842-849 Nucleic Acids Research, 1994, Vol. 22, No. S

Alternative splicing of the guanine nucleotide-bindingregulatory protein Goa generates four distinct mRNAs

James J.Murtagh Jr*,+, Joel Moss and Martha VaughanLaboratory of Cellular Metabolism, National Heart, Lung, and Blood Institute, National Institutes ofHealth, Bethesda, MD 20892, USA

Received September 14, 1993; Revised and Accepted January 20, 1994

ABSTRACT

Go, a guanine nucleotide-binding (G) protein abundantin brain and other neural tissues, has been implicatedin ion channel regulation. Concerted efforts in severallaboratories have revealed multiple Go, mRNAs andprotein isoforms in different contexts. Go, is a singlecopy gene in mammalian species, although the struc-ture, number and tissue localization of Go, mRNAsreported by investigators are inconsistent. To definethe cell-specific expression of alternatively splicedvariants of Goa mRNA, we employed several strate-gies, including Northern hybridizations with sequence-specific oligonucleotides, selective digestions of GoamRNA using RNase H, and adaptations of the polymer-ase chain reaction. Four distinct alternatively splicedvariants were identified, a 5.7-kb Goa2 mRNA andthree Goa1 mRNAs with different 3' UTRs. The UTRsof the three Goa1s are composed of different combin-ations of what have been referred to as UTR-A andUTR-B. The sequences of the spliced segments are wellconserved among mammalian species, suggesting afunctional role for these alternatively spliced 3' UTRsin post-transcriptional and/or tissue-specific regulationof Go, expression. The position of the intron - exonsplice boundary at nucleotide 31 following T of the TGAstop codon is conserved in the Gia2 and Ga!3 genes,consistent with the notion that similar alternativesplicing of 3' UTRs occurs in products of these relatedgenes.

INTRODUCTION

Heterotrimeric guanine nucleotide-binding (G) proteins regulatemany cell functions by transducing signals from cell surfacereceptors to intracellular effectors (1,2). In mammalian cells, atleast 15 genes encode distinct G protein at subunits (3), and someG,a mRNAs undergo alternative splicing (4-10). Go, a proteinthat can regulate specific Ca++ channels (11,12), was originallypurified from bovine brain (13,14), and is found at high levelsin brain (0.5-1.0% of membrane protein), where it is

concentrated in neuropil and growth cones (15,16). Outside thebrain, G., expression appears restricted to neuroendocrine andmyocardial tissues (17,18). More than two isoforms of G, withdistinct immunologic and isoelectric properties have beendemonstrated in mammalian brain (19-26). Molecular cloningidentified cDNAs encoding two forms of Go, that are splicevariants. One of these, termed Goa2, is identical to the initiallyidentified Goal in the N-terminal 248 deduced amino acids. Thesequences diverge thereafter (6,8). There is a single GO, genethat spans 100 kb on chromosome 16 (9,10). Goal and 2 resultfrom alternative splicing of exons 7 and 8. Some specific proteinisoforms in mammalian tissues have been identifiedimmunologically or by amino acid sequence analysis as eitherGo1 or G.2 (22,24-26). In the majority of cases, however,such identification has not been made, and it is possible thatadditional splice variants of G. remain to be found. Theexpression of different Go. isoforms and of Go,, mRNA speciesvaries widely in a tissue-specific manner (6,8,13,22,27). Goaexpression changes during cellular differentiation (29-32) andorgan development (33,34), and under the influence of hormonesand drugs (34,35). Thus, it has been suggested that multiple formsof Go. may play a regulatory role in cellular differentiation.We and others have demonstrated that mRNA for Goal

undergoes additional alternative splicing in the 3' untranslatedregion (UTR), resulting in Goal UTRs -A and -B (5,7-10).Molecular probes specific for these UTRs hybridize to multipleG. mRNA species that are expressed in different amounts inbovine brain and retina (7,9). Even after the elucidation of theGoa gene structure, the molecular mechanism that generatesthese distinct Go1 mRNA species remained unclear. Reports inthe literature conflict on the presence and extent of G.1 UTRs-A and -B in different Goa RNA transcripts. We had observedin brain G. RNAs of 4.0, 3.0, and 2.3 kb; both 4.0 and 3.0kb species hybridized with UTR-A-specific probes and both 4.0and 2.3 kb bands hybridized with UTR-B specific probes (7).Another group reported the existence of only two G.1 mRNAspecies, a 4.0-kb mRNA that hybridized only to UTR-B and a3.0-kb mRNA that hybridized only with UTR-A (5). No RNAspecies in that report hybridized to both UTR-A and -B. An

*To whom correspondence should be addressed at: National Institutes of Health, Room 5N-307, Building 10, Bethesda, MD 20892, USA

+Present address: Aflanta VA Medical Center (151), 1670 Clairmont Rd, Decatur, GA 30033, USA

Nucleic Acids Research, 1994, Vol. 22, No. 5 843

additional mRNA of 5.7 kb corresponding to Go,,2 was seen.At variance with both reports (and with other evidence, as

reviewed in 7,12) was a series of Northern analyses showing a

single prominant band of Go., mRNA detected in many rattissues without the tissue-specific, neural predominance expectedof Go< expression (36). Although many cDNA clones for Goalhave been isolated from mammalian species including bovine,rat, hamster and human (6,8,36-39), all are apparently truncatedat the 3'-end, lack polyadenylation signals, and are too short toaccount for the size and diversity of Go,l messages seen onNorthern analysis. During elucidation of the human Goa, genestructure, UTR-B was not recognized, and it was suggested thatthis UTR might be present in a noncoding exon downstream ofthe reported sequence (10), at variance with a report from thislaboratory showing that the highly conserved UTR-B sequencedirectly follows the TGA stop codon in human, mouse and bovineGoa genes (9). The objective of the work described here was toobtain full-length cDNAs inclusive of Go,, 3'-UTRs, deduce themolecular pathways that produces multiple Goal mRNAs, andcorrelate these findings with the observed multiplicity of mRNAs.We report here cDNA sequences of the complete 3 '-UTRs of

Goal cDNAs that arise through tissue-specific alternativesplicing, and correspond to three Go,,l mRNAs of 2.3, 3.0, and4.0 kb distinct from the 5.7 kb Goa2.

These overlapping PCRs were used to map the nucleotidesegments in the Goal mRNA present in the bovine retina andto determine the sequence of additional linking segments.Poly(A)+ RNA from bovine retina was reverse transcribed(following treatment with DNase to remove contaminatinggenomic DNA) using AMV reverse transcriptase (BoehringerMannheim Biochemicals, Indianapolis, IN). After alkalinehydrolysis of RNA, phenol-extraction, and ethanol-precipitation,

A. Go5-speci f Ic ol igonuclootide detectIon probes:

Go-48 GAAGGGCTCCGTGTCTTCCATCCGACTCACCACGTCACACACCATCTTGo-30 GAGCTGCTCTCCGCCATGATGCGACTCTGGUTR-B TTTGTTATGCCTTTTTGGAATTTGTTTACCAACTTGCATTTGTTAGTG

B2 TGCTGTCCCAGGAAATTGATGAGCAATGGAATGGTGGTCAGTTCTGTCB3 TAAATTCTTGAAGTTAACAACCTCCGCCACJO GTGACGGCCCCTCCGCTCAGCTGCATGTGGJ AGCCTTACCCAGGCCCCCCTGGGAGGCCTCAGCCCAGGGACCTTGCCC

UTR-A AGGCTGTGTGTCTTAACAAAGGCCAAAAGGTCATGCTACCAGGAGATC

B. PCR primers used to amplify Goa segments

cl CTCCGGGGCTGCGGCTTGTACc2 CGACATCATCATTGCCAACAACb GATTCCAGCACTCACAGArb TCTGTGAGTGCTGGAATCal CAAAGAGTCCGTGAAGCAGTa2 ACAGCCGTCAGTCACTCTra ACTGCTTCACGGACTCTTTG

ra2 GTTGACGATCTCCTGGTAGC

ORF 313'-360ORF 367+-396

92+-139200'247573+-602701+-730790-8371020-1067

ORF 1042-'1062ORF 1020+1041

37-45437+-54

992+-101 11102' -1150992-10111013-+1032

MATERIALS AND METHODSMaterialsOligonucleotides were made by automated phosphoramaditechemistry on a 380B DNA synthesizer (Applied Biosystems,Foster City, CA) and desalted on Sephadex G-50 (Pharmacia,Piscataway, NJ). Some oligonucleotides were biotinylated at the5' terminus using a biotinylated phosphoramidite (Fig. 1, MidlandChemical Co., Midland, TX). Thermus aquaticus DNApolymerase (Taq polymerase), polymerase chain reaction (PCR)buffer and deoxynucleotides were purchased from Perkin-ElmerCetus (Norwalk, CT); nylon/plaque hybridization filters,[a&32P]ATP (6000 Ci/mmol), [adenylate-32P]nicotinamideadenine dinucleotide (30 Ci/mmol) and c[35S]-dATP (1000Ci/mmol) from New England Nuclear (Boston, MA); plasmidvector pGEM7 from Promega (Madison, WI); columns for phageand plasmid purification from Qiagen (Studio City, CA);Sequenase kits for DNA sequencing from United StatesBiochemicals (Cleveland, OH).

Polymerase chain reaction (PCR) mapping of Goa.l 3'endsUnless otherwise specified, the standard procedure for PCRamplification was 35 cycles of 95°C, 30 sec/55°C, 45 sec/72°C,1 min, followed by extension at 72°C for 7 min. PCRs were

carried out in 50 mM KCI/10 mM Tris-HCl, pH 8.3/1.5 mMMgCl2/0.01 % gelatin/deoxynucleotides, 200 ,uM of each/0. 1 %Tween, with amplification primers (each 20 pmol) and 1-2.5units of Taq polymerase (total volume 50 ktl). Magnesiumconcentrations were not varied. PCR was performed in a

Perkin-Elmer/Cetus TC1 thermal cycler. Samples of reactionmixtures were analyzed by electrophoresis in agarose gel (1.3%).

Reverse transcription (RT) PCR of bovine retinal poly(A)+RNA was used to define the extent of three alternatively splicedversions of G,l (Fig. 2, corresponding to the observed mRNAspecies of 4.0, 3.0, and 2.3 kb on Northern analysis). Fiveoverlapping sets of PCR were primed with pairs ofoligonucleotides related to known sequences of UTRs B and A.

C. PCR primers used In RACE and in amplification of X cDNA inserts

GT-F AGCAAGTTCAGCCTGGTTAAGGT-R CTTATGAGTATTTCTTCCAGGGTAXt3 CGACGGCCAGTCGACTCTAGTTTTTTTTTTTTXt4 CGACGGCCAGTCGACTCTAG

D. Oligonucleotides used to direct cleavage of Goa by ribonuclease H

R-probe z GTACAAGCCGCAGCCCCGR-probe b TGAGTGCTGGAATCATTR-probe a CAAAGAGTCCGTGAAGCAGT

ORF 1045+-106234+-50

992'-1011

Figure 1. Oligonucleotides used as primers and probes. Oligonucleotides (leftto right, 5' to 3') were synthesized on an Applied Biosystems (Foster City, CA)380B DNA synthesizer and desalted on G-50 Sephadex (Pharmacia, Piscataway,NJ). Positions of oligonucleotides derived from the Go., 3'-UTR are numberedfrom the 'T' of the TGA stop codon (Fig. 3); oligonucleotides complementaryto the Goaa coding region are marked 'ORF'. Positions of ORF oligonucleotidesare numbered from the 'A' of the 'ATG' codon (38). Direction of arrow indicateswhether oligonucleotide is sense (-) or antisense ( -). Primers GT-F and GFRare complementary to sequence immediately flanking the EcoRl insertion siteof Xgt 10 (identical to oligonucleotides 1231 and 1232, respectively, from NewEngland Biolabs, Beverly, MA).

TGA500 11 1

Coding B

c2 cl b

500 1000 1500 2000 nt

]1AAAAAAJ A

a l a2

PCR1 L vPCR 2 1.0kb (4 kb mRNA)

PCR 3 1.1 kb £ (4kb mRNA)~- 0.2 kb ,(3 kbmRNA)

PCR 4 (3 &4 kb mRNA) 1.1 kb AAAAPR 0.6kb i..AAAPCR 5 == AAAAAA(2.4 kb mRNA)

Figure 2. PCR mapping of Goal 3' ends. Diagram of five overlapping PCRsused to obtain segments of Go0l cDNA that participate in alternative splicingof the 3' UTR, as described in Results and Discussion. All cDNA segments were

analyzed by direct sequencing. Clones corresponding to the three altemativelyspliced versions of Goal were also obtained by screening of a bovine retinalcDNA library and by rapid amplification of cDNA ends (RACE).

844 Nucleic Acids Research, 1994, Vol. 22, No. S

cDNA was suspended in 100 11 of 10 mM Tris HCl, pH 7.8,before removal of samples (1-5 Al) for PCR.

After mapping was complete, sequence was confirmed withcDNA isolated from Xphage libraries by plaque hybridizationusing PCR generated selective probes and specific oligo-nucleotides (see below). Isolated clones were mapped directlyfrom individual phage plaques soaked in 10 mM Tris HCl, pH7.8 (100 Al) for 3 h. Primers for lambda-PCR usually includedone of the oligonucleotides flanking the XgtlO cDNA insertionsite (sequences identical to oligonucleotides 1231 and 1232, NewEngland Biolabs, Beverly, MA), paired with the GO,-specificprimer CI, to amplify the specific portion of the Go, 3'-UTRpresent in the clone. DNA obtained by PCR was sequenceddirectly using the affinity-strand separation method of Mitchelland Merril (40) and Uhl6n and coworkers (41).To obtain cDNA ends distal to known Go. I sequence (as in

PCR 5, Fig. 2), a modification of the rapid amplification ofcDNA end protocol (RACE-PCR, ref. 42) was used. Becausewe and others have found that RACE-PCR procedures often resultin a large amount of nonspecific amplification, we designed aprocedure to include, after 20 cycles of PCR, affinity-enrichmentof the desired product, followed by an additional 40 cycles ofPCR, similar to the procedure described by Rosenthal and Jones(43). The procedure thus employs a total of 60 PCR cycles, andis here referred to as biotin-enhanced-RACE (BE-RACE).Poly(A)+ RNA (0.5 /tg) was reverse transcribed from the Xt3adaptor-primer (Fig. 1). After alkaline hydrolysis of RNA,phenol-extraction, and ethanol-precipitation, single-strandedcDNA was suspended in 100l, of 10 mM Tris HCI, pH 7.8.Samples (0.5 -5.0 p1) ofcDNA were amplified with an upstreambiotinylated oligonucleotide from a known portion of the targetmRNA, and an adaptor oligonucleotide (the Xt4 adaptor,sequence identical to XT3, but lacking the 12-T tail used toprime reverse transcription) corresponding to sequence linkedto the poly(A)+ tail of all cellular cDNAs generated duringreverse transcription. After 20 cycles, PCR fragments thatcontained the biotinylated oligonucleotide (i.e., the definedsequence primer specific to the target) were bound to M-280streptavidin-coated magnetic beads. Amplification of the bead-bound DNA using a nested, nonbiotinylated sequence-specificoligonucleotide and a biotinylated version of the XT4 adaptor in40 cycles of PCR produced a single band of homogeneous DNAthat was directly sequenced by binding the XT4 end of the PCR-generated cDNA to streptavidin M-280 beads, and sequencingfrom the defined end of the PCR-generated DNA, as describedabove.

Isolation of Go, clonesSeveral bovine cDNA libraries in Xgt 10 were screened for GO,,using UTR sequence-specific oligonucleotides labeled to highspecific activity with [a-32P]dATP terminal deoxynucleotidetransferase (Bethesda Research Laboratories), with buffer andreaction conditions suggested by the manufacturer, as previouslydescribed (9,44). The first library of bovine retinal cDNA wasgenerously provided by Dr Jeremy Nathans (Johns HopkinsUniversity School of Medicine). A second bovine retinal cDNAlibrary was prepared by Promega using poly(A)+ mRNAisolated in this laboratory. Bovine heart and brain libraries fromClontech laboratories (Palo Alto, CA) were also screened.Replicate plaque lifts were prehybridized for 6-16 h at 42°Cin 20% formamide/5 xSSC (I x = 0.67 M NaCl, 0.67 M sodium

polyvinylpyrrolidone, 0.02% bovine serum albumin)/0.5 %SDS/10% dextran sulphate with salmon sperm DNA, 0.1 ,ug/I,l,then hybridized at 42°C for 16 h in fresh hybridization solution.Filters were washed at 60°C once in 2 x SSC/0.5 % SDS, andtwice with 0.5 x SSC/0.5 % SDS, and exposed to Kodak XARfilm overnight at -70°C with intensifier screen. cDNA insertsfrom plaque-purified clones were subjected to PCR amplificationand sequencing as described above.

Northern blot analysisTotal RNA was purified by sedimentation through 5.7 M CsCl(45) after solubilization of the bovine tissues in guanidiumthiocyanate. The poly(A)+ fraction was isolated by oligo(dT)-cellulose chromatography, subjected to electrophoresis in 1%agarose/2.2 M formaldehyde gel, and transferred to nylon filters,which were baked at 80°C for 2 h, then prehybridized andhybridized as described for the plaque hybridizations. Filters werestripped with two washes in 0.1 x SSC/0.5 % SDS at 100°C andchecked for residual radioactivity by autoradiography before reuse(46).

RNase H mapping assay

Bovine retina poly(A)+ RNA (10 isg) was annealed to 200 ngof specified oligonucleotide in 50 mM Tris -Cl-, pH 8.0/0.15mM NaCl/10 mM MgCl2, with 25 mM ribonuclease -vanadylcomplexes (Bethesda Research Laboratories, Bethesda, MD) at0°C for 5 min (total volume = 5.0 p41). After addition of 3.1units of RNase H in 6.25 Al of2 mM dithiothreitol, and incubationat 37°C for 30 min as described by Berger (47), reactions wereterminated by the addition of EDTA to 10 mM. Samples ofdigested RNA were size-fractionated in 1.2% agarose/form-aldehyde and transferred to nylon as described above for Northernanalysis.

DNA sequence analysisDNA sequences were analyzed using the Microgenie personalcomputing program (Beckman, Columbia, MD) with ktup= andgap penalties=10.

RESULTS AND DISCUSSION

Four separate screenings of bovine retinal, brain, and heart Xgt10 cDNA libraries yielded 216 clones from a total of 4.7 millionplaques. A proportional number from each screen were plaque-purified for further evaluation. Of the 45 selected clones, threehybridized to UTR-A-specific probes, and 42 to UTR-B-specificprobes. The cDNA inserts of these clones were mapped usinga combination of PCR and limited sequencing. The 3' UTRs ofthe clones ranged between 50 and 900 nucleotides (nt). As no

polyadenylation signals or tracts of poly(A) were found, theclones were presumed to be truncated.

After plaque hybridization screening of multiple cDNAlibraries failed to yield the desired full-length Go,,I untranslatedregions, we turned to PCR mapping. Five overlapping PCRswere done on bovine retinal mRNA that had been DNase treated.The first two PCRs tested whether any Go,,1 mRNA containedboth UTR-B and UTR-A and two tested whether UTR-A was

upstream or downstream of UTR-B in such an mRNA. In PCR1, a sense oligonucleotide from UTR-A failed to primeamplification when paired with an antisense primer from UTR-B (primers ra and rb) indicating that UTR-A does not lie upstream

citrate)/l0XDenhardt's solution (lx= 0.02% Ficoll, 0.02% of -B in any G.,,,. mRNA used as RT-PCR template. In PCR

Nucleic Acids Research, 1994, Vol. 22, No. 5 845

GOa 3 -UTR (Bovine)GOa 3 -UTR (Huan) I

TCAC7CAT7it4A AGCAACCTATTTGTGACCtTTJTCC7rvTATAGCJACCTAT -T----TG:---C*..............................,g,_....... * *.**_ . ...

6161

116121

172181

231241

TGCACAC ATACACACACACCCCAcTcc CA AATGCGTGCACC ACTAACCMGrAA

CAN=CCMAAAGAGGCATAAC A rATATATATATACAAATATATTMTAAAC _ C TA A A M A T

TTTTTAGTCTGTACTAGAAGAGCTTCAGACAGAACTGACCACCATT CTCATCCTTTTTAGTTTGTACTAGAAAGAGCTGCAACAGACTGACCATCCCATAGMCTCATG

AA TTTCCTGGGACAGCACCTGAQCGTGCGCTTACGCGCGTACACACACATAGACACGGTGA AGCATGCACGTTGTTGTACACAC ACTCACA

288 CACTGCGATACAAGTCCT GATTTGGGAGTCCGTCCTTTrAAAAACAGCCACAT0CTTTC299 CATGTCCAGACGGGAGCT GGTACCTCCITG AGGATAGCCCCGGGGTGTT

347 ACGCTCTGAGACCCACCC rG359 CCTCTCTGA TCCCA ATTCTGAGAGCAGGGGAATGGC AGAACAGOOCTGGCCTTG

407 GTCCAGCCTTTTCTCTG CTTCCACCTCAGGCTGTGTGC TTTOGTrCTGTcCTGCA413 GCCCAGCCAGCTCTCTGTGCC==cCrGCT

Bi466 CTTGTGTGAAZCAAAACTGT=TTTTTTAAAAATGCCCCGCCCCCAAATGTCTCCCTG473 CTTG GCAAATTCCAGACC CTTTCAGAAATGGCCGAGCCCTAAGCCTCTCCTCA

526 CCCCATACTTGCAACAAGAGAA MCTTTAGGATGCTTCTCTSTTT GGG527 CTCTGCAC TCCCAAAAACAGAACAATTTAGGATGCTTCTCTTTIICG GGT

584 TGTTAACTTCAA.GMAGAAGAATC ATTGCTCCGACAAATCCACTGTCTCCTGAGTT586 TGTTAATTTCAGGAATTTAGAGAATCGATTGCTCCGACCAATCCACTGTCTCCTGAGTT

643 TTCrTAATTTAATT CTCCC646 TTCTTT ATTCATGTTAAGTGGCAAGT_TCAGAGAACAGGGAGACTTGGTCTGCTFTCT

703705

736765

ACATGCAGCTGAGCGGAGGGG CCGTCA CAGCACAAAAGCAGCTGCCGGCAGAGCTGAACCGCAGCGAC CTCC

AG GGTCA CCTGCA GAGCTGA AGCCGCTCCTCAGGCTCCCCCTCCAAGAGGGCATGTGGGAAGGCGGGGAGCGAGGGGAACAGGCGCCIA AC

780 AAGAGGG CT GGGGCAAGGTC CCTGGGCTG AGGCCTCCCAGCGGCCTG825 TTGTGGGCCTGACCCGATCAGGGTCT AG A CCAGGCC GG

829 GGTAAGGCTTC CTTGGTTCTGGATCCCCC CCTGCCTCCATUT885 GGATGGGCTTTCAATGGGTTCCTGACCCTCGTGC TGCTGCCCCAT CTCGCCAAC

888 CCCACGTCATTAAACACGATGGAGCGTTTTCGGTCGGTTGGTTOGT?TZCTAAAT942 CCAGCAGTAGTCAAATGTTCTAGGGTTTT TTGGTTGGTTGGTTrGT TITIAAT

948 CAAGGAAAATGGTCG CT CTGTCTCTC AC C997 CACAGAA TI AGRTTCGR I**************************** ********r ****1008 TTTGCTGTTGAC GATCTCCACT TTGTTGACACACAG1057 TTTGCTGTTGACGTTGATCTCCTGGTAGCATGACCTTTGGCClTTG TAAGACACACG

G0a 3 -UTR (Blovine)Ga 3'-UTR (Humn)

1065 rTC CGA CCAGAGTGACTGACGGCTGGTAC1116 CCTCTGTATCAAG ICCTGTACCCTACGACCCAGAGTGACTGACGGCTGTGTAT

D41124 TTCTCTAGAATGCTATAGAAT TTTCTACA?A 0MG1175 TTCTGTAGAATGCTGTAGAATCCGGTnTAG TTGAGTCTCACATAGAATTTG

************* ** **** *******

1178 GA AGAACTTTCTCACATOCTTTCTAGTGTTAAAMA AAAAAAAGAGGATAAA1234 GCTCTTAACTARAGACCATCA

** *********** **** * ****** **** * **

12321294

rlYRrTlTRTt-s-STCTTh^~~ACGGC TGCACAAAcTAICATCCCCA,IWCTGCCCCGTCC

**** * * * *

1290 AGCCTCGC CCA CCCC ACCCACCTGC AGGG TGCCIGCCTTCCACAC1354 CACCT_CC

***** * ************* *

13361414

13811474

14251534

14851594

CCTG GGCTGCCGGGTGTGTGCTCAGGC TGCTTC CCAG

TGC AGCCT CC ACG CC ACAGCAC CCCGCTGCT CAG0CCCGAGCCTGCAACCCTGCTGCTG0CCGCCGCCAGACACCACAGACGCCACTGGCGGCCCTAAGCC** ** *******************

_CCGAACCATGOTIGACAGTAGAAGCTTATGGcCAG

*********** ********************

AGCCGCCCCAM0GATACAGAACATATACATAACTAGAG CCAGTAGAAAACAGTTTTCAGCTG CCAAAAAGAACACCCATcGTATAAGGAAATCCAQCCCCATAGAAAACAATCTGC

1544 CCTACTCCTTCCTACAGAGTCCTTTATTATTTTTATTTTAGTTGTTCTAGGTTTTGGT1653 CCACCGACCCCTTTCTA AGGATAGCCTTTA GTOTrrrGT TCCTwwMrTT

1604 TTrTTT GCTGATGAGCACTACOCATTAACACCAGATCAGCTTTCGTAGTCXTTIGG1710 TTrrLCAGTTTG TG TT??ACTTTTGTCCCGCC GAGTA CTAT CTA T TACCAGC

1664 AC-I_ CII CTACCGTTCCTCTCTCG TOCTCT1763 CCCCACCCACATCAGTTTCCT AGTC TT=nGGG=AAAGGTTGT G TTTTrTTTCC

** ** ******* ****** ***

17241818

GTGTGrTGTGTI GCGTGCGGTGTCTGTC0= CCACCCCTTTTGCCGTCT TGGTTTVCACACCC0GG

**** * *** ***

1784 _CTC ACTCTGGG GG GT1876 CCACCCTG:TGTG TTCT C0CTGCC TCTCATGTGTGTTTGT

Es1843 GCTGCAGATAAAAA MC AAAMTTAATACATACACMGAATT19327CC CA********.***********************

1899 AAAAM U=MGCACAA CTCTGATCAG1992 MAM TGTAGTCTTT ACATTAAAGCG CTrTCATGACCM

19562051 TCC-------I------t-- AA C T CCTT

2015 TTMAGC AR A_ACCCACT GAGACA2111 SCMCG C CCA_C

***** * *********.**-************ ***** *****

2070 CAC2171 A A

Figure 3. Alignment of Goal 3'-UTR cDNA from bovine retina (above) and corresponding sequence of the Go. human gene (below). Numbering is from the firstbase of the termination codon. Bovine sequence is a composite of cDNA sequence obtained from PCR and from cDNA clones isolated from bovine retinal cDNAlibrary in Xgtl9 (Fig. 2). Human sequence is from Murtagh et al. (9) (nucleotides 1-1041), and Tsukamoto et al. (10). The initial 1102 bases of bovine cDNAsequence reported here match the bovine gene (9). Identity of human and bovine sequences is indicated with an asterisk. The first 31 nucleotides, which are identicalin all GO.1 clones from all mammalian species, are italicized. Immediately following is a conserved intron-exon boundary (marked 1 ). A second splice boundaryat bovine nucleotide 991 is also marked ( ' ). Positions of ends of truncated Go. cDNA clones are shown with Al for the end of XG03. 1, BI for XG03.07 and3.01, Cl for XGO3.x, 3.0, and 3.8, Dl for XGO9, and El for XGO-J4, the cDNA clone closest to full-length reflection of the 4-kb Go, transcript. The overlinearrow indicates the 624 bases defined in PCR 5 to mark the extent of the 2.3-kb transcript that contains only UTR-B. A polyadenylation consensus hexamer wasnot found in the UTR-B sequence. Although the consensus hexamer is usually present in eukaryotic transcripts, several examples ofmRNAs that lack clear polyadenylationsignals have been described (48,49). In the UTR-A mRNA, nucleotides 32-991 are spliced out; a putative polyadenylation signal at nucleotide 2058 is boxed.

2, however, using primers in the same positions but in opposite identical to cDNA clones for GO,1 containing UTR-A (XG09,orientation (primers b and a2), a 11 13-bp cDNA was produced, ref. 7,9, and 38). Direct sequencing of the > 1-kb cDNAs fromconfirming that UTR-B indeed lies upstream of A in the 4-kb PCR 2 and 3 demonstrated that these cDNAs contained bothmRNA that contains both UTR-A and UTR-B. UTR-A and UTR-B along with sequences not previously reported

In PCR 3, an upstream primer cl, derived from the Go ORF in bovine cDNA, referred to as region J (for junctional). The(just before the TGA stop codon), was paired with the UTR-A entire sequence extending from the coding region through UTR-specific downstream primer a2. Two pieces of amplified cDNA B, J and UTR-A is identical to corresponding sequence in thewere produced (1171 and 181 bp) consistent with alternative bovine gene (9). PCRs 4 and 5 yielded the distal portions of UTR-splicing. Direct sequencing of the 181 bp cDNA yielded sequence A and UTR-B to their poly(A)+ tails using BE-RACE-PCR

l

846 Nucleic Acids Research, 1994, Vol. 22, No. S

118 42 142 161 129 130_ 159 154 191 a 624 367. 1091

Exonsi 2 3 4 5 6 \/7 8a 7 8/

-_3G__ 2 3'Goal

Figure 4. Splice patterns that generate G., mRNAs. Open boxes: exons of 5'and 3' UTRs; closed numbered boxes: exons of coding regions; interrupted thinlines: introns separating coding exons. The diagram combines the assembly patterndeduced by Tsukamoto et al. (10) for exons encoding Goa,l and GO02 proteinswith the pattern described here for generation of three distinct G.,,,1 mRNAs byalternative splicing of the 3'-UTR (Figs. 2-4). The 5.6-kb transcript from Go002is assembled from exons 1-6, 7*, and 8*. The extent of the Go002 3'-UTR(s)has not been defined and may include a long 9* exon (not shown). The threeGo,,, transcripts are assembled from exons 1-8 with variable addition of 3' UTRsegments. The longest 4.0-kb Go,l transcript contains the entire 3' end, includingUTR-B, J and UTR-A, for a total of 2091 nt of 3' UTR (plus polyadenylatetail, which in average eukaryotic transcripts ranges from 50-200 nt). In the 3.0-kbtranscript, UTR-B and J sequences (32-991 nt) are spliced out, leaving 1122nt of UTR-A (plus polyadenylate tail). In the 2.3-kb Go,,, transcript only the 624nt of UTR-B are present.

AORF UTR-B J UTR-A

GOc2->* -5.6- 56 -5.6-

-40- -4.0- -4.0-

GO(Xl- -3t20-_3ofl3n0

Probe: G48 G30

G48 G-30 B Br., zZ, 7',, ,S.x oI- !,- - f]F----

ORF UTR-B( r() ,j 4 mR114N .A

B B2 B3 Jo J A

.'AII

l,AJ UTR-A

BG-48 UTR-B UTR-A

(described in Methods). Direct sequencing of the product of PCR4 revealed that UTR-A ends in a poly(A)+ tail at a positioncorresponding to one of the polyadenylation signals found in thegene. In PCR 5, a similar BE-RACE procedure defined the 624nt of UTR-B to a poly(A)+ tail using primers b and XT4.The bovine retinal Go. 1 cDNA obtained in PCRs 1-5 were

compared to the human Go< gene (Fig. 3). In intial reports,correlation of Go, cDNA with gene structure was difficultbecause the 3' UTR was only partially reported in the descriptionof the human gene (in the initial report, nucleotides 31-991 wereincorrectly assumed to serve only as an intron, and were onlypartly sequenced, ref. 10). A later report provided the missingsequence (9), allowing the composite of the Go,,1 humansequence shown.Comparison of the bovine Go,,1 cDNA obtained by PCR to

other mammalian clones previously obtained, and to the humangene reveals the precise segments of Gol involved inalternative splicing. In the longest Goa1 cDNA (correspondingto the 4 kb mRNA by Northern analysis), UTR-B wasimmediately adjacent to the TGA stop codon, followed by a364-nt junctional region of UTR not previously found in a Go.cDNA clone (J region), followed by 1.1 kb of UTR-A and atract of polyadenylation (total 3' UTR in this transcript = 2091nt). The 3.0-kb Go,l mRNA contained the 1.1 kb of UTR-A,but did not contain UTR-B or J, which were spliced out. Potentialexon/intron donor and acceptor splice sites were found atpositions 31 (position 1 = T of the stop codon) and 990 in thelargest cDNAs, corresponding to identical positions in the highlyconserved 1-kb gene segments. The smallest mRNA contained624 bases of UTR-B, followed by a poly(A)+ tract. Sequencesof these regions of Go,,I mRNA UTRs are shown (Fig. 3) anda schematic of alternative splicing (Fig. 4).We confirmed the sequence obtained through PCR in additional

cloning experiments. A 48-base probe complementary to uniquesequence of the J region (probe J) was used to rescreen the bovineretinal cDNA library, yielding a cDNA clone (XGO-J4) with anearly full-length 3' UTR (Fig. 5, sequence extending the full-length from nt 1 until nt 1816, indicated by El on the figure).The new clone XGO-J4 contained 917 nucleotides of the GO,,1coding region, followed by UTR-B, region J, and a UTR-A thatwas truncated 175 nt prior to the polyadenylation signal (total

Il..:. .4 f :.....

k-

R H P A

-5.6

-4.0

-3-0

:-2.3.

R H P A

-5.6-

^ 4.0- ^ -1' -3.0- 12..3.

R H P A

Figure 5. Selective oligonucleotide hybridizations of bovine Goal mRNA. A.Hybridization to defined segments of Go, present in species of bovine retinamRNA. Diagram below depicts location of the individual synthetic oligonucleotideprobes on Go, 4.0 mRNA. Poly(A)+ RNA from bovine retina (10 14g/lane) wasseparated by electrophoresis, transferred to nylon, then hybridized with Goaprobes. Probes G-48 and G-30 (complementary to coding sequence found in bothGo.1 and Go02) detected four bands of mRNA of 5.6, 4.0, 3.6, and 2.3 kb.Previous studies demonstrated that the 5.6-kb band represents GO.2 (5,50); thisband does not hybridize with Go,l selective probes, demonstrating that only the4.0, 3.0, and 2.3 kb mRNAs are Goal. Sequential hybridization of blots withprobes selective for regions of Goal 3' UTRs demonstrated that the 4.0-kb Gol1mRNA contains sequences of UTR-B, -A, and the J region, the 3.0-kb mRNAcontains UTR-A, and the 2.3-kb mRNA only UTR-B. Further, the end of UTR-B in the 2.3-kb mRNA occurs between the sequence of probe B3 and JO. B. Asin A., poly(A)+ RNA (10 pg/lane) from bovine retina (R), heart (H), pituitary(P), and adrenal (A) was separated by electrophoresis, transferred to nylon, andhybridized with a Go. ORF probe (G-48), a UTR-B selective probe (probe B)or a UTR-A selective probe (probe A). Locations of probes in Go. mRNA aredepicted in A. The large spot in lane R of panel UTR-A is presumed to be anartifact, as it is not centered in an electrophoresis lane and was not seen on otherhybridizations of G(, specific probes to retinal mRNA. Positions of RNAstandards (nucleotides x l0-) are shown between blots. Arrows indicate bandshybridizing with Go, probe.

3' UTR in this clone = 1816 nt). Sequence of this 3' UTR wasidentical to that obtained through the overlapping PCRs.

Northern blot hybridizations confirmed the presence of specificUTR sequences in distinct Go, mRNAs (Fig. 5). Oligo-nucleotides complementary to UTR-A, UTR-B or region J werehybridized with poly(A)+ RNA from bovine retina. The longest5.7-kb Go represents Go,X2 (5, 50). Three mRNAs, of 4.0, 3.0,

\

Nucleic Acids Research, 1994, Vol. 22, No. 5 847

G-j

Goal-- e"

.S

R-probe - Z

Rnase H - +

Goca

GM

Figure 6.cleavage ofretinal poll

oligonucleotregion (R-pias describeheteroduplesegments ofand native F

and hybridL(G-48) and fare shown btreated withRNA not clGoa I codinlat point a, cat points a a

and away frthese pointsof poly(A)+Blots were j

signal fromintense. Na'each lane, tlto direct RNlane ab prerwhen hybricpositions of3.0-, and 2.probes B, J

and 2.3 kspecific c

mRNAs,and 2.3-khybridize4.0-kb spiwith prcdownstre;is at theSelectiveof Go. nilRNA, altretina (Fi

SpecifiGon, tran

-48 UTR-B J UTR-A alternative splicing pattern, and a direct measurement of the lengthI-4.0-':-4.0 -4.0- of different 3' UTR segments (Fig. 6). Specific oligonucleotide_-353)0 " " " probes were hybridized to the 3' end of the coding region (R-23 t I ^ w ^ probez, complementary to the last 18 bases of the ORF), to the-2.3 y 2.3 -" '¢tstart of UTR-B (R-probe b, complementary to bases 34-50 of

W1.7 *17 w " 17 the Go, 3' UTR), or to the start of UTR-A (R-probe a,10 910 w 3 complementary to bases 992-1011 of the Go, 3' UTR). After-t.0-1F*-1.t.0- hybridization, the oligonucleotide-RNA complexes were cleaved

-0.6- * * -06- -0.6- by ribonuclease H, separating transcript segments on the two sidesof the R-probes. Products of the digestion were separated by

a ab - Z a ab - Z a ab - Z a ab electrophoresis, then hybridized on Northern blots with specific++ + + + + -

+ + +

48-base probes. A coding region probe (G-48) detected a singleCoding B J Aclaaeb -'"'CodingB1 A band of - 1.7 kb after cleavage directed by R-probe Z,

4.0 A AAAAAA confirming that there is a single R-probe Z G0(j coding regionCoding 2 b A and that differences in the three native GO mRNAs result from

3-0 = i - IAAAAAAAAdifferences in 3' UTRs. Cleavage directed by R-probe a resultedCoding a a in two bands of - 2.4 and 1.7-kb detected by the coding region

2.3 4d1t-- AAAAAAAA probe. However, when R-probes a and b were usedz b simultaneously to direct cleavage, a single coding region was

again detected, showing that sequences of both a and b are 3'Northem blot analysis of the products of oligonucleotide-directed to the ORF in each of the three G0.1 transcripts. SequentialG0o1 splice variants by ribonuclease H (RNase H mapping). Bovine probings of these digests determined that the distances from Zy(A)+ mRNA (10 jig) was hybridized to 18-base synthetic to the ends of the three Go., transcripts are -2.2 kb (bandtides (100 ng) derived from the common Goal C-terminal coding detected by UTR-A, -B, and J), 1.2 kb (band detected by UTR-robe z), from UTR-A (R-probe a), and/or from UTR-B (R-probe b) and -0.6 kb (band detected by UTR-B). These valuesA by Berger (47). After hybridization, oligonucleotide-RNA A),c are well to the letecte 3y UTRs found byluesxes were cleaved in the hybridized segment by RNase H, leaving intact compare well to the lengths of the 3' UTRs found by PCR,RNA flanking the oligonucleotide. Products of the RNase H digests mapping and cloning (2091, 1091, and 624 nt, respectively).INA species were separated by electrophoresis, transferred to nylon, Although alternative splicing of protein-coding exons generateszed with specific 48-base oligonucleotide probes (for coding region isoforms of several G (and other) proteins, alternative splicingFor UTR-A , -B, and J) as described in Fig. 5. Positions of size markersetween blots (basesx l0-3). Each blot has four lanes containing RNA of 3' UTRs has been thought to be rare and has not been reportedor without ribonuclease H and indicated R-probe). lane-: native for other Ga mRNAs. It is notable, however, that the two G

leaved by RNase H, 2.) lane z: RNA cleaved at point z, separating proteins most similar to Go, Gin2, and Gi3, have potentialg region from the three distinct 3' UTRs, 3.) lane a: RNA cleaved exon-intron splice sites that correspond to nucleotide 31 in Gon,leaving UTR-A from coding region, and 4.) lane ab: RNA cleavedmd b simultaneously, to separate segments of UTR-A from UTR-B (52). Furthermore, i clones of mammalian G2 cD^om the Go. coding region, to permit estimation of distance between different 3' UTRs that diverge at the nucleotide 26 potential splice. [Length of RNA segments is influenced, of course, by the length site have been observed (53). Given the other striking similaritiestail. In eukaryotes, poly A' tails range between 50 and 200 nt (51)]. of Gin, and G. gene structure [e.g., positions of eightrepeatedly washed and rehybridized, as described in Methods. The intron-exon boundaries are virtually identical (62)] it appearsthe last hybridization (with 48-base oligonucleotide G-48), was least ntro -exon boundaie aRev ay idential(2] itap rtive Goal species undigested by RNase H is shown at left. Below that alternative splicing of UTRs may serve regulatory functionhe presence or absence of RNase H and the specific R-probe(s) used for several members of this highly conserved Gn, gene family.lase digestions is indicated. A doublet band visible in panel UTR-A, Sequences in 3' UTRs critically influence post-transcriptionalsumably reflects partial or anomalous digestion of the Go. 3' UTR regulation of mRNAs during cell growth, differentiation, andlized to both R-probe a and R-probe b. Diagrams below blots indicate response to environment stimuli -

RNase-directing nucleotides (R-probes z, b, and a) on the Go,l 4.0-, ispone tonen reeptor RNA t

(54-57).An prominent example3-kb mRNA and the 48-base detection oligonucleotides (UTR-specific iS the transferrin receptor RNA transcript, which is tightly1, and A). regulated by the interaction of a 3'stem-loop structure (the iron

response element, IRE) with a regulatory IRE-binding proteinb, hybridized with G.l1-specific probes. The UTR-A- (54,59,60). Other highly conserved AU-rich elements containing)ligonucleotides hybridized with the 4.0- and 3.0-kb the pentanucleotide AUUUA regulate degradation orand UTR-B specific probes hybridized with the 4.0- accumulation of mRNA for oncogenes products, lymphokines,cb mRNAs. Probes complementary to the J sequence and cytokines such as GM-CSF, interferon y, and interleukin-3d, as expected from the splicing model, to only the (54,57,58). When such an element, e.g., that from GM-CSF,tecies. Sequential hybridization of these Northern blots is inserted into an otherwise stable mRNA for hemoglobin, theibes derived from sequence either upstream or chimeric message is rapidly degraded (54). Conversely, removalam of base 624 were used to confirm that this position of an AU-rich segment from c-fos results in increased messageend of the 2.3-kb mRNA, as predicted by PCR 5. stability and protein accumulation, and can lead to cellularoligonucleotide probes identified each of the species neoplastic formation (61,62). Cytosolic factors, such asRNA in bovine heart, pituitary, and adrenal poly(A)+ adenosine-uridine binding factors (AUBFs) have been identifiedthough in far lower abundance than was observed in that bind to AUUUA motifs in GM-CSF, interferon 'y,ig. SB). interleukin-c, c-fos, and c-myc mRNA protecting it fromc oligonucleotide-directed ribonuclease H cleavage of degradation (57). A variety of substances including phorbolsiscripts provided additional confirmation of the esters, calcium ionophores, and mitogenic antibodies, can

848 Nucleic Acids Research, 1994, Vol. 22, No. 5

accelerate this binding, enhancing message stability and proteinaccumulation.Goa is the G protein expressed in greatest abundance and with

greatest specificity in neural tissue. Go, has 3' UTRs that aresubstantially larger than those of other G proteins, and containAU-rich regions that have been highly conserved over millionsof years of species divergence. The splicing pattern is cell-typespecific. We have shown that the 2.0-kb Go,al mRNA isrelatively more abundant in retina than brain (7). Others haveshown that the 5.6-kb Go,2 mRNA is more abundant inendocrine-derived cell lines, such as the hamster insulin-secretingtumor line (HIT) (6). As examination of the Goa gene has notrevealed sequences with characteristics of a strong neural-specificpromoter, it can be expected that tissue-specific G,. expressionwill be found to depend on 3' elements. Indeed, four repeats ofthe AUUUA pentamer are found in the human Goa 3' UTR, andtwo repeats in the bovine homologue along with many stem-loopstructures. Alternative splicing would be expected to increaseGo,, message stability in some cell types by removing these AU-rich stem-loop sequences.

ACKNOWLEDGEMENTSWe thank Dr Richard Case of the Midland Certified ReagentCompany (Midland, TX) for providing an early sample of thebiotinylated phosphoramidite used to prepare oligonucleotides,and Dr Anne LeMoine and Ms Carol Kosh for expert assistancewith manuscript preparation.

ABBREVIATIONS

G-protein, guanine nucleotide-binding protein heterotrimerconsisting of a, f, and oy subunits; Gsand Gi, stimulatory andinhibitory G proteins coupled to adenylyl cyclase, respectively;Gsa, a subunit of Gs; Gia, a subunit of G1; Go, G protein,abundant in brain, which may regulate ion flux; Goal, initiallydescribed by Van Meurs et al. (38); Goa2, variant Go, cDNAreported by Hsu et al. (6) and Strathmann et al. (8); nt,nucleotide(s); PCR, polymerase chain reaction; RT-PCR, reversetranscription PCR; SDS, sodium dodecyl sulfate; BE-RACE,biotin-enhanced rapid amplification of cDNA ends.

REFERENCES1. Birnbaumer, L. (1990) Faseb J., 4, 3178-3188.2. Casey, P. J. and Gilman, A. G. (1988) J. Biol. Chem., 263, 2577-2580.3. Simon, M. I., Strathman, M. P., and Gautam, N. (1991) Science, 252,

802-808.4. Kozasa, T., Itoh, H., Tsukamoto, T., and Kaziro, Y. (1988) Proc. Natl.

Acad. Sci. USA, 85, 2081-2085.5. Bertrand, P., Sanford, J., Rudolph, U., Codina, J., and Birnbaumer, L.

(1990) J. Bio. Chem., 265, 18576-18580.6. Hsu, W. H., Rudolph, U., Sanford, J., Bertrand, P., Olate, J., Nelson, C.,

Moss, L. G., Boyd, A. E., Codina, J., and Birnbaumer, L. (1990) J. Biol.Chem., 265, 11220-11226.

7. Price, S. R., Murtagh, J. J., Jr., Tsuchiya, M., Serventi, I. M., Van Meurs,K. P., Angus, C. W., Moss, J., and Vaughan, M. (1990) Biochemistry,29, 5069-5076.

8. Stradtmann, M., Wilkie, T. M., and Simon, M. I. (1990) Proc. Natl. Acad.Sci. USA, 87, 6477-6481.

9. Murtagh, J. J. Jr., Eddy, R., Shows, T. B., Moss, J., and Vaughan, M.(1991) Mol. Cell. Biol., 11, 1146-1155.

10. Tsukamoto, T., Toyama, R., Itoh, H., Kozasa, T., Matsuoka, M., andKaziro, Y. (1991) Proc. Natl. Acad. Sci. USA, 88, 2974-2978.

11. Hoscheler, J., Rosenthal, W., Frautwein, W., and Schultz, G. (1987)Nature(London), 325, 445-447.

12. Serventi, I. M., Price, S. R., Murtagh, J. J., Jr. and Moss, J. (1990) In(Moss, J. and Vaughan, M. eds), ADP-ribosylating toxins and G proteins:Insights into Signal Transduction, American Society of Microbiology,Washington, DC, pp. 325-348.

13. Neer, E. J., Lok, J. M., and Wolf, L. G. (1984) J. Biol. Chem., 259,14222-14229.

14. Stemweis, P. C. and Robishaw, J. D. (1984) J. Biol. Chem., 259,13806-13813.

15. Brabet, P., Dumuis, A. Sebben, M., Pantaloni, C., Bockaert, J., andHomburger, V. (1988) J. Neurosci., 8, 701-708.

16. Strittmatter, S. M., Valenzuela, D., Kennedy, T. E., Neer, E. J., andFishman, M. C. (1990) Nature, 344, 836-841.

17. Brann, M. R., Collins, R. M., and Spiegel, A. (1967) FEBS Lett., 222,191- 198.

18. Price, S. R., Tsai, S.-C., Adamik, R., Angus, C. W., Serventi, I. M.,Tsuchiya, M., Moss, J., and Vaughan, M. (1989) Biochemistry, 28,3803-3807.

19. Goldsmith, P., Backlund, P. J., Jr., Rossiter, K., Carter, A., Milligan, G.,Unson, C. G., and Spiegel, A. (1988) Biochemistry, 27, 7085-7090.

20. Kobayashi, I., Shibasaki, H., Takahashi, K., Kikkawa, S., Ui, M., andKatada, T. (1989) FEBS Lett., 257, 177- 180.

21. Milligan, G., Tanfm, Z., Goureau, O., Unson, C., and Harbon, S. (1989)FEBSLett., 244, 411-416.

22. Rouot, B., Carrette, J., Lafontan, M., Lan-Tran, P., Fehrentz, J. A.,Bockaert, J., and Toutant, M. (1989) Biochem. J., 260, 307-310.

23. Brabet, P., Pantaloni, C., Rodriguez, M., Martinez, J., Bockaert, J., andHomburger, V. (1990) J. Neurochem., 54, 1310-1320.

24. Kobayashi, I., Shibasaki, H., Takahashi, K., Tohyama, K., Kurachi, H.,Ito, H., Ui, M., and Katada, T. (1990) Eur. J. Biochem., 191, 499-506.

25. Rouot, B., Charpentier, N., Chabbert, C., Carrette, J., Zumbihl, R.,Bockaert, J., and Homburger, V. (1992) Mol. Pharmacol., 41, 273-280.

26. Shibasaki, H., Kozasa, T., Takahashi, K., Inanobe, A., Kaziro, Y., Ui,M., and Katada, T. (1991) FEBS Lett., 285, 268-270.

27. Worley, P. F., Baraban, J. M., Van Dop, C., Neer, E. J., and Snyder,S. H. (1986) Proc. Natl. Acad. Sci. USA, 83, 4561-4565.

28. Rapiejko, P. J., Watkins, D. C., Ros, M., and Malbon, C. C. (1990) Biochim.Biophys. Acta, 1052, 348-350.

29. Gierschik, P., Morrow, B., Milligan, G., Rubin, C., and Spiegel, A. (1986)FEBS Lett., 199, 103-106.

30. Watkins, D. C., Northup, J. K., and Malbon, C. C. (1987) J. Biol. Chem.,262, 10651-10657.

31. Mullaney, I., Magee, A. I., Unson, C. G., and Milligan, G. (1988) Biochem.J., 256, 649-656.

32. Brabet, P., Pantaloni, C., Bockaert, J., and Homburger, V. (1991) J. Biol.Chem., 266, 12825-12830.

33. Liang, B. T., Hellmich, M. R., Neer, E. J., and Galber, J. B. (1986) J.Biol. Chem., 261, 9011-9021.

34. Luetje, C. W. and Nathanson, N. M. (1988) J. Biol. Chem., 50, 1775-1782.35. Nestler, E. J., Terwilliger, R. Z., Walker, J. R., Sevarino, K. A., and

Duman, R. S. (1990) J. Neurochem., 55, 1079-1082.36. Jones, D. T. and Reed, R. R. (1987) J. Biol. Chem., 262, 14241-14249.37. Itoh, H., Kozasa, T., Nagata, S., Nakamura, S., Katada, T., Ui, M., Iwai,

S., Ohtsuka, E., Kawasaki, H., Suzuki, K., and Kaziro, Y. (1986) Proc.Natl. Acad. Sci. USA, 83, 3776-3780.

38. Van Meurs, K. P., Angus, C. W., Lavu, S., Kung, H.-F., Czarnecki, S.K., Moss, J., and Vaughan, M. (1987) Proc. Natl. Acad. Sci. USA., 84,3107-3111.

39. Lavu, S., Clark, J., Swarpup, R., Matsushima, K., Paturu, K., Moss, J.,and Kung, H.-F. (1988) Biochem. Biophys. Res. Commun., 150, 811-815.

40. Mitchell, L. G and Merril, C. R. (1989) Anal. Biochem., 178, 239-242.41. Hultman, T., Bergh, S., Moks, T., and Uhlen, M. (1991) Biotechniques,

10, 84-93.42. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad.

Sci. USA, 85, 8998-9002.43. Rosenthal, A. and Jones, D. S. C. (1990) NucleicAcid Res. 18, 3095-3096.44. Eschenfeldt, W. H., Puskas, R. S., and Berger, S. L. (1988) In (Berger,

S. L. and Kimmel, A. R. eds.), Methods in Enzymology, Academic Press,San Diego CA, Vol. 152, pp. 337-342.

45. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, R. J.(1979) Biochemistry, 18, 5294-5299.

46. Tsuchiya, M., Price, S. R., Nightingale, M. S., Moss, J., and Vaughan,M. (1989) Biochemistry, 28, 9668-9673.

47. Berger, S. L. (1987) Anal. Biochem., 161, 272-279.

Nucleic Acids Research, 1994, Vol. 22, No. 5 849

48. Birnstiel, M. L., Busslinger, M., and Strub, K. (1985) Cell, 41, 349-359.49. Luetje, C. W., Tietje, K. M., Christian, J. L., and Nathanson, N. M. (1988)

J. Biol. Chem., 263, 13357-13365.50. Tsuchiya, M., Bliziotes, M. M., Serventi, I. M., Price, S. R., Avigan, J.,

Murtagh, J. J., Jr, Stevens, L. A., Walker, M. M., Newman, K. B., Halpem,J. L., and Tsai, S.-C. (1990) in Proc. 6th Intern'l. Symp. on Pertussis,Bethesda, MD, pp. 57-65.

51. Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J.D. (1983) Molecular Biology of the Cell, pp. 412-423 Garland Publishing,New York/London.

52. Itoh, H., Toyama, T., Kozasa, T., Tsukamoto, T., Matsuoka, M., andKaziro, Y. (1988) J. Biol. Chem., 263, 6656-6664.

53. Bray, P., Carter, A., Guo, V., Puckett, C., Kamholz, J., Spiegel, A., andNirenberg, M. (1987) Proc. Natl. Acad. Sci. USA, 84, 5115-5119.

54. Shaw, G. and Kamen, R. (1986) Cell, 46, 659-667.55. Brawerman, G. (1987) Cell, 48, 5-6.56. Jackson, R. J. and Standart, N. (1990) Cell, 62, 15-24.57. Gillis, P. and Malter, J. S. (1991) J. Biol. Chem., 266, 3172-3177.58. Kim, S. J., Park, K., Koeller, D., Kim, K. Y., Wakefield, L. M., Sporn,

M. B., and Roberts, A. B. (1992) J. Biol. Chem., 267, 13702-13707.59. Aziz, N. and Munro, H. N. (1987) Proc. Natl. Acad. Sci. USA, 84,

8478-8482.60. Eisenstein, R. S. and Munro, H. N. (1990) Enzyme, 4, 42-58.61. Lee, W. M., Lin, C., and Curran, T. (1988) Mol. Cell. Biol., 8, 5521-5527.62. Raymond, V., Atwater, J. A., and Verma, I. M. (1989) Oncogene Res.,

5, 1-12.