CHARACTERIZATION OF BENEFICIAL BACTERIA WITHIN CITRUS RHIZOSPHERIC MICROBIOME AND THEIR EFFECT ON PLANT IMMUNE RESPONSE

By

NADIA RIERA FARAONE

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

© 2017 Nadia Riera Faraone

To my family

4

ACKNOWLEDGMENTS

In the first place I would like to thank my PI, Dr. Wang. For his guidance and

encouragement made me pursue a doctorate in his laboratory. Among many other

things I learned from his ambition and interest for bacterial pathogenic interactions with

plants.

I also want to acknowledge my committee members Megan Dewdney, Joseph

Larkin, Wayne Nicholson, and Kirsten Pelz-Stelinski for their guidance, suggestions and

technical help in many ways. Always going from critical questions to words of

encouragement. I would like to note their human side as well, always interested in my

well being outside my projects. I should give a special thanks to Dr. Dewdney and Dr.

Pelz-Stelinski’s labs for their incredible guidance in their fungal and insect worlds,

respectively.

I would also owe a big part of this to all my lab mates who help me go through

these years and taught me laboratory techniques as well as stories from their own

cultures from which I learnt a lot. Yunzeng Zhang, Max Andrade, Jin Xu, Qing

Yan, Yanan Zhang. I should include a special thanks to my elder “phd-siblings" Neha

Jalan, Xiaofeng Zhou, Utpal Hendique and Samiksha Prasad for their encouragement,

motivation and friendship.

I want to thank the Microbiology and Cell Science Department for all the courses

I took and the possibility to teach in a different country with all its associated cultural and

academic challenges. I would like to thank Monica Oli for her guidance through the

process and her never-ending patience.

My friends back home, my friends in Gainesville and the ones that already left

Lake Alfred had been incredible at maintaining friendship across seas and continents. I

5

should mention a big thanks to my friends in CREC. They had been a second family to

me here.

Part of this would never have been possible without my wonderful husband

Martin Llofriu and his patience. Finally, I would like to acknowledge the amazing family I

am lucky to have. For encouraging my decisions and supporting me always.

6

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .............................................................................................................. 4

LIST OF TABLES ......................................................................................................................... 9

LIST OF FIGURES..................................................................................................................... 10

LIST OF ABBREVIATIONS ...................................................................................................... 12

ABSTRACT ................................................................................................................................. 15

CHAPTER

1 LITERATURE REVIEW ...................................................................................................... 17

Introduction .......................................................................................................................... 17 Asiaticus Citrus Canker ...................................................................................................... 18 Huanglongbing Disease Pyramid ..................................................................................... 18 Escape Plants and HLB ..................................................................................................... 20 Plant Growth Promoting Bacteria ..................................................................................... 20 Systemic Immunity in Plants ............................................................................................. 21 Bacterial and Chemical Elicitors of Systemic Resistance ............................................ 23 The Plant Defense, what can we Expect from an ‘Activated’ Citrus Plant? .............. 24 Bacterial Inoculations in Crop Protection ........................................................................ 25 Limitations of Systemic Resistance and Bacteria Application in Crop Protection .... 26 Hypothesis and Rationale .................................................................................................. 28

2 CHARACTERIZATION OF BENEFICIAL BACTERIA .................................................. 31

Introduction .......................................................................................................................... 31 Materials and Methods ....................................................................................................... 32

Isolation of Bacteria from Healthy Citrus Rhizosphere .......................................... 32 Bacterial and Fungal Growth Conditions ................................................................. 33 Antibacterial Activity .................................................................................................... 33 Identification of Beneficial Bacteria and Phylogenetic Analysis ........................... 34 Antimicrobial Activity against Citrus Pathogenic Fungi and Phytophthora

spp. ............................................................................................................................. 34 Volatile-Mediated Antifungal Activity......................................................................... 36 Statistical Analysis of Growth Inhibition by Volatiles .............................................. 36 Characterization of Beneficial Traits in vitro ............................................................ 36 DNA Isolation and Genome Sequencing, Assembly and Annotation .................. 36 Identification of Genes Involved in Beneficial Traits and Antimicrobial

Production ................................................................................................................. 37

7

Results .................................................................................................................................. 38 Isolation of Antimicrobial Producing Bacteria from Healthy Citrus

Rhizosphere .............................................................................................................. 38 Bacteria Identification and Phylogenetic Analysis .................................................. 38 Antimicrobial Activity Against Phytophthora spp. and Citrus Pathogenic

Fungi........................................................................................................................... 39 General Features of the Genomes ........................................................................... 40 Genes Responsible for Beneficial Traits .................................................................. 41

Phosphate solubilization and iron acquisition .................................................. 41 Osmoprotection and osmotic tolerance ............................................................ 42 Phytohormone production ................................................................................... 42 Antagonism and nutrient competition ................................................................ 43 Enzymes involved in VOC production ............................................................... 43

Antimicrobial Biosynthesis Gene Clusters ............................................................... 45 Discussion ............................................................................................................................ 46 Conclusions.......................................................................................................................... 49

3 ISR-ELICITING CAPACITY OF RHIZOSPHERIC BACTERIA.................................... 60

Introduction .......................................................................................................................... 60 Materials and Methods ....................................................................................................... 62

Bacterial Cultures and Growth Conditions ............................................................... 62 Plants Material and Treatments ................................................................................. 62 Xanthomonas citri subsp. citri Inoculation and Disease Severity Estimation ..... 63 Image Processing Analysis ........................................................................................ 63 RNA Extraction and Relative Gene Expression Analysis ...................................... 64 Plant Hormones Quantification and Reactive Oxygen Species

Determination ............................................................................................................ 64 Statistical Analysis ....................................................................................................... 66

Results .................................................................................................................................. 66 Bacteria Application in the Root Was Able to Reduce Citrus Canker

Development ............................................................................................................. 66 Beneficial Bacteria Trigger Changes in Expression of Defense-Related

Genes ......................................................................................................................... 67 P. geniculata Modulates Hormone and ROS Levels in Grapefruit ...................... 68

Discussion ............................................................................................................................ 69 Conclusions.......................................................................................................................... 72

4 EXPLORING THE EFFECT OF PSEUDOMONAS GENICULATA ON CITRUS ROOTS ................................................................................................................................. 78

Introduction .......................................................................................................................... 78 Materials and Methods ....................................................................................................... 80

Plant Material for Psyllid Studies ............................................................................... 80 Psyllid Movement and Efficiency Assays ................................................................. 81

8

Test the Control Effect of P. geniculata on HLB in a Field Trial ........................... 81 Root and Rhizosphere DNA Extraction .................................................................... 82 DNA Sequencing Processing..................................................................................... 83 OTUs Specific Relative Abundance .......................................................................... 84 Fruit Yield and Quality Measurements ..................................................................... 84 Las Population Determination .................................................................................... 84 Statistical Analysis ....................................................................................................... 85

Results .................................................................................................................................. 85 P. geniculata Root Application Changes Psyllid Feeding Efficiency but not

Preference ................................................................................................................. 85 P. geniculata Application has no Significant Impact on the Native Microbial

Community ................................................................................................................ 86 Survival of P. geniculata in Citrus Rhizosphere and Interaction with Las........... 87 No Significant Changes in Las Population in the Root Tissues were

Detected..................................................................................................................... 88 P. geniculata Application and Citrus Yield and Juice Quality ............................... 88

Discussion ............................................................................................................................ 89 Conclusions.......................................................................................................................... 92

5 CONCLUDING REMARKS.............................................................................................. 101

APPENDIX

A MEDIA COMPOSITION ................................................................................................... 104

B MICROORGANISMS USED IN THIS STUDY ............................................................. 105

LIST OF REFERENCES ......................................................................................................... 106

BIOGRAPHICAL SKETCH ..................................................................................................... 127

9

LIST OF TABLES

Table page 1-1 Microbial molecular traits responsible for ISR in plants. .......................................... 30

2-1 Molecular identification of six antibacterial-producing strains. ................................ 50

2-2 Phosphate solubilization and siderophore production traits in rhizospheric bacteria ............................................................................................................................ 50

2-3 Secondary metabolites biosynthesis gene cluster prediction by AntiSMASH. ..... 51

2-4 General features of the four draft genomic sequences ............................................ 52

3-1 Primers used for expression analysis of plant defense genes ................................ 74

4-1 Experimental design of the evaluation of P. geniculata application in the field .... 94

B-1 Bacterial strains used in this study ............................................................................ 105

10

LIST OF FIGURES

Figure page 2-1 Producing beneficial bacteria phylogeny based in 16S rDNA sequences from

the six beneficial bacteria and its closest type strain. .............................................. 53

2-2 Dual culture antimicrobial activity in vitro. Activity of three antimicrobial producing bacteria was tested against Colletotrichum acutatum, Alternaria alternata, Phytophthora nicotianae and Phytophthora palmivora .......................... 54

2-3 Overlay antifungal activity in vitro. ............................................................................... 55

2-4 Antimicrobial activity against Phytophthora nicotianae in compartmentalized petri dishes. ..................................................................................................................... 56

2-5 Beneficial traits related genes. ..................................................................................... 57

2-6 Heat map of genes involved in siderophore production and iron acquisition. ...... 58

2-7 Heat map representing the number of genes involved in osmoprotection. Enzymes involved in the synthesis of trehalose and cardiolipin are shown for all four bacteria. .............................................................................................................. 59

2-8 Structural prediction of the NRPS antibiotic encoded in B. pumilus strain 104 Cluster 1.. ........................................................................................................................ 59

3-1 Image processing analyses example. ImageJ was used in two steps to estimate the total area of disease. .............................................................................. 75

3-2 A) Representative pictures of canker development in (leaves). B) Boxplot represent the mean number of lesions per leaf for all plants (n=12). Boxplot with the normalized area of disease. .......................................................................... 75

3-3 Relative expression analysis of defense-related genes using RT-qPCR in leaf tissue. ............................................................................................................................... 76

3-4 Reactive oxygen species levels in leaves treated with P. geniculata strain 95, ASM or non-treated control. ROS levels were quantified at day three, five and eight post root treatment application using DHR123 probe. ............................ 77

3-5 Normalized hormone content in leaf tissue of 'Duncan' grapefruit treated with 95 (P. geniculata strain 95), Actigard and non-treated control. .............................. 77

4-1 'Hamlin' sweet orange trees were treated with three bacterial concentrations. ... 95

11

4-2 P. geniculata root application reduces feeding efficiency but does not affect psyllid preference. .......................................................................................................... 96

4-3 Bar plot with the microbial community structure in the rhizosphere and root of trees at the phyla level. ................................................................................................. 97

4-4 Alpha and beta diversity analyses in microbial composition of root (blue) and rhizosphere (red). ........................................................................................................... 97

4-5 Diversity between samples. PCoA using the Weigthed UniFrac method showing no separation between non-treated (red) and P. geniculata-treated (purple) trees. .................................................................................................................. 98

4-6 Relative abundance of reads corresponding to V4 16s rDNA sequence of Candidatus Liberibacter asiaticus and Stenotrophomonas family. ........................ 98

4-7 Disease development was monitored in Hamlin sweet orange trees P. geniculata - treated with three different concentration: (6) 106 , (7) 107 , (8) 108 cfu/mL and (Control) non treated control trees. .................................................. 99

4-8 Fruit yield expressed as kg of fruit per tree after January 2017 Harvest. ............. 99

4-9 Juice quality parameters based on standard measurements of acidity, total brix content and percentage of juice content. .......................................................... 100

12

LIST OF ABBREVIATIONS

AA Azelaic acid

ABA Abscisic acid

ACC 1-aminocyclopropane 1 carboxylate

ANOVA ANalysis Of Variance

AntiSMASH Antibiotics and Secondary Metabolity Analysis Shell

ASM Acibenzolar-S-methyl

Aza Diazelaic acid

BABA DL-3-aminobutyric acid

BCC Burkholderia cepacia complex

BGC Biosynthetic gene cluster

CAT Catalase

CREC Citrus Research and Education Center

Ct Cycle Threashold

DAPG 2,4-diacetylphloroglucinol

DNA Deoxyribonucleic acid

ET Ethylene

G3P Glycerol-3-phosphate

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GPX Phospholipid hydroperoxide glutathione peroxidase

HLB Huanglongbing

HPL Hydroperoxide lyase

HPL1 Fatty acid hydroperoxide lyase

HSB Hue Saturation Brigthness

IAA Indole acetic acid

13

INA 2,6-dichloroisonicotinic acid

ISR Induced systemic resistance

JA Jasmonate

Las Candidatus Liberibacter asiaticus

MeSA Methyl salycilate

MPK4 Mitogen-activated protein kinase 4

MYC Transcriptional regulator MYC2

NA Nutrient Agar

NB Nutrient Broth

NCBI National Center for Biotechnology Information

NPR1 Non-represor of pathogenesis related genes - 1

NRPS Non-ribosomal peptide synthetase

OUT Operational taxonomic unit

PAL1 Phenylalanine ammonia lyase 1

PATRIC Pathosystems Resourxe Integration Center

PCoA Principal Coordinate Analyses

PDA Potato Dextrose Agar

PGPB Plant Growth Promoting Bacteria

Pip Pipecolic acid

PR1 Pathogenesis related protein 1

PR2 Pathogenesis related protein 2

PR5 Pathogenesis related protein 5

qPCR Quantitative Polymerase Chain Reaction

RNA Ribonucleic acid

ROS Reactive Oxygen Species

14

rpm revolutions per minute

RT-qPCR Real Time Quantitative Polymerase Chain Reaction

SA Salicylic acid

SAM S-adenosyl-L-methionine-salicylic acid carboxyl

methyltransferase

SAR Systemic acquired resistance

STAMP Statistical analysis of taxonomic and functional profiles

TukeyHSD Tukey Honest Significant Differences

VOCs Volatile organic compounds

Xcc Xanthomonas citri subsp. citri

15

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF BENEFICIAL BACTERIA WITHIN CITRUS RHIZOSPHERIC

MICROBIOME AND THEIR EFFECT ON PLANT IMMUNE RESPONSE

By

Nadia Riera

August 2017

Chair: Nian Wang Major: Microbiology and Cell Science

The microbiome associate with plants is an essential part of the plant health and

productivity. The beneficial microorganisms living in close proximity to plants can

improve plant’s nutrition, antagonize pathogens and modulate the plant immune

response. In Florida, most citrus groves are infected with Huanglongbing (HLB)

pathogen. However, some plants remain healthy in appearance and they are named

“escape plants”. We hypothesized that the microbiome associated with HLB escape

citrus plants could harbor natural positive interactions that could be exploited in

agricultural practices. We identified microorganisms from the rhizosphere and searched

for antimicrobial activity in vitro. Six strains with antibacterial and antifungal activity were

selected. Secondly, the possible effect on plant immunity activation by these strains was

explored by inoculating young plants under greenhouse conditions and evaluating their

ability to protect themselves from Xcc. Additionally, we studied the relative gene

expression, the reactive oxygen species production and phytohormone levels to

characterize plant defense responses induced by bacterial treatment. We found that

three strains Burkholderia metallica, Burkholderia territorii and Pseudomonas geniculata

were able to induce plant defense responses. Additionally, we explored the effect of P.

16

geniculata application on the root in terms of the effect on psyllid behavior. Psyllid

feeding efficiency with P. geniculata-treated plants was lower than non-treated controls

for the first twenty-four hours. Finally, in a field trial we explored the impact of P.

geniculata application to citrus roots. We studied the microbial community structure of

the native rhizosphere and P. geniculata-treated plants for a period of six weeks and we

observed no changes in the community diversity between treatments. Moreover, we

studied the possible interaction with Candidatus Liberibacter asiaticus by quantifying the

pathogen population in the root tissue over time. Citrus productivity and fruit quality

were also evaluated between treatments and we observed some differences in fruit

acidity and fruit percentage. To conclude, we identified bacteria from the rhizosphere of

escape plants that can evoke plant defense responses and harbor beneficial traits.

Future work in field experiments is needed to further investigate the effects of bacteria

application and how to optimize their use for crop management strategies.

17

CHAPTER 1 LITERATURE REVIEW

Introduction

All multicellular organisms can be considered as holobionts. Holobionts are the

result of multicellular organisms co-evolving with their associated symbiotic

microbiomes in a close manner. In plant biology, considering plants and their associated

microbiomes as a whole entity may allow one to understand the natural beneficial

strategies of protection (Vandenkoornhuyse et al., 2015). Many studies have focused

their attention on understanding the role of the microbiome in its impact on plant health

and productivity (Berg et al., 2014; Lebeis, 2014; Schlaeppi and Bulgarelli, 2014; Turner

et al., 2013; Wagg et al., 2014).

The host plant can selectively shape the microbial community by recruiting

specific taxa from the bulk soil to the rhizosphere or rhizoplane1. Microbes in the

rhizosphere of plants have been known to suppress diseases, compete for resources

making them unavailable for pathogens, promote stress resistance and improve overall

yield by providing nutrients (Lugtenberg and Kamilova, 2009; Mendes et al., 2011).

Upon attack by specific pathogens, the plant not only recruits specific microbes but also

awakens the microbiome activity to increase its protective activity (reviewed in

Berendsen et al., 2012). Correspondingly, plant associated microbes can protect the

plant by producing antibiotic compounds and by activating the plant immune system.

1 In plant-microbiome interactions several layers define different compartments in terms of space and proximity to the plant. The rhizosphere is defined as the soil in close proximity to the root system highly influenced by root exudates. The rhizoplane includes the compartment directly attached to the root. Finally, the endosphere is defined as the compartment that exist inside the plant.

18

Asiaticus Citrus Canker

Xanthomonas citri subsp. citri (Xcc) is a gram negative proteobacteria able to

infect most citrus varieties causing asiaticus citrus canker (reviewed in Ryan et al.,

2011). The pathogen initially survives as an epiphyte on the surface of leaves, fruits or

twigs and then penetrates the plant tissue through stomata or wounds. Once inside the

plant, the bacteria multiplies in the intercellular spaces causing characteristic necrotic

lesions (A.K. Das, 2003). In the leaves these circular lesions develop a blister-like

appearance and turn yellow in color making them easy to recognize.

Citrus canker control strategies include copper-based formulations, use of

tolerant cultivars, chemical elicitors of plant immunity, and control of citrus leafminer.

However, these strategies are not sufficient to fully eradicate the pathogen (Behlau et

al., 2017). Furthermore, the prolonged use of copper compounds has led to the

development of copper-resistance Xcc strains in Argentina and more recently in

Réunion Island, France (Behlau et al., 2012; Richard et al., 2016).

Huanglongbing Disease Pyramid

Citrus greening or Huanglongbing (HLB) is a devastating citrus disease (Bové et

al., 1974; Wang and Trivedi 2013). HLB involves actors from three different kingdoms:

Animalia (the insect psyllid vector), Plantae (Citrus host) and Bacteria (the associated

gram negative bacterium Candidatus Liberibacter asiaticus). In addition, the

surrounding environment and, in particular, the complex phytobiome2 associated with

the host plant can also be involved in this complex interacting network.

2 The phytobiome refers to all factors that interact with the plant including soil, microbial communities (microbiome), nematodes, insects and other animals.

19

HLB in Florida has been associated with the gram negative α-proteobacteria

Candidatus Liberibacter asiaticus (Las) which has not been cultured in vitro (Bové,

2006; Jagoueix et al., 1994). In the Americas, Las is transmitted mainly through the

psyllid vector Diaphorina citri Kuwayama (Hemiptera: Liviidae) (Teixeira et al., 2005)

and grafting with Las infected scions (Halbert and Manjunath, 2004). Diaphorina citri

transmission is the most important factor in HLB epidemiology (Wang and Trivedi,

2013). Once Las enters the phloem it can multiply and spread throughout all phloem-

containing tissues of the plant including leaf, bark, flowers, fruit and roots (Tatineni et

al., 2008). Las colonization and dispersion within the phloem are complex and it seems

to depend on environmental factors such as differences in temperature, solar radiation

and wind (Louzada et al., 2016).

Currently no effective management method has been found for HLB disease and

most efforts to control the disease rely on insecticide applications to control the vector

population. Insecticide applications can vary from eight to fifteen applications per year

(Kanga et al., 2016; Tiwari et al., 2011). The extensive chemical control use has raised

concerns for environmental pollution, killing of beneficial insects, and development of

insecticide resistance (Chen et al., 2017; Kanga et al., 2016; Tiwari et al., 2011). For

example, the residues of chemical insecticides can be toxic for honey bee (Apis

mellifera L. (hymenoptera: Apidae)) (Chen et al., 2017).

HLB directly interacts with the root system and its associated microbiome. In

addition, at late stages HLB disrupts carbohydrate metabolism in the plant and changes

root physiology by decreasing starch content (Etxeberria et al., 2009). Recently, studies

suggest that Las can be first detected in the root system and significantly affect root

20

density even in trees that maintain a healthy appearance in aerial tissues (Johnson et

al., 2014). Apart from the impact of Las on root physiology, HLB induces root

predisposition to secondary infection by Phytophthora nicotianae which results in a

higher damage to fibrous roots (Graham et al., 2013).

Escape Plants and HLB

It has been observed that some surviving trees called escape plants in severely

HLB diseased groves can maintain their healthy status. Escape plants share the same

genotype with symptomatic trees and they are grown under similar environmental

conditions. Therefore, it has been proposed that a possible explanation for the observed

differences may be related with its associated microbiome (Sagaram et al., 2009).

Furthermore, the microbial community of these escape plants seems to be enriched in

beneficial traits as compared to that of symptomatic trees (Trivedi et al., 2010). Previous

studies in our lab isolated multiple plant growth promoting bacteria (PGPB) from the

rhizosphere of escape citrus trees (Trivedi et al., 2010).

Plant Growth Promoting Bacteria

Beneficial microbes, or PGPB (Plant Growth Promoting Bacteria) are able to

improve plant health by direct and/or indirect mechanisms (reviewed in Compant et al.,

2005, 2010; Glick, 2012; Haas and Défago, 2005). Their use in agricultural system is

still considered a promising approach to improve plant productivity (Busby et al., 2017;

Ciancio et al., 2016). Direct mechanisms include nutrient facilitation, iron sequestration

and modulation of plant hormones. Indirect mechanisms include production of

antimicrobial compounds, volatile organic compound release, niche competition, and

metabolic plasticity against environmental stresses (Haas and Keel, 2003; Mazurier et

al., 2009; Pieterse et al., 2014, 2009; Whipps, 2001).

21

The most studied nutrient facilitation mechanisms involved in plant growth

promotion are nitrogen fixation, iron sequestration, and phosphate solubilization.

Phosphate can be made bioavailable by PGPB by solubilization (mainly by producing

gluconic acid or citric acid) or by mineralization by phosphatases (Rodriguez et al.,

2004). Additionally, plant hormones can be produce by some PGPB. In particular,

cytokines, Indole acetic acid (IAA), and ethylene can be produced and affect plant

growth or inhibition (Glick, 2005; Glick et al., 2007; Nieto and Frankenberger, 1989;

Spaepen et al., 2007).

Bacteria in the rhizosphere can serve as a buffer for changes in environmental

stresses for the plant host (Vandenkoornhuyse et al., 2015). PGPB had been reported

to effectively protect plants from flooding, drought, salt, metal toxicity and extreme

temperatures (reviewed in Glick, 2012).

Among the indirect mechanisms of plant promotion, one of the best-studied is the

antagonistic activity of some PGPB. Many Burkholderia spp., Pseudomonas spp.,

Bacillus spp., Streptomyces spp., strains are able to produce antibiotic compounds,

and/or lytic enzymes that inhibit phytopathogen growth (Haas and Défago, 2005; Haas

and Keel, 2003; Mazurier et al., 2009). Additionally, some beneficial strains compete for

their niche aggressively producing extracellular enzymes such as chitinases, cellulases,

and ß-1,3 glucanases that can inhibit fungal growth.

Systemic Immunity in Plants

Systemic resistance occurs naturally in plants when properly stimulated by

certain pathogens, non-pathogens, herbivory or some chemical treatments (Kuć, 1982).

Once activated, primed plants can respond faster and more strongly to pathogen attack.

Depending on the pathway awakened after stimuli recognition, the systemic response is

22

usually classified into 1) systemic acquired resistance (SAR), 2) induced systemic

resistance (ISR) or 3) herbivore induced resistance (HIR).

1) Systemic acquired resistance (SAR) can be triggered by pathogenic as well as

non-pathogenic bacteria and chemical compounds. SAR response is typically mediated

by the plant hormone salicylic acid (SA, Kachroo and Robin, 2013). Commercially

available chemicals such as Acibenzolar-S-methyl (ASM) can induce SAR in many plant

species and are currently widely used for crop protection because of its activation

properties (Walters et al., 2013). Some beneficial bacteria are also known to stimulate

plant immunity in a SAR manner by SA-dependent pathways. Examples of these SAR-

eliciting beneficial bacteria are Paenibacillus alvei K165 and P. fluorescens SS101

(Tjamos et al., 2005; van de Mortel et al., 2012). SAR signaling throughout the plant is

mediated by small molecular compounds such as methyl salicylate (MeSA), pipecolic

acid (Pip), diazelaic acid (Aza) and glycerol-3-phosphate (G3P) (Chanda et al., 2011;

Návarová et al., 2012; Park et al., 2007; Yu et al., 2013).

2) Some beneficial bacteria can activate the plant through the

jasmonate/ethylene (JA/ET) pathways in what is usually called induced systemic

resistance (ISR). In this context, when properly stimulated by beneficial microbes and a

specific recognition in the roots occurs, the plant can acquire a systemically enhanced

capacity against a broad spectrum of phytopathogens (van Loon et al., 1998).

Moreover, some beneficial bacteria are able to enhance systemic resistance against

insect pests. For instance, Bacillus pumilus INR-7 inoculations in greenhouse and field

conditions showed a significant effect on Acalyma vittalum and Ciabrotica

undecimpunctata populations in cucumber (Zehnder et al., 1997a). Bacillus sp.

23

inoculations in cotton were shown to have a systemic resistance effect against

Spodoptera exigua, with significantly reduced larvae feeding in bacteria-treated plants

compared with non-treated controls (Zebelo et al., 2016). The observed differences

between treatments also correlate with jasmonic acid (JA) levels in planta and relative

expression of JA-related genes. In terms of defense against herbivores, the

phytohormone JA has a fundamental role in triggering the plant defense system (War et

al., 2012). The specific recognitions and the molecular mechanisms of activation of

induced systemic resistance are still poorly understood (Pieterse et al., 2014).

3) Herbivore Induced Resistance (HIR) is the systemic response against

herbivore associated elicitors (HAE) and involves the recognition of damaged tissue in

the plant (Schuman and Baldwin, 2016). As a result of HIR, the key metabolic response

includes the JA-mediated defenses which act through direct as well as indirect

mechanisms (War et al., 2012). Briefly, direct mechanisms include mechanical barriers

and the production of toxic compounds. Indirect mechanisms, on the other hand,

include the attraction of natural enemies by producing volatile organic compounds

(VOC) and extra floral nectar (EFN). SA has also been shown to have an effect in the

defense against piercing and sucking insects (Zhao et al., 2009). Additionally, reactive

oxygen species (ROS) production mediated by a SA-defense response may also be

involved in defense against insects (Peng et al., 2004). In particular, the production of

H2O2 can negatively impact insect growth and development by damaging the digestive

system (Maffei et al., 2007; Peng et al., 2004).

Bacterial and Chemical Elicitors of Systemic Resistance

Beneficial bacteria able to induce systemic resistance include different gram

negative as well as gram positive bacteria. Some of the molecules recognized by the

24

plant are summarized in Table 1-1 and reviewed by Burketova (2015). Briefly, cell wall

components, as well as secreted metabolites, siderophores and antibiotics are known to

be able to trigger ISR. Chemical elicitors of systemic resistance are very diverse in its

structure and they generally produce resistance against a broad spectrum of

phytopathogens (Lyon, 2014). Some examples are 2,6-dichloroisonicotinic acid (INA),

acibenzolar-S-methyl (ASM) also known as benzothiadiazole (BTH), DL-3-aminobutyric

acid (BABA) and azelaic acid (AA). Most known elicitors described thus far act by either

mimicking the signal molecules involved in developing the defense (such as SA) or by

mimicking the plant enemy itself (such as flagellin, chitosan and harpin) (Heil, 2014).

The Plant Defense, what can we Expect from an ‘Activated’ Citrus Plant?

By definition primed plants can respond faster and more strongly against a

pathogen challenge. Importantly, this response is thought to be awoken only after

pathogen challenge and it is therefore considered cost-efficient for the plant (Conrath et

al., 2001). Activated plants respond better to pathogen attack by using basal defense

barriers as well as those induced upon proper stimulation. The physiological

mechanisms are typically structural barriers (such as cell wall appositions like callose or

defense lignin), production of phytoalexins3, production of reactive oxygen and nitrogen

species (ROS and RNS), production of antimicrobial proteins and pathogenesis-related

(PR) - proteins (Garcion et al., 2014).

Previous work has focused on exploiting systemic resistance in citrus as a way to

protect it against pathogens. The activation of systemic resistance reported thus far is

through the application of chemical SAR-triggering elicitors such as ASM, INA and

3 Low molecular non-peptidic antimicrobial compounds produced by the plant.

25

BABA. In greenhouse studies, ASM and INA soil application on citrus resulted in

reduced disease severity of citrus canker when challenging the plant with Xanthomonas

citri subsp. citri (Francis et al., 2009). The resulting protective response observed lasted

for twenty-four months after pathogen challenge. Further work conducted in young

grapefruit trees under field conditions suggest that the reduction of canker incidence

was dependent on the rate, frequency and application method of the SAR-inducers

(Graham and Myers, 2011). Additionally, BABA treatment of 'Swingle' citrumelo showed

a negative impact on Diaphorina citri adult, nymph and egg development (Tiwari et al.,

2013). Field studies with BABA, ASM, INA and AA treated trees show a decrease of the

Ca. L. asiaticus population. Interestingly, during the two-year study certain applications

of AA, BABA and INA showed a higher yield (kg of fruit/tree) than negative control (Li et

al., 2015). In all cases, plants treated with SAR-elicitors have a higher relative gene

expression of the SAR marker gene PR-2 (which encodes for a ß-1,3 glucanase)

suggesting that the SAR response is successfully achieved. The reduction in disease

severity seems to be related to the plant physiological response and not a direct toxicity

of the chemical compounds (Francis et al., 2009; Li et al., 2015; Tiwari et al., 2013).

Taken together, the previous results suggest that, when properly stimulated, citrus

systemic resistance can act as an effective method to control citrus canker and HLB to

some extent.

Bacterial Inoculations in Crop Protection

Bio-based inoculants are used because of their biocontrol and/or plant growth

promoting properties. In order to perform its beneficial activity in the soil, however,

bacterial inoculants must survive and successfully colonize the rhizospheric

environment (Cavaglieri et al., 2005; Duffy and Weller, 1996). Under field conditions,

26

applied bacteria must be able to colonize the root system and survive environmental

stresses. Additionally, it is important to evaluate the impact of the incorporation of a

specific bacterial inoculant in the native microbial composition of the soil. One of the

most important aspects in terms of using bacterial inoculates for crop protection is

maintaining soil quality (Zancarini et al., 2013). In this way, previous groups have

studied the impact on the microbial community in the rhizosphere of cucumber after

Bacillus subtilis B068150 application. In this study there were no significant changes in

the microbial diversity, although the impact was dependent on the soil type. As

expected, the abundance of B. subtilis increased after inoculation but without

significantly affecting bacterial diversity (Li et al., 2015). A two-year study of the

microbial community from the rhizosphere of banana showed that the application of

Bacillus amyloliquefaciens NJN-6 decreased fungal diversity and increases bacterial

diversity. Moreover, these observed changes correlate with the suppression of

Fusarium wilt (Shen et al., 2015). It seems that understanding the impact on the

microbial community and the ability to survive under field conditions are two key issues

in the development of microbial inoculants.

Limitations of Systemic Resistance and Bacteria Application in Crop Protection

Although being a promising tool for the development of environmentally friendly

strategies for crop protection, there are some limitations or important negative traits

associated with systemic resistance.

First of all, plant immune systems are usually subject to strict cross-talk

regulation. In this way, a plant with an activated SA-pathway and showing enhanced

resistance against biotrophic pathogens may become more susceptible to herbivores

(Heil, 2014). Secondly, there are allocation and ecological costs associated with the

27

activation of disease resistance. That is to say, the synthesis of defense-related

proteins, phytoalexins and secondary metabolites is expensive in terms of energy and

nutrient availability. The associated cost can interfere with other important physiological

processes such as photosynthesis and growth (Herms and Mattson, 1992). However,

the allocation costs are not so high in ‘primed’ plants, where the physiological response

is not fully awaken until pathogen attack (Conrath et al., 2001; van Hulten et al., 2006;

Walters et al., 2008). On the other hand, there are also ecological costs referring to the

impact of interfering with the plant immunity. A plant with enhanced defense capacity

may become less tolerant to beneficial bacteria and mycorrhiza colonization (Heil,

2014). Moreover, one of the most important negative aspects of application of systemic

resistance elicitors is the lack of reproducibility of certain positive effects. Namely, the

results can vary with the year of application, site, dose, method, cultivar, and so forth

(Heil, 2014). In some cases, the positive effect in disease suppression is subject to

nutrient availability (Heil et al., 2000). Due to the high variability associated with the

induction of systemic resistance, a deeper understanding of the system is needed to

optimize its use. In particular, using beneficial bacteria inoculations in many cases is not

sufficient to fully protect plants from disease, but it is still considered a promising

method in an integrated protecting management approach (Walters and Bennett, 2014).

In many cases, laboratory strains may fail to show efficacious results in the field due to

the environmental variability (Walters and Bennett, 2014). A proper characterization of

the application method, the nutrient context and the disease pressure is important to

evaluate its use.

28

Hypothesis and Rationale

The overall hypothesis of this project is that the phytobiome associated with

citrus escape plants can harbor naturally occurring beneficial interactions able to

improve citrus health by protecting plants against pathogens and/or herbivores. The

protective activity could potentially come from direct antagonistic activity, improvement

of plant health, induction of the systemic resistance or a combination of those three. The

microbiome associated with the root system has been suggested to play a vital role in

plants health and is therefore considered a promising target for the development of

environmentally friendly crop protection mechanisms.

The first objective of this work was to identify possible antimicrobial-producing

strains that could potentially be used to improve citrus root health. Specifically, we

aimed to find strains with antibacterial activity against close relatives of Las and

antimicrobial activity against phytopathogens such as the oomycete Phytophthora

nicotianae. The goal was to find isolates with activity and characterize them.

In a second objective, the beneficial bacteria showing antimicrobial activity were

evaluated in their ability to induce a systemic response in citrus. The protective

response could potentially protect citrus trees from bacterial pathogens as well as insect

feeding, being a promising approach to control citrus canker and HLB diseases. The

plant response upon a proper stimuli able to induce a systemic defense response is

called the “priming phase” (Balmer et al., 2015). During the priming phase the plant can

activate the expression of defense-related genes, the production of reactive oxygen

species or change the phythormone composition. The goal of this objective was to

evaluate effects of beneficial bacteria application on the plant defense response and

disease development. For this purpose, citrus canker was used.

29

Finally, we explored the fate of a PGPB strain via field application, its effect on

Las population, and bacterial diversity.

Despite being a challenging approach, the use of PGPB strains in field

management strategies is promising. The positive interactions emerging from citrus

rhizospheric microbiome can be exploited in the development of environmentally

friendly programs to improve plant productivity.

30

Table 1-1. Microbial molecular traits responsible for ISR in plants. Name/Class Origin Pathogen Host Reference

Lipopolysaccharide (LPS)

Gram negative bacteria

Avirulent bacteria; P. syringae pv maculicola

Brassica campestris, Arabidopsis

Graham et al., 1977; Newman et al., 2002

Secreted metabolites under iron starvation (N-alkylated benzylamine)

Pseudomonas putida

Botrytis cinerea Arabidopsis, tomato, rice, tobacco, Bean

Audenaert et al., 2002; Ongena et al., 2005

Siderophores (Pyochelim, pyoverdine, cyclic lipopeptide)

Pseudomonas aeruginosa, Pseudomonas fluorescens, Bacillus spp.

B. cinerea, P. Magnaporthe oryzae, Erwinia caratovora

Tomato, Rice, Tobacco

Audenaert et al., 2002; Cawoy et al., 2014; van Loon et al., 2008; Varnier et al., 2009; De Vleesschauwer et al., 2008

Antibiotics (2,4 DAPG, Pyocyanin)

P. fluorescens, P. aeruginosa

Peronospora parasitica, B. cinerea, Magnaporthe grisea

Arabidopsis, Tomato, Rice

Audenaert et al., 2002; Iavicoli et al., 2003

31

CHAPTER 2 CHARACTERIZATION OF BENEFICIAL BACTERIA

Introduction

Citrus greening disease or Huanglongbing (HLB) is a devastating citrus disease

(Bové et al., 1974). The gram negative α-proteobacteria Candidatus Liberibacter

asiaticus (Las) is the bacteria responsible for the disease in Florida. Las is transmitted

from plant to plant mainly through the psyllid vector Diaphorina citri (Teixeira et al.,

2005). Once Las enters the phloem, it can multiply and be transmitted throughout all

phloem-containing tissues of the plant including leaf, bark, flowers, fruits and roots

(Tatineni et al., 2008).

HLB has a remarkably strong impact in the root system and its associated

microbial composition. In HLB late infection stages, carbohydrate metabolism is affected

in the plant and root physiology changes by highly decreasing starch content

(Etxeberria et al., 2009). It has been noted that Las titer can be first detected in the root

system and significantly affect root density even in trees that remain asymptomatic in

aerial tissues (Johnson et al., 2014). In addition to the direct effect of Las on root

physiology and dieback, HLB affected root symptoms present a predisposition to

secondary infection with Phytophthora nicotianae which results in a greater damage to

fibrous roots (Graham et al., 2013).

Recently, many studies have focused their attention in understanding the role of

the microbiome on its impact in plant health and productivity (Berg et al., 2014; Lebeis,

2014; Schlaeppi and Bulgarelli, 2014; Turner et al., 2013; Wagg et al., 2014). Some

microbes in the rhizosphere of plants have been known to suppress diseases, compete

for resources making them unavailable for pathogens, promote stress resistance and

32

improve overall yield by providing nutrients (Lugtenberg and Kamilova, 2009; Mendes et

al., 2011). The combination of these symbiotic microbes living in close contact with the

root tissue and the plant itself are usually referred to as holobiont (Guerrero et al., 2013;

Vandenkoornhuyse et al., 2015).

Interestingly, some citrus trees maintain their healthy state even though most

trees are severely infected in the same grove, hereafter referred as HLB escape trees.

We hypothesize that the HLB escape trees might result from 1) antagonizing Las

directly, 2) providing plant growth promotion factors, 3) antagonizing other pests present

in the root, or 4) affecting plant resistance to HLB or psyllids (Wang et al. 2017).

The goal of this study is to isolate and characterize antimicrobial-producing

bacterial strains from the rhizosphere of HLB escape citrus trees. Additionally, the

antimicrobial activity against citrus pathogens such as Phytophthora nicotianae was

investigated. Furthermore, the production of volatile organic compounds (VOCs) is

explored. Volatiles can serve either as antifungal compounds or as signaling molecules

in the plant immune system (van Dam et al., 2016). To explore the genomic basis of the

identified beneficial traits, we also sequenced four bacterial isolates showing promising

beneficial traits. This study advanced our understanding of the roles of microbiome on

HLB-escape trees and application of beneficial bacterial in disease management.

Materials and Methods

Isolation of Bacteria from Healthy Citrus Rhizosphere

All bacterial strains used in this study were isolated from the rhizosphere of

asymptomatic citrus trees in citrus groves with most trees showing severe HLB

symptoms. One hundred and forty two isolates previously obtained from 'Valencia'

orange (Citrus sinensis) trees (Trivedi et al., 2011a) were used in this study for

33

screening of beneficial bacteria. Additionally, two hundred bacterial isolates from

'Cleopatra' mandarin (Citrus reshni) were collected from groves in Lake Wales, Florida –

US (GPS location: -27°52'02.499" N 81°34'59.321"W ). Trees in Lake Wales grove were

planted in 2003 and bacterial isolation was performed in 2013. Nutrient broth (NB),

tryptic soy agar (TSA) and King’s B (KB) media were used for isolation as previously

described (Trivedi et al., 2011a).

Bacterial and Fungal Growth Conditions

Unless otherwise noticed, all bacteria isolated from healthy citrus rhizosphere

were grown on Nutrient Agar (NA) plates or in NB with 180 rpm agitation and incubated

at 28°C. Liberibacter crescens was grown in BM7 plates or broth as needed and

incubated at 28°C. Sinorhizobium meliloti and Agrobacterium tumefaciens were grown

on LB media and NB media, respectively. Colletotrichum acutatum and Alternaria

alternata isolates were grown in Potato Dextrose Agar (PDA) plates and incubated at

room temperature for seven days. Phyllosticta citricarpa was grown on half-strength

PDA medium and incubated at 25°C with 12/12 hours of light-dark photoperiods for

fourteen to twenty one days. Phytophthora nicotianae and Phytophthora palmivora were

grown on full strength V8 medium or clarified V8 medium and incubated at room

temperature for seven days.

Antibacterial Activity

Since Las has not been cultured, we used two bacteria (Sinorhizobium meliloti

and Agrobacterium tumefaciens) that are closely related to Las as surrogates.

Antibacterial activity was tested by inoculating the rhizospheric bacteria on NA plates

and cross streaking the strain in the center of the plate followed by incubation at 28°C.

After three days, plates were subject to chloroform vapors overnight to kill the bacteria

34

and were left in the fume hood until all solvent was fully evaporated. A second layer of

soft agar medium (0.6%) with an incorporated culture of Agrobacterium tumefaciens or

Sinorhizobium meliloti of 102 cfu/mL was set on top. The second layer was inoculated at

28 °C overnight. Positive inhibition was recorded as the presence of inhibitory halo.

Identification of Beneficial Bacteria and Phylogenetic Analysis

Identification of antimicrobial-producing strains was performed by amplifying 16s

rRNA gene from selected bacteria using the universal primers 27F and 1492R (Lane,

1991). The corresponding amplification products were purified (Wizard® SV Gel and

PCR Clean-Up System) and sequenced with both primers and internal primer 519F.

The sequences were assembled using Cap3 online software and further compared with

the prokaryotic 16S rRNA gene sequence database EzTaxon (Huang and Madan, 1999;

Kim et al., 2012). The 16S rRNA gene sequence of the closest type strain identified was

recorded and the total twelve sequences were used for the phylogenetic tree

construction. The twelve sequences were aligned using CLUSTALW algorithm and the

phylogenetic trees was constructed using Neighbor Joining method with MEGA (Version

6.0) with a bootstrap value of 1000 (Saitou and Nei, 1987; Tamura et al., 2013;

Thompson et al., 1994).

Antimicrobial Activity against Citrus Pathogenic Fungi and Phytophthora spp.

Many plant growth promoting bacteria (PGPB) have the ability to inhibit fungal

pathogens by producing antifungal compounds and/or extracellular enzymes. Here, we

explored the ability of the selected antimicrobial-producing bacteria to inhibit growth of

three fungi: Alternaria alternata, Colletotrichum acutatum, Phyllosticta citricarpa and two

oomycetes: Phytophthora nicotianae and Phytophthora palmivora.

35

Dual culture antagonist assays were performed as described previously

(Fokkema, 1978). Briefly, the appropriate media for each isolate was used and a

mycelium plug was placed in the center of the plate. One μL of bacterial suspensions at

108 cfu/mL were inoculated 3 cm away from the mycelium plug in three sections of the

plate.

Antagonism assay by overlay method was performed for C. acutatum,

Phyllosticta citricarpa and Phytophthora nicotianae. NA plates were inoculated with 1 μL

of bacterial suspension (108 cfu/mL) and grown for three days at 28˚C. Petri dishes

were then subject to chloroform vapors for a few hours until completely evaporated. The

appropriate medium was used for each fungal isolate in soft agar (0.06%) at 106

spores/mL.

Colletotrichum acutatum spores were obtained by flooding one week old cultures

with 3 mL of sterile distilled water and gently removing the surface of the petri dish with

a sterile spreader. The resulting suspension was then filtered using three layers of

cheesecloth. Phyllosticta citricarpa pycnidiospores were collected as described

previously (Hincapie et al., 2013). Phytophthora nicotianae zoospores were obtained by

culturing four mycelium plugs of the isolate in V8 broth in the dark. After one week

medium was replaced with sterile distilled water and left growing under dark/light

conditions. To induce zoospore release, Phytophthora nicotianae was cooled at 4°C for

one hour and then kept at room temperature for one hour. Spore concentration was

determined using Neubauer hemocytometer and was adjusted accordingly to obtain a

final concentration of 106 spores/mL.

36

Volatile-Mediated Antifungal Activity

The antifungal activity of volatiles compounds was assessed using

compartmentalized petri dishes as described previously (Fernando and Linderman,

1995). NA medium was used in one compartment for bacterial growth and clarified V8

medium was used for Phytophthora nicotianae mycelium growth. Each assay contains

five replicates and the experiment was performed three times. Growth was monitored

five days later and Phytophthora nicotianae diameter was quantified using a ruler.

Statistical Analysis of Growth Inhibition by Volatiles

Statistical analysis of volatile mediated mycelium inhibition was conducted using

RStudio (Version 0.98.1049 – © 2009-2013 RStudio, Inc.) by applying Dunn’s test

(package: dunn.test) with a P value of 0.05 or less.

Characterization of Beneficial Traits in vitro

Screening for bacterial ability to solubilize phosphate was performed by plating

each isolate in Pikovskaya medium (Pikovskaya, 1948). Strains showing a translucent

halo surrounding the colony were considered positive in phosphate solubilization.

Similarly, siderophore production was determined in vitro using CAS medium and

monitoring the presence of a halo after one day of incubation at 28 °C (Schwyn and

Neilands, 1987).

DNA Isolation and Genome Sequencing, Assembly and Annotation

Burkholderia metallica strain A53, Burkholderia territorii strain A63, Bacillus

pumilus strain 104 and Pseudomonas geniculata strain 95 were grown overnight in 1

mL of NB medium at 28 °C with 180 rpm agitation. The strains were centrifuged at 800

rpm for 5 minutes and DNA was extracted using Wizard® Genomic DNA Purification Kit

following the manufacture’s instructions. DNA quality and quantity were measured using

37

nanodrop (ND-8000 NanoDrop spectrophotometer (NanoDrop Technologies,

Wilmington, DE, U.S.A.)). Paired end reads (150 bp) were generated using an Illumina

Hiseq2000 platform by Novogene Coorporation for Bacillus pumilus strain 104 and P.

geniculata strain 95. Burkholderia territorii strain A63 and Burkholderia metallica strain

A53 were sequenced by BGI, Shenzhen using Illumina Hiseq2000 and paired end reads

(125 bp) were generated. The reads were de novo assembled using CLC Genomics

(version 8.0) for strain A63 and A53, with an iterative adaptive assembly approach, and

the assemblies from kmer 33 for Burkholderia territorii strain A63 and 29 for

Burkholderia metallica strain A53 were chosen for further analyses for their highest

reads utilization according to their longest average contig length. The de novo assembly

was performed using MegaHit (version 1.06) for Bacillus pumilus strain 104 and P.

geniculata strain 95. For each genome, functional annotation was completed using the

RAST server (Aziz et al., 2008). The nucleotide sequence of the four bacterial strains

and their annotations were submitted to the National Center for Biotechnology

Information (NCBI) database.

Identification of Genes Involved in Beneficial Traits and Antimicrobial Production

Protein family sorter tool from the Pathosystems Resource Integration Center

(PATRIC) database was used to find relevant genes within the bacterial genomes

based on the set of families FIGfams (Meyer et al., 2009; Wattam et al., 2014).

Families involved in phosphate solubilization, phytohormone production, synthesis of

volatile organic compounds, production of osmolytes and siderophores were searched

in all genomes using PATRIC visualizing tool. Prediction of the putative antimicrobial

biosynthesis clusters was performed using antiSMASH software (Version 3.0.5.) (Weber

et al., 2015).

38

Results

Isolation of Antimicrobial Producing Bacteria from Healthy Citrus Rhizosphere

Two hundred bacterial isolates from healthy 'Cleopatra' mandarin (Citrus reshni)

were collected from groves in Lake Wales, Florida, USA where most trees showed HLB

symptoms. In addition, one hundred and forty two isolates obtained from 'Valencia'

orange (C. sinensis) trees (Trivedi et al., 2011a) were also used for screening of

beneficial traits. To screen bacteria producing antimicrobials against Candidatus

Liberibacter asiaticus (Las), we used two gram negative α-proteobacteria taxonomically

related to Las: Sinorhizobium meliloti and Agrobacterium tumefaciens (Duan et al.,

2009) as surrogates since Las is currently not cultured under laboratory conditions. In

total three hundred and forty two strains were screened for antimicrobial activity against

the two species and six isolates able to produce inhibition zone indicating antimicrobial

production were identified (Figure 2-1 A and B).

Bacteria Identification and Phylogenetic Analysis

Identification of antibiotic-producing bacteria was performed by amplifying 16s

rRNA gene. All amplicons obtained were 1350 bp or longer and were analyzed using

the prokaryotic 16S rRNA gene sequence database EzTaxon (Kim et al., 2012). The

closest type strain reported with the highest score was collected for further phylogenetic

analysis (Table 2-1). In total, twelve sequences were recorded and the resulting

alignment was used to construct a phylogenetic tree (Figure 2-1 C). Four out of the six

strains belong to the proteobacteria phylum, the most abundant phylum in citrus

microbiome (Zhang et al., 2017, submitted manuscript). Two of them, Burkholderia

metallica strain A53 and Burkholderia territorii strain A63, were within the β-

proteobacteria class, whereas Pseudomonas granadensis strain 100 and Pseudomonas

39

geniculata strain 95 were grouped within the γ- proteobacteria class. Additionally, two

gram-positive bacteria were found: Rhodococcus jialingiae strain 108 and Bacillus

pumilus strain 104 belonging to the Actinobacteria and Firmicutes phylum, respectively.

These six selected strains were further characterized for other beneficial features such

as siderophore production and phosphate solubilization (Table 2-3). Notably, B.

metallica strain A53 was able to solubilize phosphate and P. granadensis strain 100

was positive for siderophore production.

Antimicrobial Activity Against Phytophthora spp. and Citrus Pathogenic Fungi

It has been reported that Las infection in the root could make fibrous roots

predisposed to P. nicotianae secondary infections (Graham et al., 2013). HLB disease

may have a higher impact in fibrous root health when P. nicotianae is present (Wang et

al., 2017). Although the mechanisms behind this interaction are yet to be fully

understood, one possible reason is that there is a higher attraction of P. nicotianae

zoospores to Las infected roots (Wang et al., 2017). In the competitive and complex

root system, rhizospheric bacteria capable of inhibiting zoospores germination or

hyphae growth may provide the plant with a competitive advantage to protect itself

against P. nicotianae infection. Therefore, it is interesting to understand the

antimicrobial activity for all six strains against P. nicotianae and P. palmivora, which

affect citrus root system causing root rot (both species) and foot rot (P. nicotianae only).

We also evaluated their antifungal activity against citrus pathogenic fungi. Three of

these pathogens, Alternaria alternata, Colletotrichum acutatum and Phyllosticta

citricarpa belong to the phylum Ascomycote and affect aerial tissues of the tree.

In dual culture antagonist assays we observed that Bacillus pumilus strain 104

significantly inhibited the growth of P. nicotianae and P. palmivora (Figure 2-2), whereas

40

Burkholderia spp. strains A53 and A63 only slightly inhibited their growth. Both

Burkholderia metallica strain A53 and Burkholderia territori strain A63 exhibited strong

antifungal activity in vitro against A. alternata, and C. acutatum. Consistently, both

strains were able to inhibit fungal growth of Phyllosticta citricarpa and C. acutatum in

overly method. Interestingly, Bacillus pumilus strain 104 and both Burkholderia spp.

strains were able to inhibit P. nicotianae growth in overlay assay with zoospores

suggesting that they may inhibit spore germination (Figure 2-3). Similar results were

observed in Bacillus pumilus strain 104, which was able to completely inhibit

pycnidiospore germination when challenged against P. citricarpa in the overlay method.

Dual culture compartmentalized petri dishes were used to explore the possible

antifungal activity by volatiles. Bacillus pumilus strain 104, Rhodococcus jialingiae strain

108 and P. geniculata strain 95 were able to significantly reduce fungal growth in

compartmentalized cultures (Figure 2-4).

General Features of the Genomes

The draft genome of the four bacterial strains was obtained by using Illumina

HiSeq2000 technology and assembled de novo. The mean coverage was 319 X for

Bacillus pumilus with a total of 33 contigs. The GC content for the gram positive bacteria

was 41.9% and the total genome size 3.7 Mb. RAST annotation identified 3894 features

in this genome. For the gram negative bacteria, the mean coverage of P. geniculata

was 411 X and a total of 294 contigs. P. geniculata draft genome has a GC content of

65.8% and a length of 5.1 Mb. Burkholderia territorii and Burkholderia metallica draft

genomes resulted in a mean coverage of 105 X and 112 X, respectively. The number of

contigs was 341 and 347 and the genome length 8.9 and 8.2 Mb. RAST annotation

identified 8366 features in Burkholderia territorii, 7722 in Burkholderia metallica and

41

4615 features in P. geniculata draft genomes. General information for the four draft

genome sequences is summarized in (Table 2-4).

Genes Responsible for Beneficial Traits

The PATRIC database was used to search for genes typically involved in

beneficial traits for the four strains. Namely, genes reported to be involved in phosphate

solubilization, siderophore production and iron acquisition, volatile organic compound

production, osmoprotection and osmotic tolerance, phytohormone production,

antagonism and nutrient competition were searched within the four genomes (Figures 2-

5, 2-6 and 2-7).

Phosphate solubilization and iron acquisition

Burkholderia metallica strain A53 was capable of phosphate solubilization (Table

2-3). In the genomic content, it was found that this strain harbors a phospholipase C

that may account for the observed phosphate solubilization activity in vitro (Figure 2-5).

Genes involved in siderophore production and iron acquisition are presented

Figure 2-5. Even though P. geniculata strain 95 does not produce siderophore in CAS

media, it harbors more than 50 genes coding for TonB-dependat receptors (TBDR).

TBDR are specialized receptors that transport siderophore-iron complexes in the

periplasm of gram negative bacteria (Cornelis, 2013). The presence of these receptors

allow bacteria to sequester iron complexes produced from other organisms (Hartney et

al., 2013). The overrepresentation of this feature in the genomic sequence has also

been described in other relevant beneficial rhizobacteria from Pseudomonas and

Stenotrophomonas genera (Berg et al., 2013; Cornelis, 2013).

42

Osmoprotection and osmotic tolerance

Many beneficial rhizospheric bacteria produce osmolytes that do not interfere

with cellular functions, are highly soluble and can serve as osmoprotectors in drought

stress conditions (Berg et al., 2013). Key players in this protection are trehalose and

glucosylglycerol and some of the genes known to be involved in their biosynthesis are

listed in Figure 2-7. Alpha, alpha-trehalose-phosphate synthase and trehalose-6-

phosphate phosphatase are two enzymes important for the synthesis of trehalose, and

both genes are present in P. geniculata strain 95 and the two Burkholderia spp. strains

A53 and A63.

Phytohormone production

ACC deaminase is known to regulate plant development by reducing levels of the

plant hormone ethylene (Glick, 2005). ACC deaminase (1-aminocyclopropane 1

carboxylate deaminase) was found in the genomes of B. metallica strain A53 and B.

territorii strain A63 (Figure 2-5). ACC deaminase is widely present in the Burkholderia

genus (Onofre-Lemus et al., 2009).

Some plant growth promoting bacteria have their promoting activity due to their

ability to produce indole acetic acid (IAA), a phytohormone important for plant growth.

The six antimicrobial-producing strains selected in this study were not able to produce

IAA using Solawaski's reagent in vitro nor to promote seed germination of tomato, corn

or soybean (data not shown). IAA production in bacteria involves at least three different

pathways. Two of the best-characterized pathways use tryptophan as substrate: indole-

3-acetamide (IAM) pathway, the Indole-3-pyruvate pathway. Additionally, there is a

tryptophan independent pathway. Consistence with our experimental data, the four

sequenced bacteria lack most genes for IAA synthesis. However, indolepyruvate

43

ferredoxin oxidoreductase and indole-3-glycerol phosphate synthase were found in the

two Burkholderia strains and in P. geniculata strain 95. The former gene is found in

Archea. The latter gene has been associated with IAA biosynthesis in tryptophan-

independent pathway in Arabidopsis thaliana (Ouyang et al., 2000).

Antagonism and nutrient competition

Apart from the production of metabolites and production of phytohormones, an

important role of the beneficial bacteria in the rhizosphere is the competition for

nutrients and their role in organic matter decomposition (Kamilova et al., 2005). Some

enzymes such as celluloses, proteases and gluconases are important for carbon cycling

as well as antagonism of fungal pathogens (Gopalakrishnan et al., 2014). Therefore, the

presence of gluconases, cellulases, and pectinases was searched in the four genomes.

Endo-1,4-beta-xylanase Z precursor, cellulase and degenerated pectate lyase were

found in the two Burkholderia spp. strains. Similarly, in the genome sequence of

Bacillus pumilus strain 104, 1,3-1,4-beta-D-glucan 4-glucanohydrolase, cellulase,

pectate lyase, xylanase and endo-1,4-beta-xylanase A precursor were identified (Figure

2-5). Apart from their role in competition for nutrients, some of these enzymes may have

a role in antagonizing fungal pathogens as they can degrade fungal cell wall.

Enzymes involved in VOC production

Volatile organic compounds (VOC) are lipophilic compounds with high vapor

pressure, and low molecular mass that have an important role in antagonism, signaling

and cross-kingdom interactions in the rhizosphere. The chemical properties of VOCs

allow them diffuse through water as well as air filled pores in the rhizosphere and in that

way they can “connect” species that are physically separated (Effmert et al., 2012;

Garbeva et al., 2014; Kai et al., 2009; Schmidt et al., 2015; Schulz-Bohm et al., 2016).

44

Most microorganisms can produce VOCs as byproducts of their primary and secondary

metabolisms. Many VOCs are produced from the oxidation of glucose (Korpi et al.,

2009), and other VOC biosynthetic pathways include heterotrophic carbon metabolism,

terpenoid biosynthesis and fatty acid degradation among others (Peñuelas et al., 2014).

In vitro antagonism assay results suggest that Bacillus pumilus strain 104, P.

geniculata strain 95 and R. jianlingiae strain 108 produce VOCs that inhibit

Phytophthora mycelium growth. Bacillus is known to produce acetoin and 2,3-

butanediol as by products of incomplete oxidation of pyruvate and α–acetolactate

(reviewed in Effmert et al., 2012). The genomic sequence of B. pumilus strain 104

harbors the gene for 2,3-butanediol dehydrogenase (EC 1.1.1.4) that catalyzes the

production of 2,3 butanediol from 2-acetoin and the reverse reaction as well. This

enzyme is also present in the genomes of Burkholderia metallica strain A53 and

Burkholderia territorii strain A63. Additionally, the gene that encodes the acetolactate

synthase small subunit (EC 2.2.1.6) is present in all four strains. Bacillus pumilus strain

104 is the only one of the four strains that contains the alpha-acetolactate

decarboxylase (EC 4.1.1.5) important for the synthesis of 2-acetoin from acetolactate.

Some rhizospheric bacteria taxonomically related to P. geniculata strain 95 are

able to produce VOCs. Namely, it has been reported that some Stenotrophomonas

maltophila strains isolated from soil were tobacco was grown were able to produce

benzaldehyde, phenylacetaldehyde and phenol as part of their active volatile organic

compounds (Gu et al., 2007; Zou et al., 2007). These compounds were found to have

both nematicidal as well as fungicidal activities. In the genome of P. geniculata strain 95

a putative benzoaldehyde dehydrogenase (EC 1.2.1.28) was identified which catalizes

45

the production of methyl benzoate. Methyl benzoate is an active volatile that has been

reported in other bacteria such as Streptomyces spp. and Stigmatella spp. (Schulz and

Dickschat, 2007).

Antimicrobial Biosynthesis Gene Clusters

A genome mining approach using AntiSMASH (version 3.0) tool was used to

identify putative antibiotic biosynthesis gene clusters that could potentially explain the

observed antimicrobial activity. The software predicted ten clusters for B. pumilus Strain

104, nine for P. geniculata Strain 95 and fifteen clusters for each of the Burkholderia sp.

strains (Table 2-4).

Bacillus pumilus strain 104 contains two clusters of non-ribosomal peptide

synthetase (NRPSs) genes and one NRPS-PK hybrid gene cluster. One NRPS cluster

identified had 95% gene similarity to the lychensyn biosynthetic gene cluster from B.

pumilus strain 7P and is highly conserved within Bacillus. In addition, AntiSMASH

software predicted a possible chemical structure for the identified lipopeptide (Figure 2-

8). Another NRPS cluster shares 53% gene similarity with the bacillibactin biosynthetic

gene cluster. The NRPS-PK hybrid gene cluster has 85% gene similarity with the

bacilysin biosynthetic gene cluster, a metabolite that has strong antibacterial effect

against Erwinia amylovora and Xanthomonas oryzae, two phytopathogenic gamma

proteobacteria (Chen et al., 2009; Wu et al., 2015). The software also identified

microcin, bacteriocin, and terpene gene clusters.

A total of nine gene clusters responsible for antimicrobial production were

identified in the genome of P. geniculata strain 95. Among them, two clusters encode

lantipeptides, one for lassopeptide, two for arylpolyene, two for bacteriocin, one for

microcin and one for NRPS. One lantipeptide gene cluster includes a lanthionine

46

synthase C family gene and two leader/core peptide genes. This gene cluster also

contains two regulatory genes: a sensor histidine kinase gene and a LuxR family DNA-

binding response regulator gene downstream of the biosynthetic genes. For the second

lantibiotic cluster no structure genes was identified. Lantibiotics are peptidic

antimicrobial compounds produced in the ribosomes that undergo numerous post-

transcriptional modifications. Lantibiotics were known to be produced by many gram

positive bacteria but lately they have been associated with other groups (Knerr and van

der Donk, 2012). The lantibiotics predicted in P. geniculata strain 95 belongs to the

class II of lantibiotics, produced by lanM-like proteins. LanM-like proteins are

bifunctional proteins that assess the maturation of the leader peptide and also the

cyclation activity. According to in silico studies now it is known that lanM-like genes are

widely spread in bacteria (reviewed in Knerr and van der Donk, 2012).

In each Burkholderia strain, fifteen clusters were identified to encode NRPSs,

bacteriocin, PKS, terpene, phenazine, arylpolyene, phosphonate, etoin and

Hserlactone. Notably, both strains harbor the complete pyrrolnitrin biosynthesis cluster.

Pyrrolnitrin is a well characterized compound produced by many Pseudomonas and

Burkholderia strains with strong antifungal and antibacterial activity (Hwang et al.,

2002).

Discussion

The positive interactions between the microbiome and HLB escape plants have

been proposed as one of the possible reasons for the observed healthy state (Sagaram

et al., 2009; Trivedi et al., 2010). The extended genome of the microbes associated with

the escape plants can be accounting for a notably fitness advantage. This study aims to

identify antagonists of Las and characterize their beneficial activity in the rhizosphere.

47

Six strains belonging to Firmicutes, Actinobacteria, Betaproteobacteria and

Gammaproteobacteria with strong antimicrobial activity in vitro against A. tumefaciens

and S. melilloti were identified. Two isolates: B. metallica strain A53 and B. territorii

strain A63 isolated from a mandarin rhizosphere belong to the Burkholderia cepacia

complex (BCC). BCC is a group of bacteria widely spread in the soil that are currently

not allowed to be used in agriculture applications due to their potential risk to human

health (Depoorter et al., 2016). However, the strains presented here Burkholderia

metallica A53 and Burkholderia territorii strain A63 have the ability to modulate citrus

immune system under greenhouse conditions when applied as a soil drench. Moreover,

the family Burkholderiaceae was found to be a key taxa in citrus microbiome of healthy

trees as compared to that of HLB symptomatic trees in the field (Zhang et al., 2017,

submitted manuscript). Therefore, even if the Burkholderia spp. strains cannot be used

as biocontrol agents, some beneficial traits might be used in agriculture.

Antagonism against mycelium and spores for fungal and Phytophthora species

allowed the characterization of the six strains. Burkholderia metallica strain A53 and

Burkholderia territorii strain A63 show antifungal activity against all isolates in dual

culture assays and overlay method. Bioinformatic analysis predicted the presence of the

whole gene cluster for the production of pyrrolnitrin, a strong antifungal and antibacterial

compound produced not only by Burkholderia, but also Pseudomonas, Myxococcus,

Serratia, and Enterobacter (el-Banna and Winkelmann, 1998). It was noted that B.

pumilus strain 104 was able to completely inhibit P. citricarpa growth in an overlay

method with fungal spores. Bacillus spp. ability to inhibit spore germination has been

previously reported in Bacillus pumillus MSH against Mucor and Aspergillus and in

48

Bacillus subtilis YM 10-20 against Penicillium roqueforti (Bottone and Peluso, 2003;

Chitarra et al., 2003). AntiSMASH prediction found that B. pumilus strain 104 contains a

gene cluster encoding NRPS class of antibiotics. One of these NRPS predicted is

lichensyn a cyclic lipopeptide (LP). LP of the surfactin family have been reported to be

involved in antifungal and antimicrobial interactions as well as facilitating root

colonization and modulating the plant immunity (reviewed in Ongena and Jacques,

2008).

VOCs are known to play two major roles in the rhizosphere: as chemical signals

shaping the behavior and population dynamics of other microorganisms and as

antimicrobial compounds suppressing or killing other microorganisms (Tyc et al., 2016).

In this work, the possible antagonistic role of VOCs was addressed by evaluating the

antifungal activity in vitro. Inhibition of P. nicotianae growth by volatile organic

compounds was significant for R. jialingiae strain 108, P. geniculata strain 95 and B.

pumilus strain 104. It is noticeable that inhibition of P. nicotianae by Bacillus pumilus

strain 104 may result from the production of VOCs or a combination of VOCs and

antimicrobial compounds. Among the three strains with VOC producing activity, B.

pumilus strain 104 was found to contain all the genes necessary for the production of

2,3 butanediol, a volatile that is usually produced by many Bacillus strains which has

been reported to have important implications in plant immunity (Rudrappa et al., 2010;

Ryu et al., 2003). Interestingly, 2,3 butanediol application has been used in the field due

to its low production cost and low active concentration (Effmert et al., 2012; Piechulla

and Degenhardt, 2014). Some VOCs are commonly produced among a group of

49

bacteria, but frequently some strains produce unique specific types of VOCs (Garbeva

et al., 2014; Schulz and Dickschat, 2007).

Phytophthora nicotianae in Florida was usually controlled with matalaxyl whose

application was discouraged because of the apparition of resistant isolates (Graham

and Feichtenberger, 2015). Nowadays, formulations based on phosphite are being used

and recently it has been proposed that these chemicals may be losing effect due to their

interaction with HLB disease (Wang et al., 2017). Many bacterial strains owe their

biocontrol effect partly to the efficient suppression of Phytophthora spp. growth (Kim et

al., 2008; Lee et al., 2008; Nakayama et al., 1999; Tran et al., 2007). The ability to

inhibit Phytophthora nicotianae and the mechanisms that can account for this activity

has potential in citrus protection strategies.

Conclusions

Ensuring root health is critical to maintain a healthy citrus tree (Graham et al.,

2013). Within the complex ecological interactions in the root system the microbiome

plays an important role to sustaining the plant productivity. In this work, we have

isolated and characterized six beneficial bacteria. We have further investigated the

genomic basis for the beneficial traits. This study advances our understanding how

beneficial bacteria may affect the outcome of Las and citrus interaction and provides

some useful resources for citrus production by manipulating citrus microbiome.

50

Table 2-1. Molecular identification of six antibacterial-producing strains.

Name Isolation Sequence length Type strain Similarity Authors

95 'Valencia' orange, 2010

1410 bp Pseudomonas geniculata ATCC 19374

99.86 (Wright 1895) Chester 1901

100 'Valencia' orange, 2010

1385 bp Pseudomonas granadensis F-278,770

99.63 Pascual et al. 2015

A63 'Cleopatra' mandarin, 2013

1361 bp Burkholderia territorii LMG 28158(T)

99.93 De Smet et al. (in press)

A53 'Cleopatra' mandarin, 2013

1359 bp Burkholderia metallica 99.93 Vanlaere et al.

2008

104 'Valencia' orange, 2010

1403 bp Bacillus pumilus 99.93 Meyer and

Gottheil 1901

108 'Valencia' orange, 2010

1363 bp Rhodococcus jialingiae 99.93 Wang et al.

2010

Table 2-2. Phosphate solubilization and siderophore production traits in rhizospheric

bacteria

Strain Name Phosphate solubilization

Siderophore production

95 Pseudomonas geniculata - -

100 Pseudomonas granadensis - +

A63 Burkholderia territorii - -

A53 Burkholderia metallica + -

104 Bacillus pumilus - -

108 Rhodococcus jialingiae - -

51

Table 2-3. Secondary metabolites biosynthesis gene cluster prediction by AntiSMASH. Strain Cluster Type From* To* Most similar known BGC** % Similarity

95

1 Lantipeptide 31661 61263 - 2 Lantipeptide 69318 92035 - 3 Lassopeptide 50889 73443 - 4 Nrps 00001 17903 Griseobactin BGC 23 5 Arylpolyene 76759 99067 APE Ec BGC 36 6 Arylpolyene 00001 21276 - 7 Bacteriocin 83161 105829 Orfamide BGC 11 8 Microcin 00001 1365 - 9 Bacteriocin 143636 154481 -

104

1 Nrps 142637 226234 Lichenysin BGC 85 2 Nrps-T1pks 63941 144842 Paenilamicin BGC 14 3 Microcin 00001 4646 - 4 Bacteriocin 389939 400265 - 5 T3pks 709780 750880 - 6 Terpene 789007 810881 -

7 Siderophore-Terpene

15791200003

1607517 Carotenoid BGC 33

8 Terpene 245042 265962 - 9 Other 698475 739896 Bacilysin BGC 85

10 Nrps 953569 1003277 Bacillibactin BGC 53

A63

1 Other 27970 57696 Pyrrolnitrin BGC 75 2 Bacteriocin 39718 50533 - 3 T1pks 62948 110555 - 4 Phosphonate 62903 98429 - 5 Terpene 00001 21898 - 6 Nrps 00001 1016 - 7 Nrps 97017 137068 Pyochelin BGC 80 8 Terpene 00001 15995 - 9 Arylpolyene 00001 2250 - 10 Nrps 00001 11614 - 11 Terpene 00001 11121 - 12 Phenazine 86375 133089 Lomofungin BGC 34 13 Terpene 48030 68863 - 14 Terpene 06981 28009 - 15 Hserlactone 02653 17394 - 1 Terpene 42600 63598 -

A53

2 Nrps 00001 17924 - 3 Terpene 27664 49640 - 4 Terpene 07467 37850 - 5 Bacteriocin 00001 5961 - 6 Other 32988 75978 -

52

Table 2-3. (Continued): Strain Cluster Type From* To* Most similar known BGC** % Similarity

A53

7 Terpene 31278 55382 - 8 Ectoine 03735 14133 - 9 Terpene 13100 33933 - 10 Terpene 00001 11107 - 11 Other 02018 34354 Pyrrolnitrin BGC 100

12 Terpene 14830 37505 - 13 Phosphonate 00001 36125 - 14 Hserlactone 36730 54805 -

15 T1pks 43661 91265 Lipopolysaccharide BGC 5 * Genome position ** Biosynthesis gene cluster Table 2-4. General features of the four draft genomic sequences

Name NCBI Accession No.

Mean coverage

Contigs No.

Features No.

GC content

Size (bp)

Burkholderia territori strain A63

MUZF00000000 105x 341 8366 66.4 8,865,752

Burkholderia metallica strain A53

MULQ00000000 112x 347 7722 66.6 8,233,033

Pseudomonas geniculata strain 95

MULR00000000 411x 294 4615 65.8 5,080,605

Bacillus pumilus strain 104

MULS00000000 319x 33 3894 41.9 3,685,367

53

Figure 2-1. Producing beneficial bacteria phylogeny based in 16S rDNA sequences

from the six beneficial bacteria and its closest type strain.A) Antagonist activity in vitro against the alpha proteobacteria Sinorhizobium meliloti. B) Antagonist activity in vitro against the alpha proteobacteria Agrobacterium tumefaciens. C) Antibiotic –Sequences were aligned using CLUSTALW algorithm and the phylogenetic trees was constructed using Neighbor Joining method with MEGA (Version 6.0).

54

Figure 2-2. Dual culture antimicrobial activity in vitro. Activity of three antimicrobial

producing bacteria was tested against Colletotrichum acutatum, Alternaria alternata, Phytophthora nicotianae and Phytophthora palmivora by co-plating both organisms in culture media following incubation at room temperature for approximately ten days. Inhibitions was observed for Burkholderia spp. strains against C. acutatum, A. Alternata and Phytophthora spp. and Bacillus pumilus against Phythophthora spp.

55

Figure 2-3. Overlay antifungal activity in vitro. A) Burkholderia sp. have antifungal

activity against Colletotrichum acutatum. B) Burkholderia metallica strain A53 antifungal activity against Phyllosticta citricarpa pycnidiospores and Bacillus pumilus strain 104 total inhibition in vitro. C) Burkholderia spp. strains and Bacillus pumilus inhibition activity against zoospores from Phytophthora nicotianae in vitro.

56

Figure 2-4. Antimicrobial activity against Phytophthora nicotianae in compartmentalized

petri dishes. A) Phytophthora nicotianae growth in the presence or four antimicrobial-producing beneficial bacteria. Error bars represent the standard deviation for five replicates. The experiment was repeated for three times (n = 15). Letters indicate significant difference based on Dunn’s test (package: dunn.test, RStudio (Version 0.98.1049 – © 2009-2013 RStudio, Inc.) with a P value of 0.05 or less. B) Pictures of Phytophthora nicotianae growth in the presence or antimicrobial producing beneficial bacteria.

57

Figure 2-5. Beneficial traits related genes. The heat map represents the number of

genes putatively involved in direct antagonism, phosphate solubilization and nutrient facilitation in the four bacterial genomes. Phospholipase C, reported to be involved in the solubilization of phosphate is only present in Burkholderia metallica strain A53. ACC deaminase an enzyme known to modulate ethylene levels in plants (1-aminocyclopropane 1 carboxylate deaminase) is present in the Burkholderia metallica strain A53 and Burkholderia territorii strain A63. 1,3-1,4-beta-D-glucan 4-glucanohydrolase, cellulase, pectate lyase, xylanase and endo-1,4-beta-xylanase A precursor identified in Bacillus pumilus strain 104 have a role in nutrient competition and fungal antagonism.

58

Figure 2-6. Heat map of genes involved in siderophore production and iron acquisition.

Genes involved in pyochelin biosynthesis and tonB dependant receptor family proteins are represented. P. geniculata strain 95 presents a highly overrepresented genomic feature of more than fifty TBDR involved in iron sequestration.

59

Figure 2-7. Heat map representing the number of genes involved in osmoprotection.

Enzymes involved in the synthesis of trehalose and cardiolipin are shown for all four bacteria.

Figure 2-8. Structural prediction of the NRPS antibiotic encoded in B. pumilus strain 104

Cluster 1. AntiSMASH software identified a putative NRPS antimicrobial biosynthesis cluster. Based on the domain organization found, the prediction of the putative structure is shown.

60

CHAPTER 3 ISR-ELICITING CAPACITY OF RHIZOSPHERIC BACTERIA

Introduction

Asiatic citrus canker is a globally distributed disease that affects all commercial

citrus varieties. The causal agent Xanthomonas citri subsp. citri (Xcc) infects plants

through stomata or wounds, multiplies in the intercellular spaces, and causes

characteristic necrosis and raised lesions in fruit, leaf and twigs (Ryan et al., 2011).

Chemical control based on copper compounds is currently the most frequent

treatment for this disease. However, the prolonged use of copper compounds can have

a negative impact on the environment (Alva et al., 1995), resulting in copper

accumulation to toxic levels in the roots (Graham et al., 1986) and causing phytotoxicity

on the fruit peel (Graham et al., 2008). In addition, copper-based compounds have no

systemic activity in the plant and its effect relies on their multiple applications throughout

the year and its protective effect decreases with heavy winds and rains (Graham and

Myers, 2016; Stall et al., 1980). Consequently, copper resistant Xcc strains have been

identified in Argentina (Behlau et al., 2012).

A possible alternative for chemical control is the activation of the plant immune

system in a systemic way called ‘priming’. Systemic resistance occurs naturally in plants

upon proper stimulation by certain pathogens, non-pathogens, herbivory and/or some

chemical treatments (Kuć, 1982). After the stimuli is recognized, the plant immune

system is activated in a systemic way leaving distal aerial tissues better protected from

future pathogen attack. In citrus, most studies on priming have focused their attentions

on the chemical elicitors (Francis et al., 2009; Graham and Myers, 2013; Li et al., 2015).

For instance, acibenzolar-S-methyl (ASM), isonicotinic acid (INA) and DL-3-

61

aminobutyric acid (BABA) had been evaluated for the protective effect against citrus

canker, Diaphorina citri development and Huanglongbing (Francis et al., 2009; Graham

and Myers, 2013; J. Li et al., 2015; Tiwari et al., 2013). Application of ASM as well as

INA as soil drench resulted in reduced disease development in small plants inoculated

with Xcc under greenhouse conditions (Francis et al., 2009).

The activation of systemic resistance in plants can also be triggered by plant

growth promoting bacteria (PGPB) (van Loon et al., 1998). Different PGPB strains have

been reported to induce plant defense against a broad spectrum of pests from

oomycetes, fungi, bacteria, insects to nematodes (reviewed in Walters and Bennett,

2014). Microbial-mediated priming has been linked with differential expression of

defense related genes, changes in phytohormone content, changes in ROS (reactive

oxygen species) levels, sugars as well as amino acids and tricarboxylic acid (TCA)

components (reviewed in Balmer et al., 2015). PGPB induction of defense has been

mostly associated with the jasmonate/ethylene (JA/ET) pathways of plant defense

(Zamioudis and Pieterse, 2012). Additionally, SA-dependent PGPB induction of

resistance has been reported (Barriuso et al., 2008; Niu et al., 2016; van de Mortel et

al., 2012). The use of PGPB in the field has been suggested as an alternative strategy

to control crop diseases in a sustainable way. Different PGPB strains able to promote a

protective effect in plants had been used in field conditions as part of crop protection

strategies against chili wilt disease and blast disease in rice (Lucas et al., 2009;

Sundaramoorthy et al., 2012).

In this chapter, we have identified rhizospheric bacteria able to induce a systemic

defense response in citrus plants challenged with Xcc. Disease severity was compared

62

between non-treated plants and plants inoculated with rhizospheric bacteria via soil

drench. In addition, we investigated the relative hormone content, the reactive oxygen

species production levels and the relative gene expression of plant defense genes after

treatment with PGPB. Overall, three bacteria were found to evoke a plant response

against citrus canker: Burkholderia territorii strain A63, Burkholderia metallica strain A53

and Pseudomonas geniculata strain 95.

Materials and Methods

Bacterial Cultures and Growth Conditions

Bacterial isolates were cultured in Nutrient Broth (NB) or on Nutrient Agar (NA) at

28 °C for twenty-four hours. For plant inoculation, bacterial strains were grown overnight

in NB at 28 °C with agitation at 200 rpm. Cells were centrifuged at 10,000 g for twenty

minutes and then suspended in sterile distilled water to a final concentration of 108

cfu/mL. Xcc strain 306 (Rybak et al., 2009) was grown in NB or on NA medium at 28 °C.

Plants Material and Treatments

Two-year old 'Duncan' grapefruit plants were used for Xcc inoculation or PGPB

treatments. Plants were grown in small pots of 500 mL with sterile soil. Five treatments

were applied as a soil drench to the root system seven days before pathogen challenge

as soil drench. The five treatments were as follow: 1) Pseudomonas geniculata strain 95

(108 cfu/mL), 2) Burkholderia territorii strain A63 (108 cfu/mL), 3) Burkholderia metallica

strain A53 (108 cfu/mL), 4) 5 mg of acibenzolar-S-methyl (ASM) (commercially available

in US as Actigard 50WG and Bion® in Europe) active ingredient, and 5) sterile distilled

water as negative control. Actigard 50 WG is an analogue of salicylic acid and was used

as a positive control of plant defense activator (Francis et al., 2009; Graham and Leite,

2004). The experiment was repeated independently two times and data of all plants

63

were combined for statistical analyses. Experiments were performed in a quarantine

greenhouse facility (Citrus Research and Education Center, Lake Alfred, Florida, U.S.A)

with controlled temperature (28–35 °C) and relative humidity of 80%.

Xanthomonas citri subsp. citri Inoculation and Disease Severity Estimation

'Duncan' grapefruit plants were challenged with Xcc strain 306 (108 cfu/mL) by

spray inoculation at seven days post root treatment with PGPB. For each plant, at least

three fully expanded immature leaves were labeled and sprayed. Plants were then

covered with a plastic bag for twenty-four hours to maintain humidity. Symptoms were

monitored at six weeks post pathogen inoculation. Labeled leaves were collected and

pictures were taken immediately. Pictures were uniformly taken by setting the camera

(Nikon D80) on a tripod and using a blank background at 30 cm. To estimate disease

severity, pictures were used for manual lesion count and image processing analysis.

The experiment was repeated to obtain a total of twelve plants per treatment and results

were combined for statistical analysis.

Image Processing Analysis

The normalized area of disease was estimated using the software ImageJ

(version 1.49). Recorded images from individual leaves were transformed to the HSB

color space and further analyzed using two different macros. In the first step, the

background was subtracted using the saturation channel and total leaf area was

recorded. Secondly, two masks were applied to the hue channel, around the yellow

color to specifically identify the lesions. Finally, the total area of lesions was recorded

(Figure 3-1). The normalized area of disease per leaf was calculated as follows:

Normalized area = Area lesions / Area leaf.

64

RNA Extraction and Relative Gene Expression Analysis

For gene expression analysis one leaf was collected from each of three different

plants at the following time points: zero, three, five and seven days post treatment

application in the root system. Individual leaves were then ground in liquid nitrogen

using a mortar and pestle and then 100 mg of leaf samples were used for RNA

extraction. RNA was extracted using the RNeasy Mini Kit (QIAGEN) following the

manufacture’s instructions. Samples were then treated with Ambion® DNA-free DNase

Treatment and Removal Reagents. RNA concentration was determined using a

NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE,

USA), the final concentration was normalized to 50 ng/μL for qRT-PCR analysis.

Relative expression of eleven defense-related genes was determined by

quantitative reverse transcription PCR. The primer sequences are presented in Table 3-

1 The housekeeping gene encoding a glyceraldehyde 3-phosphate dehydrogenase

(GAPDH) was used as an endogenous control as previously described (Francis et al.,

2009). Quantitative reverse transcription was performed using Verso 1-step RT-qPCR

Kit (ThermoFisher) and the fold change was calculated using the ∆∆Ct method as

previously described (Livak and Schmittgen, 2001).

Plant Hormones Quantification and Reactive Oxygen Species Determination

Plant hormones were quantified in 'Duncan' grapefruit plants at zero, three and

eighth days post treatment application in the root system. Three treatments were

conducted 1) Pseudomonas geniculata strain 95 (108 cfu/ml), 2) 5 mg of Actigard and 3)

sterile distilled water as a negative control. Three leaves from different plants were

pooled together as one biological repeat and four biological repeats were tested. Plant

tissue was kept in liquid nitrogen immediately after detaching from the plant. Tissue was

65

ground into powder in a mortar and pestle in liquid nitrogen. The frozen powder was

weighed and 100 mg frozen powder was kept in 2 mL screw-cap tubes. Samples were

kept in -80 °C for further analyses.

For phytohormone extraction and quantification the internal standard mixture

working solution (d2-IAA, d6 -ABA, d6-SA, d5-JA) was added to each 2 mL tube

containing the frozen plant tissue powder. Then, 500 µL extraction solvent was added

(2-propanol/H20/concentrated HCl (2:1:0.002 vol/vol/vol)). The samples were shaken at

a speed of 100 rpm at 4 °C in a cold room for thirty min. Finally, 1 mL dichloromethane

was added to each tube and the tubes were further shaken at 4 °C at 100 rpm for thirty

min. Samples were then centrifuged at 13,000 g for 10 min at 4 °C. The lower phase

solvent was transferred to a screw-cap tube and gently evaporated with nitrogen flow.

Concentrated samples were dissolved in 1 mL methanol. Samples were cleaned in a

solid phase extraction column (Oasis HLB 1 cc 30 mg extraction cartridge, waters).

Cartridges were equilibrated with 1 ml water and loaded with 1 ml of sample. Samples

were eluted with 1 ml methanol and evaporated with nitrogen flow. Concentrated

samples were dissolved in methanol and filtered through 0.2 µm filter before analysis.

For each sample, 50 µl of sample solution was injected into the reverse-phase C18

HPLC column SynergiTM for UPLC-ESI-MS/MS analysis using an Ultimate 3000 UPLC

with a TSQ Quantiva MS.

For ROS determination, the fluorescent dye DHR 123 (dihydrorhodamine) was

used as previously described with modifications (Qin et al., 2008). Briefly, extraction

buffer (50 mM Tris pH = 7.8, 5 mM EDTA, 0.2% Triton 100x, 10% Glycerol, 5 mM DTT

and 2% PVPP) was added to 100 mg of ground tissue. Samples were then centrifuged

66

at 15,000 rpm for 30 min. Following centrifugation, 900 μl of dihydrorhodamine 123

probe (dihydrorhodamine 123 Sigma-Aldrich, Inc.) was added to 100 μl of supernatant.

The obtained solution was incubated at room temperature for one hour in the dark and

fluorescence was determined in three technical repeats at 488nm excitation and 534nm

emission in a Synergy™ HT Multi-Mode Microplate Reader (Biotek Instrumets Inc.).

Each tube was kept at 60°C in a stove and dry weight was determined for further

calculations.

Statistical Analysis

Disease severity (normalized area of disease and lesion count) data was

analyzed using RStudio (Version 0.98.1049 – © 2009-2013 RStudio, Inc.) by applying

Dunn’s test (package: dunn.test) with a p value of 0.05 or less.

Hormone levels and ROS production on leaves data were analyzed with RStudio

using analysis of variance and Tukey Honest Significant Differences posthoc with a

confidence interval of 95% and a p value of 0.05 or less (ANOVA - TukeyHSD).

Results

Bacteria Application in the Root Was Able to Reduce Citrus Canker Development

Some rhizospheric bacteria have the ability to induce a systemic resistance in

plants and modulate their immunity to make them better prepared to pathogen attack

(Pieterse et al., 2014). We selected seven bacterial strains and tested for their ability to

induce systemic resistance in 'Duncan' grapefruit against Xcc. The selected bacterial

isolates were previously isolated from the rhizosphere of citrus trees in Florida.

To screen for rhizospheric bacteria ability to activate citrus immunity, we

inoculated the beneficial bacteria in the root system via soil drench and allowed the

plant to respond for seven days. After one week, Duncan grapefruit plants were spray

67

inoculated with Xcc strain 306 in young leaves (Figure 3-2 A). Six weeks post pathogen

challenge we compared the disease severity in the leaves. In addition to bacterial

treatments we included the chemical treatment Acibenzolar-S-methyl (ASM) as a

positive control of defense activation. ASM has been previously reported to induce

citrus systemic resistance against canker (Francis et al., 2009).

Disease severity was quantified using two independent measurements: 1) by

counting the number of lesions per leaf and 2) by estimating the total area of disease.

The estimation of lesion count when the pathogen has been sprayed on the leaves has

two major limitations: the variability of the lesion size in different leaves and the

aggregation of some lesions that makes it hard to discriminate individual counts. In

order to improve this estimation, we used the same pictures and estimated the area of

disease with image processing analysis using ImageJ software. According to both

measurements, three strains were able to significantly reduce the disease severity in

Duncan grapefruit. Namely, Burkholderia territorii strain A63, Burkholderia metallica

strain A53 and Pseudomonas geniculata strain 95 were able to reduce symptom

development after six weeks under greenhouse conditions (Figure 3-2 B and C). No

significant differences were observed in plants inoculated with Pseudomonas

granadensis strain 100, Rhodococcus jialingiae strain 108 or Bacillus pumilus strain 104

as compared to non-treated control plants (data not shown).

Beneficial Bacteria Trigger Changes in Expression of Defense-Related Genes

Activation of citrus systemic immunity has been linked to the overexpression of

certain defense-related genes (Distefano et al., 2008; Dutt et al., 2015; Francis et al.,

2009; Li et al., 2015, p. 201). We evaluated if the application of beneficial bacteria in the

root system could change the expression of defense-related genes in a systemic way.

68

We collected leaf tissues during the first week immediately after beneficial bacteria

inoculation but prior to pathogen challenge. We monitored the expression of eleven

selected genes and compared the relative expression to non-treated plants. The

expression of ASM-treated plants was also included as a positive control of plant

defense activation. Among the selected genes we selected markers from both salicylic

acid (SA) and Jasmonate-Ethylene (JA/ET) pathways of plant immunity (Table 3-1).

Bacterial treatments with Pseudomonas geniculata strain 95, Burkholderia

territorii strain A63 and Burkholderia metallica strain A53 caused differential expression

of defense-related genes from non-treated control plants. The three bacterial treatments

showed upregulation of the pathogenesis-related protein 1 (PR1) at different time points

post bacteria inoculation. Pseudomonas geniculata strain 95 induced changes in

relative expression of three genes besides PR1: PR2, PR5 and HPL. PR2 and PR5 are

normally related to the activation of the SA pathway, whereas the last one is considered

a marker of JA-ET pathways of plant immunity (Figure 3-3 B and C). Some similarities

in gene induction were observed in both Burkholderia spp. treated plants. Although at

different time points, both treatments induced expression of a phenylalanine ammonia

lyase 1 (PAL1) gene, and SAM-SACM gene, and suppressed CAT expression at day

seven (Figure 3-3 C).

P. geniculata Modulates Hormone and ROS Levels in Grapefruit

Primed plants stimulated with a proper signal enter a different physiological state

named priming phase (Balmer et al., 2015). In this state, plants can respond faster to

pathogen attack. We investigated two putative mechanisms involved in plant defense

activation: the production of reactive oxygen species and hormone in the leaf tissue. In

both cases we studied the aerial response of P. geniculata - inoculated plants during the

69

one week period post root stimulation. As for disease severity and relative gene

expression analyses we included ASM-treated plants in the comparison. We observed

that plants inoculated with P. geniculata had significantly higher levels of ROS than non-

treated control plants at seven days post beneficial bacteria root inoculation. Plants

inoculated with ASM showed significantly higher levels of ROS at three days post

treatment application (Figure 3-4).

Hormones were extracted as previously described (Pan et al., 2010) and

samples were cleaned up using solid phase extraction cartridge and quantified using

UPLC-MS/MS. Four internal standards for ABA (d6 -ABA), JA (d5-JA), SA (d6-SA) and

IAA (d2-IAA) were used to calculate the relative hormone content. For each treatment,

we normalized the relative hormone levels with the first day samples prior to treatment

application. We observed that plants treated with ASM or P. geniculata contains higher

IAA relative contents than non-treated control plants at three and eight days after

treatment (Figure 3-5). Interestingly, we found that the levels of ABA at eight days post

stimuli application were significantly lower in P. geniculata treated plants but

significantly higher in ASM-treated plants than non-treated control plants. We found that

plants treated with ASM showed lower levels of SA three days post application than

non-treated control plants.

Discussion

The bacterial ability to induce a systemic response in citrus plants has been

largely unexplored. Agostini et al. in 2003 evaluated the effect of Serenade (biological

fungicide based on Bacillus subtilis strain QST 713) inoculation in reducing disease

severity of citrus scab on rough lemon, melanose on grapefruit and Alternaria brown

spot in mandarin under greenhouse conditions (Agostini et al., 2003). However, it is

70

unclear whether the control effect is due to the activation of systemic resistance or

direct antagonism of the bacterial strain. In this study, we inoculated the beneficial

bacteria in the root system as soil drench and evaluated the effect on leaf pathogen Xcc

to avoid any direct competition between beneficial and pathogenic bacteria. We

observed significant differences in disease severity on 'Duncan' grapefruit plants treated

with B. metallica, B. territorii and P. geniculata suggesting an activation of plant defense

mechanisms.

The expression profile of 'Duncan' grapefruit plants changed upon root

stimulation with the three beneficial bacteria B. territorii, B. metallica and P. geniculata.

P. geniculata stimulated an up-regulation of PR proteins as well as HPL. PR1, PR2 and

PR5 are usually considered as markers associated with SA signaling pathway

(reviewed in Dong, 2004), while HPL is associated with JA signaling pathway (Ongena

et al., 2004). In contrast, root application of the two Burkholderia spp. strains caused up-

regulation of PR1 and SAM-SACM genes involved in SA-pathway of plant defense. The

increase in the relative expression levels of PAL gene was also observed at three days

after treatment with B. territorii and seven days for B. metallica. The PAL gene is in the

phenylpropanoid pathways of plant defense and is believe to be activated by JA/ET

signaling pathway (Diallinas and Kanellis, 1994). The mechanisms by which beneficial

bacteria activate systemic resistance in plant are diverse. Some bacteria are able to

induce systemic resistance through activating the SA- dependent defense pathway (van

de Mortel et al., 2012), some through the ET/JA signaling pathway (Pieterse et al.,

1998), whereas some bacteria induce both (Niu et al., 2011). Recently, the ISR-eliciting

beneficial strain B. cereus AR156 has been shown to induce PR1 protein expression

71

through SA-pathway through NPR1, inducing ROS levels as compared to non-treated

plants (Niu et al., 2016). In our study, we did not find any change of NPR1 relative

expression in beneficial bacteria treated plants.

After recognizing a proper stimulus, plants usually respond with a moderate

physiological change that can be seen at different levels. Apart from the gene

expression profile, hormone and ROS levels may vary as a result from treatment

application. ROS species are produced as part of the plant defense response. In SA-

dependent defense, it has been proposed that ROS is involved in the production of AzA,

a signal molecule associated with triggering the systemic acquire resistance (SAR)

response (Wang et al., 2014; Wendehenne et al., 2014). We observed that root

application of ASM and P. geniculata in grapefruit plants results in an increase in ROS

levels in aerial tissues compared to non-treated control plants. Activation of ROS by

beneficial bacteria has been reported in Nicotiana tabacum agroinfiltrated with

Agrobacterium tumefaciens GV3101 and in barley treated with Pseudomonas

fluerescens. ROS pathway was proposed in both cases to be part of the plant defense

mechanism resulting in defense activation against Pseudomonas syringae and

Fusarium culmorum (Petti et al., 2010; Sheikh et al., 2014).

P. geniculata application on grapefruit roots altered the levels of plant hormones

in the leaves. P. geniculata application resulted in an increase of IAA as compared to

non-inoculated control plants. IAA accumulation was also reported in Arabidopsis

thaliana treated with Pseudomonas syringae (Pastor et al., 2014). In ASM-treated

plants, we observed that the IAA levels decreased over time but the change was less

than the decrease in non-treated control plants. IAA levels in priming events have been

72

associated with changes in primary metabolism and tryptophan pathway. Additionally,

we found that ABA levels were significantly lower in grapefruit at eight days post P.

geniculata inoculation. ABA is a key stress hormone in plants that has a dual activity in

plant-pathogen interactions that range from promoting resistance to increased

susceptibility. ABA may have an active role in the early stages of defense but a

suppressive role in late stages. Overall, it has been proposed that the effect of ABA in

defense against bacterial pathogens is mostly negative (Ton et al., 2009). For instance,

callose deposition, an important defense mechanism in plants was shown to be

suppressed by ABA in A. thaliana (Clay et al., 2008). P. geniculata inoculation in

grapefruit plants results in over expression of PR-protein and SAM genes which are

dependent on the SA-pathway. However, we noted that the levels of SA were not

significantly different from those of control plants. The same pattern was observed for

ASM treated plants, with a decrease in SA observed at three days post treatment

application. Additionally, the over expression of SAM-SACM at three days post ASM

stimulation may result in the production of methyl- SA (MeSA) and reduction in SA

levels.

Conclusions

In this chapter, the ability of rhizospheric beneficial bacteria to activate citrus

plant immunity and prime them against canker was explored. Three bacteria,

Burkholderia metallica strain A53, Burkholderia territorii strain A63 and Pseudomonas

geniculata strain 95 were able to significantly decrease canker symptoms of 'Duncan'

grapefruit when inoculated via soil drench. Pseudomonas geniculata inoculation induces

changes of expression of defense-related genes, phytohormones IAA and ABA, and

ROS levels, suggesting that a physiological effect is induced. Due to the environmental

73

adverse effects of chemical control of citrus canker, the exploitation of environmentally

friendly strategies represents an attractive approach to develop new control measures.

The bacteria presented in this study could be potentially used to manage citrus canker

disease and other bacterial diseases.

74

Table 3-1. Primers used for expression analysis of plant defense genes

Short name Protein encoded Primers (5’-3’) Reference

HPL1 Fatty acid hydroperoxide lyase

F-AGTGTGCCGGAAAGGATTAC, R-GCCGTGATCGAAGATGAGTT This study

GPX

Phospholipid hydroperoxide glutathione peroxidase

F-TGTGCAAGTCGTTACCTTCTTA, R-TCTCAACAGGGTTTGCTTACA This study

NPR1 Transcriptional regulator of defense genes

F-GTAGGCCGGCTGTTGATTT, R-GTCTAGGAGGTGCCTCTGATAA This study

MYC Transcriptional regulator MYC2

F-GCGATGGGTATTACAAAGGAGA, R-TTCGCGCAGTACCTTCTTAC This study

PR1 Pathogenesis related protein 1

F-CAGGGTCTCCAAGCAACTATG, R- CCACCTCGCGTATTTCTCTAA This study

PR2 Pathogenesis related protein 2

F-TTCCACTGCCATCGAAACTG, R-TGTAATCTTGTTTAAATGAGCCTCTTG

(Francis et al., 2009)

PR5 Pathogenesis related protein 5

F-CACCATTGCCAATAACCCTAATG, R-GGGACAGTTACCGTTAAGATCAG This study

PAL Phenylalanine ammonia lyase

F-GGAGGGTTTGTGCAAGAATAAC, R-CACCATACGCTTCACTTCCT This study

SAM

S-adenosyl-L-methionine-salicylic acid carboxyl methyltransferase

F-GGACGCATCTTCTTGGGATAA, R-CGTGACAGTTTCCTTGACGA This study

MPK4 Mitogen-activated protein kinase 4

F-GTTGGTTGCATACTTGGTGAAA, R-GCATCATCGGGAGAACCTATT This study

CAT Catalase F-GGAAACCAACTTGTGGAGTTAAG, R-TGAGTCGTAGAGATCCTGAGTAG This study

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

F-GGAAGGTCAAGATCGGAATCAA, R-CGTCCCTCTGCAAGATGACTCT

(Francis et al., 2009)

75

Figure 3-1. Image processing analyses example. ImageJ was used in two steps to estimate the total area of disease.

Figure 3-2. A) Representative pictures of canker development in (leaves). B) Boxplot represent the mean number of lesions per leaf for all plants (n=12). Boxplot with the normalized area of disease.

76

Figure 3-3. Relative expression analysis of defense-related genes using RT-qPCR in leaf tissue. The fold change at 3, 5 and 7 days post beneficial bacteria root inoculation is represented color-coded for those genes showing upregulation (fold change > 2) or downregulation (fold change < 0.5) as compared to non-treated plants. Relative expression was calculated using GAPDH housekeeping gene as endogenous control according to ΔΔCt method. A) ASM-treated plants, B) Pseudomonas geniculata strain 95 treated plants, C) Burkholderia territorii strain A63 treated plants and D) Burkhodleria metallica strain A53 treated plants.

77

Figure 3-4. Reactive oxygen species levels in leaves treated with P. geniculata strain 95, ASM or non-treated control. ROS levels were quantified at day three, five and eight post root treatment application using DHR123 probe.

Figure 3-5. Normalized hormone content in leaf tissue of 'Duncan' grapefruit treated with

95 (P. geniculata strain 95), Actigard and non-treated control. Hormones were extracted and quantified by UPLC-ESI-MS/MS analysis at day cero, three and eight post root treatment application. Samples were analyzed with an ANOVA test followed with a Tukey Honest Significant differences poshoc (* means a p value < 0.05, n = 4, confidence interval 95%)

78

CHAPTER 4

EXPLORING THE EFFECT OF PSEUDOMONAS GENICULATA ON CITRUS ROOTS

Introduction

Candidatus Liberibacter asiaticus (Las) is the causal agent of citrus

Huanglongbing (HLB) disease (Bové, 2006; Wang and Trivedi, 2013). In Florida, Las is

transmitted through the insect vector Diaphorina citri. The psyllid feeds from the citrus

phloem sap where it acquires Las then it can spread the pathogen when feeding on

other citrus trees. Chemical insecticides are currently the main management approach

to control HLB. However, extensive application of insecticides can cause insecticide

resistance and affect non-target beneficial insects such as honey bees (Chen et al.,

2017; Kanga et al., 2016; Tiwari et al., 2011).

A possible alternative to chemical control is using plant immune activation to

enhance the plant resistance. Plant defense activation can lead to protection against

insect pests. The plant immune activation can result from plant – beneficial bacteria

recognition as well as through application of chemical compounds called ‘elicitors’. For

instance, Serratia marcescens 90-166 and Bacillus pumilus INR-7 have been reported

to activate a defense response in cucumber under field conditions. Cucumber plants

treated with these bacteria were able to protect themselves against two beetle pests:

Diavrotica undecimpunctata howandi and Acalymma vittatum (F.). Interestingly, bacteria

application in field trials resulted in a lower insect population in plants and increased

plant growth and yield (Zehnder et al., 1997a, 1997b). Recently, Bacillus spp. were

applied to cotton resulting in a systemic protection against Spodoptera exigua (Zebelo

et al., 2016). It has been reported that the activation of citrus plant systemic defense by

79

the chemical DL-3-aminobutyric acid (BABA) can impair Diaphorina citri development of

larvae, nymphs and adults (Tiwari et al., 2013) resulting in increased protection.

Integrating plant beneficial microbes from the plant associated microbiome to

manage crop disease is currently considered a promising management strategy to

enhance plant health (Berendsen et al., 2012; Busby et al., 2017; Ciancio et al., 2016).

Despite being a widely used sustainable approach, little information is currently

available about their persistence in soil and how bacterial applications impact the plant

native microbiome (Ambrosini et al., 2016).

In the second and third chapters we characterized PGPB strains capable of

producing antimicrobial compounds and eliciting a protective systemic response against

citrus canker in 'Duncan' grapefruit. In this work, we selected the PGPB strain

Pseudomonas geniculata strain 95 to explore its effect in the field. Pseudomonas

geniculata strain 95 was initially isolated from the rhizosphere of 'Valencia' sweet

orange (Trivedi et al., 2011). As shown in Chapter 2, although being named

‘Pseudomonas’, the strain belongs to the Stenotrophomonas genus. The strain was

found to have antimicrobial activity against Agrobacterium tumefaciens and

Sinorhizobium meliloti, two alpha proteobacteria closely related to Las. Thus, we

hypothesized that it may be able to directly antagonize Las through the production of

antimicrobial compounds. In Chapter 3, greenhouse studies demonstrated that P.

geniculata strain 95 was able to activate defenses of 'Duncan' grapefruit plants

conferring a protective effect against citrus canker.

The root system provides plants with water and nutrients required for health. HLB

disease has a strong impact on citrus root health and their associated microbiome.

80

Furthermore, it was recently proposed that HLB affected trees may have a higher

impact on root health in the presence of the oomycete pathogen Phytophthora

nicotianae (Wang et al., 2017). Because maintaining root health is fundamental for plant

nutrition and productivity, it seems that roots are a good target for crop protection

strategies. In vitro studies demonstrated that P. geniculata was able to significantly

reduce Phytophthora nicotianae growth in vitro through the production of volatile organic

compounds (seen in Chapter 2).

The objective of this work was to evaluate the possible effect of P. geniculata

strain 95 root application in citrus. Firstly, we focused on the effect of PGPB root

treatment in psyllid feeding efficiency and preference using 'Duncan' grapefruit under

controlled conditions. Secondly, we conducted a field trial in an HLB-affected citrus

grove and evaluated the effect of P. geniculata root application on Las titer in the roots.

Additionally, we sequenced root and rhizosphere samples from inoculated trees to

explore the impact of this PGPB application in the native microbiome of citrus trees.

Finally, we investigated the effect of PGPB application on citrus yield and fruit quality.

Materials and Methods

Plant Material for Psyllid Studies

The root systems of one-year old healthy 'Duncan' grapefruit plants grown in 500

mL pots were drenched with P. geniculata bacterial suspension. P. geniculata was

cultured in NB media overnight at 28 °C with agitation at 200 rpm. The culture broth was

centrifuged at 10,000 g for twenty minutes and cells were suspended in sterile distilled

water up to a final concentration of 108 cfu/mL. Plants were treated with a volume of 15

mL of PGPB. Plants were allowed to respond to beneficial bacteria inoculation for seven

81

days and then three leaves were collected from each plant in a greenhouse with

controlled temperature (28–35 °C) and relative humidity of 80%.

Psyllid Movement and Efficiency Assays

Feeding efficiency was evaluated by counting the honeydew droplets as

previously described for Diaphorina citri (Mann et al., 2012). Leaf disks were collected

from P. geniculata-treated and non-treated plants. Disks were immediately positioned in

a plastic small petri dish containing 1.5% water agar in the bottom. A Whatman filter

paper was placed inside on the cover and petri dishes were placed bottom-side-up with

ten adult psyllids inside. Honeydew drops were revealed using a ninhydrin spray

reagent after twenty-four, forty-eight, and seventy-two hours. For each time point and

each repeat five petri dishes were used, the experiment was performed three times.

Psyllid movement was studied as previously described (Mann et al., 2012;

Martini et al., 2015). Briefly, cages with four plants: two P. geniculata-treated and two

non-treated plants were set up in a cage. Additionally, a fifth plant (treated or non-

treated) was positioned in the middle of the cage containing sixty Las-infected psyllids

previously settled. Adult psyllids on each plant were counted after three and seven

days. Five cages were used in each repeat. The experiment was conducted three times

during the month of June 2016 and all data were combined for statistical analyses.

Test the Control Effect of P. geniculata on HLB in a Field Trial

Twenty-four 'Hamlin' sweet orange trees (Citrus sinensis) on 'Swingle' citrumelo

(Citrus paradisi × Poncirus trifoliata) rootstock were selected from one grove at the

Citrus Research and Education Center, University of Florida, Lake Alfred, Florida. The

trees were planted in 1991. The experimental design consisted of four different

treatments with six trees per treatment. Three treatments with P. geniculata strain 95

82

were applied in the root system as soil drench as follows: 1) eight liters of P. geniculata

strain 95 at 108 cfu/mL, 2) eight liters of P. geniculata strain 95 at 107 cfu/mL, 3) eight

liters of P. geniculata strain 95 at 106 cfu/mL and 4) six non-treated trees were used as

negative controls. All trees in the selected grove show typical HLB symptoms were

rated, and trees with similar symptoms were selected (Figure 4-1). All trees were under

the same routine grove management including fertilizer, insecticide and herbicide

application.

To prepare P. geniculata strain 95 for field application, the bacterium was first

cultured overnight at a small scale in 200 mL of NB media with agitation at 180 rpm and

28 ºC. After growing the bacterial culture for one day the broth was transferred to a

fermentor (Wp Winpact, Major Science) with a peristaltic pump. The fermenter was set

up with 6 L of NB media and grown overnight under controlled pH (6.92-7.00), agitation

(70 rpm), oxygen condition (ORP – 244 mV) and 28 ºC. After twenty-four hours, the

bacterial cultures were used to prepare suspensions accordingly for tree application via

soil drench. Bacterial solutions were applied to the root as listed in Table 4-1.

Root and Rhizosphere DNA Extraction

Root and rhizospheric soil samples were collected at the beginning, first, second

and sixth weeks immediately after the first bacteria root application in October 2015 to

November 2015 (Table 4-1). Only two treatments including P. geniculata strain 95 at

108 cfu/mL and non-inoculated control trees were selected for bacterial DNA extraction

and 16S rRNA amplicon sequencing. Soil samples were collected with a soil sampler by

inserting a probe (2 cm diameter) in six randomly selected areas approximately 1 m

away from the tree trunk. Rhizospheric soil in immediate contact with the root was

carefully collected for further analysis. Additionally, the remaining roots were used to

83

extract the DNA from root tissue. DNA was extracted using the CTAB chemical

extraction protocol. DNA quality and quantity were checked by gel electrophoresis and

nanodrop (ND-8000 NanoDrop spectrophotometer (NanoDrop Technologies,

Wilmington, DE, U.S.A.)). Samples from two trees were pooled together and stored at -

20°C until sending for sequencing. A 292 bp fragment from V4 region of 16S rRNA gene

was amplified using the primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R

(GGACTACHVGGGTWTCTAAT). Two hundred and fifty bp paired-end DNA sequences

were obtained from the HiSeq 2000 platform by Novogene Coorporation Inc.

(Novogene, Beijing, China).

DNA Sequencing Processing

Data analysis was performed following a standard Qiime pipeline of the 16S

rRNA gene (Qiime v1.9.1) (Caporaso et al., 2010a). Firstly, the chimeras of the 16S

sequences due to amplification and sequencing errors were identified and removed

(Haas et al., 2011). Then the bacterial OTUs were obtained based on the high quality

16S sequences using UCLUST algorithm at a default sequence similarity threshold of

97% (Edgar, 2010). To obtain the taxonomic information of OTUs, the representative

sequences of each obtained cluster were aligned against the Greengenes database

with PyNAST algorithm (Caporaso et al., 2010b; DeSantis et al., 2006). Based on OTUs

taxonomic information, the mitochondria and chloroplast reads were filtered before

normalizing the sequence depth. The minimum number of counts (4829 counts/sample)

was used to normalize sample depth to obtain an even OTU table for downstream core

diversity analysis. Three alpha diversity metrics Chao1, observed OTUs and PD whole

tree were estimated. These metrics were used for comparing the different treatments

through time. The statistical test of alpha diversity was performed using nonparametric

84

two-sample t-test with the default (999) number of Monte Carlo permutations in Qiime.

The beta diversity was estimated using Weighted UniFrac index according to the

phylogenetic distance.

OTUs Specific Relative Abundance

The relative abundances of Stenotrophomonas and Candidatus Liberibacter

asiaticus were estimated from the obtained normalized OTU table. The relative

abundance was calculated for the specific OTU as [reads/total reads (per sample)] x

100.

Fruit Yield and Quality Measurements

Fruit yield was calculated by weighting all fruits in the canopy and below the tree

at fourteen months post application during harvest in January 2017. The total yield was

reported as the total kilograms of fruit per tree for each tree. From each tree, a bag of

fruit of approximately eight kilograms was used for quality analysis at CREC according

to standard procedures (Gottwald et al., 2012). The total sugar content in the fruit is

expressed as fruit brix (total grams of sugars in 100 g of juice), fruit acidity is expressed

as percent of citric acid. The brix/acidity ratio was calculated accordingly based on the

two previous measurements.

Las Population Determination

Roots were collected from each tree using the root sampler as mentioned for the

soil and rhizosphere sampling. Roots were ground with liquid nitrogen using mortar and

pestle. Homogenized roots were used to extract DNA using CTAB chemical extraction

protocol. DNA was eluted to a final volume of 80 µl and DNA quality was determined

with a nanodrop spectrophotometer (NanoDrop Technologies, Wilmington, DE), quantity

was normalized to 200 ng/µl. DNA samples were then amplified by quantitative PCR

85

(qPCR) using primers/probe CQULA04F-CQULAP10P-CQULA04R targeting β-operon

of Las (Wang et al., 2006). The qPCR reaction was performed using QuantiTect Probe

PCR Kits (Qiagen) in a QuantiStudio 3 (Applied Biosystems, Thermo Fisher Scientific)

equipment. Las population was estimated as genome equivalents using the standard

curve previously determined for root tissue Y = -0.2768 x (Cycle threshold value) +

11.677 (Trivedi et al., 2009).

Statistical Analysis

Statistical analyses were performed in RStudio (Version 1.0.44 – © 2009-2016

RStudio, Inc.) and a phyton script in the Qiime platform for microbial community

analyses. Differences in particular OTUs were studied using statistical analysis of

taxonomic and functional profiles (STAMP v2.1.3) using Welch test, p < 0.05 (Parks et

al., 2014). For psyllid movement and feeding efficiency Dunn test was performed with a

P value below 0.05. For fruit quality and yield data Welch two sample t-test (unequal

variances) was used with a P value of 0.05 or less.

Results

P. geniculata Root Application Changes Psyllid Feeding Efficiency but not Preference

Citrus plants were treated with P. geniculata via soil drench to evaluate its effect

on Diaphorina citri feeding efficacy and preference. Citrus plants were treated with P.

geniculata and allowed to respond for a period of seven days in a greenhouse facility.

After seven days, leaf samples were used to feed the psyllids in small petri dishes.

Feeding efficiency was estimated by comparing the number of honeydew droplets

(Figure 4-2 A). Significant differences were observed at twenty-four hours but the effect

was not observed in later time points.

86

Psyllid preference for different citrus plants can be monitored by studying insect

movement toward plants in controlled conditions. For this assay, we inoculated citrus

plants with P. geniculata and challenged the plants with psyllids at seven days after

bacterial treatment. Briefly, four plants (two treated with P. geniculata and two non-

treated) were kept inside a cage at even distances. A fifth plant with sixty settled psyllids

was set in the middle and psyllids were released to allow them to freely move towards

the other plants. Psyllid preference was estimated by measuring the number of adult

psyllids that moved from the source plant to other four plants. No differences in psyllid

preferences were observed between P. geniculata treated or not treated plants at three

and seven days post psyllid release (Figure 4-2 B).

P. geniculata Application has no Significant Impact on the Native Microbial Community

Inoculation of exogenous bacteria in agricultural systems may alter the native

microbial community associated with the crop (Ambrosini et al., 2016). Additionally, it

has been proposed that the efficiency of bioinoculants depends largely on their ability to

survive in environmental conditions and effectively colonize the rhizosphere. We

evaluated how P. geniculata application in the root system affects the native microbial

community using a metagenomic approach and its ability to survive. During a period of

six weeks, rhizosphere and root samples were collected from 'Hamlin' sweet orange

trees treated with P. geniculata in the roots. High quality DNA was extracted and

samples were sequenced using an Illumina HiSeq2000 platform.

Firstly, the microbial community of P. geniculata-treated and non-treated citrus

trees was compared for the first six weeks post bacteria application in the root system.

The structure of the community was determined with 16S rRNA gene sequencing

87

(Figure 4-3). We observed that the ten most represented phyla in root and rhizosphere

differ in its composition but not between treated and non-treated trees. Microbial

community diversity within samples was studied for root and rhizospheric samples. As

expected, rhizosphere samples contained higher OTU index values than those from root

samples (Figure 4-4 A). No significant difference in alpha diversity was observed in

those P. geniculata-treated or non-treated samples (Figure 4-4 B). Diversity between

samples was compared using the Weighted UniFrac (WUF) metric and no separation

could be found based on different treatments. As expected, the principal coordinates

analysis (PCoA) for (WUF) was able to separate root from rhizospheric samples in

principal component one (PC1) were 31.5% of the differences are explained (Figure 4-

5).

Survival of P. geniculata in Citrus Rhizosphere and Interaction with Las

P. geniculata strain 95 was able to inhibit S. melilloti and A. tumefaciens in vitro,

two alpha-proteobacteria taxonomically related to Las. P. geniculata inoculation in the

root system also induced plant defenses of ‘Duncan’ grapefruit under greenhouse

conditions. The relative abundance of P. geniculata in the sequencing data can be seen

within the Stenotrophomonas family, a common group of bacteria found in the

rhizosphere associated with plants. Additionally, Las relative abundance was followed

over time for root and rhizosphere samples for the first six weeks after the first bacteria

inoculation in the root system. Interestingly, in trees inoculated with P. geniculata, we

observed that Stenotrophomonas family increased with time in the root while Las

relative abundance decreased (Figure 4-6). In non-treated trees, Las relative

abundance increased with time whereas Stenotrophomonas family relative abundance

remained relatively constant. In the rhizosphere samples, Las relative abundance

88

values were near cero consistent with the fact that Las lives within the phloem of the

plant. Stenotrophomonas family relative abundance in the rhizosphere remained

relatively constant in treated trees as well as non-treated trees. The pattern was less

consistent in non-treated rhizosphere samples with higher variation among repeats two

weeks after the first inoculation.

No Significant Changes in Las Population in the Root Tissues were Detected

The effect on HLB development was calculated by quantifying Las population in

the root for the four treatments. Trees were sampled every six months in October 2015,

April 2016, October 2016 and April 2017. At 1.5 years after PGPB application, Las

population was higher in April as compared to October 2015 (Figure 4-7). However,

when observing the population in the roots, the treatment with P. geniculata with 107

cfu/mL had significantly lower numbers compared to control on the first bacteria

application in October 2015. The same pattern was overserved in October 2016 and in

April 2017. After one year and a half of beneficial bacteria inoculation, Las populations

in the root tissue of P. geniculata inoculated trees (107 cfu/mL and 108 cfu/mL) were

lower than in non-inoculated trees and the treatment with the lowest bacterial

concentration 106 cfu/mL.

P. geniculata Application and Citrus Yield and Juice Quality

The application of PGPB under field conditions can result in an increase of yield

(Lucas et al., 2009; Zehnder et al., 1997a). In order to study the effect of P. geniculata

application in the citrus productivity, all trees were harvested in January 2017. By this

time, trees had been treated three times during a period of approximately one year. The

data showed a significant difference in fruit yield (as kg of fruit/tree) in P. geniculata (107

cfu/mL) treated trees as compared to non-treated control trees. The mean yield for trees

89

inoculated with P. geniculata at a higher concentration (108 cfu/mL) was slightly higher

than in non-control trees although not statistically significant (Figure 4-8).

Many root treatments can affect not only the quantity of fruit but also the quality.

Fruit samples from the January 2017 harvest for the three P. geniculata treatments and

non-treated controls were tested for quality in Citrus Research and Education Center

(CREC, Florida, United States). Fruit acidity in P. geniculata-treated trees with the two

highest concentrations (107 cfu/mL and 108 cfu/mL) was slightly higher than in non-

treated control trees (p = 0.04217 and p = 0.09817, respectively) (Figure 4-9). A similar

dose-dependent pattern was observed in juice percentage (p = 0.01586 and p =

0.04604). However, no significant differences were found in brix content or in brix/acidity

ratio.

Discussion

Plants are able to protect themselves against insect threats to a certain extent by

using their native immunity. The activation of plant immunity has been exploited within

crop management strategies to limit herbivore attack (Zebelo et al., 2016; Zehnder et

al., 1997a, 1997b). For instance, chemical activation of plant defense by the elicitor

BABA can enhance protection against herbivore feeding by increasing lignin and callose

formation in aerial tissues (Cohen et al., 1999; Hamiduzzaman et al., 2005). In citrus,

the same chemical compound was able to disrupt development of larvae, adults and

nimphs in citrus (Tiwari et al., 2013). In this study we used P. geniculata strain 95, a

strain that is able to enhance 'Duncan' grapefruit systemic resistance and observed the

effect on psyllid feeding efficiency and preference. Diaphorina citri feeding efficiency

was significantly lower in grapefruit leaves from P. geniculata-treated plants after

twenty-four hours but the effect was not sustained at two and three days in leaf disks.

90

We did not find any significant difference in psyllid movement preferences towards

treated or non-treated plants in controlled conditions when psyllids were given the

choice.

It has been regarded that one key factor when using bacterial inoculants in

agriculture is maintaining soil biodiversity and quality (Zancarini et al., 2013). Some

studies have focused their attention in understanding the impact of bacterial-based

inoculants on microbial diversity and how the changes correlate with disease (Gupta et

al., 2014; Li et al., 2015; Qiu et al., 2014; Shen et al., 2015). In this field study of one

year and a half, P. geniculata strain 95 was applied in 'Hamlin' sweet orange trees

planted on 'Swingle' citrumelo rootstock and the effect on microbiome was monitored for

the first six weeks. Our sequencing results for four time points reveal higher diversity

indexes in rhizospheric samples as compared to those from the root associated

microbiome. These results are consistent with the model that plant selects certain

bacteria from bulk soil to the rhizosphere and then to the root. It has been proposed that

there is an enrichment process for specific taxa (Bulgarelli et al., 2012; Lundberg et al.,

2012; Ofek-Lalzar et al., 2014).

In our experimental design, we observed no difference in diversity metrics in

PGPB-treated 'Hamlin' sweet orange trees as compared to non-treated controls (non-

parametric Monte Carlo, using a p of 0.05 or less). Additionally, the microbial diversity

within samples, or beta diversity, showed no separation between trees treated with P.

geniculata and control trees. In a similar way, studies by Li and co-workers in the

ecological impact of Bacillus subtilis B068150 application in cucumber rhizosphere

show no significant differences in overall microbial community (Li et al., 2015). The

91

authors observed an increase in the relative abundance of B. subtilis but not in the

diversity index, although the impact was dependent on soil type. Some authors attribute

the evenness of rhizospheric diversity as a fundamental aspect to limit pathogen attack

(Crowder et al., 2010; Yao and Wu, 2010).

The bacterial titer in treated and non-treated leaves showed a dynamic Las

population pattern with higher titers during April and lower titers during October. In

previous studies it has been observed that Las population fluctuates throughout the

year typically showing lower Las titers during the months of summer (Gottwald et al.,

2012). For the two highest beneficial bacteria inoculations (107 cfu/mL and 108 cfu/mL),

a decrease in Las population in the roots was observed. However, this difference is only

significant for 107 cfu/mL. We attributed this difference to the different initial conditions

of the selected trees, more than a negative effect of the highest concentration 108

cfu/mL. The trees were initially selected in the field based on similar symptoms in the

canopy but the determination of Las populations in the roots resulted in significant

differences in the initial conditions.

P. geniculata application in 'Hamlin' sweet orange trees resulted in a higher

mean fruit yield after one year of bacteria treatment for the highest PGPB inoculation.

However, the observed difference was not significant (t test, p < 0.05) for the highest

PGPB concentration, only for the second highest (107 cfu/mL) (Figure 4-8). In field

experiments, P. fluorescens Aur 6 was applied in the seed and in the leaves of rice to

test for induced systemic resistance protection and direct antibiosis. Field data show

that seed, leaf and the combination of both applications of P. fluorescens in rice resulted

in disease control.

92

The effect of bio-formulations in fruit juice quality is of utmost importance for the

development of commercial products. Bacteria application to the roots increased fruit

acidity in an apparent dose-dependent manner. Fruit acidity was significantly higher in

the two highest PGPB treatment applications. For both treatments, the percentage of

juice content was significantly lower than in non-treated control trees. In terms of brix

content the values obtained for PGPB treated trees with the two highest concentrations

were on average higher than control trees although no significant differences were

observed.

In summary, our results show that P. geniculata application in the roots system of

'Hamlin' sweet orange trees did not significantly change the microbial community

associated with the rhizosphere of root. During a period of six weeks the PGPB

application seemed to decrease Las relative abundance in the root tissue as compared

to non-inoculated trees. The effect in Las copy number, however, was not significant.

Additionally, we observed an effect in juice acidity and percentage of juice per fruit.

Changes in fruit quality may be associated with differential nutrient availability in the soil

rather than in changes in the functionality of the microbial community.

Conclusions

The application of bacteria under field conditions presents challenges for the

development of effective crop disease management. In order to create effective

bacterial formulations it is important to study the effect on plant application and their

ability to survive in field conditions. In the field trial we conducted for one year and a half

we observed that trees treated with bacteria inoculations presented some differences in

juice acidity composition in the fruit. One limitation usually associated with PGPB

application in the field is that environmental factors may change their effectiveness.

93

Further evaluations are needed to optimize P. geniculata as an effective bio-control

application in field conditions.

94

Table 4-1. Experimental design of the evaluation of P. geniculata application in the field 2015 2016 2017

October November December February April October December April

Bacteria application Soil drench

Soil drench

Soil drench Soil drench

DNA sampling for Las population determination

AT

AT AT

AT

DNA sequencing Two time points

One time point

One time point

Harvest

N/A

AT

Fruit quality

N/A

AT

AT - All treatments N/A – Not available

95

Figure 4-1. 'Hamlin' sweet orange trees were treated with three bacterial concentrations.

A) Non treated trees, B) 106 cfu/mL, C) 107 cfu/mL and D) 108 cfu/mL trees from Block 9, Citrus Research and Education Center, Lake Alfred, Florida. Eigth liters of bacteria suspension were inoculated in the root system of 'Hamlin' sweet orange trees infected with HLB to evaluate the effect of P. geniculata application. Pictures were taken in November 2016.

96

Figure 4-2. P. geniculata root application reduces feeding efficiency but does not affect

psyllid preference. A) Psyllid efficiency was estimated by comparing the number of honeydew droplets at 24, 48 and 72 hours in leaf disks from plants treated with P. geniculata strain 95 seven days prior to the experiment (red) or non treated control (blue). Significant differences were observed after one day (dunn test, p < 0.05). B) Psyllid preference was evaluated in a psyllid movement assay where psyllids are given the choice for P. geniculata and non treated plants. No differences were observed after three or seven days.

97

Figure 4-3. Bar plot with the microbial community structure in the rhizosphere and root

of trees at the phyla level. Only the ten most represented phyla are represented. Proteobacteria, Bacterioidetes, Actinobacteria and Acidobacteria are the four most represented phyla in root and rhizospheric samples.

Figure 4-4. Alpha and beta diversity analyses in microbial composition of root (blue) and

rhizosphere (red). A) Rarefraction curve for all rizosphere (red) and root (blue) samples. B) Alpha diversity Chao1 index over time the day of P. geniculata application (0) one, two and six weeks post treatment application. No significant differences were observed in alpha diversity index of 'Hamlin' sweet orange trees inoculated with the highest concentration as compared to non-treated control trees.

98

Figure 4-5. Diversity between samples. PCoA using the Weigthed UniFrac method

showing no separation between non-treated (red) and P. geniculata-treated (purple) trees. The samples can be separated by root (ligth orange) or rhizosphere (light green).

Figure 4-6. Relative abundance of reads corresponding to V4 16s rDNA sequence of

Candidatus Liberibacter asiaticus and Stenotrophomonas family. Points represent the mean abundance with the standard deviation (n=3) for the two taxa in P. geniculata treated trees (95) and non-treated trees (Control).

99

Figure 4-7. Disease development was monitored in Hamlin sweet orange trees P.

geniculata - treated with three different concentration: (6) 106 , (7) 107 , (8) 108 cfu/mL and (Control) non treated control trees. Estimation of copy number was performed using qPCR as previously described Trivedi (2009). Letters denote significant differences based on Welch t test with a P value of 0.05 or less.

Figure 4-8. Fruit yield expressed as kg of fruit per tree after January 2017 Harvest.

Welch Two Sample t-test (unequal variances) was performed. Significant differences were observed for treatment P. geniculata 107 cfu/mL as compared to non-inoculated control trees.

100

Figure 4-9. Juice quality parameters based on standard measurements of acidity, total

brix content and percentage of juice content.

101

CHAPTER 5 CONCLUDING REMARKS

In recent years a lot of effort has been invested in understanding the positive

interactions emerging from the plant associated microbiome and its possible use in

agricultural practices (Barea, 2015; Berendsen et al., 2012; Berg et al., 2014; Busby et

al., 2017; Chaparro et al., 2012; Kanchiswamy et al., 2015; Schäfer and Adams, 2015).

Briefly, many of the proposed approaches involve using the plant “second genome” to

alleviate plant stress and improve its health. In this context, we aimed to explore the

beneficial microorganisms from HLB escape citrus plants and identify their potential

interactions with the plant.

In the first part, we used microbes isolated from the rhizosphere of escape plants

and screened for their activity to produce antimicrobial compounds. Firstly, we

hypothesized that the antagonistic activity of beneficial bacteria from the root could be

serving as a protective shield against belowground threats. Namely, in Florida Las lives

within the phloem of citrus roots resulting in a deep disturbance of the root physiological

health and its associated microbiome. Apart from changing the microbial composition

and function, HLB disease can make the roots more susceptible to the oomycete

Phythophthora nicotianae. In this sense, bacteria from the citrus rhizosphere able to

antagonize Phythophthora nicotianae and Las could be interesting candidates for the

production of bacterial formulations. Six bacteria were identified as putative “root

protectors” based on their ability to inhibit citrus pathogens in vitro. We studied their

antimicrobial activity in vitro against three Ascomycotas that affect aerial tissues of citrus

plants and two Oomycetes that affect the root system as well as two gram negative

bacteria closely related to Las. We tested their ability to inhibit spore germination,

102

mycelium growth and growth inhibition through the production of volatile organic

compounds (VOCs).

In addition, we aimed to identify interactions from the microbiome-plant that could

modulate the plant defense response against pathogens. Activation of plant immune

response is currently considered an approach to control plant diseases (Annapurna et

al., 2013; Lyon et al., 2014). We identified three bacteria able to effectively decrease

canker symptoms in leaves after six weeks. We observed that the relative gene

expression of PR-proteins as well as PAL gene (for the two Burkholderia spp. Strains) or

HPL (for P. geniculata) were over-expressed upon beneficial bacteria soil drench

inoculation. These results suggest that bacteria activation of plant defense may involve

SA as well as JA/ET pathways of defense response. In addition, P. geniculata

application could significantly increase the levels of ROS in the leaves when inoculated

in the root system. Furthermore, P. geniculata treatment could increase IAA levels

compared to non-treated control plants. In contrast, ABA levels were lower at eight days,

a hormone that has been associated with suppression of plant defense in late stages

(Ton et al., 2009). Taken together, the results suggest that bacteria inoculation in the

roots is being recognized and a systemic protective response is awakened.

Thirdly, we aimed to evaluate the possible effects of P. geniculata application in

citrus roots. We studied the possible effect of plant activation response in insect psyllid

feeding efficiency and preference. We observed that treated leaves were significantly

lower in psyllid feeding activity than non-treated leaves. However, we did not observe

any differences in psyllid movement towards treated or non-treated plants in controlled

conditions.

103

Finally, we explored the effect of P. geniculata application in a field trial. We

tested the possible disturbance of the native microbial community when trees were

applied with eight liters of bacteria suspension in the root system. Using NGS data from

six weeks we compared the microbial composition of the rhizosphere and root-

associated microbiomes and the relative abundances of P. geniculata and Las. We

observed that P. geniculata relative abundance increased in the root-associated

microbiome while Las decreased. However, no significant differences were observed in

Las copy number at one year and a half after bacteria inoculation.

Overall, we have investigated several beneficial microbes isolated from HLB escape

trees, which show promising beneficial traits. Among these, we highlight the role of some

PGPB in modulating plant defense response against citrus canker. However, further study

is needed to optimize their application in the field as part of citrus disease management

practices.

104

APPENDIX A MEDIA COMPOSITION

1. Nutrient Agar Beef Extract 3.0 g, Peptone 5.0 g, Agar 15.0 g, distilled water 1000 mL.

2. Nutrient Broth Beef Extract 3.0 g, Peptone 5.0 g, distilled water 1000 mL.

3. Water Agar Agar 9.0 g, distilled water 1000 mL

4. Potato Dextrose Agar Potato infusion 4.0 g, Dextrose 20.0 g, Agar 15.0 g, distilled water 1000 mL

5. Potato Dextrose Agar – half strength Potato Infusion 2.0 g, Dextrose 10.0 g, Agar 15.0 g, distilled water 1000 mL

6. V8 half strength CaCO3 1.0 g, V-8 juice 200 mL, 800 mL distilled water

105

APPENDIX B MICROORGANISMS USED IN THIS STUDY

Table B-1. Bacterial strains used in this study

Name Comment Reference or source

Bacillus pumilus strain 104 Isolated from ’Valencia’ sweet orange rhizosphere

Trivedi, 2011

Burkholderia territorii strain A63 Isolated from Mandarin rhizosphere

This study

Burkholderia metallica strain A53 Isolated from Mandarin rhizosphere

This study

Pseudomonas geniculata strain 95 Isolated from ’Valencia’ sweet orange rhizosphere

Trivedi, 2011

Sinorhizobium meliloti

Agrobacterium tumefaciens

Xanthomonas citri subsp. citri strain 306

Citrus bacterial pathogen, causes citrus canker

Rybak et al., 2009

Table B-2. Fungal and Oomycetes used in this study

Name Accession code Comment Reference or source

Alternaria alternata

WAT-MN-R9-L1-1’s

From Lake County, tangerine cultivar Minneola

Provided by Megan Dewdney

Colletotrichum acutatum

STL-FTP-1’s Polk County, Frostproof, Navel orange flower. Year: 2000 (re-isolated in 2005)

Provided by Megan Dewdney

Phyllosticta citricarpa

Isolated from Polk County Provided by Megan Dewdney

Phytophthora nicotianae

Citrus pathogen Provided by Jim Graham

Phytophthora palmivora

Citrus pathogen Provided by Jim Graham

106

LIST OF REFERENCES

Agostini, J.P., Bushong, P.M., Timmer, L.W., 2003. Greenhouse Evaluation of Products That Induce Host Resistance for Control of Scab, Melanose, and Alternaria Brown Spot of Citrus. Plant Dis. 87, 69–74. doi:10.1094/PDIS.2003.87.1.69

Alva, A.K., Graham, J.H., Anderson, C.A., 1995. Soil pH and Copper Effects on Young

“Hamlin” Orange Trees. Soil Sci. Soc. Am. J. 59, 481–487. doi:10.2136/sssaj1995.03615995005900020031x

Ambrosini, A., Souza, R. de, Passaglia, L.M.P., 2016. Ecological role of bacterial

inoculants and their potential impact on soil microbial diversity. Plant Soil 400, 193–207. doi:10.1007/s11104-015-2727-7

Annapurna, K., Kumar, A., Kumar, L.V., Govindasamy, V., Bose, P., Ramadoss, D.,

2013. PGPR-Induced Systemic Resistance (ISR) in Plant Disease Management, in: Maheshwari, D.K. (Ed.), Bacteria in Agrobiology: Disease Management. Springer Berlin Heidelberg, pp. 405–425.

Audenaert, K., Pattery, T., Cornelis, P., Höfte, M., 2002. Induction of systemic

resistance to Botrytis cinerea in tomato by Pseudomonas aeruginosa 7NSK2: role of salicylic acid, pyochelin, and pyocyanin. Mol. Plant-Microbe Interact. MPMI 15, 1147–1156. doi:10.1094/MPMI.2002.15.11.1147

Aziz, R.K., Bartels, D., Best, A.A., DeJongh, M., Disz, T., Edwards, R.A., Formsma, K.,

Gerdes, S., Glass, E.M., Kubal, M., Meyer, F., Olsen, G.J., Olson, R., Osterman, A.L., Overbeek, R.A., McNeil, L.K., Paarmann, D., Paczian, T., Parrello, B., Pusch, G.D., Reich, C., Stevens, R., Vassieva, O., Vonstein, V., Wilke, A., Zagnitko, O., 2008. The RAST Server: Rapid Annotations using Subsystems Technology. BMC Genomics 9, 75. doi:10.1186/1471-2164-9-75

Balmer, A., Pastor, V., Gamir, J., Flors, V., Mauch-Mani, B., 2015. The “prime-ome”:

towards a holistic approach to priming. Trends Plant Sci. 20, 443–452. doi:10.1016/j.tplants.2015.04.002

Barea, J.M., 2015. Future challenges and perspectives for applying microbial

biotechnology in sustainable agriculture based on a better understanding of plant-microbiome interactions. J. Soil Sci. Plant Nutr. 15, 261–282. doi:10.4067/S0718-95162015005000021

Barriuso, J., Solano, B.R., Gutiérrez Mañero, F.J., 2008. Protection against pathogen

and salt stress by four plant growth-promoting rhizobacteria isolated from Pinus sp. on Arabidopsis thaliana. Phytopathology 98, 666–672. doi:10.1094/PHYTO-98-6-0666

107

Behlau, F., Hong, J.C., Jones, J.B., Graham, J.H., 2012. Evidence for Acquisition of Copper Resistance Genes from Different Sources in Citrus-Associated Xanthomonads. Phytopathology 103, 409–418. doi:10.1094/PHYTO-06-12-0134-R

Behlau, F., Scandelai, L.H.M., da Silva Junior, G.J., Lanza, F.E., 2017. Soluble and

insoluble copper formulations and metallic copper rate for control of citrus canker on sweet orange trees. Crop Prot. 94, 185–191. doi:10.1016/j.cropro.2017.01.003

Berendsen, R.L., Pieterse, C.M.J., Bakker, P.A.H.M., 2012. The rhizosphere

microbiome and plant health. Trends Plant Sci. 17, 478–486. doi:10.1016/j.tplants.2012.04.001

Berg, G., Alavi, M., Schmidt, C.S., Zachow, C., Egamberdieva, D., Kamilova, F.,

Lugtenberg, B.J.J., 2013. Biocontrol and Osmoprotection for Plants under Salinated Conditions, in: Bruijn, F.J. de (Ed.), Molecular Microbial Ecology of the Rhizosphere. John Wiley & Sons, Inc., pp. 587–592.

Berg, G., Grube, M., Schloter, M., Smalla, K., 2014. Unraveling the plant microbiome:

looking back and future perspectives. Front. Microbiol. 5, 148. doi:10.3389/fmicb.2014.00148

Bottone, E.J., Peluso, R.W., 2003. Production by Bacillus pumilus (MSH) of an

antifungal compound that is active against Mucoraceae and Aspergillus species: preliminary report. J. Med. Microbiol. 52, 69–74. doi:10.1099/jmm.0.04935-0

Bové, J., 2006. Huanglongbing: A destructive, newly-emerging, century-old disease of

citrus. J. Plant Pathol. 88, 7–37. Bove, J.M., Calavan, E.C., Capoor, S.P., Cortez, R.E., Schwarz, R.E., 1974. Influence

of temperature on symptoms of California stubborn, South Africa greening, India citrus decline and Philippines leaf mottling diseases. Presented at the Proceedings of the Sixth Conference of the International Organization of Citrus Virologists., pp. 12–15.

Bulgarelli, D., Rott, M., Schlaeppi, K., Ver Loren van Themaat, E., Ahmadinejad, N.,

Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E., Peplies, J., Gloeckner, F.O., Amann, R., Eickhorst, T., Schulze-Lefert, P., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 488, 91–95. doi:10.1038/nature11336

Burketova, L., Trda, L., Ott, P.G., Valentova, O., 2015. Bio-based resistance inducers

for sustainable plant protection against pathogens. Biotechnol. Adv. 33, 994–1004. doi:10.1016/j.biotechadv.2015.01.004

108

Busby, P.E., Soman, C., Wagner, M.R., Friesen, M.L., Kremer, J., Bennett, A., Morsy, M., Eisen, J.A., Leach, J.E., Dangl, J.L., 2017. Research priorities for harnessing plant microbiomes in sustainable agriculture. PLOS Biol. 15, e2001793. doi:10.1371/journal.pbio.2001793

Caporaso, J.G., Bittinger, K., Bushman, F.D., DeSantis, T.Z., Andersen, G.L., Knight,

R., 2010a. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 26, 266–267. doi:10.1093/bioinformatics/btp636

Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello,

E.K., Fierer, N., Peña, A.G., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Sevinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight, R., 2010b. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–336. doi:10.1038/nmeth.f.303

Cavaglieri, L.R., Andrés, L., Ibáñez, M., Etcheverry, M.G., 2005. Rhizobacteria and their

potential to control Fusarium verticillioides: effect of maize bacterisation and inoculum density. Antonie Van Leeuwenhoek 87, 179–187. doi:10.1007/s10482-004-3193-z

Cawoy, H., Mariutto, M., Henry, G., Fisher, C., Vasilyeva, N., Thonart, P., Dommes, J.,

Ongena, M., 2014. Plant defense stimulation by natural isolates of bacillus depends on efficient surfactin production. Mol. Plant-Microbe Interact. MPMI 27, 87–100. doi:10.1094/MPMI-09-13-0262-R

Chanda, B., Xia, Y., Mandal, M.K., Yu, K., Sekine, K.-T., Gao, Q., Selote, D., Hu, Y.,

Stromberg, A., Navarre, D., Kachroo, A., Kachroo, P., 2011. Glycerol-3-phosphate is a critical mobile inducer of systemic immunity in plants. Nat. Genet. 43, 421–427. doi:10.1038/ng.798

Chaparro, J.M., Sheflin, A.M., Manter, D.K., Vivanco, J.M., 2012. Manipulating the soil

microbiome to increase soil health and plant fertility. Biol. Fertil. Soils 48, 489–499. doi:10.1007/s00374-012-0691-4

Chen, X.D., Gill, T.A., Pelz-Stelinski, K.S., Stelinski, L.L., 2017. Risk assessment of

various insecticides used for management of Asian citrus psyllid, Diaphorina citri in Florida citrus, against honey bee, Apis mellifera. Ecotoxicology 26, 351–359. doi:10.1007/s10646-017-1768-5

Chen, X.H., Scholz, R., Borriss, M., Junge, H., Mögel, G., Kunz, S., Borriss, R., 2009.

Difficidin and bacilysin produced by plant-associated Bacillus amyloliquefaciens are efficient in controlling fire blight disease. J. Biotechnol. 140, 38–44. doi:10.1016/j.jbiotec.2008.10.015

109

Chitarra, G. s., Breeuwer, P., Nout, M. j. r., Van Aelst, A. c., Rombouts, F. m., Abee, T., 2003. An antifungal compound produced by Bacillus subtilis YM 10–20 inhibits germination of Penicillium roqueforti conidiospores. J. Appl. Microbiol. 94, 159–166. doi:10.1046/j.1365-2672.2003.01819.x

Ciancio, A., Pieterse, C.M.J., Mercado-Blanco, J., 2016. Editorial: Harnessing Useful

Rhizosphere Microorganisms for Pathogen and Pest Biocontrol. Front. Microbiol. 7. doi:10.3389/fmicb.2016.01620

Clay, N.K., Adio, A.M., Denoux, C., Jander, G., Ausubel, F.M., 2008. Glucosinolate

Metabolites Required for an Arabidopsis Innate Immune Response. Science. doi:10.1126/science.1164627

Cohen, Y., Reuveni, M., Baider, A., 1999. Local and Systemic Activity of BABA (DL-3-

aminobutyric Acid) Against Plasmopara viticola in Grapevines. Eur. J. Plant Pathol. 105, 351–361. doi:10.1023/A:1008734019040

Compant, S., Clément, C., Sessitsch, A., 2010. Plant growth-promoting bacteria in the

rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol. Biochem. 42, 669–678. doi:10.1016/j.soilbio.2009.11.024

Compant, S., Duffy, B., Nowak, J., Clément, C., Barka, E.A., 2005. Use of Plant Growth-

Promoting Bacteria for Biocontrol of Plant Diseases: Principles, Mechanisms of Action, and Future Prospects. Appl. Environ. Microbiol. 71, 4951–4959. doi:10.1128/AEM.71.9.4951-4959.2005

Conrath, U., Thulke, O., Katz, V., Schwindling, S., Kohler, A., 2001. Priming as a

Mechanism in Induced Systemic Resistance of Plants. Eur. J. Plant Pathol. 107, 113–119. doi:10.1023/A:1008768516313

Cornelis, P., 2013. Iron Transport Systems and Iron Homeostasis in Pseudomonas, in:

Chakraborty, R., Braun, V., Hantke, K., Cornelis, P. (Eds.), Iron Uptake in Bacteria with Emphasis on E. Coli and Pseudomonas, SpringerBriefs in Molecular Science. Springer Netherlands, pp. 67–89. doi:10.1007/978-94-007-6088-2_3

Crowder, D.W., Northfield, T.D., Strand, M.R., Snyder, W.E., 2010. Organic agriculture

promotes evenness and natural pest control. Nature 466, 109–112. doi:10.1038/nature09183

Das, A.K., 2003. Citrus canker – A review. J. Appl. Hort. 5, 52–60.

110

Dam, N.M. van, Weinhold, A., Garbeva, P., 2016. Calling in the Dark: The Role of Volatiles for Communication in the Rhizosphere, in: Blande, J.D., Glinwood, R. (Eds.), Deciphering Chemical Language of Plant Communication, Signaling and Communication in Plants. Springer International Publishing, pp. 175–210. doi:10.1007/978-3-319-33498-1_8

De Vleesschauwer, D., Djavaheri, M., Bakker, P.A.H.M., Höfte, M., 2008. Pseudomonas

fluorescens WCS374r-Induced Systemic Resistance in Rice against Magnaporthe oryzae Is Based on Pseudobactin-Mediated Priming for a Salicylic Acid-Repressible Multifaceted Defense Response. Plant Physiol. 148, 1996–2012. doi:10.1104/pp.108.127878

Depoorter, E., Bull, M.J., Peeters, C., Coenye, T., Vandamme, P., Mahenthiralingam,

E., 2016. Burkholderia: an update on taxonomy and biotechnological potential as antibiotic producers. Appl. Microbiol. Biotechnol. 1–15. doi:10.1007/s00253-016-7520-x

DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E.L., Keller, K., Huber, T.,

Dalevi, D., Hu, P., Andersen, G.L., 2006. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, 5069–5072. doi:10.1128/AEM.03006-05

Devi, U., Khatri, I., Saini, R.V., Kumar, L., Singh, D., Gupta, A., Kumar, N., Gárriz, A.,

Subramanian, S., Sharma, D., Saini, A.K., 2015. Genomic and Functional Characterization of a Novel Burkholderia sp. Strain AU4i from Pea Rhizosphere Conferring Plant Growth Promoting Activities. Adv. Genet. Eng. doi:10.4172/2169-0111.1000129

Diallinas, G., Kanellis, A.K., 1994. A phenylalanine ammonia-lyase gene from melon

fruit: cDNA cloning, sequence and expression in response to development and wounding. Plant Mol. Biol. 26, 473–479. doi:10.1007/BF00039557

Distefano, G., Malfa, S.L., Vitale, A., Lorito, M., Deng, Z., Gentile, A., 2008. Defence-

related gene expression in transgenic lemon plants producing an antimicrobial Trichoderma harzianum endochitinase during fungal infection. Transgenic Res. 17, 873–879. doi:10.1007/s11248-008-9172-9

do Carmo Teixeira, D., Luc Danet, J., Eveillard, S., Cristina Martins, E., Cintra de Jesus

Junior, W., Takao Yamamoto, P., Aparecido Lopes, S., Beozzo Bassanezi, R., Juliano Ayres, A., Saillard, C., Bové, J.M., 2005. Citrus huanglongbing in São Paulo State, Brazil: PCR detection of the “Candidatus” Liberibacter species associated with the disease. Mol. Cell. Probes 19, 173–179. doi:10.1016/j.mcp.2004.11.002

Dong, X., 2004. NPR1, all things considered. Curr. Opin. Plant Biol. 7, 547–552.

doi:10.1016/j.pbi.2004.07.005

111

Duan, Y., Zhou, L., Hall, D.G., Li, W., Doddapaneni, H., Lin, H., Liu, L., Vahling, C.M.,

Gabriel, D.W., Williams, K.P., Dickerman, A., Sun, Y., Gottwald, T., 2009. Complete Genome Sequence of Citrus Huanglongbing Bacterium, “ Candidatus Liberibacter asiaticus” Obtained Through Metagenomics. Mol. Plant. Microbe Interact. 22, 1011–1020. doi:10.1094/MPMI-22-8-1011

Duffy, B.K., Weller, D.M., 1996. Biological Control of Take-all of Wheat in the Pacific

Northwest of the USA Using Hypovirulent Gaeumannomyces graminis var. tritici and Fluorescent Pseudomonads. J. Phytopathol. 144, 585–590. doi:10.1111/j.1439-0434.1996.tb00303.x

Dutt, M., Barthe, G., Irey, M., Grosser, J., 2015. Transgenic Citrus Expressing an

Arabidopsis NPR1 Gene Exhibit Enhanced Resistance against Huanglongbing (HLB; Citrus Greening). PLOS ONE 10, e0137134. doi:10.1371/journal.pone.0137134

Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST.

Bioinformatics 26, 2460–2461. doi:10.1093/bioinformatics/btq461 Effmert, U., Kalderás, J., Warnke, R., Piechulla, B., 2012. Volatile Mediated Interactions

Between Bacteria and Fungi in the Soil. J. Chem. Ecol. 38, 665–703. doi:10.1007/s10886-012-0135-5

el-Banna, N., Winkelmann, G., 1998. Pyrrolnitrin from Burkholderia cepacia: antibiotic

activity against fungi and novel activities against streptomycetes. J. Appl. Microbiol. 85, 69–78.

Etxeberria, E., Gonzalez, P., Achor, D., Albrigo, G., 2009. Anatomical distribution of

abnormally high levels of starch in HLB-affected Valencia orange trees. Physiol. Mol. Plant Pathol. 74, 76–83. doi:10.1016/j.pmpp.2009.09.004

Fernando, W.G.D., Linderman, R.G., 1995. Inhibition of Phytophthora vignae and Stem

and Root Rot of Cowpea by Soil Bacteria. Biol. Agric. Hortic. 12, 1–14. doi:10.1080/01448765.1995.9754719

F.J. Gutierrez Mañero, J.A.L., B. Ramos Solano, F. Montes, J. Ojeda, M. Megias, 2009.

Use of two PGPR strains in the integrated management of blast disease in rice (Oryza sativa) in Southern Spain. Field Crops Research 144, 404–410.

Fokkema, N.J., 1978. Fungal antagonisms in the phyllosphere. Ann. Appl. Biol. 89,

115–119. doi:10.1111/j.1744-7348.1978.tb02582.x

112

Francis, M.I., Redondo, A., Burns, J.K., Graham, J.H., 2009. Soil application of imidacloprid and related SAR-inducing compounds produces effective and persistent control of citrus canker. Eur. J. Plant Pathol. 124, 283–292. doi:10.1007/s10658-008-9415-x

Garbeva, P., Hordijk, C., Gerards, S., de Boer, W., 2014. Volatiles produced by the

mycophagous soil bacterium Collimonas. FEMS Microbiol. Ecol. 87, 639–649. doi:10.1111/1574-6941.12252

Garcion, C., Lamotte, O., Cacas, J.-L., Métraux, J.-P., 2014. Mechanisms of Defence to

Pathogens: Biochemistry and Physiology, in: Walters, D.R., Newton, A.C., Lyon, G.D. (Eds.), Induced Resistance for Plant Defense. John Wiley & Sons, Ltd, pp. 106–136.

Glick, B.R., 2012. Plant growth-promoting bacteria: mechanisms and applications.

Scientifica 2012, 963401. doi:10.6064/2012/963401 Glick, B.R., 2005. Modulation of plant ethylene levels by the bacterial enzyme ACC

deaminase. FEMS Microbiol. Lett. 251, 1–7. doi:10.1016/j.femsle.2005.07.030 Glick, B.R., Todorovic, B., Czarny, J., Cheng, Z., Duan, J., McConkey, B., 2007.

Promotion of Plant Growth by Bacterial ACC Deaminase. Crit. Rev. Plant Sci. 26, 227–242. doi:10.1080/07352680701572966

Gopalakrishnan, S., Srinivas, V., Prakash, B., Sathya, A., Vijayabharathi, R., 2014.

Plant growth-promoting traits of Pseudomonas geniculata isolated from chickpea nodules. 3 Biotech 1–9. doi:10.1007/s13205-014-0263-4

Gottwald, T.R., Graham, J.H., Irey, M.S., McCollum, T.G., Wood, B.W., 2012.

Inconsequential effect of nutritional treatments on huanglongbing control, fruit quality, bacterial titer and disease progress. Crop Prot. 36, 73–82. doi:10.1016/j.cropro.2012.01.004

Graham, J., Feichtenberger, E., 2015. Citrus phytophthora diseases: Management

challenges and successes. J. Citrus Pathol. 2. Graham, J.H., Johnson, E.G., Gottwald, T.R., Irey, M.S., 2013. Presymptomatic Fibrous

Root Decline in Citrus Trees Caused by Huanglongbing and Potential Interaction with Phytophthora spp. Plant Dis. 97, 1195–1199. doi:10.1094/PDIS-01-13-0024-RE

Graham, J.H., Leite, R.P., 2004. Lack of Control of Citrus Canker by Induced Systemic

Resistance Compounds. Plant Dis. 88, 745–750. doi:10.1094/PDIS.2004.88.7.745

113

Graham, J.H., Leite, R.P., Yonce, H.D., Myers, M., 2008. Streptomycin controls citrus canker on sweet orange in Brazil and reduces risk of copper burn on grapefruit in Florida. Proc. Fla. State Hortic. Soc. 121, 118–123.

Graham, J.H., Myers, M.E., 2016. Evaluation of soil applied systemic acquired

resistance inducers integrated with copper bactericide sprays for control of citrus canker on bearing grapefruit trees. Crop Prot. 90, 157–162. doi:10.1016/j.cropro.2016.09.002

Graham, J.H., Myers, M.E., 2013. Integration of soil applied neonicotinoid insecticides

and acibenzolar-S-methyl for systemic acquired resistance (SAR) control of citrus canker on young citrus trees. Crop Prot. 54, 239–243. doi:10.1016/j.cropro.2013.09.002

Graham, J.H., Myers, M.E., 2011. Soil Application of SAR Inducers Imidacloprid,

Thiamethoxam, and Acibenzolar-S-Methyl for Citrus Canker Control in Young Grapefruit Trees. Plant Dis. 95, 725–728. doi:10.1094/PDIS-09-10-0653

Graham, J.H., Timmer, I.W., Fardelmann, D., 1986. Toxicity of fungicidal copper in soil

to citrus seedlings and vesicular-arbuscular mycorrhizal fungi. Phytopathol. USA. Graham, T.L., Sequeira, L., Huang, T.S., 1977. Bacterial lipopolysaccharides as

inducers of disease resistance in tobacco. Appl. Environ. Microbiol. 34, 424–432. Gu, Y.-Q., Mo, M.-H., Zhou, J.-P., Zou, C.-S., Zhang, K.-Q., 2007. Evaluation and

identification of potential organic nematicidal volatiles from soil bacteria. Soil Biol. Biochem. 39, 2567–2575. doi:10.1016/j.soilbio.2007.05.011

Guerrero, R., Margulis, L., Berlanga, M., 2013. Symbiogenesis: the holobiont as a unit

of evolution. Int. Microbiol. Off. J. Span. Soc. Microbiol. 16, 133–143. doi:10.2436/20.1501.01.188

Gupta, R., Mathimaran, N., Wiemken, A., Boller, T., Bisaria, V.S., Sharma, S., 2014.

Non-target effects of bioinoculants on rhizospheric microbial communities of Cajanus cajan. Appl. Soil Ecol. 76, 26–33. doi:10.1016/j.apsoil.2013.12.001

Haas, B.J., Gevers, D., Earl, A.M., Feldgarden, M., Ward, D.V., Giannoukos, G., Ciulla,

D., Tabbaa, D., Highlander, S.K., Sodergren, E., Methé, B., DeSantis, T.Z., Consortium, T.H.M., Petrosino, J.F., Knight, R., Birren, B.W., 2011. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res. 21, 494–504. doi:10.1101/gr.112730.110

Haas, D., Défago, G., 2005. Biological control of soil-borne pathogens by fluorescent

pseudomonads. Nat. Rev. Microbiol. 3, 307–319. doi:10.1038/nrmicro1129

114

Haas, D., Keel, C., 2003. Regulation of Antibiotic Production in Root-Colonizing Pseudomonas Spp. and Relevance for Biological Control of Plant Disease. Annu. Rev. Phytopathol. 41, 117–153. doi:10.1146/annurev.phyto.41.052002.095656

Halbert, S.E., Manjunath, K.L., 2004. Asian Citrus Psyllids (Sternorrhyncha: Psyllidae)

and Greening Disease in Citrus: A Literature Review and Assessment of Risk in Florida. Fla. Entomol. 87, 330–353.

Hamiduzzaman, M.M., Jakab, G., Barnavon, L., Neuhaus, J.-M., Mauch-Mani, B., 2005.

β-Aminobutyric Acid-Induced Resistance Against Downy Mildew in Grapevine Acts Through the Potentiation of Callose Formation and Jasmonic Acid Signaling. Mol. Plant. Microbe Interact. 18, 819–829. doi:10.1094/MPMI-18-0819

Hartney, S.L., Mazurier, S., Girard, M.K., Mehnaz, S., Davis, E.W., Gross, H.,

Lemanceau, P., Loper, J.E., 2013. Ferric-Pyoverdine Recognition by Fpv Outer Membrane Proteins of Pseudomonas protegens Pf-5. J. Bacteriol. 195, 765–776. doi:10.1128/JB.01639-12

Heil, M., 2014. Trade-offs Associated with Induced Resistance, in: Walters, D.R.,

Newton, A.C., Lyon, G.D. (Eds.), Induced Resistance for Plant Defense. John Wiley & Sons, Ltd, pp. 171–192.

Heil, M., Hilpert, A., Kaiser, W., Linsenmair, K.E., 2000. Reduced Growth and Seed Set

Following Chemical Induction of Pathogen Defence: Does Systemic Acquired Resistance (SAR) Incur Allocation Costs? J. Ecol. 88, 645–654.

Herms, D.A., Mattson, W.J., 1992. The Dilemma of Plants: To Grow or Defend. Q. Rev.

Biol. 67, 283–335. doi:10.1086/417659 Hincapie, M., Wang, N.-Y., Peres, N.A., Dewdney, M.M., 2013. Baseline Sensitivity of

Guignardia citricarpa Isolates from Florida to Azoxystrobin and Pyraclostrobin. Plant Dis. 98, 780–789. doi:10.1094/PDIS-03-13-0335-RE

Huang, X., Madan, A., 1999. CAP3: A DNA sequence assembly program. Genome Res.

9, 868–877. Hwang, J., Chilton, W.S., Benson, D.M., 2002. Pyrrolnitrin production by Burkholderia

cepacia and biocontrol of Rhizoctonia stem rot of poinsettia. Biol. Control 25, 56–63. doi:10.1016/S1049-9644(02)00044-0

Iavicoli, A., Boutet, E., Buchala, A., Métraux, J.-P., 2003. Induced systemic resistance in

Arabidopsis thaliana in response to root inoculation with Pseudomonas fluorescens CHA0. Mol. Plant-Microbe Interact. MPMI 16, 851–858. doi:10.1094/MPMI.2003.16.10.851

115

Jagoueix, S., Bove, J.-M., Garnier, M., 1994. The Phloem-Limited Bacterium of Greening Disease of Citrus Is a Member of the α Subdivision of the Proteobacteria. Int. J. Syst. Bacteriol. 44, 379–386. doi:10.1099/00207713-44-3-379

Johnson, E.G., Wu, J., Bright, D.B., Graham, J.H., 2014. Association of “Candidatus

Liberibacter asiaticus” root infection, but not phloem plugging with root loss on huanglongbing-affected trees prior to appearance of foliar symptoms. Plant Pathol. 63, 290–298. doi:10.1111/ppa.12109

Kachroo, A., Robin, G.P., 2013. Systemic signaling during plant defense. Curr. Opin.

Plant Biol. 16, 527–533. doi:10.1016/j.pbi.2013.06.019 Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., Piechulla, B., 2009. Bacterial

volatiles and their action potential. Appl. Microbiol. Biotechnol. 81, 1001–1012. doi:10.1007/s00253-008-1760-3

Kamilova, F., Validov, S., Azarova, T., Mulders, I., Lugtenberg, B., 2005. Enrichment for

enhanced competitive plant root tip colonizers selects for a new class of biocontrol bacteria. Environ. Microbiol. 7, 1809–1817. doi:10.1111/j.1462-2920.2005.00889.x

Kanchiswamy, C.N., Malnoy, M., Maffei, M.E., 2015. Bioprospecting bacterial and

fungal volatiles for sustainable agriculture. Trends Plant Sci. 20, 206–211. doi:10.1016/j.tplants.2015.01.004

Kanga, L.H.B., Eason, J., Haseeb, M., Qureshi, J., Stansly, P., 2016. Monitoring for

Insecticide Resistance in Asian Citrus Psyllid (Hemiptera: Psyllidae) Populations in Florida. J. Econ. Entomol. 109, 832–836. doi:10.1093/jee/tov348

Kim, O.-S., Cho, Y.-J., Lee, K., Yoon, S.-H., Kim, M., Na, H., Park, S.-C., Jeon, Y.S.,

Lee, J.-H., Yi, H., Won, S., Chun, J., 2012. Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int. J. Syst. Evol. Microbiol. 62, 716–721. doi:10.1099/ijs.0.038075-0

Kim, Y.C., Jung, H., Kim, K.Y., Park, S.K., 2008. An effective biocontrol bioformulation

against Phytophthora blight of pepper using growth mixtures of combined chitinolytic bacteria under different field conditions. Eur. J. Plant Pathol. 120, 373–382. doi:10.1007/s10658-007-9227-4

Knerr, P.J., van der Donk, W.A., 2012. Discovery, biosynthesis, and engineering of

lantipeptides. Annu. Rev. Biochem. 81, 479–505. doi:10.1146/annurev-biochem-060110-113521

Korpi, A., Järnberg, J., Pasanen, A.-L., 2009. Microbial volatile organic compounds. Crit.

Rev. Toxicol. 39, 139–193. doi:10.1080/10408440802291497

116

Kuć, J., 1982. Induced Immunity to Plant Disease. BioScience 32, 854–860. doi:10.2307/1309008

Lane D.J., 1991. 16S/23S rRNA sequencing. Nucleic Acid Techniques in Bacterial

Systematics 115–175. Lebeis, S.L., 2014. The potential for give and take in plant–microbiome relationships.

Plant Biot. Interact. 5, 287. doi:10.3389/fpls.2014.00287 Lee, K.J., Kamala-Kannan, S., Sub, H.S., Seong, C.K., Lee, G.W., 2008. Biological

control of Phytophthora blight in red pepper (Capsicum annuum L.) using Bacillussubtilis. World J. Microbiol. Biotechnol. 24, 1139–1145. doi:10.1007/s11274-007-9585-2

Li, J., Trivedi, P., Wang, N., 2015. Field Evaluation of Plant Defense Inducers for the

Control of Citrus Huanglongbing. Phytopathology 106, 37–46. doi:10.1094/PHYTO-08-15-0196-R

Li, L., Ma, J., Ibekwe, A.M., Wang, Q., Yang, C.-H., 2015. Cucumber Rhizosphere

Microbial Community Response to Biocontrol Agent Bacillus subtilis B068150. Agriculture 6, 2. doi:10.3390/agriculture6010002

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif 25, 402–408. doi:10.1006/meth.2001.1262

Louzada, E.S., Vazquez, O.E., Braswell, W.E., Yanev, G., Devanaboina, M., Kunta, M.,

2016. Distribution of “Candidatus Liberibacter asiaticus” Above and Below Ground in Texas Citrus. Phytopathology 106, 702–709. doi:10.1094/PHYTO-01-16-0004-R

Lucas, J.A., Ramos Solano, B., Montes, F., Ojeda, J., Megias, M., Gutierrez Mañero,

F.J., 2009. Use of two PGPR strains in the integrated management of blast disease in rice (Oryza sativa) in Southern Spain. Field Crops Res. 114, 404–410. doi:10.1016/j.fcr.2009.09.013

Lugtenberg, B., Kamilova, F., 2009. Plant-growth-promoting rhizobacteria. Annu. Rev.

Microbiol. 63, 541–556. doi:10.1146/annurev.micro.62.081307.162918 Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S.,

Tremblay, J., Engelbrektson, A., Kunin, V., del Rio, T.G., Edgar, R.C., Eickhorst, T., Ley, R.E., Hugenholtz, P., Tringe, S.G., Dangl, J.L., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature 488, 86–90. doi:10.1038/nature11237

117

Lyon, G.D., 2014. Agents That Can Elicit Induced Resistance, in: Walters, D.R., Newton, A.C., Lyon, G.D. (Eds.), Induced Resistance for Plant Defense. John Wiley & Sons, Ltd, pp. 11–40.

Lyon, G.D., Newton, A.C., Walters, D.R., 2014. Induced Resistance in Crop Protection:

The Future, Drivers and Barriers, in: Walters, D.R., Newton, A.C., Lyon, G.D. (Eds.), Induced Resistance for Plant Defense. John Wiley & Sons, Ltd, pp. 316–325. doi:10.1002/9781118371848.ch14

Maffei, M.E., Mithöfer, A., Boland, W., 2007. Insects feeding on plants: rapid signals and

responses preceding the induction of phytochemical release. Phytochemistry 68, 2946–2959. doi:10.1016/j.phytochem.2007.07.016

Mann, R.S., Ali, J.G., Hermann, S.L., Tiwari, S., Pelz-Stelinski, K.S., Alborn, H.T.,

Stelinski, L.L., 2012. Induced Release of a Plant-Defense Volatile “Deceptively” Attracts Insect Vectors to Plants Infected with a Bacterial Pathogen. PLoS Pathog 8, e1002610. doi:10.1371/journal.ppat.1002610

Martini, X., Hoffmann, M., Coy, M.R., Stelinski, L.L., Pelz-Stelinski, K.S., 2015. Infection

of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal. PLoS ONE 10, e0129373. doi:10.1371/journal.pone.0129373

Mazurier, S., Corberand, T., Lemanceau, P., Raaijmakers, J.M., 2009. Phenazine

antibiotics produced by fluorescent pseudomonads contribute to natural soil suppressiveness to Fusarium wilt. ISME J. 3, 977–991. doi:10.1038/ismej.2009.33

Mendes, R., Kruijt, M., de Bruijn, I., Dekkers, E., van der Voort, M., Schneider, J.H.M.,

Piceno, Y.M., DeSantis, T.Z., Andersen, G.L., Bakker, P.A.H.M., Raaijmakers, J.M., 2011. Deciphering the rhizosphere microbiome for disease-suppressive bacteria. Science 332, 1097–1100. doi:10.1126/science.1203980

Meyer, F., Overbeek, R., Rodriguez, A., 2009. FIGfams: yet another set of protein

families. Nucleic Acids Res. 37, 6643–6654. doi:10.1093/nar/gkp698 Nakayama, T., Homma, Y., Hashidoko, Y., Mizutani, J., Tahara, S., 1999. Possible Role

of Xanthobaccins Produced byStenotrophomonas sp. Strain SB-K88 in Suppression of Sugar Beet Damping-Off Disease. Appl. Environ. Microbiol. 65, 4334–4339.

Návarová, H., Bernsdorff, F., Döring, A.-C., Zeier, J., 2012. Pipecolic Acid, an

Endogenous Mediator of Defense Amplification and Priming, Is a Critical Regulator of Inducible Plant Immunity. Plant Cell Online tpc.112.103564. doi:10.1105/tpc.112.103564

118

Newman, M.-A., von Roepenack-Lahaye, E., Parr, A., Daniels, M.J., Dow, J.M., 2002. Prior exposure to lipopolysaccharide potentiates expression of plant defenses in response to bacteria. Plant J. Cell Mol. Biol. 29, 487–495.

Nieto, K.F., Frankenberger, W.T., 1989. Biosynthesis of cytokinins by Azotobacter

chroococcum. Soil Biol. Biochem. 21, 967–972. doi:10.1016/0038-0717(89)90089-8

Niu, D., Wang, X., Wang, Y., Song, X., Wang, J., Guo, J., Zhao, H., 2016. Bacillus

cereus AR156 activates PAMP-triggered immunity and induces a systemic acquired resistance through a NPR1-and SA-dependent signaling pathway. Biochem. Biophys. Res. Commun. 469, 120–125. doi:10.1016/j.bbrc.2015.11.081

Niu, D.-D., Liu, H.-X., Jiang, C.-H., Wang, Y.-P., Wang, Q.-Y., Jin, H.-L., Guo, J.-H.,

2011. The Plant Growth–Promoting Rhizobacterium Bacillus cereus AR156 Induces Systemic Resistance in Arabidopsis thaliana by Simultaneously Activating Salicylate- and Jasmonate/Ethylene-Dependent Signaling Pathways. Mol. Plant. Microbe Interact. 24, 533–542. doi:10.1094/MPMI-09-10-0213

Ofek-Lalzar, M., Sela, N., Goldman-Voronov, M., Green, S.J., Hadar, Y., Minz, D., 2014.

Niche and host-associated functional signatures of the root surface microbiome. Nat. Commun. 5, 4950. doi:10.1038/ncomms5950

Ongena, M., Duby, F., Rossignol, F., Fauconnier, M.-L., Dommes, J., Thonart, P., 2004.

Stimulation of the Lipoxygenase Pathway Is Associated with Systemic Resistance Induced in Bean by a Nonpathogenic Pseudomonas Strain. Mol. Plant. Microbe Interact. 17, 1009–1018. doi:10.1094/MPMI.2004.17.9.1009

Ongena, M., Jacques, P., 2008. Bacillus lipopeptides: versatile weapons for plant

disease biocontrol. Trends Microbiol. 16, 115–125. doi:10.1016/j.tim.2007.12.009 Ongena, M., Jourdan, E., Schäfer, M., Kech, C., Budzikiewicz, H., Luxen, A., Thonart,

P., 2005. Isolation of an N-alkylated benzylamine derivative from Pseudomonas putida BTP1 as elicitor of induced systemic resistance in bean. Mol. Plant-Microbe Interact. MPMI 18, 562–569. doi:10.1094/MPMI-18-0562

Onofre-Lemus, J., Hernández-Lucas, I., Girard, L., Caballero-Mellado, J., 2009. ACC (1-

aminocyclopropane-1-carboxylate) deaminase activity, a widespread trait in Burkholderia species, and its growth-promoting effect on tomato plants. Appl. Environ. Microbiol. 75, 6581–6590. doi:10.1128/AEM.01240-09

Ouyang, J., Shao, X., Li, J., 2000. Indole‐3‐glycerol phosphate, a branchpoint of

indole‐3‐acetic acid biosynthesis from the tryptophan biosynthetic pathway in Arabidopsis thaliana. Plant J. 24. doi:10.1046/j.1365-313x.2000.00883.x

119

Pan, X., Welti, R., Wang, X., 2010. Quantitative analysis of major plant hormones in crude plant extracts by high-performance liquid chromatography-mass spectrometry. Nat. Protoc. 5, 986–992. doi:10.1038/nprot.2010.37

Park, S.-W., Kaimoyo, E., Kumar, D., Mosher, S., Klessig, D.F., 2007. Methyl salicylate

is a critical mobile signal for plant systemic acquired resistance. Science 318, 113–116. doi:10.1126/science.1147113

Parks, D.H., Tyson, G.W., Hugenholtz, P., Beiko, R.G., 2014. STAMP: statistical

analysis of taxonomic and functional profiles. Bioinforma. Oxf. Engl. 30, 3123–3124. doi:10.1093/bioinformatics/btu494

Pastor, V., Balmer, A., Gamir, J., Flors, V., Mauch-Mani, B., 2014. Preparing to fight

back: generation and storage of priming compounds. Front. Plant Sci. 5. doi:10.3389/fpls.2014.00295

Peng, J., Deng, X., Huang, J., Jia, S., Miao, X., Huang, Y., 2004. Role of salicylic acid in

tomato defense against cotton bollworm, Helicoverpa armigera Hubner. Z. Für Naturforschung C J. Biosci. 59, 856–862.

Peñuelas, J., Asensio, D., Tholl, D., Wenke, K., Rosenkranz, M., Piechulla, B.,

Schnitzler, J.P., 2014. Biogenic volatile emissions from the soil. Plant Cell Environ. 37, 1866–1891. doi:10.1111/pce.12340

Petti, C., Khan, M., Doohan, F., 2010. Lipid transfer proteins and protease inhibitors as

key factors in the priming of barley responses to Fusarium head blight disease by a biocontrol strain of Pseudomonas fluorescens. Funct. Integr. Genomics 10, 619–627. doi:10.1007/s10142-010-0177-0

Piechulla, B., Degenhardt, J., 2014. The emerging importance of microbial volatile

organic compounds. Plant Cell Environ. 37, 811–812. doi:10.1111/pce.12254 Pieterse, C.M.J., Leon-Reyes, A., Van der Ent, S., Van Wees, S.C.M., 2009.

Networking by small-molecule hormones in plant immunity. Nat. Chem. Biol. 5, 308–316. doi:10.1038/nchembio.164

Pieterse, C.M., van Wees, S.C., van Pelt, J.A., Knoester, M., Laan, R., Gerrits, H.,

Weisbeek, P.J., van Loon, L.C., 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10, 1571–1580.

Pieterse, C.M.J., Zamioudis, C., Berendsen, R.L., Weller, D.M., Van Wees, S.C.M.,

Bakker, P.A.H.M., 2014. Induced Systemic Resistance by Beneficial Microbes. Annu. Rev. Phytopathol. 52, 347–375. doi:10.1146/annurev-phyto-082712-102340

120

Pikovskaya R. I., 1948. Mobilization of phosphorus in soil in connection with the vital activity of some microbial species. Mikrobiologiya 17, 362–370.

Qin, Y., Lu, M., Gong, X., 2008. Dihydrorhodamine 123 is superior to 2,7-

dichlorodihydrofluorescein diacetate and dihydrorhodamine 6G in detecting intracellular hydrogen peroxide in tumor cells. Cell Biol. Int. 32, 224–228. doi:10.1016/j.cellbi.2007.08.028

Qiu, M., Li, S., Zhou, X., Cui, X., Vivanco, J.M., Zhang, N., Shen, Q., Zhang, R., 2014.

De-coupling of root–microbiome associations followed by antagonist inoculation improves rhizosphere soil suppressiveness. Biol. Fertil. Soils 50, 217–224. doi:10.1007/s00374-013-0835-1

Raguchander, T., R. Samiyappan, S. Sundaramoorthy, 2012. Combinatorial effect of

endophytic and plant growth promoting rhizobacteria against wilt disease of Capsicum annum L. caused by Fusarium solani. Biological Control 60.

Richard, D., Tribot, N., Boyer, C., Terville, M., Boyer, K., Javegny, S., Roux-Cuvelier,

M., Pruvost, O., Moreau, A., Chabirand, A., Vernière, C., 2016. First Report of Copper-resistant Xanthomonas citri pv. citri Pathotype A Causing Asiatic Citrus Canker in Réunion, France. Plant Dis. 101, 503. doi:10.1094/PDIS-09-16-1387-PDN

Rodriguez, H., Gonzalez, T., Goire, I., Bashan, Y., 2004. Gluconic acid production and

phosphate solubilization by the plant growth-promoting bacterium Azospirillum spp. Naturwissenschaften 91, 552–555. doi:10.1007/s00114-004-0566-0

Rudrappa, T., Biedrzycki, M.L., Kunjeti, S.G., Donofrio, N.M., Czymmek, K.J., Paré,

P.W., Bais, H.P., 2010. The rhizobacterial elicitor acetoin induces systemic resistance in Arabidopsis thaliana. Commun. Integr. Biol. 3, 130–138.

Ryan, R.P., Vorhölter, F.-J., Potnis, N., Jones, J.B., Van Sluys, M.-A., Bogdanove, A.J.,

Dow, J.M., 2011. Pathogenomics of Xanthomonas: understanding bacterium–plant interactions. Nat. Rev. Microbiol. 9, 344–355. doi:10.1038/nrmicro2558

Rybak, M., Minsavage, G.V., Stall, R.E., Jones, J.B., 2009. Identification of

Xanthomonas citri ssp. citri host specificity genes in a heterologous expression host. Mol. Plant Pathol. 10, 249–262. doi:10.1111/j.1364-3703.2008.00528.x

Ryu, C.-M., Farag, M.A., Hu, C.-H., Reddy, M.S., Wei, H.-X., Paré, P.W., Kloepper,

J.W., 2003. Bacterial volatiles promote growth in Arabidopsis. Proc. Natl. Acad. Sci. 100, 4927–4932. doi:10.1073/pnas.0730845100

121

Sagaram, U.S., DeAngelis, K.M., Trivedi, P., Andersen, G.L., Lu, S.-E., Wang, N., 2009. Bacterial Diversity Analysis of Huanglongbing Pathogen-Infected Citrus, Using PhyloChip Arrays and 16S rRNA Gene Clone Library Sequencing. Appl. Environ. Microbiol. 75, 1566–1574. doi:10.1128/AEM.02404-08

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for

reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schäfer, T., Adams, T., 2015. The Importance of Microbiology in Sustainable

Agriculture, in: Lugtenberg, B. (Ed.), Principles of Plant-Microbe Interactions. Springer International Publishing, pp. 5–6.

Schlaeppi, K., Bulgarelli, D., 2014. The Plant Microbiome at Work. Mol. Plant. Microbe Interact. 28, 212–217. doi:10.1094/MPMI-10-14-0334-FI

Schmidt, R., Cordovez, V., de Boer, W., Raaijmakers, J., Garbeva, P., 2015. Volatile

affairs in microbial interactions. ISME J. 9, 2329–2335. doi:10.1038/ismej.2015.42

Schulz, S., Dickschat, J.S., 2007. Bacterial volatiles: the smell of small organisms. Nat.

Prod. Rep. 24, 814–842. doi:10.1039/b507392h Schulz-Bohm, K., Geisen, S., Wubs, E.R.J., Song, C., de Boer, W., Garbeva, P., 2016.

The prey’s scent – Volatile organic compound mediated interactions between soil bacteria and their protist predators. ISME J. doi:10.1038/ismej.2016.144

Schuman, M.C., Baldwin, I.T., 2016. The Layers of Plant Responses to Insect

Herbivores. Annu. Rev. Entomol. 61, null. doi:10.1146/annurev-ento-010715-023851

Schwyn, B., Neilands, J.B., 1987. Universal chemical assay for the detection and

determination of siderophores. Anal. Biochem. 160, 47–56. Sheikh, A.H., Raghuram, B., Eschen-Lippold, L., Scheel, D., Lee, J., Sinha, A.K., 2014.

Agroinfiltration by cytokinin-producing Agrobacterium sp. strain GV3101 primes defense responses in Nicotiana tabacum. Mol. Plant-Microbe Interact. MPMI 27, 1175–1185. doi:10.1094/MPMI-04-14-0114-R

Shen, Z., Ruan, Y., Chao, X., Zhang, J., Li, R., Shen, Q., 2015. Rhizosphere microbial

community manipulated by 2 years of consecutive biofertilizer application associated with banana Fusarium wilt disease suppression. Biol. Fertil. Soils 51, 553–562. doi:10.1007/s00374-015-1002-7

Spaepen, S., Vanderleyden, J., Remans, R., 2007. Indole-3-acetic acid in microbial and

microorganism-plant signaling. FEMS Microbiol. Rev. 31, 425–448. doi:10.1111/j.1574-6976.2007.00072.x

122

Stall, R.E., Miller, J.W., Marco, G.M., Echenique, B.I.C. de, 1980. Population dynamics of Xanthomonas citri causing cancrosis of citrus in Argentina. Proc. Annu. Meet. Fla. State Hortic. Soc. USA.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular

Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. mst197. doi:10.1093/molbev/mst197

Tatineni, S., Sagaram, U.S., Gowda, S., Robertson, C.J., Dawson, W.O., Iwanami, T.,

Wang, N., 2008. In Planta Distribution of “Candidatus Liberibacter asiaticus” as Revealed by Polymerase Chain Reaction (PCR) and Real-Time PCR. Phytopathology 98, 592–599. doi:10.1094/PHYTO-98-5-0592

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

Tiwari, S., Mann, R.S., Rogers, M.E., Stelinski, L.L., 2011. Insecticide resistance in field

populations of Asian citrus psyllid in Florida. Pest Manag. Sci. 67, 1258–1268. doi:10.1002/ps.2181

Tiwari, S., Meyer, W.L., Stelinski, L.L., 2013. Induced resistance against the Asian citrus

psyllid, Diaphorina citri, by β-aminobutyric acid in citrus. Bull. Entomol. Res. 103, 592–600. doi:10.1017/S0007485313000229

Tjamos, S.E., Flemetakis, E., Paplomatas, E.J., Katinakis, P., 2005. Induction of

resistance to Verticillium dahliae in Arabidopsis thaliana by the biocontrol agent K-165 and pathogenesis-related proteins gene expression. Mol. Plant-Microbe Interact. MPMI 18, 555–561. doi:10.1094/MPMI-18-0555

Ton, J., Flors, V., Mauch-Mani, B., 2009. The multifaceted role of ABA in disease

resistance. Trends Plant Sci. 14, 310–317. doi:10.1016/j.tplants.2009.03.006 Tran, H., Ficke, A., Asiimwe, T., Höfte, M., Raaijmakers, J.M., 2007. Role of the cyclic

lipopeptide massetolide A in biological control of Phytophthora infestans and in colonization of tomato plants by Pseudomonas fluorescens. New Phytol. 175, 731–742. doi:10.1111/j.1469-8137.2007.02138.x

Trivedi, P., Duan, Y., Wang, N., 2010. Huanglongbing, a Systemic Disease,

Restructures the Bacterial Community Associated with Citrus Roots. Appl. Environ. Microbiol. 76, 3427–3436. doi:10.1128/AEM.02901-09

123

Trivedi, P., Sagaram, U.S., Kim, J.-S., Brlansky, R.H., Rogers, M.E., Stelinski, L.L., Oswalt, C., Wang, N., 2009. Quantification of viable Candidatus Liberibacter asiaticus in hosts using quantitative PCR with the aid of ethidium monoazide (EMA). Eur. J. Plant Pathol. 124, 553–563. doi:10.1007/s10658-009-9439-x

Trivedi, P., Spann, T., Wang, N., 2011a. Isolation and Characterization of Beneficial

Bacteria Associated with Citrus Roots in Florida. Microb. Ecol. 62, 324–336. doi:10.1007/s00248-011-9822-y

Turner, T.R., James, E.K., Poole, P.S., 2013. The plant microbiome. Genome Biol. 14,

209. doi:10.1186/gb-2013-14-6-209 Tyc, Song, C., Dickschat, J.S., Vos, M., Garbeva, P., 2016. The Ecological Role of

Volatile and Soluble Secondary Metabolites Produced by Soil Bacteria. Trends Microbiol. doi:10.1016/j.tim.2016.12.002

van de Mortel, J.E., de Vos, R.C.H., Dekkers, E., Pineda, A., Guillod, L., Bouwmeester,

K., van Loon, J.J.A., Dicke, M., Raaijmakers, J.M., 2012. Metabolic and transcriptomic changes induced in Arabidopsis by the rhizobacterium Pseudomonas fluorescens SS101. Plant Physiol. 160, 2173–2188. doi:10.1104/pp.112.207324

van Hulten, M., Pelser, M., van Loon, L.C., Pieterse, C.M.J., Ton, J., 2006. Costs and

benefits of priming for defense in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 103, 5602–5607. doi:10.1073/pnas.0510213103

van Loon, L.C., Bakker, P.A.H.M., Pieterse, C.M.J., 1998. Systemic Resistance Induced

by Rhizosphere Bacteria. Annu. Rev. Phytopathol. 36, 453–483. doi:10.1146/annurev.phyto.36.1.453

van Loon, L.C., Bakker, P.A.H.M., van der Heijdt, W.H.W., Wendehenne, D., Pugin, A.,

2008. Early responses of tobacco suspension cells to rhizobacterial elicitors of induced systemic resistance. Mol. Plant-Microbe Interact. MPMI 21, 1609–1621. doi:10.1094/MPMI-21-12-1609

Vandenkoornhuyse, P., Quaiser, A., Duhamel, M., Le Van, A., Dufresne, A., 2015. The

importance of the microbiome of the plant holobiont. New Phytol. 206, 1196–1206. doi:10.1111/nph.13312

Varnier, A.-L., Sanchez, L., Vatsa, P., Boudesocque, L., Garcia-Brugger, A.,

Rabenoelina, F., Sorokin, A., Renault, J.-H., Kauffmann, S., Pugin, A., Clement, C., Baillieul, F., Dorey, S., 2009. Bacterial rhamnolipids are novel MAMPs conferring resistance to Botrytis cinerea in grapevine. Plant Cell Environ. 32, 178–193. doi:10.1111/j.1365-3040.2008.01911.x

124

Wagg, C., Bender, S.F., Widmer, F., Heijden, M.G.A. van der, 2014. Soil biodiversity and soil community composition determine ecosystem multifunctionality. Proc. Natl. Acad. Sci. 111, 5266–5270. doi:10.1073/pnas.1320054111

Walters, D.R., Bennett, A.E., 2014. Microbial Induction of Resistance to Pathogens, in:

Walters, D.R., Newton, A.C., Lyon, G.D. (Eds.), Induced Resistance for Plant Defense. John Wiley & Sons, Ltd, pp. 149–170.

Walters, D.R., Paterson, L., Walsh, D.J., Havis, N.D., 2008. Priming for plant defense in

barley provides benefits only under high disease pressure. Physiol. Mol. Plant Pathol. 73, 95–100. doi:10.1016/j.pmpp.2009.03.002

Walters, D.R., Ratsep, J., Havis, N.D., 2013. Controlling crop diseases using induced

resistance: challenges for the future. J. Exp. Bot. ert026. doi:10.1093/jxb/ert026 Wang, C., El-Shetehy, M., Shine, M.B., Yu, K., Navarre, D., Wendehenne, D., Kachroo,

A., Kachroo, P., 2014. Free Radicals Mediate Systemic Acquired Resistance. Cell Rep. 7, 348–355. doi:10.1016/j.celrep.2014.03.032

Wang, N., Stelinski, L., Pelz-Stelinski, K., Graham, J.H., Zhang, Y., 2017. Tale of the

Huanglongbing disease pyramid in the context of the citrus phytobiome. Phytopathology. doi:10.1094/PHYTO-12-16-0426-RVW

Wang, N., Trivedi, P., 2013. Citrus Huanglongbing: A Newly Relevant Disease Presents

Unprecedented Challenges. Phytopathology 103, 652–665. doi:10.1094/PHYTO-12-12-0331-RVW

Wang, Z., Yin, Y., Hu, H., Yuan, Q., Peng, G., Xia, Y., 2006. Development and

application of molecular-based diagnosis for “Candidatus Liberibacter asiaticus”, the causal pathogen of citrus huanglongbing. Plant Pathol. 55, 630–638. doi:10.1111/j.1365-3059.2006.01438.x

War, A.R., Paulraj, M.G., Ahmad, T., Buhroo, A.A., Hussain, B., Ignacimuthu, S.,

Sharma, H.C., 2012. Mechanisms of plant defense against insect herbivores. Plant Signal. Behav. 7, 1306–1320. doi:10.4161/psb.21663

Wattam, A.R., Abraham, D., Dalay, O., Disz, T.L., Driscoll, T., Gabbard, J.L., Gillespie,

J.J., Gough, R., Hix, D., Kenyon, R., Machi, D., Mao, C., Nordberg, E.K., Olson, R., Overbeek, R., Pusch, G.D., Shukla, M., Schulman, J., Stevens, R.L., Sullivan, D.E., Vonstein, V., Warren, A., Will, R., Wilson, M.J.C., Yoo, H.S., Zhang, C., Zhang, Y., Sobral, B.W., 2014. PATRIC, the bacterial bioinformatics database and analysis resource. Nucleic Acids Res. 42, D581-591. doi:10.1093/nar/gkt1099

125

Weber, T., Blin, K., Duddela, S., Krug, D., Kim, H.U., Bruccoleri, R., Lee, S.Y., Fischbach, M.A., Müller, R., Wohlleben, W., Breitling, R., Takano, E., 2015. antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, W237–W243. doi:10.1093/nar/gkv437

Wendehenne, D., Gao, Q., Kachroo, A., Kachroo, P., 2014. Free radical-mediated

systemic immunity in plants. Curr. Opin. Plant Biol., SI: Biotic interactions 20, 127–134. doi:10.1016/j.pbi.2014.05.012

Whipps, J.M., 2001. Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot.

52, 487–511. doi:10.1093/jexbot/52.suppl_1.487 Wu, L., Wu, H., Chen, L., Yu, X., Borriss, R., Gao, X., 2015. Difficidin and bacilysin from

Bacillus amyloliquefaciens FZB42 have antibacterial activity against Xanthomonas oryzae rice pathogens. Sci. Rep. 5, 12975. doi:10.1038/srep12975

Yao, H., Wu, F., 2010. Soil microbial community structure in cucumber rhizosphere of

different resistance cultivars to fusarium wilt. FEMS Microbiol. Ecol. 72, 456–463. doi:10.1111/j.1574-6941.2010.00859.x

Yu, K., Soares, J.M., Mandal, M.K., Wang, C., Chanda, B., Gifford, A.N., Fowler, J.S.,

Navarre, D., Kachroo, A., Kachroo, P., 2013. A feedback regulatory loop between G3P and lipid transfer proteins DIR1 and AZI1 mediates azelaic-acid-induced systemic immunity. Cell Rep. 3, 1266–1278. doi:10.1016/j.celrep.2013.03.030

Zamioudis, C., Pieterse, C.M.J., 2012. Modulation of host immunity by beneficial

microbes. Mol. Plant-Microbe Interact. MPMI 25, 139–150. doi:10.1094/MPMI-06-11-0179

Zancarini, A., Lépinay, C., Burstin, J., Duc, G., Lemanceau, P., Moreau, D., Munier-

Jolain, N., Pivato, B., Rigaud, T., Salon, C., Mougel, C., 2013. Combining Molecular Microbial Ecology with Ecophysiology and Plant Genetics for a Better Understanding of Plant–Microbial Communities’ Interactions in the Rhizosphere, in: Bruijn, F.J. de (Ed.), Molecular Microbial Ecology of the Rhizosphere. John Wiley & Sons, Inc., pp. 69–86.

Zebelo, S., Song, Y., Kloepper, J.W., Fadamiro, H., 2016. Rhizobacteria activates (+)-δ-

cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua). Plant Cell Environ. n/a-n/a. doi:10.1111/pce.12704

Zehnder, G., Kloepper, J., Tuzun, S., Yao, C., Wei, G., Chambliss, O., Shelby, R.,

1997a. Insect feeding on cucumber mediated by rhizobacteria-induced plant resistance. Entomol. Exp. Appl. 83, 81–85. doi:10.1046/j.1570-7458.1997.00159.x

126

Zehnder, G., Kloepper, J., Yao, C., Wei, G., 1997b. Induction of Systemic Resistance in Cucumber Against Cucumber Beetles (Coleoptera: Chrysomelidae) by Plant Growth-Promoting Rhizobacteria. J. Econ. Entomol. 90, 391–396. doi:10.1093/jee/90.2.391

Zhao, L.Y., Chen, J.L., Cheng, D.F., Sun, J.R., Liu, Y., Tian, Z., 2009. Biochemical and

molecular characterizations of Sitobion avenae-induced wheat defense responses. Crop Prot. 28, 435–442. doi:10.1016/j.cropro.2009.01.005

Zou, C.-S., Mo, M.-H., Gu, Y.-Q., Zhou, J.-P., Zhang, K.-Q., 2007. Possible

contributions of volatile-producing bacteria to soil fungistasis. Soil Biol. Biochem. 39, 2371–2379. doi:10.1016/j.soilbio.2007.04.009

127

BIOGRAPHICAL SKETCH

Nadia Riera Faraone was born in Montevideo, Uruguay in 1988. She obtained a

bachelor degree in biochemistry from University of the Republic in Montevideo,

Uruguay. During 2011, she focused on microbial ecology and beneficial plant-microbe

interactions. During the last two years as an undergrad, Nadia worked in the Institute of

Biological Research “Clemente Estable” (IIBCE) in the characterization of an antifungal

compounds produced by the biocontrol strain Pseudomonas fluorescens CFP2392.

After completing her bachelor degree in Biochemistry Nadia started to pursue a Master

degree in Biological Sciences with a concentration in microbiology from PEDECIBA

(Montevideo, Uruguay). As a Master student Nadia joined Nian Wang’s lab where she

worked in the identification of chemical compounds able to inhibit Xanthomonas citri

subsp. citri biofilm formation and quorum sensing. In August 2013 Nadia joined the

graduate program in the Department of Microbiology and Cell Science at the University

of Florida where she worked in citrus microbiome and the positive interactions emerging

from rhizospheric microorganisms. She received her Ph.D. from the University of Florida

in the summer of 2017.