Feature Article

Two-Surface Strategy in Electrochemical DNA HybridizationAssays: Detection of Osmium-Labeled Target DNA at CarbonElectrodesMiroslav Fojta, Ludek Havran, Sabina Billova, Pavel Kostecka, Michal Masarik, Rene Kizek

Institute of Biophysics, Academy of Sciences of the Czech Republic, Kralovopolska 135, 612 65 Brno, Czech Republic*e-mail: fojta@ibp.cz

Received: June 15, 2002Final version: July 19, 2002

AbstractTarget DNAs, including a 71-mer oligonucleotide, a PCR product and a plasmid DNA, all containing oligo(A)stretches, were hybridized at magnetic Dynabeads oligo(dT)25 (DBT). The hybridization events were detected using atechnique based on chemical modification of the target DNAwith a complex of osmium tetroxide with 2,2�-bipyridine(Os, bipy) and voltammetric detection at carbon electrodes. DNAwas modified with Os, bipy prior to capture at DBT,at the beads, or after release from the beads. In the latter case, DNA-Os, bipy was detected in the reaction mixtureusing adsorptive transfer stripping voltammetry involving extraction of unreacted Os, bipy from the electrode byorganic solvents. Pre-labeling of the target plasmid DNA and the PCR product with Os, bipy significantly increasedthe yield of DNA captured at the beads. Tens of femtomoles of both short (the 71-mer oligonucleotide) and long (the3-kilobase plasmid) target DNAs in a 20-microliter hybridization sample can be easily detected by means of thesetechniques. Various carbon electrode materials, including pyrolytic graphite (PGE), highly oriented pyrolytic graphite(HOPGE), carbon paste (CPE), glassy carbon and pencil graphite, were tested regarding their suitability for thedetection of osmium-labeled DNA. Among them, PGE and HOPGE appeared usable in the measurements of bothpurified DNA-Os, bipy and its mixtures with unreacted Os, bipy while CPE was suitable for the detection purifiedosmium-labeled DNA.

Keywords: Osmium-labeled target DNA, Magnetic beads, DNA hybridization, Electrochemical detection, Carbonelectrodes

1. Introduction

Diagnosis of a number of bacterial or viral infectious as wellas human genetic (inherited) diseases involves detection ofspecific DNA (or RNA) sequences by using DNA hybrid-ization techniques. Development of electrochemical bio-sensors for DNA hybridization represents one of the majortopics of the present nucleic acid electrochemistry (re-viewed in [1 ± 4]). Electrochemical signal transductionappears to be a useful alternative to the optical one mainlydue to lower costs and easier construction of simple,portable, perhaps one-purpose devices. It is expected thatelectrochemical sensors for DNA hybridization or DNAdamage (reviewed in [1, 5, 6]) will be available in near futurefor routine medical diagnostics, for environmental analysis,etc.Electroactive DNA markers (indicators) have been used

in DNA electrochemical analysis and in DNA biosensortechnology to improve the sensitivity and selectivity of themeasured signals. DNA displays a specific intrinsic electro-activity, yielding redox signals due to base reduction (atmercury electrodes) or oxidation (at carbon electrodes) ordue to deoxyribose oxidation (at copper electrodes) (re-viewed in [3, 7]). In addition, tensammetric DNA responsecan be obtained at the mercury electrodes [3, 7]. It has been

shown that DNA signals obtained at themercury electrodesdisplay a unique sensitivity to DNA structure [2, 3, 7 ± 10].However, intrinsic DNA electrochemical signals are ingeneral irreversible and occur at rather extreme potentials,close to background discharge at both mercury and carbonelectrodes. For these reasons DNA complexation or deriva-tization techniques involving electroactive markers arebeing developed (reviewed in [2, 3]). These techniquesemploy species exhibiting i) well-pronounced electrochem-istry at less extreme potentials, involving reversible orcatalytic electrode processes, and/or ii) non-covalent orcovalent structure-selective interactions with DNA. Elec-troactive non-covalent binders includingDNA intercalators(metal chelates such as [Co(phen)3]3� [11], daunomycin [12],a bis-intercalator bis-9-acridinyl derivative with a viologenlinker [13] or a threading intercalator ferrocenyl-couplednaphthalenediimide [14]) or groovebinders (Hoechst 33258[15]) selectively recognizing duplexDNAhave been used asredox indicators of DNA hybridization at the electrodesurface.Other authors used covalent labeling of targetDNAor hybridization (reporter) probes with electroactive mark-ers (such as ferrocene derivatives [16]) or enzymes takingpart in electrocatalytic processes (peroxidase [17]).Osmium tetroxide complexes (Os,L) were introduced as

electroactive DNA markers in the early 80×s [18, 19].

431

Electroanalysis 2003, 15, No. 5 ± 6 ¹ 2003 WILEY-VCH Verlag GmbH&Co. KGaA, Weinheim 1040-0397/03/0503-0431 $ 17.50+.50/0

Complexes of OsO4 with nitrogen ligands such 2,2�-bipyr-idine (bipy) covalently bind to the 5,6 double bond of thepyrimidine ring (thymine is about 10-fold more reactivethan cytosine) [20 ± 22]. On the other hand, purine basespractically do not react with Os,L [20 ± 22]. Pyrimidineswithin B-formdouble-stranded (ds)DNAare not accessiblefor the reaction with Os, bipy. This feature makes Os, bipyand some other Os,L excellent DNA structural probes [20,23]. At the mercury or carbon electrodes, Os,L as well asOs,L-modified DNA (DNA-Os,L) undergo several (qua-si)reversible faradaic processes corresponding to consec-utive reduction/oxidation of osmium atom [19, 21, 22, 24].We have recently shown [22] that DNA-Os, bipy yields aspecific peak (peak �) at the pyrolytic graphite electrode(PGE) whose potential significantly differs from that of acorresponding signal of free Os, bipy reagent. This fact,together with application of an adsorptive transfer voltam-metric (AdTSV) procedure involving extraction of unreact-edOs, bipy from the electrode surfacewith organic solvents,allowed us to determine DNA-Os, bipy in an excess of freeOs, bipy. This procedure was ineffective in connection withthe mercury electrode; measurements of osmium-labeledDNA at the HMDE required careful removal of the freeOs, bipy reagent prior to analysis. On the other hand,measurement of a catalytic osmium peak yielded by themodified DNA at HMDE represents probably the mostsensitive DNA electrochemical determination withoutprevious degradation (down to sub-femtomole amountswhen 5-microliter samples are analyzed) [19, 24].Up to now, electrochemical DNA biosensors have been

based mainly on oligonucleotide (ODN) probes immobi-lized on a transducer electrode surface (reviewed in [1 ± 4]).In such a system,ODN-modified electrode is immersed intotarget DNA solution under conditions allowing DNAduplex formation (when DNA sequence complementaryto the immobilized probe is present) followed by anelectrochemical detection step. This system works wellwith target synthetic ODNs of about the same lengths as thecapture probe.When real, substantially longer target DNAs(PCR products, plasmid, viral or chromosomal DNAs) areanalyzed, sensitivity and specificity of the assay are usuallyinsufficient [2, 3, 25]. The main difficulties arise fromnonspecific DNA adsorption, and considerable interactionsof redox indicators with the former or with the single-stranded hybridization probe, etc.A new strategy has been recently [25 ± 30] based on

separation of DNA hybridization from the electrochemicaldetection. Target DNA is hybridized with the immobilizedprobe DNA at one surface (surface H). Electrochemicaldetection is performed at another surface (DetectionElectrode, DE). This system allows much easier finding ofoptimal conditions for both the hybridization and thedetection steps [3, 25, 26] than the one-surface systems. Inour work we used commercially available magnetic Dyna-beads oligo(dT)25 as surface H, in connection with variousdetection techniques including i) cathodic stripping voltam-metry of purine bases (released from captured target DNAsby acid treatment) at HMDE [26, 31] or at a solid copper

amalgam electrode [31] , or ii) enzyme-linked electrochem-ical immunoassay ofOs, bipy-labeledDNA[3]. In this paperwe utilize a recently developed [22] technique of analysis ofthe Os, bipy-modified DNA at carbon electrodes as thedetection technique in two-surface DNA hybridizationassays involving osmium labeling of target DNAs.

2. Experimental

2.1. Material

Dynabeads Oligo(dT)25 (DBT) and magnetic particle con-centrator MPC-S were supplied by Dynal A.S.( Norway).Plasmid DNAs pSP64 vector and pSP64-polyA werepurified using Qiagen Plasmid Purification Kit (Qiagen,Germany) according to the user×s manual, and linearizedwith restrictase Eco RI (Takara, Japan) followed by ethanolprecipitation and dissolving in 10 mM Tris, 1 mM EDTA,pH 7.6 (TE buffer). Oligonucleotides, the 71-mer5�TTGG(TTTTTTCTC)4TTTTTG(A)253� and the 61-mer5�(AAG)12(A)253� were purchased from VBC-GENOMICS(Austria). 226 base pair PCR product 5�-AAA AAAAAAAAAAAAAAAAAAAAAACGTTCTTCGGGGCGAAA ACT CTC AAG GAT CTT ACC GCT GTT GAGATC CAG TTC GAT GTA ACC CAC TCG TGC ACCCAACTGATCTTCAGCATCTTTTCTTTCACCAGCGTT TCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGT TGAATACTC TTC CTT TTT C-3� wassynthesized and kindly donated by Dr. Jan Palecek (In-stitute of Biophysics, Brno, Czech Republic). Osmiumtetroxide was obtained from JMC (Great Britain). Otherchemical reagents were of analytical grade. The concen-tration of ODNs and plasmid DNAs was determinedspectrophotometrically using a HP 8452 spectrophotome-ter, concentration of the PCR product was estimated bydensitometry of ethidium-stained agarose gel.

2.2. DNA Modification with Os, bipy

In the pre-labeling technique, DNA samples (50 �g mL�1)were incubated with 2 mM OsO4 and 2 mM 2,2�-bipyridinein 0.1 M Tris-HCl (pH 7.4). The reaction was carried out at37 �C for 3 h. Unreacted Os, bipy was removed either bydialysis against TE buffer using Slide-A-Lyzer MINIDialysis Units (Rockford, IL,USA) at 5 �C for 6 h (in caseof the 71-mer ODN), or by ultrafiltration with MicroconYM-50 (Millipore, USA) (PCR samples and plasmidDNAs). Concentrations of osmium-modified DNAs weredetermined by AdTS SWV. In the post-labeling procedure,Os, bipy was added to target DNA samples released fromthe beads in TE buffer to a final concentration of 2 mMfollowed by a 3-hour-incubation at 37 �C. Target DNAmodification at the DBTwas performed by shaking of thebeads with hybridized target ODNs with 50 �L of 2 mMOs, bipy in 0.3 M NaCl, 0.01 M Tris-HCl, pH 7.4 (buffer H)

432 M. Fojta et al.

Electroanalysis 2003, 15, No. 5 ± 6

followed by triple washing the beads in 50 �L of buffer Hand releasing of the DNA (see below).

2.3. DNA Hybridization at Magnetic Beads

In all steps, magnetic beads were separated from thesupernatant using the magnetic concentrator and resus-pended in a new medium by vortexing. Aliquots (10 �L) ofDBTwere first washed two times by 20 �Lof bufferH. Then20 �L of DNA solution in buffer H was added to the DBT.The mixtures were shaken in the thermomixer for 30 min20 �C (if not stated otherwise) to allow hybridizationbetween target DNA in solution and the (dT)25 probes onthe beads surface. After hybridization, the beads werewashed twice by short vortexing in 50 �L of buffer H. TargetDNA was released into 10 �L of TE buffer by heating theDBTsuspension at 85 �Cfor 2 min. Prior to adsorption at theelectrode, 2.2 �L of 2 M NaCl was added to each sample(final NaCl concentration 0.2 M).

2.4. Voltammetric Measurements

2.4.1. Preparation of Carbon Electrodes

Surfaces of homemade PGE or highly oriented pyrolyticgraphite electrode (HOPGE; HOPG purchased fromStructure Probes, USA) were renewed after each measure-ment by applying a potential �1.7 V for 30 s in thebackground electrolyte followed by cleaving the facialgraphite layer using sticky tape. Carbon paste electrode(CPE) was prepared by mixing of graphite powder CR-5(Tesla, CzechRepublic) withmineral oil (Sigma) in aweightratio of 70/30 and filled in a teflon electrode body. Prior toDNA adsorption, the surface was wiped by wet filtrationpaper. Glassy carbon electrode (GCE; Metrohm, Switzer-land) was polished by 10 �m alumina paste on wet cottonfollowed by 5-min exposure to hot 20% H2SO4 and 5-minsonication in distilled water. Pencil graphite electrode(PeGE) was prepared of a 10 mm piece (new for eachmeasurement) of pencil graphite Pentel (Extra Strong) Hi-Polymer 120 HB 0.5 mm (Pentel Co., Japan) and pretreatedby applying potential �1.7 V for 60 s in the backgroundelectrolyte.

2.4.2. Procedure

The adsorptive transfer stripping voltammetric (AdTSV)technique was carried out as described previously [22, 32].DNA was adsorbed at the electrode surface from 7-�Laliquots containing 0.2 M NaCl for 60 s, if not statedotherwise, without stirring. In the pre-labeling procedureand in experiments withDNAmodification at the beads, theelectrode was subsequently rinsed by distilled water and bybackground electrolyte, followed by a transfer into avoltammetric cell. Analysis of reaction mixtures containingfree Os, bipy (in the post-labeling technique) involved

extraction of free Os, bipy from the electrode by acetone.After the adsorption step, the electrode was rinsed by waterand by 80% ethanol, followed by 90-s washing in stirredacetone. Then the electrode was rinsed by 80% ethanol andby water, and transferred into the voltammetric cell.

2.4.3. Square-Wave Voltammetry

The measurements were performed with an Autolabanalyzer equipped with GPES 4 software (Eco Chemie,The Netherlands), connected to a three-electrode systeminvolving Ag/AgCl/3M KCl electrode as a reference andplatinum wire as an auxiliary electrode. Following settingswere used: initial potential�1.0 V, quiescent time 2 s, pulseamplitude 25 mV, frequency 200 Hz, potential step 5 mV,final potential �0.1 V. Measurements were performed in0.2 M acetate buffer (pH 5.0) on air at room temperature.Voltammograms were smoothed by the Sawitzky-Golayprocedure and baseline-corrected using themoving averagealgorithm.

3. Results and Discussion

3.1. DNA Hybridization at Magnetic Beads and DNAOsmium Labeling

As shown in our previous papers [25 ± 27], DBT can be usedfor capturing target DNAs and RNAs (including syntheticoligonucleotides, polynucleotides, natural mRNA, plasmidDNAs and PCR products) containing oligo(A) stretches(Fig. 1). The latter hybridize with (T)25 oligonucleotidescovalently coupled to the beads. Using DBT (or streptavi-din-coated beads with immobilized biotinylated captureprobes [M. Fojta et al., unpublished]; [28]) as the ™surfaceH∫, target DNAs can be efficiently and specifically rescuedfrom solutions containing large excesses of non-specificnucleic acids [25 ± 27]. Choice of a suitable detectiontechnique depends on the nature of the target DNA,particularly on the nucleotide composition and/or sequenceof the ™overhanging∫ parts of the target DNA strandscaptured via the oligo(A) stretches (Fig. 1). These tech-niques may include, for example, measurements of intrinsicelectrochemical signals of the target DNA [27, 29], acidDNA hydrolysis followed by cathodic stripping voltamme-try [26, 31], labeling of target DNAwith osmium tetroxide,2,2�-bipyridine (Os, bipy), use of second hybridization(reporter) probes labeled with an electroactive marker [M.Fojta et al., unpublished] or with biotin [28], etc.Among these approaches, DNAosmium labeling appears

to bemost suitable for pyrimidine-richDNAsbecause of thereactivity of Os, bipy towards (predominantly) thymine(while direct DNA voltammetry at carbon electrodes andCSVare better suited for purine-rich DNA strands). More-over, as purines do not considerably react with Os, bipy [20,21],modification ofDNAwith this complex does not abolishDNAhybridization via homopurine stretches. TargetDNAscontaining (A)n stretches can thus be osmium-labeled prior

433Detection of Osmium-Labeled Target DNA

Electroanalysis 2003, 15, No. 5 ± 6

to capturing at DBT [25, 27] (we have observed that thesame was true when DNA was hybridized via otherhomopurine sequences [M. Fojta et al., unpublished])(Fig. 1A). After the hybridization step, washing of theDBT and thermal release of the hybridized target DNAfrom the beads, osmium DNA markers can easily bedetected at both mercury [24] and carbon [22] electrodes.The pre-labeling technique obviously cannot be used whenthe captured sequence contains pyrimidine residues (theirmodification with Os, bipy prevents duplex formation).We prepared Os, bipy-modified DNA samples, including

i) the 71-mer ODN, ii) the PCR product and a blank PCRcontrol (PCR reaction mixture without template DNA),and iii) plasmids pSP64-polyAandpSP64 vector.UnreactedOs, bipy was removed from the sample solutions by dialysis(the 71-mer ODN) or by ultrafiltration using MicroconYM50 (PCR samples and plasmids). (It should be noted thatDBT cannot be used for capturing of osmium-labeled targetDNA from the reaction mixture containing free Os, bipybecause modification of the (T)25 chains at the beads woulddisable hybridization). Purified DNA samples were addedto the DBT suspension in buffer H (see Sec. 2.) followed by

shaking the samples at 20 �C for 30 min. After the hybrid-ization step, the beads were washed three times with bufferH and transferred into TE buffer. Captured DNAs werereleased from DBT by thermal denaturation of the duplex-es. After removal of the beads, signals of the DNA osmiummarker (peak � [22]) were measured using AdTS SWV.Figure 2A shows that well-developed signals were observedfor the 71-mer ODN (Fig. 2A, i), the PCR product (Fig. 2A,ii) and pSP64-polyA plasmid DNA (Fig. 2A, iv). Moleculesof these target DNAs contained oligo(A) stretches thathybridized with the (T)25 chains at the DBT. On the otherhand, pSP64 vector (Fig. 2A, v) and the PCR blank control(Fig. 2A, iii) yielded no response. The pSP64 plasmid doesnot contain the (A)30 stretch and so it could not be capturedat DBT. ODN primers added to the blank PCR mixturewere removed during the ultrafiltration purification step.In principle, any targetDNA containing thymine (regard-

less of the sequence recognized by the capture probe) can bepost-labeled with Os, bipy (i.e., modified after release fromthe beads, Fig. 1B) followed by detection at the PGE. FreeOs, bipy yields at the PGE a specific signal (peak I) at apotential by about 140 mV less negative thanDNA-Os, bipy

Fig. 1. Scheme of the DNA hybridization assay at the Dynabeads oligo(dT)25 (DBT) involving osmium target DNA labeling andelectrochemical detection. A) Target DNA is pre-labeled with Os, bipy. As purine bases do not react with Os, bipy, the modified targetDNAs can be captured at DBT via (A)n stretches. After washing, target DNA is released from the beads by heating followed byelectrochemical detection of the osmium marker. B) Post-labeling technique. Unmodified target DNA is captured at the DBT followedby subsequent washing and thermal release. Then the DNA is Os, bipy modified and detected by AdTSV at carbon electrodes. C)Osmium labeling of target DNA captured at the beads.

434 M. Fojta et al.

Electroanalysis 2003, 15, No. 5 ± 6

adduct [22]. Using AdTSV involving extraction of freeOs, bipy from the electrode surface by organic solvents [22],it is thus possible to distinguish between free Os, bipy andOs, bipy-labeled DNA, and to determine DNA-Os, bipy inan excess of the unreacted complex. We have shown that,with random-sequence calf thymus DNA, this techniqueallowed to detect about 150 picograms of DNA in severalmicroliters of solution with neither stirring nor applicationof positive potentials (about the same sensitivity wasreached in measurements of guanine oxidation signal atcarbon electrodes, but only when the solution was stirredand DNA adsorbed at positively charged electrode surfaceto facilitate DNA accumulation at the electrode [33]).In the following experiment, unmodified DNA samples

were thermally denatured (except the 71-mer ODN) andimmediately added to the DBT suspension. Hybridization,washing and release of the captured target DNA wereperformed in the same way as described above. Then,Os, bipy was added to each sample (final concentration

2 mM) followed by a 3-hour incubation at 37 �C. Thesamples were measured without further purification usingthe AdTSV procedure involving electrode washing withacetone. Figure 2B shows well-developed peak � yielded bythe 71-mer ODN (Fig. 2B, i), the PCR product (Fig. 2B, ii)and plasmid pSP64-polyA (Fig. 2B, iv). In addition to peak�, a small shoulder at the voltammograms appeared at�0.45, corresponding to residual free Os, bipy [22] (Fig. 2B,iii). Blank PCR reaction mixture yielded a small peak �

whose height corresponded to about 11% of the peakyielded by the ™positive∫ PCR product (Fig. 2B, ii). Thissignal can be attributed to certain amount of ODN primerAAAAAAAAAAAAAAAAAAAAAAAAACGTTCT-TCGGGGCGAAAACT that remained in the sample afterpurification of the PCR products (in contrast to the osmiumpre-labeled samples, the post-labeled ones have never beenpurified by ultrafiltration). No peak � was obtained withthe pSP64 vector DNA lacking the oligo(A) segment(Fig. 2B, v).

Fig. 2. Signals of the osmium DNA marker (peak �) obtained at PGE after hybridization of target DNA at the DBT. i) the 71-merODN (4.5 pmol per a 20 �L sample); ii) the 226-base pair PCR product (6 pmol); iii) the blank PCR (no template used); iv) the plasmidpSP64-poly(A) (0.6 pmol); v) the plasmid pSP64 vector (0.6 pmol). PCR samples and EcoRI-linearized plasmid DNAs were precipitatedwith ethanol, dissolved in 10 mM Tris, 1 mM EDTA, pH 7.4 (TE) and thermally denatured prior to the following treatment. A) Pre-labeling technique. DNA samples were incubated with 2 mM Os, bipy in 100 mM Tris-HCl, pH 7.4 for 3 hours at 37 �C. UnreactedOs, bipy was removed either by dialysis on Slide-A-Lyzer (from the ODN sample) or by triple ultrafiltration on Microcon YM 50 (PCRproduct, plasmids). The given amount of DNA was incubated with 10 �L of DBT suspension in 20 �L of 0.3 M NaCl, 10 mM Tris-HCl,pH 7.4 (buffer H) at 20 �C for 30 min; the samples were intensively shaken during the hybridization step. Then, the beads were washedtwice with 50 �L of buffer H and transferred into 10 �L of TE followed by release of the hybridized target DNA by heating at 85 �C for2 min. After the DBT removal, NaCl was added to each sample to a final concentration of 0.2 M, and AdTS SW voltammograms wererecorded (accumulation time 60 s, frequency 200 Hz, potential step 5 mV, amplitude 25 mV; initial potential �1.0 V, final potential�0.1 V; background electrolyte, 0.2 M sodium acetate, pH 5.0; measured on air). B) Post-labeling technique. Unmodified DNA wascaptured at the DBT, washed and released from the beads as described above. Then Os, bipy was added to a final concentration of2 mM, followed by a 2- to 3-h incubation at 37 �C. After addition of NaCl (0.2 M final concentration), AdTS SWV involving the acetonewashing step (see Sec. 2.) was performed (for other see A).

435Detection of Osmium-Labeled Target DNA

Electroanalysis 2003, 15, No. 5 ± 6

3.2.Target DNA Prelabeling with Os, bipy Facilitates ItsCapturing at DBT

Interestingly, the heights of the signals obtained with thePCR product and with pSP64-polyA plasmid DNA in thepost-labeling protocolwereby about 75%and73%, smaller,respectively, as compared to the signals obtained with thesame target DNAs using the pre-labeling technique (DNAconcentrations and other conditions were the same in bothcases) (Fig. 2). On the other hand, peak � yielded by thepost-labeled 71-mer ODN was lower only by 23% than thesignal yielded by the pre-labeledODN. In the latter case, thedifference can be easily explained by dilution of the DNAsamples by added Os, bipy solution (compared to the pre-labeled samples, the final sample volume was increasedfrom 12 to 15 �L). On the contrary, the strong differencesbetween the hybridization responses obtained for pre-labeled and post-labeled PCR product and the pSP64-polyA plasmid weremost likely due to a different efficiencyof capturing of Os, bipy-modified and unmodified DNAs atthe beads. Such a behavior can be explained by reannealingof the target DNA strands with the complementary ones(separated by thermal denaturation prior to addition ofDBT) in solution during the hybridization step. This eventcan be expected to compete with capturing of the targetDNAs at the beads. No duplex formation in solution waspossible with Os, bipy-modified DNA. The oligo(A)stretches in the osmium-labeled DNA were accessible forhybridizationwith theDBT, because the oligo(T) sequencesin the complementary strandswere chemicallymodified andcould not hybridize with the former.OsmiumDNA labelingthus increased the yield of DNA captured via oligo(A)stretches (or, in general, any homopurine sequence [M.Fojta et al., unpublished]). In agreement with single-strand-ed nature of the 71-mer ODN, yields of this target DNAcaptured at the DBT were similar for unmodified andOs, bipy-labeled ODN (no annealing in solution interferedwith DNA hybridization at the beads because no comple-mentary strand was present).

3.3. Osmium Labeling of DNA Captured at the Beads

DNA modification at the beads might be used as analternative to the post-labeling technique. This approach isnot restricted to hybridization of homopurine target DNAsequences, because onceDNAduplex between target DNAand capture probe is formed, treatmentwithOs, bipy shouldnot significantly affect the yield of hybridization (pyrimi-dine bases within the duplex are not reactive towardsOs, bipy and the complex at millimolar concentration doesnot affect the duplex stability [20]). For the same reasons, itcan be expected that DBTwith hybridized target ODNs canbe exposed to Os, bipy without significant loss of thecaptured DNA. Unreacted Os, bipy can be removed byusing magnetoseparation so that no extraction procedurewith organic solvents is necessary. The unmodified 71-merODN (4.5 or 2.2 picomoles in 20 �L of the sample) was

captured at the DBT. After removal of the target DNAsolution, the beads were incubated with 2 mM Os, bipy inbuffer H at 20 �C for 60 min. Then the beads were washedand the target ODN was thermally released, followed byAdTS SWV detection at the PGE. Well-developed peak �

was obtained whose height was about proportional to thetargetDNAamount hybridized at the beads (Fig. 3, curves 1and 2). In a control experiment, bare beads (with no targetDNA hybridized) were treated in the same way. A consid-erable signal was obtained after heating of theDBTexposedto Os, bipy (Fig. 3, curve 4). Potential of this signal corre-sponded to the adduct-specific peak�.We therefore suggestthat this response was due to a release of certain amount ofOs, bipy-modified oligo(T) chains from the DBT surface(possibly due to labilization of their covalent linking to thebeads upon exposure to the reagent) rather than tounreacted Os, bipy nonspecifically adsorbed at the beads.When 4.5 pmol of homopurine ODN (A)25(GAA)12 (thatcannot be labeled by Os, bipy because of the absence ofpyrimidine bases) was hybridized at the DBT prior toincubation with Os, bipy, the DBT ™background∫ signaldecreased to about 30% of the peak obtained with barebeads (Fig. 3, curve 3). This result further supports theabove mentioned idea of the oligo(T) leaking from thebeads: hybridization of the (T)25 chains with the targetODNprobably protected thymine residues from Os, bipy mod-ification which resulted in a decrease of the backgroundDBT signal. Taken together, results mentioned in thisparagraph suggest that osmium labeling ofDNAcaptured atthe DBT surface can be used with some limitations arising

Fig. 3. Os, bipy-modification of target DNA captured at theDBT. After washing of the DBT with hybridized target ODNs in50 �L of buffer H, the beads were shaken in 50 �L of 2 mM Os,bipy in buffer H at 20 �C for 60 min, followed by triple washingwith buffer H and release of the captured target ODNs. 1) the 71-mer ODN, 2.2 pmol; 2) the 71-mer ODN, 4.5 pmol; 3) thehomopurine 61-mer ODN, 4.5 pmol; 4) no target (bare DBT).The voltammograms were measured at the PGE; for more detailssee Figure 2.

436 M. Fojta et al.

Electroanalysis 2003, 15, No. 5 ± 6

from possible false-positive signals yielded by the DBTalone (i.e., when no target DNA is hybridized).

3.4. Effects of Hybridization Time, Non-Specific DNA,and Temperature

Using pre-labeled 71-mer ODN (2.2 pmol in 20 �L) andpSP64-polyA plasmid DNA (0.3 pmol), the dependence ofthe measured signal on the time of hybridization wasexamined. Signal of the ODN increased very steeplybetween 0 and 5 min of the DNA sample shaking withDBT; at longer incubation times, no significant changes inthe peak � height were observed (Fig. 4). With the plasmidDNA, the signal increased less steeply in agreement with itssubstantially higher molecular weight (i.e., lower molarconcentration of the target sequence). Nonetheless, asubstantial portion of the plasmid DNA was captured atthe DBT after 5 min, followed by a slower increase withtime. At hybridization times longer than 30 min, only smallincrements in the peak � height were detected (Fig. 4).Analogous experiment was performed after addition of aten-fold excess of non-specificDNA(unmodified denaturedpSP64 vector) to the pSP64-polyA target DNA. In this case,peak� yielded by the targetDNA increasedwith the time ofhybridization less steeply, as compared to pure target DNA,suggesting that hybridization in the presence of the non-specificDNAwas slower.After 5 min of hybridization, peak� obtained in the presence of excess of the non-specificDNAwas about 50% of the value obtained with the targetDNA alone (Fig. 4). After 30 min the time dependence ofthe hybridization signal in the presence of non-specific

DNA leveled off, reaching about 90% of the value obtainedwith pure pSP64-polyA. These observations suggest thatusing sufficiently long hybridization times, a good selectivityand efficiency of target DNA capturing can be reached.With the pre-labeled pSP64-polyA, the influence of

temperature on the target DNA hybridization signal wasstudied. DNA (0.3 pmol in 20 �L)was captured at the beadsfor 30 min at different temperatures. Inset in Figure 4 showsthat under given conditions, a temperature optimumoccurred between 20 ± 25 �C. Height of peak � obtainedfor 35 �C was about 60%, as compared to the maximumvalue obtained at 25 �C. At higher temperatures the peakheight decreasedwith temperature almost linearly, reachingzero around 65 �C (Fig. 4).

3.5. Effect of the Target DNA Amount (Concentration)and Detection Limits

In further experiments, target DNAs were incubated withtheDBT suspension at 20 �C for 30 min.Dependences of thepeak � heights on the amounts of 71-mer ODN or pSP64-polyA plasmid DNA loaded into the samples were studiedby the pre-labeling and post-labeling techniques (Figs. 5 and6).With theODN, both techniques provided linear increaseof the signal intensity with the target DNA amount up to 4.5picomoles (Fig. 5; higher 71-mer ODN concentrations werenot tested). The slope of the dependence was by about 30%lower in the post-labeling technique, as compared with thepre-labeling one. The former offered also higher sensitivity,with a detection limit about 50 femtomoles of this targetDNA in 20 �L sample (ODN concentration in the hybrid-ization mixture about 2.5 pM, i.e., 60 ngmL�1). Under thesame conditions, at least 120 femtomoles (concentration

Fig. 4. Dependence of the hybridization signal (peak �measuredat the PGE) on the time of hybridization of osmium-pre-labeledtarget DNAs at DBT. (�) 2.2 pmol of 71-mer; (�) 0.3 pmol ofpSP64-poly(A) plasmid; (�) 0.3 pmol of pSP64-poly(A) plasmidin the presence of 3 pmol of unmodified pSP64 vector. Inset,effect of the temperature (kept during the hybridization step) onthe hybridization signal of 0.3 pmol of pSP64-poly(A) plasmid.For other details see Figure 2.

Fig. 5. Dependence of the hybridization signal (peak �measuredat the PGE) of the 71-mer ODN on the amount of the targetDNA in a 20-�L sample. (�) pre-labeling; (�) post-labelingtechnique. Inset, section of the graph at low target DNA amounts.For other details see Figure 2.

437Detection of Osmium-Labeled Target DNA

Electroanalysis 2003, 15, No. 5 ± 6

6 pM� 150 ngmL�1) of the 71-mer ODNwere necessary toobtain a measurable signal in the post-labeling technique(inset in Fig. 5). Signals obtained with the pSP64-polyADNA increased linearly with the target DNA amount up to180 or 300 fmol in the pre-labeling and post-labelingtechniques, respectively, followed by less steeply increasingregions (Fig. 6). Peak � heights yielded by the pre-labeledDNA were 4 to 5-fold higher than those obtained whenunmodified DNAwas captured at the beads, and detectionlimits were about 10 fmol (DNA concentration 500 fM�0.5 �gmL�1 in the hybridization mixture) or 60 fmol(3 pM� 2.5 �gmL�1), respectively.

3.6. Testing Other Carbon Materials as DetectionElectrodes

Most of the measurements of osmium-labeled DNA atcarbon electrodes were performed at the PGE. Here wetested other carbon electrodes, including HOPGE, CPE,GCE and PeGE. All measurements were performed usingthe AdTS SWV technique involving DNA adsorption from7-�L drops of solution at open circuit, without stirring.Responses of purified Os, bipy-modified 71-mer ODN nearits detection limits at PGE,HOPGEandCPEare comparedin Figure 7 (in these measurements, the hybridization stepwas omitted). All three electrodes exhibited similar detec-tion limits for theODN (about 15 ngmL�1, i.e., 0.64 nM, i.e.,4.5 fmol of the osmium-labeled ODN in the 7 �L aliquot)and a good linearity of the calibration plots at very lowODNconcentrations (Fig. 7A). Differences in the slopes of thecalibration lines were probably primarily due to differencesin the active areas of the electrodes (the ratio of the areas offerrocyanide CVoxidation peak measured at the HOPGE,CPE and PGEwas 1 :1.8 :3.9, respectively, while the ratio of

the slopes taken from Figure 7Awas 1 :2.3 : 5.8, respective-ly). In spite of the highest peak currents obtained at thePGE, curves measured at this electrode exhibited consid-erably stronger noise (even in relation to the peak height)and randompeak deformations at lowODNconcentrations,as compared to HOPGE and CPE (Fig. 7B). In all threecases peak heights remarkably increased with the accumu-lation time (Fig. 7B), suggesting a strong adsorption of theosmium-labeled DNA at the electrode surfaces. Using thePeGE (pretreated by application of a potential �1.7 V for60 s in the background [29, 34] , or without any pretreat-ment), a measurable peak � was obtained only at consid-erably higher ODN concentrations (�1 �gmL�1, notshown). GCE did not provide any measurable signal up totens of micrograms of the osmium-labeled ODN permilliliter. This observation was in agreement with previousresults [35] showing that GCE yielded the worst DNAresponse among various carbon electrodes.The electrodes were tested also for their usability in direct

analysis of DNA mixtures with unreacted Os, bipy, involv-ing the acetone extraction procedure. Plasmid pSP64-polyADNA (20 �gmL�1) was adsorbed at the electrode in thepresence of 2 mM Os, bipy after a 3-hour preincubation at

Fig. 6. Dependence of the osmium hybridization signal (peak �measured at the PGE) of the pSP64-poly(A) plasmid on theamount of the target DNA in a 20-�L sample. (�) pre-labeling;(�) post-labeling technique. For other details see Figure 2.

Fig. 7. AdTS SWV responses obtained for low concentrations ofOs, bipy-modified (purified by dialysis) 71-mer ODN at differentcarbon electrodes. (A) dependence of the peak � height on theDNA concentration; (�) PGE; (�) HOPGE; (�) CPE. Accumu-lation time 60 s. B) Details of baseline-corrected peak � yieldedby Os, bipy-modified 71-mer ODN close to the detection limit (at15 ngmL�1) after 1) 60 s, 2) 300 s and 3) 600 s accumulation atdifferent carbon electrodes. For other details see Figure 2.

438 M. Fojta et al.

Electroanalysis 2003, 15, No. 5 ± 6

37 �C. Both PGE and HOPGE exhibited qualitativelysimilar behavior (Fig. 8). Peak I of free Os, bipy stronglydecreased due to a 60 s washing of the electrode withacetone, and the adduct-specific peak � appeared. CPE wasless suitable for this kind of analysis. After the acetoneextraction step, peak I was still higher than peak � (Fig. 8)and prolonged incubation in acetone resulted in diminishingof both peaks (not show). This was not surprising withrespect to the expectable leakage of the hydrophobicOs, bipy into the oil component of CPE and dissolving ofthe latter in the organic solvent with concomitant destruc-tion of the electrode surface. In measurements performedwith the PeGE andGCE, only peak I, decreasing due to theacetone treatment, was observed, without any sign of thepeak � (not shown).

4. Conclusions

Labeling of target DNA with electroactive osmium tetr-oxide complexes represents one of the possible approachesin electrochemical DNA hybridization assays involvingmagnetic microbeads. Target DNA modified with Os, bipycan be easily detected at solid (graphite) electrodes with agood sensitivity, allowing to detect tens of femtomoles ofboth 71-mer oligonucleotide and 3-kilobase plasmid DNA.The sensitivity reached with short DNAs (due to a lack ofpublished data, no comparison could be done for long targetDNAs) appears to be remarkably better than label-freeDNAdetection based on guanine oxidation peak (picomoleODNamounts, concentration 160 pM [29]) but by one orderofmagnitude less favorable, as compared to those reached inenzyme-linked immunoassay of osmium-labeled DNA atthe beads with electrochemical detection (3 fmol of a 67-mer ODN in 20 �L, concentration 150 fM [27]), or in silver-enhanced electrochemical detection of colloidal gold nano-particles captured at hybridized DNA via streptavidin-

biotin linking (1.5 fmol of a 19-mer ODN in 50 �L, concen-tration 30 fM [30]). Direct detection of the osmium pre-labeledDNAat graphite electrodes is inexpensive and rapid(except the hybridization, washing and dehybridizationsteps, no other manipulations with the samples are neces-sary; the detection step does not require oxygen removaland involves a fast-scan voltammetric technique). Usingmercury detection electrodes (allowing to measure theosmium catalytic signal [24]), sensitivity of the pre-labelingassay can be increased at least by an order of magnitude [M.Fojta et al., in preparation], thus approaching the sensitivityof the above mentioned techniques [27, 30].Depending on the nature of the target DNA, optimal

experimental arrangement canbe chosen, including osmiumpre-labeling, post-labeling orOs, bipymodification ofDNAcaptured at the beads. Especially the osmium pre-labelingprotocol appear to be an useful technique for DNA hybrid-ization of homopurine target DNAs. We have shown thatthis technique not only provides a powerful DNA electro-active labeling, but also significantly increases the yield ofhybridization of such target DNA sequences that easilyundergo renaturation in solution (this report and [M. Fojtaet al., in preparation]). Selective chemical modification ofone strand of naturally double-stranded target DNAs(including PCR products) makes it possible to efficientlyhybridize these DNAs at surfaces, and this principle mayfind practical applications [M. Fojta et al., in preparation].On the other hand, the post-labeling and ™on-bead-label-ing∫ protocols can be used in various alternations for anytarget DNA sample.

5. Acknowledgements

This work was supported by grants No. A4004108 from theGrant Agency of the Academy of Sciences of the CzechRepublic to MF, No. 204/00/D49 from the Grant Agency ofthe Czech Republic to LH, No. Z 5004920 from theAcademy of Sciences of the Czech Republic, and bynovember AG, Erlangen, Germany. The authors thankMrs. Iva Salajkova¬ for technical assistance.

6. References

[1] E. Palecek, M. Fojta, M. Tomschik, J. Wang, Biosens.Bioelectron. 1998, 13, 621.

[2] E. Palecek, M. Fojta, Anal. Chem. 2001, 73, 74A.[3] E. Palecek, M. Fojta, F. Jelen, V. Vetterl, in The Encyclopedia

of Electrochemistry, Vol. 9, Bioelectrochemistry (Eds.: A. J.Bard, M. Stratsmann), Wiley-VCH, Weinheim 2002,p. 365.

[4] J. Wang, Nucleic Acids Res. 2000, 28, 3011.[5] M. Fojta, Electroanalysis 2002, 14, 1449.[6] J. L. Wang, Prog. Biochem. Biophys. 2001, 28, 125.[7] E. Palecek, Electroanalysis 1996, 8, 7.[8] M. Fojta, E. Palecek, Anal. Chim. Acta 1997, 342, 1.[9] M. Fojta, R. P. Bowater, V. Stankova, L. Havran, D. M. J.

Lilley, E. Palecek, Biochemistry 1998, 37, 4853.

Fig. 8. Measurements of Os, bipy-modified pSP64-poly(A) plas-mid in the presence of unreacted Os, bipy at different carbonelectrodes by AdTS SWV procedure involving acetone washingstep. Denatured plasmid DNA (20 �gmL�1) was incubated with2 mM Os, bipy in 100 mM Tris-HCl, pH 7.4 at 37 �C for 3 hours.The reaction mixture was then analyzed without any purificationstep using PGE, HOPGE and CPE. After the adsorption step, theelectrode was 1) rinsed only with water; 2) subsequently rinsed byethanol, incubated in stirred acetone for 60 s, rinsed with ethanoland with water, followed by transfer into the background electro-lyte. For other details, see Figure 2.

439Detection of Osmium-Labeled Target DNA

Electroanalysis 2003, 15, No. 5 ± 6

[10] M. Fojta, L. Havran, J. Fulneckova, T. Kubicarova, Electro-analysis 2000, 12, 926.

[11] J. Wang, E. Palecek, P. E. Nielsen, G. Rivas, X. H. Cai, H.Shiraishi, N. Dontha, D. Luo, P. A. M. Farias, J. Am. Chem.Soc. 1996, 118, 7667.

[12] M. Mascini, I. Palchetti, G. Marrazza, Fresenius J. Anal.Chem. 2001, 369, 15.

[13] S. Takenaka, T. Ihara, M. Takagi, J. Chem. Soc. Chem.Commun. 1990, 21, 1485.

[14] S. Takenaka, K. Yamashita, Y. Uto, M. Takagi, H. Kondo,Denki Kagaku 1998, 12, 1329.

[15] K. Hashimoto, K. Ito, Y. Ishimori, Anal. Chem. 1994, 66,3830.

[16] T. Ihara, Y. Maruo, S. Takanaka, M. Takagi, Nucl. Acids Res.1996, 24, 4273.

[17] D. J. Caruana, A. Heller, J. Am. Chem. Soc. 1999, 121, 769.[18] E. Lukasova, F. Jelen, E. Palecek, Gen. Physiol. Biophys.

1982, 1, 53.[19] E. Palecek, M. A. Hung, Anal. Biochem. 1983, 132, 236.[20] E. Palecek, Meth. Enzymol. 1992, 212, 139.[21] F. Jelen, P. Karlovsky, P. Pecinka, E. Makaturova, E. Palecek,

Gen. Physiol. Biophys. 1991, 10, 461.[22] M. Fojta, L. Havran, R. Kizek, S. Billova, Talanta 2002, 56,

867.

[23] E. Palecek, Crit. Rev. Biochem. Mol. Biol. 1991, 26, 151.[24] R. Kizek, L. Havran, M. Fojta, E. Palecek, Bioelectrochem-

istry 2002, 55, 119.[25] E. Palecek, M. Fojta, F. Jelen, Bioelectrochemistry 2002, 56,

85.[26] E. Palecek, S. Billova, L. Havran, R. Kizek, A. Miculkova, F.

Jelen, Talanta 2002, 56, 919.[27] E. Palecek, R. Kizek, L. Havran, S. Billova, M. Fojta, Anal.

Chim. Acta 2002, 469, 73.[28] J. Wang, D. Xu, A. Erdem, R. Polsky, M. A. Salazar, Talanta

2002, 56, 931.[29] J. Wang, A. N. Kawde, A. Erdem, M. Salazar, Analyst 2001,

126, 2020.[30] J. Wang, R. Polsky, D. K. Xu, Langmuir 2001, 17, 5739.[31] F. Jelen, B. Yosypchuk, A. Kourilova, L. Novotny, E.

Palecek, Anal. Chem. 2002, 74, 4788.[32] E. Palecek, I. Postbieglova, J. Electroanal. Chem. 1986, 214,

359.[33] E. Palecek, M. Tomschik, V. Stankova, L. Havran, Electro-

analysis 1997, 9, 990.[34] J. Wang, A. N. Kawde, E. Sahlin, Analyst 2000, 125, 5.[35] C. Cai, G. Rivas, P. A. M. Farias, H. Shiraishi, J. Wang, E.

Palecek, Electroanalysis 1996, 8, 753.

440 M. Fojta et al.

Electroanalysis 2003, 15, No. 5 ± 6