document

Nature © Macmillan Publishers Ltd 1998

8

E-cadheringermlinemutationsin familial gastric cancerParry Guilford*, Justin Hopkins*, James Harraway*,Maybelle McLeod†, Ngahiraka McLeod†,Pauline Harawira†, Huriana Taite†, Robin Scoular‡,Andrew Miller§ & Anthony E. Reeve*

* Cancer Genetics Laboratory, Biochemistry Department, University of Otago,PO Box 56, Dunedin, Aotearoa New Zealand† Kimi Hauora Health Clinic, PO Box 4062, Mt Maunganui South,Aotearoa New Zealand‡ Tauranga Public Hospital, Tauranga, Aotearoa New Zealand§ Pathology Department, University of Otago, PO Box 56, Dunedin,Aotearoa New Zealand. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

The identification of genes predisposing to familial cancer is anessential step towards understanding the molecular events under-lying tumorigenesis and is critical for the clinical management ofaffected families. Despite a declining incidence, gastric cancerremains a major cause of cancer death worldwide1, and about 10%of cases show familial clustering2,3. The relative contributions ofinherited susceptibility and environmental effects to familialgastric cancer are poorly understood because little is known ofthe genetic events that predispose to gastric cancer. Here wedescribe the identification of the gene responsible for early-onset, histologically poorly differentiated, high grade, diffusegastric cancer4 in a large kindred from New Zealand (Aotearoa).Genetic linkage analysis demonstrated significant linkage tomarkers flanking the gene for the calcium-dependent cell–adhesionprotein E-cadherin. Sequencing of the E-cadherin gene revealed aG → T nucleotide substitution in the donor splice consensussequence of exon 7, leading to a truncated gene product. DiminishedE-cadherin expression is associated with aggressive, poorly dif-ferentiated carcinomas5. Underexpression of E-cadherin is aprognostic marker of poor clinical outcome in many tumourtypes6, and restored expression of E-cadherin in tumour modelscan suppress the invasiveness of epithelial tumour cells7,8. The roleof E-cadherin in gastric cancer susceptibility was confirmed byidentifying inactivating mutations in other gastric cancerfamilies. In one family, a frameshift mutation was identified inexon 15, and in a second family a premature stop codon inter-rupted exon 13. These results describe, to our knowledge for the

first time, a molecular basis for familial gastric cancer, andconfirm the important role of E-cadherin mutations in cancer.

Familial gastric cancer in a kindred of Maori ethnicity (family A)was originally reported9 in 1964 and in the past 30 years over 25family members have died of this disease (Fig. 1). There is noevidence of an elevated rate of cancer of other organs in this family.The age of death from gastric cancer ranges upwards from 14 yearsof age, with the majority of cases occurring in people under the ageof 40. This is in marked contrast with the general New Zealandpopulation, in which about 80% of gastric carcinomas occur inpeople older than 60 years. (B. Cox, personal communication).

The pedigree pattern (Fig. 1) is consistent with the dominantinheritance of a susceptibility gene with incomplete penetrance. Toidentify this putative gene, we carried out a genetic linkage analysisby using microsatellite markers flanking candidate genes for thecancer-susceptibility locus.

One of these candidates was the homophilic cell adhesion moleculeE-cadherin. E-cadherin is a transmembrane protein with five tandemlyrepeated extracellular domains and a cytoplasmic domain thatconnects to the actin cytoskeleton through a complex with a, b andg catenins10. It is important for establishing cell polarity and main-taining normal tissue morphology and cellular differentiation10.

The linkage analysis found a maximum two-point lod score(Zmax ¼ 5:04, v ¼ 0) with marker D16S752 (Table 1), which mapswithin the genetic interval on chromosome 16q22.1 containing theE-cadherin gene11. Genotyping of five other markers12 in the vicinityof E-cadherin identified additional significantly linked markers(Table 1). A conserved haplotype spanning 9 centimorgans12 fromD16S3019 to D16S3138 was consistently inherited with the disease.This haplotype was also present in all obligate carriers of the

letters to nature

402 NATURE | VOL 392 | 26 MARCH 1998

Table 1 Linkage of the gastric cancer susceptibility gene to markers flankingE-cadherin

Marker Lod scores Recombinationfraction (v)

.............................................................................................................................................................................Equal allelefrequencies

Kindred allelefrequencies

.............................................................................................................................................................................D16S752 5.04 4.04 0D16S3043 2.01 2.34 0.05D16S3019 2.28 1.57 0D16S3095 4.90 4.07 0D16S3083 2.79 2.16 0D16S3138 3.32 2.68 0.............................................................................................................................................................................Two-point lod scores were calculated assuming either equal allele frequencies or, in aconservative approach (in the absence of allele frequencies for the study population), usingthe actual frequencies observed in the study kindred.

35 60 18

52

66 67

53 51 54 21

75

2727 55 38 16 4445 3321 59

17 48

6862

3145

22 17

30 3036 41 14

81 83

45 58 60 56

32 20 22 35

74

29 334045 42 36

68 64

34

60 59

18

38 41

Figure 1 Gastric cancer kindred (family A). Where

known, the individual’s age is indicated to the right of

the symbols. The age is underlined if a blood or biopsy

sample was available. General symbols: squares,

males; circles, females; all symbols with a diagonal,

deceased. Solid symbols: gastric carcinoma, pathol-

ogy available; dotted symbols: gastric carcinoma,

pathology unavailable; vertical stripes: colorectal

cancer. Some details unrelated to the mode of

inheritance of the disease have been modified to

protect the privacy of individual family members.


8

susceptibility gene, in two individuals affected by colorectal cancer(aged 30 and 74 years) and in a proportion of the unaffectedindividuals. The proportion of individuals with the haplotypewho were affected by the age of 60 provided an approximation of70% for the penetrance of the susceptibility gene in this kindred.

Mutation analysis of E-cadherin exons 2–16 using the single-stranded conformational polymorphism (SSCP) technique13

revealed a band shift in exon 7 (Fig. 2a) in DNA extracted forlymphocytes of two affected people and four obligate carriers of thesusceptibility gene. Direct sequencing of exon 7 identified a G → Ttransversion at the last nucleotide (position 1,008) of this exon (Fig.2b). The SSCP band shift was not observed in 150 unrelatedchromosomes.

This mutation may have two consequences for E-cadherinexpression and function. First, the mutated base forms part of thesplice donor site14,15 for exon 7. To examine the possible effect of theG → T transversion on splicing, we used exon linking RT-PCR(polymerase chain reaction with reverse transcription) on stomachbiopsy material taken from an affected family member. In additionto the expected wild-type product of 180 base pairs (bp) derivedfrom exons 7 and 8, a minor band of 187 bp was observed (data notshown). Nucleotide sequencing revealed that all clones derived fromthe 187-bp product contained the mutation 1008T and a 7-bpinsertion derived from intronic sequence between the normal splicedonor site and an adjacent cryptic splice site (Fig. 2c). This insertionis predicted to generate a premature stop codon in exon 8 of E-cadherin. The absence of the wild-type nucleotide at position 1,008associated with the 7-bp insertion argues that use of the cryptic

splice site is limited to the mutant transcript. Cryptic splicing of the1008T transcript occurs with a high efficiency: nucleotide sequen-cing revealed that only 1/20 clones derived from the normal 180-bpPCR product contained the 1008T mutation. The presence of asomatic mutation at position 1,008 of E-cadherin in human cancerhas been reported previously: A G → A mutation at position 1,008has been found in a histologically diffuse gastric carcinoma, leadingto cryptic splice-site activation and transcript instability16.

The second consequence of the G → T transversion is the sub-stitution of a glutamic acid residue at position 336 with aspartic acidin the residual correctly spliced transcript. Glu 336 is located in oneof the LDRE motifs (single-letter amino-acid code) which are partof E-cadherin’s four calcium-binding pockets17. Calcium binding isrequired for dimerization and rigidification of E-cadherin andprovides protection from proteolytic degradation18. The LDREmotif is highly conserved17, not only among vertebrates but alsoin Drosophila19, suggesting that a Glu → Asp mutation at thisposition is important for the correct functioning of the protein.

To confirm the role of E-cadherin in inherited gastric cancersusceptibility, we searched for germline mutations in this gene intwo other families (families B and C) with early-onset, histologically

letters to nature

NATURE | VOL 392 | 26 MARCH 1998 403

A C G T A C G T

wild type affected

Genomic DNA

GGGGACTG

AGAGCCAGGT

intron 7

exo

n 7

G T

3'

5'

+8

998

b

CCCTTTGAGGGACTGTAGAGCCA

A C G T

exo

n 8

exo

n 7

7b

p in

sertio

n

3'

5'

1001

1016

cDNAc

affecte

d

oblig

ate

carr

iers

wild

typ

ea

Figure 2 Identification of the mutation in family A. a, SSCP pattern of exon 7 in E-

cadherin gene. The SSCP band pattern of two affected people, two obligate

carriers and two unaffected spouses (wild type) are shown. The additional band

in the affected and obligate carrier samples is indicated by the arrow. b, Genomic

DNA sequence analysis of the exon–intron boundary of exon 7 showing the wild-

type sequence and the sequence from an affected person heterozygous for the

G → T transversion. The position of the exon–intron boundary is marked. c,

Example of the sequence analysis of the 187-bp RT-PCR cDNA product showing

the E-cadherin exon 7–8 boundary. The nucleotide 1,008 mutation and the 7-bp

insertion of intronic DNA are marked.

A C G T

exon 13

5'

3'

C T

AGCTGTCCGA

ACGGAAGGA

Family C

2105

2086

A C G T

exon 15

Family B

5'

3'

wild

type

CCCCCTGTG

CCTTCTATGGC

CCCTTCTATGG

muta

nt

2378

2397

35 35

16

34

28

Family B

34

a

b c

Figure 3 Mutations in families B and C. a, Abbreviated pedigree of family B. The

symbols are as for Fig.1. Grey shaded symbols: unconfirmed gastric carcinoma.

b, Exon 15 DNA sequence (familyB) showing the insertionof anadditionalC in the

run of cytosines between positions 2,382–2,386. c, Exon 13 sequence (family C)

showing the C → T transition at nucleotide 2,095.


8diffuse gastric cancer. SSCP analysis of exons 2–16 amplified fromlymphocyte DNA was carried out on two affected individuals andone obligate carrier from family B (Fig. 3a) and the proband offamily C. A band shift was observed in exon 15 in the three membersof family B who were tested. Direct sequencing of exon 15 showedthat all three individuals were heterozygous for the insertion of anadditional C residue in a run of five cytosines at positions 2,382–2,386 (Fig. 3b). The resulting frameshift leads to an E-cadherinmolecule lacking about half of its cytoplasmic domain.

The proband of family C (aged 30 years) showed an SSCP bandshift in exon 13. Direct sequencing identified a heterozygous C → Ttransition at nucleotide 2,095 which converted Gln 699 to a TAGstop codon (Fig. 3c). This inactivating mutation would result in anE-cadherin peptide lacking both the transmembrane and cytoplas-mic domains. In addition to the inactivating mutations in familiesA, B and C, we found silent mutations and one missense mutationwhich did not segregate with the phenotype (Table 2).

E-cadherin germline mutations have not been previouslyobserved in familial cancer. However, somatic mutations havebeen identified in sporadic histologically diffuse gastric carcino-mas20–22, lobular breast cancers13,23 and carcinomas of the endome-trium and ovary24. Although a lack of sufficient pure tumourmaterial, due to the high level of contamination with normalcells, precluded our search for loss-of-heterozygosity (LOH), inac-tivation of both E-cadherin alleles by mutation and LOH13,20,22,23 iscommon in sporadic tumours. Epigenetic inactivation of the E-cadherin gene by CpG hypermethylation has also been observed inseveral tumour types25,26.

The process of tumorigenesis is driven by the progressive accu-mulation of somatic mutations in a number of genes. Our identi-fication of a pre-existing mutation in a gene widely regarded as aninvasion-suppressor gene6 emphasizes that the order of accumula-tion of mutations leading to tumour formation may belie theobserved histopathological progression. The early accumulationof mutations associated with late events of tumorigenesis (such asinvasion and metastasis) may explain the unpredictable clinicalprogression of certain tumour types.

Loss of E-cadherin function and the concomitant disruption ofnormal cell–cell adhesion could also play a role in the initiation ofcell proliferation by allowing escape from growth-control signals.Alternatively, the cytoplasmic domain of E-cadherin may modulatethe Wnt signalling pathway by inhibiting the availability of freecytoplasmic b-catenin, in a manner complementary to the productof the colorectal tumour-suppressor gene APC27.

Regardless of the mechanism, our demonstration of germline E-cadherin mutations (Table 2) in families predisposed to diffusegastric cancer demonstrates a direct role for an intercellular adhe-sion protein in cancer susceptibility. The high frequency of inacti-vation of the E-cadherin gene in many types of sporadic tumours5,6

suggests that this gene may also confer inherited susceptibility toother cancers. M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Methods

Genotyping. DNA extracted from blood and biopsy samples28 was genotyped

using standard conditions12 in reactions containing 0.2 U AmpliTaq Gold(Perkin Elmer) and 25 pmol infrared labelled (IR800) forward primer (MWGBiotech). Products were analysed on a LiCor 4000L DNA sequencer.SSCP analysis. SSCP mutation analysis was carried out as described13. PCRproducts were electrophoresed at room temperature through a 6% non-denaturing polyacrylamide gel without added glycerol; products were detectedby autoradiography.RT-PCR. Total RNA was extracted29 from frozen biopsy material and reverse-transcribed using SuperScript II (Gibco BRL) according to the manufacturer’sinstructions. Nucleotide position 1,008 was PCR-amplified from the cDNAusing a forward primer within exon 7 (59-taa cag gaa cac agg agt cat ca-39) and areverse primer from exon 8 (59-gtg gtg gga ttg aag atc gg-39). Reactionscontained 4 mM MgCl2 and 0.2 U AmpliTaq Gold and were cycled as follows:(95 8C for 10 min) 1 cycle, and (95 8C for 15 s, 57 8C for 45 s, and 72 8C for 10 s)for 35 cycles.Plasmid and direct sequencing. RT-PCR products were eluted from a 6%polyacrylamide denaturing gel, re-amplified with the original primers usingPwo polymerase (Boehringer-Mannheim) and ligated into the EcoRV site ofBluescript. Template for direct sequencing of mutations was produced fromlymphocyte genomic DNA by PCR using the SSCP antisense primers and thesense primers13 with an added 59 leader corresponding to the T3 sequencingprimer. Plasmid and direct sequencing were carried out using Thermoseque-nase (Amersham) and an IR800 labelled (MWG Biotech) T3 primer (3 pmolper reaction). Products were analysed on a LiCor 400L DNA sequencer.Linkage analysis. Two-point lod scores were calculated using MLINK of theLINKAGE 5.1 package30. A gene frequency of 10−4 was assumed for the diseasegene. Age-dependent penetrance was taken into account; seven liability classeswere obtained from the cumulative age of onset curve: 0.18 for individuals from0–20 years, 0.24 (21–25 years), 0.34 (26–30 years), 0.48 (31–35 years), 0.56(36–40 years), 0.64 (41–45 years) and 0.70 (.46 years). Variation of themaximum penetrance from 60–80% did not change the significance of theresults.

Received 12 December 1997; accepted 23 January 1998.

1. Howson, C. P., Hiyama, T. & Wynder, E. L. The decline in gastric cancer: Epidemiology of anunplanned triumph. Epidemiol. Rev. 8, 1–27 (1986).

2. La Vecchia, C., Negri, E., Franceschi, S. & Gentile, A. Family history and the risk of stomach andcolorectal cancer. Cancer 70, 50–55 (1992).

3. Zanghieri, G. et al. Familial occurrence of gastric cancer in the 2-year experience of a population-basedregistry. Cancer 66, 2047–2051 (1990).

4. Lauren, P. The two histological main types of gastric carcinoma: diffuse and so-called intestinal-typecarcinoma. An attempt at a histo-clinical classification. Acta Pathol. Microbiol. Scand. 64, 31–49(1965).

5. Shiozaki, H., Oka, H., Inoue, M., Tamura, S. & Monden, M. E-cadherin mediated adhesion system incancer cells. Cancer 77, 1605–1613 (1995).

6. Bracke, M. E., Roy, F. M. & Mareel, M. M. The E-cadherin/catenin complex in invasion and metastasis.Curr. Topics Microbiol. Imm. 213, 123–161 (1996).

7. Frixen, E. H. et al. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carinomacells. J. Cell Biol. 113, 173–185 (1991).

8. Vleminckx, K., Vakaet, L., Mareel, M., Fiers, W. & Roy, F. V. Genetic manipulation of E-cadherinexpression by epithelial tumour cells reveals an invasion suppressor role. Cell 66, 107–119 (1991).

9. Jones, E. G. Familial gastric cancer. NZ Med. J. 63, 287–296 (1964).10. Grunwald, G. B. The structural and functional analysis of cadherin calcium-dependent cell adhesion

molecules. Curr. Opin. Cell Biol. 5, 797–805 (1993).11. GDB (TM) Human Genome Database. (John Hopkins University, Baltimore, Maryland).12. Dib, C. et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Nature 380, 152–154 (1996).13. Berx, G. et al. E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast

cancers. EMBO J. 14, 6107–6115 (1995).14. Padgett, R. A., Grabowski, P. J., Konarska, M. M., Seiler, S. & Sharp, P. A. Splicing of messenger RNA

precursors. Annu. Rev. Biochem. 55, 1119–1150 (1986).15. Weil, D. et al. The autosomal recessive isolated deafness, DFNB2, and the Usher 1B syndrome are

allelic defects of the myosin-VIIA gene. Nature Genet. 16, 191–193 (1997).16. Oda, T. et al. E-cadherin gene mutations in human gastric carcinoma cell lines. Proc. Natl Acad. Sci.

USA 91, 1858–1862 (1994).17. Berx, G. et al. Cloning and characterization of the human invasion supressor gene E-cadherin

(CDH1). Genomics 26, 281–289 (1995).18. Nagar, B., Overduin, M., Ikura, M. & Rini, J. M. Structural basis of calcium-induced E-cadherin

rigidification and imerization. Nature 380, 360–364 (1996).19. Mahoney, P. A. et al. The fat tumour suppressor gene in Drosophila encodes a novel member of the

cadherin gene superfamily. Cell 67, 853–868 (1991).20. Becker, K.-F. et al. E-cadherin gene mutations provide clues to diffuse type gastric carcinomas. Cancer

Res. 54, 3845–3852 (1994).21. Muta, H. et al. E-cadherin mutations in signet ring cell carcinoma of the stomach. Jap. J. Cancer Res.

87, 843–848 (1996).22. Tamura, G. et al. Inactivation of the E-cadherin gene in primary gastric carcinomas and gastric

carcinoma cell lines. Jap. J. Cancer Res. 87, 1153–1159 (1996).23. Berx, G. et al. E-cadherin is inactivated in a majority of invasive human lobular breast cancers by

truncation mutations throughout its extracellular domain. Oncogene 13, 1919–1925 (1996).24. Risinger, J. I., Berchuck, A., Kohler, M. F. & Boyd, J. Mutations of the E-cadherin gene in human

gynaecologic cancers. Nature Genet. 7, 98–102 (1994).

letters to nature

404 NATURE | VOL 392 | 26 MARCH 1998

Table 2E-cadheringermlinemutations andpolymorphisms in gastric cancerfamilies

Family Nucleotideposition (exon)

Mutation Type

.............................................................................................................................................................................A 1,008 (7) G → T Splice siteB 2,382–2,386 (15) C insertion FrameshiftC 2,095 (13) C → T Premature termination (TAG).............................................................................................................................................................................B 1,409 (10)* C → T Codon 470: Thr → IleA, C intron 12† C → T SilentA, B, C 2,076 (13)‡ C → T Silent.............................................................................................................................................................................* This mutation did not segregate with the disease in family B.† Located 13 nucleotides upstream of the exon.‡ Thispolymorphismhasbeen reportedpreviously (see, for example, refs 13, 24). Nucleotidepositions are as described in ref.17.


8

25. Yoshiura, K. et al. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation inhuman carcinomas. Proc. Natl Acad. Sci. USA 92, 7416–7419 (1995).

26. Graff, J. R. et al. E-cadherin expression is silenced by DNA hypermethylation in human breast andprostate carcinomas. Cancer Res. 55, 5195–5199 (1995).

27. Morin, P. J. et al. Activation of b catenin-Tcf signalling in colon cancer mutations in b catenin or APC.Science 275, 1787–1792 (1997).

28. Banerjee, S. K., Makdisi, W. F., Weston, A. P., Mitchell, S. M. & Campbell, D. R. Microwave-basedDNA extraction from paraffin-embedded tissue for PCR amplification. Biotechniques 18, 768–773(1995).

29. Chomczynski, P. & Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem. 162, 156–159 (1987).

30. Lathrop, G. M., Lalouel, J. M., Julier, C. & Ott, J. Multilocus linkage analysis in humans: Detection oflinkage and estimation of recombination. Am. J. Hum. Genet. 37, 482–498 (1985).

Acknowledgements. We acknowledge the support of the New Zealand Lottery Grants Board, HealthResearch Council of New Zealand, Maurice and Phyllis Paykel Trust, Healthcare Otago Charitable Trustand the Cancer Society of New Zealand; we thank G. Barbezat, J. Cutfield, R. J. M. Gardner, D. Perez,T. Sutton, E. Richardson, D. Shaw, L. Scanlon, J. Ratema, J. Dunphy, I. Morison, M. Eccles for advice andthe participating families.

Correspondence and requests for materials should be addressed to P.G. (e-mail: [email protected]).

letters to nature

NATURE | VOL 392 | 26 MARCH 1998 405

Stabilizationofwild-typep53byhypoxia-inducible factor1aWon G. An*, Meera Kanekal*, M. Celeste Simon†,Emin Maltepe‡, Mikhail V. Blagosklonny*& Leonard M. Neckers§

* Department of Cell and Cancer Biology, Medicine Branch, NCI, NIH, Bethesda,Maryland 20892, USA† Departments of Medicine and Molecular Genetics and Cell Biology, and‡ Department of Pathology, Howard Hughes Medical Institute, University ofChicago, Chicago, Illinois 60637, USA§ Medicine Branch, NCI, NIH, Key West Facility, 9610 Medical Center Drive,Room 300, Rockville, Maryland 20850, USA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Although hypoxia (lack of oxygen in body tissues) is perhaps themost physiological inducer of the wild-type p53 gene1, themechanism of this induction is unknown. Cells may detect lowoxygen levels through a haem-containing sensor protein2. Thehypoxic state can be mimicked by using cobalt chloride and theiron chelator desferrioxamine2–5: like hypoxia, cobalt chloride anddesferrioxamine activate hypoxia-inducible factor 1a (HIF-1a)(ref. 6), which stimulates the transcription of several genes that

are associated with hypoxia6–9. Here we show that these treat-ments induce accumulation of wild-type p53 through HIF-1a-dependent stabilization of p53 protein. Induction of p53 does notoccur in either a mutant hepatoma cell line that is unable toinduce HIF-1a (ref. 10) or embryonic stem cells derived from

Figure 1 Cobalt chloride and desferrioxamine cause p53 protein stabilization.

a, Cobalt chloride and desferrioxamine induce wild-type p53 protein accumulation in

MCF7 cells. Wild-type p53 was measured by western blot at various times after

addition of cobalt chloride or desferrioxamine (DFX). b, Cobalt chloride and

desferrioxamine increase wild-type p53 protein levels by stabilization. Cobalt chloride

or desferrioxamine was added to MCF7 cells for 6 h, the half-life of p53 was then

determined by [35S]-methionine pulse-chase analysis. p53-band intensity was

quantified by image analysis. Band intensities are expressed as a percentage of the

control signal (pulse only, no chase). Inset 1 depicts a northern blot showing p53

mRNA levels (upper panel) in untreated (lane 1), cobalt-chloride-treated (lane 2), or

desferrioxamine-treated (lane 3) MCF7 cells 6h after treatment. The blot was stripped

and reprobed for actin (lower panel). Inset 2 shows a representative result of [35S]-

methionine pulse-chase analysis in untreated and desferrioxamine-treated cells.

Figure 2 Induction of p53 by cobalt chloride and desferrioxamine requires

concomitant induction of HIF-1a. a–c, Cobalt chloride and desferrioxamine induce

HIF-1a protein accumulation in MCF7 and SKBr3 cells, but do not induce

accumulation of mutated p53 in SKBr3 cells. Cells were exposed to either cobalt

chloride or desferrioxamine for 6h and lysed; western blots were probed for either

HIF-1a (MCF7 and SKBr3 cells) or mutated p53 (SKBr3 cells). Untreated cells are

shown in lanes a1, a3, b1 and c1; cobalt-chloride-treated cells are shown in lane 2

of a–c; desferrioxamine-treated cells are shown in lanes a4, b3 and c3. d, Cobalt

chloride and desferrioxamine induce HIF-1a accumulation in Hepa1c1c7 but not

in Hepa1c4 cells. Cells were treated with cobalt chloride or desferrioxamine for

6 h and nuclearextracts were western blotted to locate HIF-1a. Untreated cells are

shown in lanes 1 and 4; cobalt-chloride-treated cells are shown in lanes 2 and 5;

and desferrioxamine-treated cells are shown in lanes 3 and 6. e, Cobalt chloride

and desferrioxamine induce p53 accumulation in Hepa1c1c7 but not Hepa1c4

cells, whereas proteasome inhibition induces p53 accumulation in both cell lines.

Cells were treated with either cobalt chloride or desferrioxamine and blotted for

p53 as in Fig.1. Untreated cells are shown in lanes 1 and 4; cobalt-chloride-treated

cells are shown in lanes 2 and 5; and desferrioxamine-treated cells are shown in

lanes 3 and 6. Alternatively, both cell lines were exposed to the proteasome

inhibitor ALLN for 6 h and blotted for p53. Untreated cells are shown in lanes 7 and

9, and ALLN-treated cells are shown in lanes 8 and 10. f, Desferrioxamine induces

HIF-1a protein accumulation in normal ES cells, but not in ES HIF− cells. Lanes 1

and 3 show untreated cells; lanes 2 and 4 show results from cells exposed to

desferrioxamine for 6 h. g, Desferrioxamine induces p53 accumulation in normal

ES cells, but not in ESHIF− cells. Lanes 1 and 3 show untreated cells; lanes 2 and 4

show cells exposed to desferrioxamine for 6 h.

Documents

document