mibey, R. (2016). First

report of Pratylenchus zeae on upland rice from Kwale County, Kenya. Plant Disease 100,

1022-1022.

Plowright, R. A., Coyne, D. L., Nash, P. & Jones, M. P. (1999). Resistance to the rice nematodes

Heterodera sacchari, Meloidogyne graminicola and M. incognita in Oryza glaberrima and

O. glaberrima x O. sativa interspecific hybrids. Nematology 1, 745-751.

Plowright, R. A., Matias, D., Aung, T. & Mew, T. (1990). The effect of Pratylenchus zeae on the

growth and yield of upland rice. Revue de Nematologie 13, 283-292.

Prasad, R. (2011). Aerobic rice systems. Advances in agronomy. Elsevier, pp. 207-247.

Prot, J.-C. & Rahman, M. (1994). Nematode ecology, economic importance, and management in

rice ecosystems in South and Southeast Asia. Rice pest science and management, 129-44.

Reichert, A. I., He, X.-Z. & Dixon, R. A. (2009). Phenylalanine ammonia-lyase (PAL) from

tobacco (Nicotiana tabacum): characterization of the four tobacco PAL genes and active

heterotetrameric enzymes. Biochemical Journal 424, 233-242.

Reversat, G., Boyer, J., Sannier, C. & Pando-Bahuon, A. (1999). Use of a mixture of sand and

water-absorbent synthetic polymer as substrate for the xenic culturing of plant-parasitic

nematodes in the laboratory. Nematology 1, 209-212.

Schneider, S. (1991). Penetration of susceptible and resistant tobacco cultivars by Meloidogyne

juveniles. Journal of Nematology 23, 225.

Seck, P. A., Diagne, A., Mohanty, S. & Wopereis, M. C. (2012). Crops that feed the world 7: rice.

Food Security 4, 7-24.

Seid, A., Fininsa, C., Mekete, T., Decraemer, W. & Wesemael, W. M. (2015). Tomato (Solanum

lycopersicum) and root-knot nematodes (Meloidogyne spp.)–a century-old battle.

Nematology 17, 995-1009.

Soriano, I. R., Schmit, V., Brar, D. S., Prot, J.-C. & Reversat, G. (1999). Resistance to rice root-

knot nematode Meloidogyne graminicola identified in Oryza longistaminata and O.

glaberrima. Nematology 1, 395-398.

Starr, J., Mc Donald, A. & Claudius-Cole, A. (2013). Nematode resistance in crops. Plant

nematology, 2nd edition. Wallingford, UK, CAB International, 411-436.

Talavera, M. (2001). Monitoring Pratylenchus thornei densities in SOCL and roots under resistant

(Triticum turgidum durum) and susceptible (Triticum aestivum) wheat cultivars.

Phytoparasitica 29, 29-35.

Thi Phan, N., De Waele, D., Lorieux, M., Xiong, L. & Bellafiore, S. (2017). A Hypersensitivity-

Like Response to Meloidogyne graminicola in rice (Oryza sativa L.). Phytopathology.

Thomason, I., Rich, J. & O'melia, F. C. (1976). Pathology and histopathology of Pratylenchus

scribneri infecting snap bean and lima bean. Journal of Nematology 8, 347.

Tonnessen, B. W., Manosalva, P., Lang, J. M., Baraoidan, M., Bordeos, A., Mauleon, R., Oard, J.,

Hulbert, S., Leung, H. & Leach, J. E. (2015). Rice phenylalanine ammonia-lyase gene

OsPAL4 is associated with broad spectrum disease resistance. Plant molecular biology 87,

273-286.

Trudgill, D. (1991). Resistance to and tolerance of plant parasitic nematodes in plants. Annual

Review of Phytopathology 29, 167-192.

Trudgill, D. (1995). An assessment of the relevance of thermal time relationships to nematology.

Fundamental and Applied Nematology 18, 407-417.

Vogt, T. (2010). Phenylpropanoid biosynthesis. Molecular plant 3, 2-20.

Weisshaar, B. & Jenkins, G. I. (1998). Phenylpropanoid biosynthesis and its regulation. Current

opinion in plant biology 1, 251-257.

Williamson, V. M. & Hussey, R. S. (1996). Nematode pathogenesis and resistance in plants. The

Plant Cell 8, 1735.