document

letter

276 nature genetics • volume 28 • july 2001

Tbx5 associates with Nkx2-5 and synergisticallypromotes cardiomyocyte differentiation

Yukio Hiroi1, Sumiyo Kudoh2, Koshiro Monzen1, Yuichi Ikeda1, Yoshio Yazaki3, Ryozo Nagai1 & Issei Komuro4

1Department of Cardiovascular Medicine, University of Tokyo Graduate School of Medicine, Tokyo, Japan. 2Department of Cardiovascular Medicine,Kanazawa Medical University, Ishikawa, Japan. 3International Medical Center of Japan, Tokyo, Japan. 4Department of Cardiovascular Science and Medicine,Chiba University Graduate School of Medicine, Chiba, Japan. Correspondence should be addressed to I.K. (e-mail: [email protected]).

The cardiac homeobox protein Nkx2-5 is essential in cardiacdevelopment, and mutations in Csx (which encodes Nkx2-5)cause various congenital heart diseases1–5. Using the yeasttwo-hybrid system with Nkx2-5 as the ‘bait’, we isolated the T-box-containing transcription factor Tbx5; mutations in TBX5cause heart and limb malformations in Holt-Oram syndrome6–8

(HOS). Co-transfection of Nkx2-5 and Tbx5 into COS-7 cellsshowed that they also associate with each other in mammaliancells. Glutathione S-transferase (GST) ‘pull-down’ assays indi-cated that the N-terminal domain and N-terminal part of the T-box of Tbx5 and the homeodomain of Nkx2-5 were necessaryfor their interaction. Tbx5 and Nkx2-5 directly bound to the pro-moter of the gene for cardiac-specific natriuretic peptide pre-cursor type A (Nppa) in tandem, and both transcription factors

showed synergistic activation. Deletion analysis showed thatboth the N-terminal domain and T-box of Tbx5 were importantfor this transactivation. A G80R mutation of Tbx5, which causessubstantial cardiac defects with minor skeletal abnormalities inHOS, did not activate Nppa or show synergistic activation,whereas R237Q, which causes upper-limb malformations with-out cardiac abnormalities8, activated the Nppa promoter to asimilar extent to that of wildtype Tbx5. P19CL6 cell lines9,10

overexpressing wildtype Tbx5 started to beat earlier andexpressed cardiac-specific genes more abundantly than didparental P19CL6 cells, whereas cell lines expressing the G80Rmutant did not differentiate into beating cardiomyocytes.These results indicate that two different types of cardiac tran-scription factors synergistically induce cardiac development.

Fig. 1 Association of Tbx5 and Nkx2-5. a,b, Celllysates containing FLAG-tagged Tbx5 and/orHA-tagged Nkx2-5 expression plasmids wereincubated with anti-HA or anti-FLAG mono-clonal antibody, then the immune complex wasprecipitated with anti-mouse IgG agarosebeads and separated by SDS–PAGE.Immunoblotting with anti-FLAG antibody (a) oranti-HA monoclonal antibody (b) shows thatTbx5 and Nkx2-5 are associated in mammaliancells. c–e, The association of GST–Nkx2-5 fusionproteins and in vitro-translated Tbx5 labeledwith [35S]methionine. c, Nkx2-5 deletionmutants and full-length Tbx5, showing thehomeodomain of Nkx2-5 is necessary and sufficient for this associ-ation. Left, Nkx2-5 mutants. WT, Full-length protein; ∆N, deletionof N-terminal domain outside homeodomain; ∆C, deletion of C-terminal domain outside homeodomain; HD, homeodomain; N, N-terminal domain. d, Tbx5 deletion mutants and full-lengthNkx2-5, showing the N-terminal domain of Tbx5 outside of the T-box is necessary for this interaction. Numbers at left, amino acidsof Tbx5 mutants. e, Deletion mutants of the C-terminal domainand T-box of Tbx5, and a full-length Nkx2-5, showing the N-termi-nal part of T-box is necessary for this interaction. Numbers at left,amino acids of Tbx5 mutants.

a b c

d

e

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

letter

nature genetics • volume 28 • july 2001 277

Fig. 2 Transactivation of Nppa by Tbx5and Nkx2-5. a, Dose-dependent trans-activation of Nppa by Tbx5. Co-trans-fection of Tbx5 expression plasmidand Nppa driving expression of a -2.6kb promoter luciferase gene showsthat overexpression of Tbx5 transacti-vates the Nppa promoter in a dose-dependent manner. Data representluciferase activities relative to an inter-nal control. b, Synergistic activation ofNppa by Tbx5 and Nkx2-5. Expressionof Tbx5 (50 ng/three dishes) or Nkx2-5(50 ng/three dishes) results in showonly weak transactivation of Nppa,whereas overexpression of both Tbx5and Nkx2-5 strongly activate Nppa.Neither Xenopus T (brachyury; Bra)nor Hoxb6 transactivates Nppa. Thereare no synergistic effects between T(brachyury) and Nkx2-5 or Tbx5 andHoxb6. c, Transactivation of Nppa bydeletion mutants of Tbx5 (50 ng/threedishes) with or without Nkx2-5 (50 ng/three dishes). Deletion of the C-terminal domain of Tbx5 (∆C) activates Nppa less than full-length Tbx5 does, and it lacks thesynergistic effect with Nkx2-5. Deletion of the N-terminal domain of Tbx5 (∆N) abolishes its transcription of Nppa. d, Transactivation by Tbx5 of Nppa promoterswith deletions. Deletion up to –270bp of the Nppa promoter has marginal effects on the transactivation by Tbx5, whereas activation of the promoter containingless than 240bp by Tbx5 is significantly reduced. e, Transactivation and synergistic activation of Nppa by misssense mutants of Tbx5 (50 ng/three dishes). The R237Qmutant, which causes minor cardiac defects in HOS, activates Nppa and shows synergistic activity with Nkx2-5, whereas the G80R mutant that causes severe cardiacmalformations activates Nppa significantly less than wildtype Tbx5.

The cardiac homeobox protein Nkx2-5 is a vertebrate homologof Drosophila tinman, which is required for its dorsal vessel devel-opment11–13. Homozygous deletion of Csx is embryonicallylethal in mice because of cardiac defects3,14. Heterozygous muta-tions of the human homolog, C5X, cause congenital heart dis-eases including atrial septal defect, ventricular septal defect andtetralogy of Fallot4,5,15,16. Recent studies have indicated thatNkx2-5 induces cardiac development in concert with other tran-scription factors such as serum response factor17, MADS boxtranscription enhancer factor 2, polypeptide C (or myocyteenhancer factor 2C; Mef2c)18 and GATA-binding protein 4(Gata4)10,19–21. To elucidate the molecular mechanism by whichNkx2-5 regulates cardiac development, we isolated factors thatassociate with Nkx2-5 using the yeast two-hybrid system withNkx2-5 as the ‘bait’. Sequence analysis showed that one isolatedcDNA encoded the N-terminal domain and T-box of Tbx5.Tbx5, a member of the T-box DNA-binding transcription factorfamily22, is expressed in the heart, upper limb and eye in theembryo and is important in their development23–27. Heterozy-gous mutations of TBX5 cause Holt-Oram syndrome (HOS),characterized by anterior pre-axial limb and cardiac malforma-tions including atrial septal defect, ventricular septal defect andtetralogy of Fallot6–8.

To examine the association of Tbx5 and Nkx2-5 in mammaliancells, we transfected COS-7 cells with constructs encoding FLAG-tagged Tbx5 and hemagglutinin (HA)-tagged Nkx2-5. Westernblot analysis showed that Tbx5 was co-immunoprecipitated withNkx2-5 (Fig. 1a,b). Another T-box family protein, T (also knownas brachyury), was not co-immunoprecipitated with Nkx2-5,and Hoxb6, an unrelated homeoprotein, was not co-immuno-precipitated with Tbx5 (data not shown). These results indicatethat Tbx5 and Nkx2-5 specifically associate with each other inmammalian cells as well as in yeast.

To determine the domains important for this interaction, weused GST ‘pull-down’ assays with GST–Nkx2-5 proteins and invitro translated Tbx5 proteins. Full-length protein, proteins with adeletion of the amino-terminal or carboxy-terminal domains out-side the homeodomain, and the homeodomain of Nkx2-5 itself,all associated with Tbx5, but GST protein and the N-terminaldomain of Nkx2-5 did not bind to Tbx5 (Fig. 1c). These resultsindicate that the homeodomain of Nkx2-5 is necessary and suffi-cient for its association with Tbx5. Although deletion of half ofthe C-terminal domain of Tbx5 (amino acids 1–378) did notaffect binding, deletion of the N-terminal domain of Tbx5 (aminoacids 83–518, 165–518 or 245–518) abrogated its binding abilityto Nkx2-5 (Fig. 1d). Deletion analysis of the T-box domain from

a b c

d e

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co


letter


the C-terminus showed that the N-terminal domain outside theT-box and the N-terminal part of the T-box (amino acids 1–90)were sufficient for its binding to Nkx2-5 (Fig. 1e).

To elucidate the function of the association of Tbx5 and Nkx2-5 in cardiac development, we examined their transcriptionalactivities using the cardiac-specific Nppa promoter. Overexpres-sion of Nkx2-5 activated the Nppa promoter as reported previ-ously17–21. Tbx5 also transactivated Nppa (Fig. 2a), andsimultaneous transfection of Tbx5 and Nkx2-5 substantially acti-vated the promoter of Nppa transactivation (Fig. 2b). Neither co-expression of T (brachyury) and Nkx2-5 nor of Hoxb6 and Tbx5have a synergistic effect on expression of Nppa (Fig. 2b). Theseresults indicate that Tbx5 and Nkx2-5 specifically associate andproduce a synergistic effect on the transcription of Nppa. Nkx2-5was reported to bind to the thyroid transcription factor 1 bindingsequence and to activate an artificial promoter containing fourmultimerized thyroid transcription factor binding sequences21.Tbx5 did not affect this promoter or produce a synergistic effectwith Nkx2-5 (data not shown). These results indicate that thesynergistic effect of Nkx2-5 and Tbx5 is sequence-specific, but isnot a general enhancement of transcriptional efficiency, and thatthe DNA-binding activity of Nkx2-5 is not sufficient for the syn-ergistic action of Nkx2-5 and Tbx5.

To determine which domains of Tbx5 are important for acti-vation of Nppa, we examined the transcriptional activity ofTbx5 mutants with deletions and point mutations. The Nppapromoter was activated less by Tbx5 with a C-terminal deletion(amino acids 1–251) than wildtype Tbx5 and was not activatedby Tbx5 with an N-terminal deletion (amino acids 63–518)(Fig. 2c). We examined synergistic activation by deletionmutants of Tbx5 with Nkx2-5. Neither C-terminal deletion norN-terminal deletion in mutants produced a synergistic effectwith Nkx2-5 (Fig. 2c). Transcriptional assay using the galac-tosidase (Gal) 4 system showed that there was a transactivationdomain in the C-terminal domain but not in the N-terminaldomain of Tbx5 (data not shown). These results indicate thatthe N-terminal domain is important for association with othermolecules, including Nkx2-5, and for activation of Nppa, andthat the C-terminal domain is important for strong and syner-gistic activation of Nppa.

To determine whether this transactivation by Tbx5 is director indirect through Nkx2-5, we used electromobility shift assay(EMSA) with DNA fragments of the Nppa promoter. As thetranscriptional analysis using Nppa promoters with deletionsindicated that the region of bp –270 to –240 is important foractivation by Tbx5 (Fig. 2d), we first did an EMSA using DNAfragments of bp –284 to –246 and bp –254 to –227. Tbx5bound to the fragment of bp –254 to –227, and the DNA frag-ment corresponding to the sequence of bp –254 to –236, but

not the fragment of bp –244 to –227, successfully competedwith this binding (Fig. 3a). Tbx5 bound to the fragment of bp–254 to –236 (Fig. 3b), and this fragment contained an Nkx2-5-binding sequence (TGAAGTG) 21 and a ‘half-site’ (TCA-CACCT) of a palindromic T (brachyury)-binding sequence(T[G/C]ACACCTAGGTGTGAAATT)22 with a one base-pairspacer. We then carried out an EMSA using a DNA fragmentcontaining this ‘half-site’ (core) and three DNA fragments withpoint mutations (m1–m3) as competitors. The DNA fragmentsof core and m1 completely abolished the band shift, and m3produced weak competition, whereas m2, which has a muta-tion in the center of the core sequence, did not affect the bind-ing of Tbx5 to the DNA fragment of bp –254 to –236 (Fig. 3b).These results indicate that Tbx5 binds to this core sequence.Nkx2-5, as well as Tbx5 binds to the DNA fragment of bp –254to –236, and incubation of both Tbx5 and Nkx2-5 with theDNA fragment produced a larger shifted band in addition tothe Tbx5– and Nkx2-5–DNA complexes (Fig. 3c). These resultsindicate that these two transcription factors form a het-erodimer complex and bind to the Nppa promoter in tandem.

Many mutations, including nonsense and frameshift muta-tions of Tbx5, have been reported in patients with HOS (refs.6–8). Among these, a G80R missense mutation causes substantialcardiac malformations with minor skeletal abnormalities,whereas an R237Q mutation causes upper-limb malformationswithout substantial cardiac abnormalities8. The G residue atposition 80 within the N-terminal T-box is highly conservedamong the T-box family members, and it has been reported tointeract with the major groove of target DNA (refs. 8,28). The Rresidue at position 237 is located in the C-terminal T-boxdomain that has been reported to bind selectively to the minorgroove of DNA (refs. 8,28). The R237Q mutant activated theNppa promoter and showed synergistic activation with Nkx2-5to a slightly lesser degree than did wildtype Tbx5, whereas theG80R mutant showed significantly less activation and synergisticeffect on Nppa (Fig. 2e). These results may explain the severe car-diac defects in patients with the G80R mutation.

Fig. 3 Binding of Tbx5 and Nkx2-5 to the Nppa pro-moter. The DNA fragment of the Nppa promoter waslabeled and incubated with Tbx5 and/or Nkx2-5. a,Tbx5 binds to the fragment (bp –254 to –227) in adose-dependent manner. The fragment of bp –254 to–236, but not the fragment of bp –244 to –227, com-petes with this binding. b, Competition of the bindingof Tbx5 to the labeled fragment (bp –254 to –236). Inbold, the Nkx2-5 binding sequence and a ‘half-site’ ofthe palindromic T (brachyury)-binding sequence (Tbx5site); small upper-case letters, mutated nucleotides. c,Nkx2-5, as well as Tbx5, binds to the fragment of bp–254 to –236. Incubation of both Tbx5 and Nkx2-5 withthis DNA fragment produces a larger shifted band inaddition to the Tbx5– and Nkx2-5–DNA complexes(complex).

a b

c

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co


letter

nature genetics • volume 28 • july 2001 279

P19CL6 cells, a derivative of mouse embryonal carcinoma P19cells, efficiently differentiate into beating cardiomyocytesexpressing cardiac-specific genes after treatment with 1% DMSO(refs. 9,10). To elucidate the biological functions of Tbx5 and itsmutants, we established P19CL6 cell lines that overexpress wild-type Tbx5 or the G80R or R237Q mutant (CL6-WT, CL6-G80Rand CL6-R237Q, respectively). CL6-WT cells differentiated intobeating cardiomyocytes at day seven, two days earlier thanparental P19CL6 cells10. Differentiated CL6-WT cells contractedmore vigorously than P19CL6 cells, and some clusters of cellswere spontaneously detached from the culture dish and formedbeating bodies. Although CL6-R237Q cells started to beat at day10, CL6-G80R cells never differentiated into beating cardiomy-ocytes. We examined expression of cardiac transcription factorsand other proteins at day eight (except for cardiac-responsiveadriamycin protein (Crap), which we examined at day 10). CL6-WT cells expressed cardiac genes such as Nkx2-5, Gata4, Mef2c,Crap and Nppa and the genes encoding myosin light polypeptide2 (Myl2) and ATPase, Ca2+ transporting, cardiac muscle, slowtwitch 2 (Atp2a2) more abundantly than did parental CL6 cells(Fig. 4). Although there was very little expression of Myl2 andCrap in parental CL6 cells, they were abundantly expressed inCL6-WT cells. Expression of cardiac genes was slightly reducedin CL6-R237Q cells compared to CL6 cells, whereas their expres-sion was were barely detectable in CL6-G80R cells (Fig. 4). Theseresults indicate that Tbx5 promotes cardiac differentiation andthat the G80R mutation of Tbx5 markedly impairs cardiomy-ocyte differentiation.

In Xenopus, glucocorticoid-inducible dominant negative xTbx5inhibits cardiac development26. Ventricular overexpression ofTbx5 under the promoter of β-myosin heavy chain in miceinhibits normal heart chamber development and reduces theexpression of ventricle-specific genes29. These observations indi-cate that Tbx5 expression at appropriate time, dose and location isimportant for normal cardiac development. Our study has shownthat Tbx5 is essential in cardiomyocyte differentiation in concertwith Nkx2-5. The association and synergistic action of Nkx2-5and Tbx5 may explain the similar cardiac abnormalities generatedby these mutant proteins, and the different phenotypes producedby G80R and R237Q mutations.

MethodsYeast two-hybrid screening We screened a human heart MATCHMAKERcDNA library (Clontech) with pGBT9–human Nkx2-5 as the ‘bait’ usingthe MATCHMAKER Two-Hybrid System, according to the manufacturer’sprotocol (Clontech). We determined sequences using a 310 Genetic Ana-lyzer (Perkin-Elmer), and searched by FASTA. To obtain full-length Tbx5cDNA, we screened a λgt11 human fetal heart cDNA Library (Clontech)with the isolated Tbx5 cDNA fragment. We generated truncated mutants,the G80R mutant and the R237Q mutant of Tbx5, by PCR and subclonedthese into a pCDNA3 plasmid (Invitrogen).

Co-immunoprecipitation experiments. We transiently transfected expres-sion plasmids of FLAG–Tbx5 and HA–Nkx2-5 into COS-7 cells using thecalcium phosphate method and, at 48 h after transfection, incubated cellswith anti-HA monoclonal antibody 12CA5 or anti-FLAG monoclonalantibody M2 (KODAK); ref. 21. We visualized the immune complex usinghorseradish peroxidase-conjugated anti-mouse immunoglobulin (Ig)Gantibody and the ECL detection kit (Amersham Pharmacia Biotech).

GST ‘pull-down’ assay. GST fusion proteins of Nkx2-5 derivatives havebeen described21. We used GST or GST–Nkx2-5 fusion proteins immobi-lized on glutathione–Sepharose 4B beads and in vitrotranslated Tbx5derivatives labeled with [35S]methionine by the TNT Quick Coupled Tran-scription/Translation Systems (Promega) and mixed these in NTEN bind-ing buffer (150 mM NaCl, 50 mM Tris, pH 7.5, 0.5 mM EDTA, 0.5% NP-40, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and0.05% bovine serum albumin) for 2 h at 4 °C with gentle rotation. We sep-arated Tbx5 derivatives bound to GST–Nkx2-5 fusion proteins by SDS-PAGE and visualized them by autoradiography.

EMSA. We synthesized double-stranded oligonucleotides with a GGoverhanging at the 5′ terminus of each nucleotide. We then annealedthese and labeled them with [α-32P]dCTP using Klenow enzyme. Weincubated labeled probes with 2 µg poly(dI-dC) and 5 µl products ofTbx5 or Nkx2-5 using TNT Quick Coupled Transcription/TranscriptionSystem in 20 µl binding buffer21.

Luciferase assays. We used the 2.6-kb Nppa promoter–luciferase gene as areporter and pRL-CMV (Promega) as an internal control. We measured dualluciferase activities 48 h after transfection with a luminometer (BertholdLumat LB9507), and corrected differences in transfection efficiency relative tothe level of sea pansy luciferase activity. We repeated experiments at least threetimes in triplicate and show representative data here.

P19CL6 cell lines and stable transformants. We cultured P19CL6 cell linesas described before9,10. We transfected plasmids pCDNA3–Tbx5, pCD-NA3–G80R or pCDNA3–R237Q into P19CL6 cells using Tfx-50 lipofec-tion reagents (Promega). We isolated at least three independent clones ofeach plasmid. We confirmed expression of the Tbx5 derivatives usingnorthern blot analysis.

Northern blot analysis and RT–PCR. We separated 20 µg total RNA byagarose–formaldehyde gel electrophoresis and then transferred RNA onto aHybond N membrane filter (Amersham Pharmacia Biotech). For hybridiza-tion, we incubated filters at 42 °C overnight in a buffer of 50% formamide, 5×SSPE buffer, 5× Denhardt solution, 5% dextran sulfate and 1% SDS. Welabeled probes with [32P]dCTP by random priming (Takara). Primers forreverse transcription and PCR of Nppa were 5′–GATGCCGGTAGAAGAT-GAGGTC–3′ and 5′–AAGAGGGCAGATCTATCGGAGG–3′. Reverse tran-scription–PCR for the analysis of Nkx2-5 mRNA has been described10.

AcknowledgmentsWe thank N. Mochizuki for technical advice, C. Masuo and K. Abe fortechnical assistance and J. Hiroi for encouragement. This work was supportedin part by grants from the Japanese Ministry of Education, Science, andCulture; Mochida Memorial Foundation; and Kanae Foundation (Aventis).

Received 29 January; accepted 17 May 2001.

1. Komuro, I. & Izumo, S. Csx: a murine homeobox-containing gene specificallyexpressed in the developing heart. Proc. Natl. Acad. Sci. USA 90, 8145–8149(1993).

2. Lints, T.J., Parsons, L.M., Hartley, L., Lyons, I. & Harvey, R.P. Nkx-2.5: a novel murine

Fig. 4 Expression of cardiac genes in P19CL6 cell lines. Data represent expressionof Nkx2-5, Gata4, Mef2c, Myl2, Atp2a2 and Nppa on day 8 and Crap expressionon day 10. The cell line expressing wildtype Tbx5 (WT) expresses all these cardiacgenes more abundantly than parental P19CL6 cells but expression of all the car-diac genes is markedly suppressed in the cell line expressing the G80R mutant.These three cell lines expressed similar amounts of exogenous Tbx5 and itsmutants (exogenous Tbx5). 28S RNA demonstrates equal loading of samples.

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co


letter


homeobox gene expressed in early heart progenitor cells and their myogenicdescendants. Development 119, 419–431 (1993).

3. Lyons, I. et al. Myogenic and morphogenetic defects in the heart tubes of murineembryos lacking the homeobox gene Nkx2-5. Genes Dev. 9, 1654–1666 (1995).

4. Schott, J.J. et al. Congenital heart disease caused by mutations in thetranscription factor NKX2-5. Science 281, 108–111 (1998).

5. Benson, D.W. et al. Mutations in the cardiac transcription factor NKX2.5 affectdiverse cardiac developmental pathways. J. Clin. Invest. 104, 1567–1573 (1999).

6. Li, Q.Y. et al. Holt-Oram syndrome is caused by mutations in TBX5, a member ofthe Brachyury (T) gene family. Nature Genet. 15, 21–29 (1997).

7. Basson, C.T. et al. Mutations in human TBX5 cause limb and cardiac malformationin Holt-Oram syndrome. Nature Genet. 15, 30–35 (1997).

8. Basson, C.T. et al. Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci. USA 96, 2919–2924 (1999).

9. Habara-Ohkubo, A. Differentiation of beating cardiac muscle cells from aderivative of P19 embryonal carcinoma cells. Cell Struct. Funct. 21, 101–110 (1996).

10. Monzen, K. et al. Bone morphogenetic proteins induce cardiomyocytedifferentiation through the mitogen-activated protein kinase kinase kinase TAK1and cardiac transcription factors Csx/Nkx-2.5 and GATA-4. Mol. Cell. Biol. 19,7096–7105 (1999).

11. Bodmer, R. The gene tinman is required for specification of the heart and visceralmuscles in Drosophila. Development 118, 719–729 (1993).

12. Azpiazu, N. & Frasch, M. Tinman and bagpipe: two homeo box genes thatdetermine cell fates in the dorsal mesoderm of Drosophila. Genes Dev. 7,1325–1340 (1993).

13. Tanaka, M. et al. Vertebrate homologs of tinman and bagpipe: roles of thehomeobox genes in cardiovascular development. Dev. Genet. 22, 239–249 (1998).

14. Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N. & Izumo, S. The cardiachomeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essentialfor heart development. Development 126, 1269–1280 (1999).

15. Kasahara, H. et al. Loss of function and inhibitory effects of human CSX/NKX2.5homeoprotein mutations associated with congenital heart disease. J. Clin. Invest.106, 299–308 (2000).

16. Hosoda, T. et al. Familial atrial septal defect and atrioventricular conduction

disturbance associated with a point mutation in the cardiac homeobox geneCSX/NKX2-5 in a Japanese patient. Jpn. Circ. J. 63, 425–426 (1999).

17. Chen, C.Y. et al. Activation of the cardiac alpha-actin promoter depends uponserum response factor, Tinman homologue, Nkx-2.5, and intact serum responseelements. Dev. Genet. 19, 119–130 (1996).

18. Skerjanc, I.S., Petropoulos, H., Ridgeway, A.G. & Wilton, S. Myocyte enhancerfactor 2C and Nkx2-5 up-regulate each other’s expression and initiatecardiomyogenesis in P19 cells. J. Biol. Chem. 273, 34904–34910 (1998).

19. Durocher, D., Charron, F., Warren, R., Schwartz, R.J. & Nemer, M. The cardiactranscription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 16,5687–5696 (1997).

20. Lee, Y. et al. The cardiac tissue-restricted homeobox protein Csx/Nkx2.5 physicallyassociates with the zinc finger protein GATA4 and cooperatively activates atrialnatriuretic factor gene expression. Mol. Cell. Biol. 18, 3120–3129 (1998).

21. Shiojima, I. et al. Context-dependent transcriptional cooperation mediated bycardiac transcription factors Csx/Nkx-2.5 and GATA-4. J. Biol. Chem. 274,8231–8239 (1999).

22. Smith, J. T-box genes: what they do and how they do it. Trends Genet. 15,154–158 (1999).

23. Gibson-Brown, J.J., Agulnik, S.I., Silver, L.M., Niswander, L. & Papaioannou, V.E.Involvement of T-box genes Tbx2-Tbx5 in vertebrate limb specification anddevelopment. Development 125, 2499–2509 (1998).

24. Takeuchi, J.K. et al. Tbx5 and Tbx4 genes determine the wing/leg identity of limbbuds. Nature 398, 810–814 (1999).

25. Rodriguez-Esteban, C. et al. The T-box genes Tbx4 and Tbx5 regulate limboutgrowth and identity. Nature 398, 814–818 (1999).

26. Horb, M.E. & Thomsen, G.H. Tbx5 is essential for heart development.Development 126, 1739–1751 (1999).

27. Koshiba-Takeuchi, K. et al. Tbx5 and the retinotectum projection. Science 287,134–137 (2000).

28. Muller, C.W. & Herrmann, B.G. Crystallographic structure of the T domain-DNAcomplex of the Brachyury transcription factor. Nature 389, 884–888 (1997).

29. Liberatore, C.M., Searcy-Schrick, R.D. & Yutzey, K.E. Ventricular expression of Tbx5inhibits normal heart chamber development. Dev. Biol. 223, 169–180 (2000).

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co


Documents

document