Trapping and Characterization of Novel Retinoid Response Elements

Trapping and Characterization of Novel RetinoidResponse Elements

MICHELE A. GLOZAK*, YONG LI*, RAE REUILLE, KWAN HEE KIM, MY-NUONG VO, AND

MELISSA B. ROGERS

Department of Biology (M.A.G., Y.L., R.R., M.B.R.) and Institute for Biomolecular Science (M.B.R.),University of South Florida, Tampa, Florida 33620; Departments of Genetics, Cell Biology, andBiochemistry (K.H.K., M.-N.V.), Washington State University, Pullman, Washington 99164; andDepartment of Biochemistry and Molecular Biology (M.B.R.), UMDNJ-New Jersey Medical School,Newark, New Jersey 07103

Retinoids, such as retinoic acid (RA), play a criticalrole in normal vertebrate development and physi-ology. However, embryonic exposure to excessretinoids also causes severe malformations. Reti-noids bind RA receptors and retinoid X receptors,thus activating a plethora of genes. Separating thegenes induced directly by retinoid-bound recep-tors from those induced subsequently by othertranscription factors is difficult. The loose consen-sus defining known RA responsive elements

(RAREs) further complicates this effort. We devel-oped a yeast-based system to trap functionalRAREs in the mouse genome. Several of the clonescontain RAREs near RA-induced genes. Mamma-lian reporter gene analyses and EMSAs showedthat these are bona fide RAREs. This functionalgenomics approach should identify RA-regulatedgenes that initiate critical signaling cascades incells. (Molecular Endocrinology 17: 27–41, 2003)

VITAMIN A (RETINOL) and other retinoids are cru-cial mediators of normal development and physi-

ology. Vitamin A deficiency also elevates the risk ofdeveloping cancer. Paradoxically, retinoids are terato-genic at high doses. Interestingly, vitamin A defi-ciency, blocks in retinoid signal transduction, or reti-noid overdose induce similar malformations (1, 2). Themost extensively studied retinoid, all-trans-retinoicacid [RA (1)], affects embryonic or adult cell behaviorby altering proliferation or differentiation, or by induc-ing cell death (3). Retinoids exert their influence oncells by controlling the expression of specific genes.Identifying these directly regulated genes will providecritical insight into these processes.

RA-regulated gene expression is mediated by nu-clear receptors that act as retinoid-dependent tran-scription factors. These receptors are encoded by sixdifferent genes, RA receptor (RAR) �, �, and � andretinoid X receptor (RXR) �, �, and �, and act ashomodimers and heterodimers (4). The sequencesbound by these receptors are highly pleiotropic. Al-though a loose consensus sequence of two directlyrepeated PuG(G/T)TCA motifs (half-sites) separatedby five nucleotides (DR5) occurs in many genes, thespacing, relative position, and number of these re-

peats are highly variable (4). Indeed, RARs have beenshown to bind and activate transcription via half-sitesseparated by up to 150 nucleotides (5). Variation in theconsensus half-site sequence is also common. Thediversity of receptors and binding elements makes itdifficult to identify RA response elements (RAREs)from sequence alone.

Like many other enhancers, RAREs may be locatedwithin distant control regions. Although the naturaltendency to study regulatory elements near promoterscreates a strong bias toward discovering upstreamRAREs, RAREs have been identified in introns [e.g. themajor histocompatability complex (MHC) H2Kb andCD38 genes (6, 7)] or kilobases downstream of theirgenes [e.g. erythropoietin and Hoxa1, b1, a4, b4, andd4, (8–11)]. The pattern of RAREs regulating the Hoxb1gene strongly supports the need for an RARE screenunbiased by location. The Hoxb1 gene is controlled bythree, highly conserved RAREs that independentlymediate part of the endogenous expression patternand response to retinoid exposure in vivo (Ref. 11 andreferences therein). One RARE is upstream and twoare 3 kb and 6.5 kb downstream of the transcribedregion. The presence and requirement for all threeelements were only uncovered after nearly a decade oftransgenic mouse labor by several laboratories. Simi-larly, in vivo Hoxd4 expression requires both upstreamand downstream RAREs.

Retinoid-responsive genes have been discoveredby serendipity and methods such as differential hy-bridization (12); subtractive hybridization (13); en-hancer/gene traps (14, 15); and PCR-assisted bindingsite selection from chromatin (16). Because retinoid

Abbreviations: �-gal, �-Galactosidase; BMP, bone mor-phogenetic protein; CRBP, cellular retinol binding protein;CT, cAMP and theophylline; d, deoxy; dNTP, deoxynucle-otide triphosphate; EST, expressed sequence tag; GRIP, glu-cocorticoid receptor interacting protein; MHC, major histo-compatability complex; RA, retinoic acid; RACT, all-trans-RA �CT; RAR, RA receptor; RXR, retinoid X receptor; RARE, RA-responsive element; RT, reverse transcription; SRC, steroid re-ceptor coactivator; SV40, Simian virus 40; TK, thymidine kinase.

0888-8809/03/$15.00/0 Molecular Endocrinology 17(1):27–41Printed in U.S.A. Copyright © 2003 by The Endocrine Society

doi: 10.1210/me.2002-0192

27

receptor isoforms and accessory transcription factorsdiffer in various cell types, a gene that is not RA re-sponsive in the chosen cells will be missed. For ex-ample, because embryonal carcinoma or embryonicstem cells were used in the published examples,genes induced in adult cells may be underrepre-sented. Approaches such as differential hybridizationrely on differences in mRNA abundance between un-treated and RA-treated cells. Because retinoids caninduce other transcription factors or signaling mole-cules, the induction of a particular gene in an RA-treated cell may be only indirectly due to RA. Also, dueto an experimental bias toward strongly inducedgenes, weakly induced genes may be missed. Anotherdifficulty with screening for RA-regulated genes inmammalian cells is that many mammalian cells stopgrowing or undergo apoptosis in the presence of RA(3). Thus, cell lines must be replicated to a master plateand a test plate containing RA. Although trivial formicrobes, replica plating mammalian tissue culturecells is laborious.

Directly regulated genes should be associated withRAREs. Thus, we devised a method to trap RAREsbased on their functionality in yeast and have begun toanalyze the expression of nearby genes. This ap-proach avoids many of the biases described above.

Yeast lack retinoid receptors and exhibit little retin-oid-metabolizing activity. However, if transformed withreceptor expression vectors, yeast can synthesizefunctional receptors. These receptors drive the RA-dependent expression of yeast reporter genes underthe control of mammalian RAREs (17–19). We previ-ously showed that an RARE near the key developmen-tal gene bone morphogenetic protein (Bmp)2 canfunction in yeast expressing mammalian retinoid re-ceptors (20). A major advantage of using yeast is theabsence of retinoid-induced gene-regulatory proteinsthat might activate mammalian genes. Thus, only ele-ments directly activated by retinoid-bound receptorscan function in yeast. We used this approach to screenthe mouse genome for RAREs responsive to RAR�and RXR� homo- or heterodimers. We demonstratedthat RAREs trapped in yeast can drive mammalianreporter genes in response to RA and can bind RAR�/RXR� directly in vitro. Furthermore, RA induces thetranscription of genes associated with these RAREs inmammalian cells.

RESULTS

Preparation of a Murine Genomic DNA Library ina Yeast Reporter Vector

We showed previously that a 57-bp sequence be-tween �2373 to �2316 bp relative to the Bmp2 trans-lation start site drove RA-responsive �-galactosidase(�-gal) expression in yeast (20). Because trapping aRARE near the Bmp2 gene suggested that trappingRAREs from the mouse genome was feasible, we con-

structed a mouse genomic DNA library in the yeast�-gal vector p�ss (21). This plasmid encodes �-galunder the control of a minimal cyc1 promoter. Anenhancer is required to activate this promoter. The�-gal gene was specifically chosen over selectablemarkers to permit the trapping of both weak andstrong RAREs. Genomic DNA was partially digestedwith Sau3AI into fragments of approximately 2 kb,which were inserted upstream of the cyc1 promoter.The probability (P) of having any individual 2-kb se-quence represented in a typical murine genomiclibrary can be calculated from the formula: n � ln(1 � P)/ln [1 � (2 � 103/3 � 109)], where n is thenumber of independent clones in the library (22). Be-cause the size of the mouse genome is 3 � 109 bp andthis library contained 1.3 � 106 independent clones(2.6 � 109 bp), any individual genomic DNA sequencehas a 58% probability of representation in this library.

Selection of RA-Induced Clones

The strategy to screen the library for RARE-containingplasmids is illustrated in Fig. 1. The host strain,BJ5409, is auxotrophic for uracil, tryptophan, and his-tidine. This allows transformation with two differentreceptor expression vectors and a reporter vector. The�-gal reporter plasmid, p�ss, confers the ability togrow on plates lacking uracil (21). The retinoid recep-tor expression vectors p2HG-RAR� and pG1-RXR�

Fig. 1. Strategy to Select Genomic Sequences ContainingRAREs in Yeast

Sau3AI-generated fragments were inserted upstream ofthe cyc1 promoter and the �-gal coding region of p�ss.BJ5409 cells expressing both RAR� and RXR� were trans-formed with these plasmids and selected on plates contain-ing Xgal and 5 �M all-trans-RA. �-gal-positive (blue) colonieswere streaked onto plates without or with RA. Streaks thatwere darker blue on plates containing RA were consideredinduced ( ). Streaks that were equally blue in the presence orabsence of RA were considered constitutive (C).

28 Mol Endocrinol, January 2003, 17(1):27–41 Glozak et al. • Trapping Retinoid Response Elements

confer the ability to grow on plates lacking histidineand tryptophan, respectively (18).

Competent BJ5409 cells expressing both RAR� andRXR� were transformed with the genomic DNA libraryplasmids. Transformants were selected on plates con-taining Xgal with 5 �M all-trans-RA added to ensure theexpression of �-gal controlled by trapped RAREs.Transformants (2 � 105), equivalent to about 9% of themouse genome, were grown 4 d at 30 C. A total of1544 colonies were blue, indicating that these murinesequences activated the minimal cyc1 promoter. Bluecolonies contained either sequences that specificallyresponded to RA or sequences that constitutively in-duced �-gal expression. To identify the blue coloniesspecifically induced by RA, blue colonies werestreaked and replica-plated onto Xgal plates contain-ing or lacking RA (Fig. 1). Sixty-four colonies were blueon Xgal plus RA plates but not on Xgal minus RAplates, suggesting that these reporter plasmids con-tained RAREs.

The activity of the trapped RAREs was quantifiedusing liquid �-gal assays. Because the yeast clonesmay have had more than one reporter plasmid, res-cued plasmids were transformed back into yeast toconfirm that one plasmid was responsible for the ob-served induction. Thirty-two reporter plasmids exhib-ited at least 2-fold inducibility upon preliminary analysis.

Receptor Heterodimers Activate the TrappedRAREs Most Efficiently

The isolated RAREs drove RA-responsive �-gal genetranscription in yeast transformed with both RAR� andRXR�. Because the in vivo receptor complex can beeither heterodimers or homodimers of RAR� andRXR�, we examined which receptors optimally acti-vate the isolated RAREs. A subset of trapped clones,selected on the basis of their strength or close prox-imity to transcribed sequences (A24 and D6), wastransformed into yeast expressing no receptor, RAR�

alone, RXR� alone, or both receptors. These cultureswere treated with the RAR/RXR panagonist, 9-cis RA,to activate both the homo- and heterodimeric forms ofthe receptors. Two control reporter genes also weretested. The YRp�RE plasmid contains a natural RAREfrom the RAR� gene (17). The YRpCRBPII plasmidcontains a natural RARE from the cellular retinol bind-ing protein (CRBP) II gene that is induced exclusivelyby 9-cis RA-activated RXRs in yeast (17). The �-galactivity of untreated cultures or cultures treated with 1�M 9-cis RA was compared (Table 1). The most robustinduction occurred in yeast expressing both RAR� andRXR�, suggesting that these elements are preferen-tially activated by RA-bound heterodimers in yeast.However, RAR� alone (A18, B12, C13) or RXR� alone(B9, B10, B12) also activated a subset of clones tolevels similar to those achieved by these homodimersin �RE or CRBPII control plasmid-containing yeast,respectively.

RARE Structure and Functionality inMammalian Cells

A subset of clones was selected to identify the specificRARE sequences and to test their ability to inducetranscription in RA-treated mammalian cells. The se-quences of these clones were also compared withGenBank to identify transcripts potentially regulatedby the trapped DNA.

RA Induction of the Nonclassical MHC Class IGene, T20d

Many genes are induced by retinoids (23). Isolating aknown gene would validate our yeast assay. The MHCclass I genes encode highly polymorphic membraneantigens involved in the cellular immune response. RAhas long been known to induce classical MHC class Iagenes (24) and RAREs have been identified in or near

Table 1. Fold Induction Mediated by RA in Yeast Expressing Various Receptor Combinations

Clone No Receptor RAR� RXR�RAR�RXR�

�RE 1.0 � 0.2 (2) 2.2 � 0.2 (2) N.D. 3.3 � 0.1 (4)CRBPII 1.2 � 0.2 (2) N.D. 2.1 � 0.1 (2) 3.6 � 0.4 (4)A18 1.0 � 0.3 (2) 2.6 � 0.3 (4) 1.0 � 0.1 (4) 5.2 � 1.2 (6)A20 1.0 � 0.0 (2) 1.2 � 0.2 (4) 1.1 � 0.0 (4) 2.0 � 0.4 (5)A24 1.0 � 0.0 (2) 1.2 � 0.1 (4) 1.0 � 0.1 (4) 1.5 � 0.1 (6)B9 1.1 � 0.0 (2) 1.1 � 0.1 (4) 1.6 � 0.4 (4) 3.3 � 1.0 (4)B10 1.1 � 0.2 (2) 1.0 � 0.1 (4) 1.6 � 0.1 (4) 2.7 � 0.1 (6)B12 1.1 � 0.0 (2) 3.0 � 0.2 (4) 2.0 � 0.1 (4) 4.4 � 1.4 (7)C9 1.7 � 0.3 (2) 1.5 � 0.2 (4) 1.2 � 0.2 (4) 5.7 � 0.6 (7)C13 1.0 � 0.0 (2) 2.2 � 0.0 (4) 1.2 � 0.1 (4) 10.5 � 3.3 (7)D6 N.D. 1.3 � 0.0 (2) 1.0 � 0.0 (2) 3.0 � 0.2 (4)D7 0.9 � 0.1 (2) 1.2 � 0.4 (4) 1.3 � 0.4 (4) 4.0 � 1.1 (8)E2 1.2 � 0.1 (2) 1.1 � 0.0 (4) 1.2 � 0.1 (4) 4.4 � 1.7 (6)

Yeast strain BJ5409 was transformed with expression vectors encoding the indicated receptors and reporter clones. The averagefold induction of �-gal by 1 �M 9-cis-RA � SEM is shown with the number of determinations (n) in parentheses. N.D., Not done.

Glozak et al. • Trapping Retinoid Response Elements Mol Endocrinol, January 2003, 17(1):27–41 29

these genes (6, 25). Our genomic clone D7 overlappedan MHC class Ib gene.

Part of clone D7 is 98% identical to the availablesequence for exon 5 and flanking intronic sequencesof the nonclassical MHC gene T20d formerly known asT15c [Genbank accession no. X16220 (26, 27)]. Sixmismatches out of 328 nucleotides may be accountedfor by strain differences because our clone was iso-lated from a strain 129 library and the GenBank se-quence was from BALB/c mice.

Although RA has been shown to induce severalclassical MHC genes in F9 embryonal carcinomacells, the RA inducibility of the nonclassical MHCgene T20d has not been tested. Because MHCgenes readily cross-hybridize, we used the specificRT-PCR assay devised by Eghtesady et al. (28) to

measure the abundance of the T20d transcript inRNA isolated from F9 cells treated for 24 h with 250�M dibutyryl-cAMP, and 500 �M theophylline (CT)alone or with 1.0 �M all-trans-RA (RACT). As shownin Fig. 2A, a 334-bp fragment was specifically am-plified from RNA from RACT-treated cells, but notfrom cells treated with CT. Cells treated for severaldays with RACT differentiate into parietal endoderm,whereas CT alone has no effect. Differentiation is astepwise process during which a few directly regu-lated genes are induced early, within 24 h, beforemorphological differentiation. In contrast, manygenes are not induced until later when cells expressthe terminally differentiated phenotype. The induc-tion of T20d within 24 h is consistent with directregulation by RA.

Fig. 2. An RARE Near the T20d GeneA, T20d is induced in RACT-treated F9 cells. Oligo-deoxythymidine-primed cDNA was synthesized from RNA isolated from F9

cells treated for 24 h with 250 �M dibutyryl cAMP, and 500 �M theophylline with (RACT) or without (CT) 1.0 �M all-trans-RA.T20d-specific primers were used for PCR amplification. To avoid amplifying genomic DNA that might contaminate the RNA, allRT reactions were pretreated with XbaI, which cleaves within the amplified region. The PCR products were Southern blotted andhybridized to a T20d-specific probe. The same RT products were also amplified with actin-specific primers and hybridized to anactin-specific probe. B, The D7 RARE drives RA-dependent reporter gene expression in yeast and F9 cells. The 1301-bp Sau3AI(Sa) insert in the D7 clone is shown with arrows indicating the locations of the DR5s. The entire fragment (n � 8) or a 756-bpSau3AI subclone (n � 2) in p�ss was transformed into yeast. The average fold induction of �-gal by 1 �M 9-cis-RA � SEM is shown.Two luciferase reporter constructs generated from a 417-bp XbaI (Xb) fragment and a 306-bp XbaI-Sau3AI fragment weretransfected into F9 cells in duplicate. Cells were grown in media containing ethanol vehicle alone or media containing 1 �M

all-trans-RA for 24 h. Extracts were assayed for luciferase activity in duplicate. The average fold induction by all-trans-RA � SEM

is shown; n � 2–4 transfections. Fold induction mediated by the XbaI fragment did not differ significantly from that mediated bypLucTK2 alone.


Both the entire 1301-bp insert and a 756-bp sub-clone of the D7 clone drove 9-cis RA-dependent �-galactivity in yeast (Fig. 2B). The 756-bp subclone con-tains two DR5-like motifs located at nucleotides687–703 (AGGTAAattgaAGGTCA) and 1065–1081(AGGTCAgggtgATGTCA). DR5 indicates that twoPuG(G/T)TCA motifs are separated by five nucleotides.We used reporter gene analyses to measure their re-spective RARE activities in mammalian cells. Placingfragments containing nucleotides 541–847 (Sa to Xb) or847-1264 (Xb to Xb) upstream of the minimal thymidinekinase (TK) promoter in pLucTK2 separated the putativeRAREs (Fig. 2B). Only the construct containing the DR5element at 687–703 induced reporter gene expressionafter 24 h of 1 �M all-trans-RA treatment. Thus, thissequence is a functional RARE in both mammalian andyeast reporter gene assays. This suggests that, like otherMHC genes, RA may regulate T20d.

A Gene Involved in Spermatogenesis (D6)

A portion of clone D6 matched the sperizin gene (29).Exclusively expressed in round spermatids, sperizinencodes a RING zinc-finger protein. Proteins withthese motifs often exhibit ubiquitin E3 ligase activity(30, 31), suggesting sperizin may be involved in thedramatic cellular remodeling occurring during sper-miogenesis. The D6 clone includes 390 bp of thisintronless gene and 1007 bp of downstream sequence(Fig. 3B). Vitamin A (retinol) is vital in maintaining mam-malian spermatogenesis (32). Dietary treatment of vi-tamin A-deficient animals with retinoids can reinitiatespermatogenesis. Several genes regulated by RA intestes have been identified by various means includinggene traps (14, 33–36). To test the hypothesis thatvitamin A can induce sperizin transcription in vivo, wecompared the levels of sperizin RNA in the testes of

Fig. 3. Activation of Sperizin by RetinoidsA, Retinol induces sperizin in vitamin A-deficient rat testes. Total RNA was isolated from the testes of rats fed vitamin

A-sufficient diets (Normal) and rats fed vitamin A-deficient diets for 10 wk (VAD). Retinol-replenished rats were fed vitaminA-deficient diets for 10 wk followed by the injection of 7.5 mg retinol. RNA was isolated 4 (VAD � 4 h ROH) or 8 h (VAD � 8 hROH) after injection (36). Blots were probed with an EST encoding sperizin (IMAGE clone 602592, GenBank accession no.AA144720). The blot was stripped and hybridized to actin to control for loading. B, A sequence downstream of sperizin drivesall-trans-RA-inducible luciferase gene expression in yeast and F9 cells. The D6 1397 bp Sau3AI (Sa) insert is shown with arrowsindicating the DR5 elements located 218 and 553 bp downstream of the sperizin polyadenylation site. The 3�-end of the sperizingene is indicated by a solid black box. The entire 1397-bp fragment in p�ss was transformed into yeast. The average foldinduction of �-gal by 1 �M 9-cis-RA � SEM is shown; n � 4. The 1179-bp XhoI (X) subclone in pLucTK2 was transfected induplicate into F9 cells that were then treated with ethanol vehicle or 1 �M all-trans-RA as described in Fig. 2; n � 3 independenttransfections, shown with the SEM.


vitamin A-sufficient and vitamin A-deficient rats (Fig.3A). Because only A-type spermatogonia and prelep-totene spermatocytes remain in vitamin A-deficientrats, it was not surprising that the round spermatid-specific sperizin transcript was undetectable (36). Wealso measured sperizin RNA in testes in which sper-matogenesis was reinitiated by retinol injection. Thesperizin transcript was induced within 4 h of injectionand levels continued to rise 8 h post injection (Fig. 3A,lanes 2–4).

Two putative DR5 class RAREs, AGTGCAcacggGG-TTCC and AGTTCAaattcGGGTCC were identified inthe D6 sequence 218 and 553 bp downstream fromthe sperizin polyadenylation signal. A fragment con-taining these RAREs induced luciferase reporter geneexpression in the presence of 1 �M all-trans-RA (Fig.3B). The level of reporter gene induction in F9 cellswas comparable to that observed in yeast cells. Theidentification of a functional RARE downstream of thesperizin gene and the rapid induction of sperizin tran-scription by retinol suggest that retinoids directly in-duce sperizin.

A Highly Conserved Trapped Gene (A24)

Analysis of the genomic clone A24 revealed a se-quence resembling a DR5 RARE: AGGTCAgct-ggGGGGCA. To test whether or not this element canmediate RA-regulated expression in mammalian cells,several subclones of A24 were inserted into mamma-lian reporter vectors. The luciferase activity of thesesequences in the presence or absence of retinoid wastested. A 145-bp subclone containing the intact DR5element induced luciferase activity fold in response toall-trans-RA in the context of two different promoters,TK (3.17 � 0.23, n � 4 in pLucTK2, Fig. 4A) and SV40(3.87 � 0.02, n � 2, in pGL3pro, not shown). 9-cis-RAalso induced the TK subclone to similar levels (2.87 �0.33, n � 2, not shown). In contrast, the fold inductionmediated by clones containing only one half-site didnot differ significantly from that of the empty vector,pLucTK2 (Fig. 4A).

9-cis-RA transactivated A24-controlled �-gal re-porter genes in yeast expressing RAR� and RXR�. Incontrast, no induction occurred in yeast lacking theretinoid receptors. The fact that the A24 clone inducedRA-responsive �-gal expression only in yeast express-ing mammalian receptors indicates that the A24 RAREinteracts directly with the receptors in vivo (Table 1).This was confirmed with EMSA (Fig. 4, B and C).Oligonucleotides containing the wild-type and mu-tated RARE were synthesized. In vitro transcribed andtranslated RAR� and RXR� heterodimers bound thewild-type oligonucleotide, but not the mutated oligo-nucleotide. Neither RAR� nor RXR� homodimersbound either oligonucleotide (Fig. 4B). Heterodimerbinding was equivalent in the presence or absence ofall-trans-RA (Fig. 4C). We also used both the wild-typeand mutant A24 RARE oligonucleotides as cold com-petitors for RAR�/RXR� binding to the wild-type A24

RARE. As shown in Fig. 4C, 100-fold molar excess ofthe mutant oligonucleotide did not affect binding tothe wild-type probe. However, adding cold wild-typeoligonucleotide inhibited binding to the wild-typeprobe. Together, these data indicate that this yeast-trapped RARE functions in mammalian cells and bindsmammalian receptors. Thus, the A24 RARE may reg-ulate a gene that directly responds to RA.

We used the A24 sequence to search GenBank fornearby genes and identified several expressed se-quence tags (ESTs) derived from various tissues.IMAGE EST clone 734988 was used to screen a cDNAlibrary prepared from RA-treated P19 cells (37). A1909-bp clone (S8) overlapping the genomic cloneA24 was isolated and sequenced. The DR5 sequenceis positioned 85 bp downstream of the 3�-end of thiscDNA. Similarly, other RAREs (e.g. Refs. 8–11), arelocated downstream of genes.

This cDNA clone was used to probe Northern blotsof total RNA isolated from tissue culture cells, em-bryos, and adult organs. As shown in Fig. 4D, RA morethan doubled the abundance of a transcript in D3embryonic stem cells. Thus, the A24 RARE is imme-diately downstream of a transcript regulated by RA.The transcript was also present in RNA isolated fromall tested adult organs and throughout midgestation(Fig. 4E). After normalization to a constitutively ex-pressed ribosomal protein gene, 36B4 (38), and actin(Fig. 4E) and comparison to the rRNA intensities (notshown), the transcript abundance was found to beelevated in liver, brain, and cortex.

The A24 cDNA clone contains an open readingframe that may encode a 276-amino-acid peptide. Theentire peptide is highly conserved across vertebratespecies (Fig. 5). Substantially conserved regions canalso be identified in nonvertebrate genomes, specifi-cally the sea squirt, Halocynthia roretzi, the fly, Dro-sophila melanogaster, and the nematode, Caenorhab-ditus elegans. Indeed, whereas the overall amino acididentity between the Drosophila and mouse se-quences is 40%, several motifs are entirely conservedas shown in Fig. 5. Interestingly, the A24 open readingframe is 88% identical to that encoded by a humangene located on chromosome 6. A partial sequence ofthis gene was previously isolated in a screen for braincDNA clones containing CAG trinucleotide repeats[TNRC5, GenBank accession no. U80744, (39)], indi-cating expression in human brain as well as mouse.

Analysis of a Complex RARE

Clone C13 activated the yeast �-gal reporter gene10-fold in response to 9-cis RA-treatment (10.5 � 3.3,n � 7). Similarly, C13 strongly activated the mamma-lian luciferase reporter gene in the context of twodifferent promoters [Simian virus 40 (SV40) inpGL3pro, Fig. 6; and TK in pLucTK2, not shown]. Upontreatment with all-trans-RA, transcription was acti-vated by 5- to 9-fold (Fig. 6). Treatment with 9-cis-RA


Fig. 4. The A24 RARE Functions in Vitro and in VivoA, The A24 RARE drives all-trans-RA-inducible luciferase gene expression in F9 cells. The 986-bp Sau3AI (Sa) insert in the A24

clone is shown with an arrow indicating the DR5 located 85 bp downstream from the S8 polyadenylation site. Three luciferasereporter constructs generated from the entire 145-bp SspI (Ss)-StyI (St) fragment containing the RARE or 30-bp or 115-bpsubclones generated by PvuII digestion were transfected into F9 cells in duplicate. The PvuII (Pv) site bisects the RARE. Cells werethen treated with ethanol vehicle alone or with media containing 1 �M all-trans-RA for 24 h. Extracts were assayed for luciferaseactivity in duplicate. The average fold induction by all-trans-RA � SEM is shown; n � 2–4 independent transfections. B, RAR�/RXR� heterodimers bind the A24 RARE. Oligonucleotides containing wild-type (TCGAGAAGGTCAGCTGGGGGGCAGG) ormutated (mutated nucleotides are indicated by lowercase letters: TCGAGAAcGagcGCTGGaGGGacGG) A24 RAREs wereradiolabeled and incubated with in vitro transcribed and translated RAR� and RXR�, and then electrophoresed throughnondenaturing gels. WGE indicates unprogrammed wheat germ extract. C, Competition for binding to the A24 RARE. Unlabeledwild-type or mutant competitor oligonucleotides (25-, 50-, and 100-fold molar excess, as indicated by the triangles) were addedto compete with the labeled wild-type oligonucleotide for binding to RAR� and RXR�. The fraction of bound oligonucleotide inthe presence of competitor oligonucleotide is plotted relative to the amount bound in the absence of competitor (None). Error barsindicate the SEM, n � 3. One binding reaction also contained 1 �M all-trans-RA (None � RA). D, All-trans-RA induces the A24transcript in embryonic stem cells. D3 ES cells were grown as aggregates for 3 d in the absence or presence of 50 nM all-trans-RA.RNA was Northern blotted and hybridized to cDNA clone S8. The blot was stripped and hybridized to 36B4 (plasmid encodinga constitutive ribosomal protein) to control for loading. Treatment with all-trans-RA induced the A24 transcript by 2.1-fold. E, TheA24 transcript is ubiquitously expressed in midgestation embryos (E8–E14) and adult tissues. RNA was analyzed as describedin panel D. Actin was an additional loading control.


induced the full-length construct to similar levels(8.18 � 1.03, n � 3).

Maximal transactivation in yeast depended on co-transfection with both mammalian RAR� and RXR�expression vectors (Table 1). This supports a directinteraction between the C13 insert and the receptorheterodimers in vivo. Inspection of the C13 sequenceidentified three perfect PuG(G/T)TCA motifs at the ex-treme 3�-end of the clone, arranged in an overlappingDR5 and DR1 pattern (position 891–914, Figs. 6 and7). To determine whether or not these half-sites influ-enced RA-dependent transcription, luciferase con-structs containing (771–925) or lacking (1–770) the

DR5/1 element were prepared. As shown in Fig. 6, RAdid not affect reporter gene activity driven by the770-bp fragment lacking the DR5/1. In contrast, RAinduced reporter gene activity driven by the 155-bpDR5/1-containing fragment by approximately 6-fold.These data support the hypothesis that this compositeDR5/1 element is an RARE.

To confirm the ability of this sequence to bind re-ceptors, EMSA was performed using oligonucleotidescontaining the entire composite element (DR5/1), theDR5, or the DR1 elements (Fig. 7B). In vitro transcribedand translated RAR� and RXR� heterodimers boundall three oligonucleotides as demonstrated by the

Fig. 5. The A24 Transcript Encodes a Highly Conserved ProteinClustalW alignment of open reading frames occurring in GenBank as indicated by the accession numbers. In some cases,

several submitted sequences were concatenated to obtain the longest open reading frame. Danio rerio (zebrafish, AI794368), D.melanogaster (fruit fly, AE003518), H. roretzi (sea squirt, AV383368), Sus scrofa (pig, BE014121, BE032471, BF442963), Bostaurus (cow, AV597535, AW656420), Homo sapiens (human, AL035587), Mus musculus (mouse clone S8, AF361644), Gallusgallus (chick, AI981252, AJ394068), Ictalurus punctatus (catfish, BE212618), C. elegans (nematode, Z70205, AL031265). Aminoacids that are evolutionarily conserved between all ten species are boxed. An asterisk (*) indicates fully conserved residues, acolon (:) indicates conservation of strong side chains, and a period (.) indicates conservation of weak side chains. The conservedcysteines are underlined.


shifted bands. By quantifying the intensity of the shiftedbands, we determined that the DR5/1 and the DR5oligonucleotides bound receptors comparably. TheDR1-containing oligonucleotide bound receptors withone-half the intensity of the DR5/1 oligonucleotide, re-spectively (47 � 6%, n � 2). As observed for the A24element, adding all-trans-RA did not influence in vitroreceptor binding (data not shown).

To further delineate the contribution of each half-siteto RAR�-RXR� heterodimer binding, we prepared oli-gonucleotides containing mutations in each of thehalf-sites (Fig. 7A) and performed EMSA (Fig. 7B).Mutating the first or third half-site did not affect theability of the RAR�-RXR� heterodimer to bind to theoligonucleotide. In contrast, mutating the second half-site abrogated binding by the heterodimer. This indi-cates that an intact DR1 (mutant 1) or DR5 (mutant 3),but not a DR12, is sufficient for heterodimer binding.RAR� or RXR� homodimers did not bind to any of theoligonucleotides.

We next analyzed binding specificity of the half-sitesby competition analysis, using wild-type and mutantoligonucleotides (Fig. 7, C and D). As expected, add-ing cold wild-type oligonucleotide completely inhibitedbinding of the heterodimer to the wild-type probe.Similarly, mutant 3, which contains an intact DR5,completely inhibited binding to the wild-type probe.Mutant 2 failed to compete with the wild-type probe,consistent with its inability to bind receptor (Fig. 7C).Mutant 1, containing an intact DR1, inhibited bindingonly at the highest concentration, indicating that theDR5 site has a higher affinity for the receptors.

EMSAs determined the contribution of each half-sitein our composite RARE to RAR�-RXR� heterodimerbinding. To determine the role of each motif in a func-tional assay, we generated the same mutations in thecontext of the 155-bp luciferase reporter construct.These constructs were transfected into F9 cells thatwere then treated with all-trans-RA (Fig. 6, last fourbars). Mutating either the first (MT1) or second (MT2)half-sites reduced RA inducibility to levels approach-ing background, indicating the importance of thesemotifs. In contrast, mutation of the third half-site (MT3)had little effect. Together, the EMSA and luciferasedata indicate that, although RAR�-RXR� heterodimerscan bind the DR1, only the DR5 drives RA inducibilityin cells. These data are in keeping with previous ob-servations indicating that DR5 elements mediatestronger transcriptional responses than DR1 elements(Ref. 5 and references therein).

To identify a gene that the C13 complex RARE mightregulate, we queried GenBank with the C13 genomicclone sequence using BlastN. The terminal 740 bp ofthe mouse genomic clone UUGC1M0544E01 in theGSS database were 98.4% identical to the end of C13.This match ended 166 bp from the DR5/1 RARE. Wefully sequenced this clone (6.88 kb) and queried Gen-Bank; however, no additional matches were observed.BlastP analysis indicated that open reading frameswithin this sequence differed from those of any knownproteins. This suggests that the potent C13 RAREregulates either a completely novel gene or one with-out sequence deposited in GenBank.

Fig. 6. The C13 Clone Contains a RARE That Drives all-trans-RA-Inducible Luciferase Gene Expression in F9 CellsThe indicated fragments were inserted into the luciferase reporter vector pGL3-Promoter. The arrows indicate the orientation

of the insert relative to the SV40 promoter. Each of the mutant constructs had a single half-site mutated (X), as shown in Fig. 7(mutant 1, MT1; mutant 2, MT2; mutant 3, MT3). The constructs were transfected in duplicate into F9 cells that were then treatedwith ethanol vehicle or 1 �M all-trans-RA, and assayed as described in Fig. 2. Bars indicate the fold induction by RA, shown withthe SEM; n � 2–10 independent transfections. Sa, Sau3AI; Xc, XcmI.


Fig. 7. C13 Contains DR5 and DR1 Motifs that Bind Retinoid Receptors in VitroA, Sequence of oligonucleotides used in EMSA analysis. The indicated double-stranded oligonucleotides were used as probes

and/or cold competitors in panels B and C. The DR5/1 oligonucleotide corresponds to nucleotides 886–919 of the C13 trappedgenomic clone. Each half-site is indicated by an arrow. Mutated nucleotides are indicated by lowercase letters. B, RAR�/RXR�heterodimers bind the C13 RAREs, but mutation of half-site 2 abrogates binding. Oligonucleotides containing the wild-typecomposite C13 RARE (DR5/1), the wild-type DR5 only (DR5), the wild-type DR1 only (DR1), or the composite RARE mutated ineach half-site (DR5/1 mutants 1, 2, 3) were analyzed by EMSA as described in Fig. 4. WGE, Unprogrammed wheat germ extract.C, Competition for binding to the composite C13 RARE. Unlabeled competitor oligonucleotides (1-, 4.2-, and 125-fold molarexcess as indicated by the triangles) were added to compete with the labeled composite C13 DR5/1 wild-type RARE for bindingto RAR� and RXR�. These included the unlabeled composite RARE (wild type), or each of the DR5/1 mutants shown in panel A.D, Competition quantification. The fraction of bound oligonucleotide in the presence of competitor oligonucleotide is plottedrelative to the amount bound in the absence of competitor. Error bars indicate the SEM, n � 2, except n � 3 in the absence ofcompetitor.


DISCUSSION

Unbiased genetic screens have been proven to eluci-date key developmental mechanisms in geneticallytractable organisms. For example, enhancer or genetrapping strategies have directly identified elementsthat regulate key genes in lower organisms. However,similar large-scale genetic screens are difficult inmammals. Gene or promoter traps combined with mu-rine embryonic stem cell technology (see Refs. 40 and41 and references therein) have identified develop-mentally regulated genes, but using this approach tocompletely survey the genome for specific regulatoryelements is impractical. Also, because gene traps aredesigned to select the 5�-end of genes, enhancersacting distantly from the promoter will be missed. Wehave exploited the advantages of yeast to trap en-hancers (RAREs) that drive gene expression in re-sponse to RA. We present here our initial analysis ofthese trapped sequences.

The number of RAREs activated by specific receptorcombinations is unknown. By transforming yeast ex-pressing various receptor combinations with a repre-sentative sample of the mouse genomic DNA library,one can estimate the total number of RAREs in thegenome by extrapolation. The number of trapped re-porter genes in each receptor background provides anestimate of the number of RAREs activated by thatreceptor combination. For example, our isolation of 32confirmed RAREs from 9% of the murine genomesuggests that RAR� and RXR� could activate approx-imately 350 RAREs in the entire genome. This estimateis plausible, considering that RA directly regulates onlya subset of the many hundreds of RA-regulated genes.We now have the tools to estimate the number ofRAREs activated by specific receptor combinations.

Because the receptor-expressing yeast lack othermammalian transcription factors, this estimate specif-ically reflects the influence of receptor binding. Thus,this assay is stringent because only those RAREs thatcan be independently activated by receptors will beisolated. Some RAREs, however, require binding bynonreceptor transcription factors. For example, thetissue plasminogen activator RARE also requires bind-ing by Sp1 (42). We may not isolate these complexRAREs. Alternatively, they may be trapped, but induceweakly in yeast or cells lacking the contributing tran-scription factor. The RARE associated with sperizin(D6) may fall into this class. In the unique cells normallyexpressing sperizin, specifically the male germ cells,other transcription factors may stabilize the interactionbetween retinoid receptors and this RARE. Similarly,the absence of specific transcriptional repressors inyeast would permit the detection of RAREs, the activ-ity of which is masked by repressors in some mam-malian cells.

In mammalian cells, coactivators and corepressorsmodulate receptor activity by remodeling chromatin(43, 44). Likewise, gene expression in yeast is regu-

lated via highly conserved chromatin remodeling com-plexes. The general transcription apparatus and manycoactivators with histone acetylase activity are highlyconserved and are required for the activity of all nu-clear receptors. Other coactivators are highly receptorand ligand specific. These factors contribute to thehighly cell-specific effects of hormones. Homologs tothe steroid receptor coactivator (SRC)/p160 family ofcoactivators have not been identified in yeast andinsects (Refs. 45–47 and our recent Medline searches).However, transfected murine GRIP1 (glucocorticoidreceptor-interacting protein 1)/SRC2/transcriptionalintermediary factor 2 has been shown to strongly stim-ulate the activity of transfected RARs on the �REelement in yeast (46). Interestingly, RAR�, but notRAR� or RAR�, homodimers did exhibit some GRIP-independent activity and binding in yeast (47). Ourinitial trapping protocol using RAR� would have se-lectively trapped RAREs that lack a strong SRC/p160coactivator requirement. It will be interesting to testwhether or not GRIP1 can stimulate the activity ofthese RAREs in yeast.

Unliganded nuclear hormone receptors can repressbasal transcription by recruiting corepressors and hi-stone deacetylases (48, 49). Ligand-mediated relief ofthis repression contributes to the ability of hormonesto greatly induce transcription. Hormone-mediated re-pression has been observed on response elements invarious promoter contexts in mammalian cells, but notin yeast. This may be due to the absence of silencingmediator of retinoid and thyroid hormone receptor ornuclear receptor corepressor homologs capable of in-teracting with mammalian receptors (Ref. 47 and ourrecent Medline searches). We also found that unligan-ded retinoid receptors failed to repress �-gal tran-scription driven by 13 different RAREs in yeast (�RE,CRBPII, A18, A20, A24, B9, B10, B12, C9, C13, D4,D7, E2; data not shown). This supports the hypothesisthat the yeast repressor apparatus cannot interact withmammalian receptors.

We have scanned the 32 trapped sequences forcanonical RAREs consisting of two directly repeatedPuG(G/T)TCA motifs. Despite being able to activatereporter gene activity only in yeast expressing retinoidreceptors, only C13 contained perfect direct repeats ina DR5 pattern (Fig. 7). We demonstrated that severalof the sequences lacking canonical RAREs also in-duced mammalian reporter genes (D7, D6, and A24,Figs. 2–4; C9 and E2, not shown). The relative flexibilityof the half-site is supported by in vitro measurementsof receptor binding. Hauksdottir and Privalsky (50)compared the in vitro binding of RAR or RXR ho-modimers or heterodimers to oligonucleotides mu-tated systematically at each position of each half-siterelative to AGGTCA. The A24, D6, and D7 sequenceseach contain DR5-like elements that vary from theconsensus at a single nucleotide. These variationswere shown to permit in vitro binding (Fig. 4 and Ref.50). The flexible nature of the RARE highlights the


need for a genetic analysis of RAREs based onfunctionality.

Three of the trapped RAREs are located near RA-regulated genes (Figs. 2–4). D6 and D7 are proximal toknown genes, the round spermatid-specific genesperizin and the nonclassical MHC gene T20d, respec-tively. The A24 RARE is 85 bp downstream of a noveland highly conserved gene regulated by RA in embry-onic stem cells. In all mammalian sequences, the tran-scribed region contains an open reading frame thatencodes a string of leucines and other nonpolar aminoacids typical of a signal peptide (Fig. 5). In addition, theA24 open reading frame encodes six conserved cys-teine residues. An even number of cysteines suggeststhat the protein can form intramolecular disulfidebonds like many secreted proteins. A consensus N-linked glycosylation site at amino acid 153 is anotherfeature common in secreted proteins. Thus, thetrapped A24 RARE may influence the expression of ahighly conserved secreted protein in mammalian cells.

In conclusion, we developed a functional assay toefficiently isolate RAREs from whole genomes. Weidentified 32 sequences that functioned as RAREs inRA-treated yeast expressing RAR� and RXR�. Analy-sis of four selected sequences showed that theseRAREs also drove RA-dependent transcription inmammalian cells. This approach relies only on theability of an enhancer to mediate RA-induced reportergene expression in yeast. Genes proximal to theseRAREs are highly likely to be regulated directly byretinoids. Indeed, three of these RAREs (A24, D6, andD7) are located near transcripts induced by RA. Be-cause directly regulated genes may launch signalingprocesses controlling key cellular decisions, this ap-proach will provide insight into the action of retinoids.Specifically, it should be possible to identify geneswhose normal expression requires natural retinoid sig-nals as well as genes induced by teratogenic levels ofretinoids. Finally, this method may also be used toidentify the target genes for any cellular signal whosereceptor can function in yeast.

MATERIALS AND METHODS

Animals

Male Sprague Dawley rats were made vitamin A deficient asdescribed in Ref. 36. Briefly, 20-d-old animals (30–40 g) wereplaced on a VAD diet (Ralston Purina Co., Richmond, IN) for10 wk. Arrest of spermatogenesis was verified histologically.Procedures were approved by the Institutional Animal Careand Use Committee of Washington State University.

Plasmids

The yeast reporter vector, p�ss, contains the �-gal genedriven by the yeast cytochrome c1 (cyc1) minimal promoter(21). The expression vectors p2HG-RAR� and pG1-RXR�encode RAR� and RXR�, respectively (18). pLucTK2 wasgenerated by inserting a SmaI-KpnI polylinker fragment from

pBluescript II SK(�) (Stratagene, La Jolla, CA) into the SmaIand KpnI site of pLucTK (51).D7. The D7 trapped genomic clone (1301-bp Sau3AI frag-ment) was partially digested with Sau3AI. A 759-bp fragmentwas filled in with deoxy (d)ATP and dGTP and inserted intothe XhoI site of p�ss, which was partially filled in with de-oxythymidine triphosphate and dCTP. This same 759-bpSau3AI fragment was also inserted into the BamHI site ofpBluescriptSK. This plasmid was then digested with XbaI,producing a 417-bp fragment and a 306-bp fragment. Thesefragments were filled in with Klenow enzyme and de-oxynucleotide triphosphates (dNTPs) and inserted into theSmaI site of pLucTK2.D6. The D6 trapped genomic clone (1397-bp Sau3AI frag-ment) was digested with XhoI, releasing an 1179-bp fragment(positions 209-1388) containing two putative RAREs. Thisfragment was ligated into XhoI-digested pLucTK2.A24. A 145-bp SspI-StyI fragment containing the A24RARE was isolated from the A24 trapped genomic clone.After filling in the StyI end with Klenow enzyme, the fragmentwas inserted into the SmaI site of pLucTK2 in both orienta-tions. Two additional constructs were prepared by digestingplasmids containing the insert in both orientations with PvuIIand XhoI (vector polylinker site). The XhoI site was then filledin and the plasmids were religated, yielding subclones con-taining inserts of 115 or 30 bp.C13. To facilitate subcloning of the C13 genomic clone,positions 15–940 were PCR amplified and inserted into thepCRII vector (Invitrogen, San Diego, CA). This 925-bp insertwas released by digestion with EcoRI (vector polylinker sites),filled in with dNTPs and Klenow enzyme, and inserted intoSmaI-digested pGL3-Promoter (Promega Corp., Madison,WI) in both orientations. The 925-bp fragment in pCRII wasalso digested with EcoRV (vector polylinker site) and XcmIand treated with mung bean nuclease. The resulting 770-bpfragment was inserted into SmaI-digested pGL3-Promoter inthe forward orientation relative to the luciferase gene (see Fig.6). The 925-bp fragment in pCRII was also digested withEcoRI (vector polylinker site) and XcmI and treated with mungbean nuclease. The resulting 155-bp fragment was insertedinto SmaI-digested pGL3-Promoter in the reverse orientationrelative to the luciferase gene. This construct was the startingmaterial for the subsequent half-site mutations describedbelow. To reverse the orientation of the 155-bp fragment, theinsert was released by digestion with XhoI and NheI (pGL3-Promoter polylinker sites) and ligated into pBluescript di-gested with XhoI and XbaI. The resulting pBS construct wasdigested with NotI (pBS polylinker site), filled in with dNTPsand Klenow enzyme, and then digested with KpnI (also in thepBS polylinker). This fragment was then inserted into KpnI-SmaI-digested pGL3-Promoter, producing the plasmid con-taining the 155-bp fragment in the forward orientation. TheC13 half-site mutants were generated by overlap extensionPCR as described in Ref. 22. Sequences of the mutatedoligonucleotides are shown in Fig. 7A. To prepare each half-site mutant, two separate PCRs were performed, each usingone mutant oligonucleotide and one vector polylinker oligo-nucleotide to amplify overlapping portions of the 155-bpfragment. These two overlapping products were then mixedand amplified using the two vector polylinker oligonucleo-tides. The full-length product was then digested with XhoIand SstI (vector polylinker sites) and inserted into XhoI-SstI-digested pGL3-Promoter. Each mutant was verified by se-quencing to ensure that only the desired mutations wereintroduced.

Construction of a Murine Genomic DNA Library in aYeast Reporter Plasmid

D3 embryonic stem cell DNA was purified as described inRef. 22. After partial digestion with Sau3AI, fragments ofapproximately 2 kb were partially filled in with dATP anddGTP and inserted into the XhoI site of p�ss, which was


partially filled in with deoxythymidine triphosphate and dCTP.The ligated DNA was used to transform DH5� competentcells (22). The transformed colonies were harvested and am-plified in liquid culture for 2 h before plasmid isolation.

Yeast Transformations and �-gal Assays

The yeast strain BJ5409 (leu2-�, his3�200, ura3–52, trp1)was transformed as described in Ref. 52. Double or tripletransformants were selected by plating on medium lackingthe appropriate nutrients. Plates were incubated at 30 C for2–4 d to recover transformants. Plate and liquid �-gal assaysare described in Ref. 22. Yeast were RA treated for 24 h asdescribed (20).

Isolation of Reporter Plasmids from Yeast

Yeast reporter plasmids were rescued by preparing DNA asdescribed in Ref. 53 and transforming Escherichia coli strainDH5�.

RT-PCR

RT-PCR was performed essentially as described in (28).Briefly, oligo-deoxythymidine-primed (Fig. 2A) or randomhexamer-primed cDNA (not shown) was synthesized fromtotal cellular RNA. To avoid amplifying genomic DNA thatmight contaminate the RNA, all reverse transcription (RT)reactions were pretreated with XbaI, which cleaves within theamplified region. T20d-specific (28) or actin-specific primerswere used for PCR amplification. The PCR products wereSouthern blotted and probed with a 252-bp XbaI-BstNI frag-ment specific for T20d, or with an actin-specific probe (Am-bion, Inc., Austin, TX).

F9 Cell Transfections and Luciferase Reporter Assays

F9 cells were grown and transfected as described in Ref. 20with the following modifications. After removing the CaPO4precipitate, cells were incubated with fresh media containingethanol vehicle alone or 1 �M all-trans-RA. After 24 h, the cellswere lysed and the luciferase activity was measured using theLuciferase Assay System (Promega Corp.). Transfection ef-ficiency was normalized by cotransfecting the �-gal expres-sion vector (p�AclacZ), which contains the �-gal-coding re-gion driven by the constitutive �-actin promoter (54).

cDNA Cloning

A cDNA library (4 � 105 plaques) made from RA-treated P19embryonal carcinoma cells (37) was screened using a gel-purified insert from IMAGE EST clone 734988 (GenBank ac-cession no. AA260027), corresponding to positions 84–656of the A24 trapped genomic clone. After plaque purification,plasmids were excised by in vivo excision and purified. Sixindependent clones were isolated and partially mapped andsequenced. These clones differed only by the length of their5�- and 3�-ends. The longest clone, S8 (1909 bp), was fullysequenced.

Northern Analysis

Northern analysis procedures are described in Ref. 55.

EMSAs

Expression vectors encoding human RAR� and murine RXR�(obtained from R. Evans) were linearized with BamHI and in

vitro transcribed and translated using the TnT T7-coupledwheat germ extract system (Promega Corp.) according to themanufacturer’s instructions. Binding reactions contained 20mM HEPES (pH 7.9), 40 mM KCl, 6 mM MgCl2, 1 mM dithio-threitol, 2.5–5 �g BSA, 1 �g poly-(deoxyinosine-deoxycyti-dine), 0.5 �g sonicated salmon sperm DNA, 2% Ficoll, 20,000cpm (�0.2 ng) 32P-labeled oligonucleotide probe, and 4 �lreceptor protein or unprogrammed extract. All componentsexcept probe were allowed to prebind on ice for 10 min, andthen probe was added and the reactions proceeded at roomtemperature for 20 min. Reactions were loaded on 5% non-denaturing polyacrylamide gels, electrophoresed, dried, andexposed to x-ray film. When used, competitor oligonucleo-tides were added as indicated in the figure legends. Probeswere prepared by end labeling oligonucleotides (IntegratedDNA Technologies, Coralville, IA) with T4 polynucleotide ki-nase and 32P-�ATP. Complementary oligonucleotides wereannealed and then purified by passage over Sephadex G50spin columns. Quantification was performed using Image-Quant Software (Molecular Dynamics, Inc., Sunnyvale, CA).

Acknowledgments

We thank S. Chao and C. Roland for expert technicalassistance and Drs. J. Garey, J. Szostak, and D. Rogers foradvice. We also thank Drs. R. Heyman, E. Allegretto, M.Privalsky, and C. Woolford for gifts of plasmids and yeaststrains.

Received May 23, 2002. Accepted September 17, 2002.Address all correspondence and requests for reprints to:

Dr. Melissa Rogers, Biochemistry & Molecular Biology (MSBE627), UMDNJ-New Jersey Medical School, 185 South Or-ange Avenue, Newark, New Jersey 07103-2714. E-mail:[email protected].

This work was supported in part by the Molecular Imagingand Molecular Biology Core Facilities at the H. Lee MoffittCancer Center and Research Institute, by National Institute ofChild Health and Human Development Grant HD-31117, andby Research Grant 1-FY00-381 from the March of DimesBirth Defects Foundation.

* M.A.G. and Y.L. contributed equally to this work.

REFERENCES

1. Kastner P, Mark M, Chambon P 1995 Nonsteroid nuclearreceptors: what are genetic studies telling us about theirrole in real life? Cell 83:859–869

2. Zile M 1998 Vitamin A and embryonic development: anoverview. J Nutr 128:455S–458S

3. Rogers M 1997 Life and death decisions influenced byretinoids. Curr Top Dev Biol 35:1–46

4. Chambon P 1996 A decade of molecular biology of reti-noic acid receptors. FASEB J 10:940–954

5. Kato S, Sasaki H, Suzawa M, Masushige S, Tora L,Chambon P, Gronemeyer H 1995 Widely spaced, directlyrepeated PuGGTCA elements act as promiscuous en-hancers for different classes of nuclear receptors. MolCell Biol 15:5858–5867

6. Jansa P, Forejt J 1996 A novel type of retinoic acidresponse element in the second intron of the mouseH2Kb gene is activated by the RAR/RXR heterodimer.Nucleic Acids Res 24:694–701

7. Kishimoto H, Hoshino S, Ohori M, Kontani K, Nishina H,Suzawa M, Kato S, Katada T 1998 Molecular mechanismof human CD38 gene expression by retinoic acid. Iden-tification of retinoic acid response element in the firstintron. J Biol Chem 273:15429–15434


8. Makita T, Hernandez-Hoyos G, Chen TH, Wu H, Rothen-berg EV, Sucov HM 2001 A developmental transition indefinitive erythropoiesis: erythropoietin expression is se-quentially regulated by retinoic acid receptors and HNF4.Genes Dev 15:889–901

9. Kambe T, Tada-Kambe J, Kuge Y, Yamaguchi-Iwai Y,Nagao M, Sasaki R 2000 Retinoic acid stimulates eryth-ropoietin gene transcription in embryonal carcinoma cellsthrough the direct repeat of a steroid/thyroid hormonereceptor response element half-site in the hypoxia-response enhancer. Blood 96:3265–3271

10. Morrison A, Ariza-McNaughton L, Gould A, FeatherstoneM, Krumlauf R 1997 HOXD4 and regulation of the group4 paralog genes. Development 124:3135–3146

11. Langston AW, Thompson JR, Gudas LJ 1997 Retinoicacid-responsive enhancers located 3� of the Hox A andHox B homeobox gene clusters. Functional analysis.J Biol Chem 272:2167–2175

12. Wang S-Y, Gudas LJ 1983 Isolation of cDNA clonesspecific for collagen IV and laminin from mouse terato-carcinoma cells. Proc Natl Acad Sci USA 80: 5880–5884

13. LaRosa GJ, and Gudas, LJ 1988 An early effect of reti-noic acid: cloning of an mRNA (Era-1) exhibiting rapidand protein synthesis-independent induction during ter-atocarcinoma stem cell differentiation. Proc Natl AcadSci USA 85:329–333

14. Komada M, McLean DJ, Griswold MD, Russell LD, So-riano P 2000 E-MAP-115, encoding a microtubule-asso-ciated protein, is a retinoic acid-inducible gene requiredfor spermatogenesis. Genes Dev 14:1332–1342

15. Forrester L, Nagy A, Sam M, Watt A, Stevenson L, Bern-stein A, Joyner A, Wurst W 1996 An induction gene trapscreen in embryonic stem cells: identification of genesthat respond to retinoic acid in vitro. Proc Natl Acad SciUSA 93:1677–1682

16. Shago M, Giguere V 1996 Isolation of a novel retinoicacid-responsive gene by selection of genomic fragmentsderived from CpG-island-enriched DNA. Mol Cell Biol16:4337–4348

17. Allegretto EA, McClurg MR, Lazarchik SB, Clemm DL,Kerner SA, Elgort MG, Boehm MF, White SK, Pike JW,Heyman RA 1993 Transactivation properties of retinoicacid and retinoid X receptors in mammalian cells andyeast. Correlation with hormone binding and effects ofmetabolism [published erratum appears in J Biol Chem1994 Mar 11;269(10):7834]. J Biol Chem 268:26625–26633

18. Hall B, Smit-McBride Z, Privalsky M 1993 Reconstitutionof retinoid X receptor function and combinatorial regula-tion of the nuclear hormone receptors in the yeast Sac-charomyces cerevisiae. Proc Natl Acad Sci USA 90:6929–6933

19. Heery D, Zacharewski T, Pierrat B, Gronemeyer H,Chambon P 1993 Efficient transactivation by retinoicacid receptors in yeast requires retinoid X receptors.Proc Natl Acad Sci USA 90:4281–4285

20. Heller LC, Li Y, Abrams KA, Rogers MB 1999 Transcrip-tional regulation of the Bmp2 gene: retinoic acid induc-tion in F9 embryonal carcinoma cells and Saccharomy-ces cerevisiae. J Biol Chem 274:1394–1400

21. Schena M, Yamamoto K 1988 Mammalian glucocorticoidreceptor derivatives enhance transcription in yeast. Sci-ence 241:965–967

22. Ausubel FM, Brent R, Kingston RE, Moore DD, SeidmanJG, Smith JA, Struhl K 1997 Current protocols in molec-ular biology. New York: Wiley and Sons

23. Sporn M, Roberts A, Goodman D 1994 The retinoids:biology, chemistry, and medicine. New York: RavenPress

24. Croce CM, Linnenbach A, Huebner K, Parnes JR, Mar-gulies DH, Appella E, Seidman JG 1981 Control of ex-pression of histocompatibility antigens (H-2) and �2-

microglobulin in F9 teratocarcinoma stem cells. Proc NatlAcad Sci USA 78:5754–5758

25. Nagata T, Segars JH, Levi BZ, Ozato K 1992 Retinoicacid-dependent transactivation of major histocompatibil-ity complex class I promoters by the nuclear hormonereceptor H-2RIIBP in undifferentiated embryonal carci-noma cells. Proc Natl Acad Sci USA 89:937–941

26. Brorson KA, Hunt SWD, Hunkapiller T, Sun YH, Cher-outre H, Nickerson DA, Hood L 1989 Comparison of exon5 sequences from 35 class I genes of the BALB/c mouse.J Exp Med 170:1837–1858

27. Klein J, Benoist C, David CS, Demant P, Lindahl KF,Flaherty L, Flavell RA, Hammerling U, Hood LE, HuntSWD, Jones PP, Kourilsky P, McDevitt HO, Merelo D,Murphy DB, Nathenson SG, Sachs DH, Steinmetz M,Tonegawa S, Wakeland EK, Weiss EH 1990 Revisednomenclature of mouse H-2 genes. Immunogenetics 32:147–149

28. Eghtesady P, Brorson KA, Cheroutre H, Tigelaar RE,Hood L, Kronenberg M 1992 Expression of mouse Tlaregion class I genes in tissues enriched for �� cells.Immunogenetics 36: 377–388

29. Fujii T, Tamura K, Copeland NG, Gilbert DJ, Jenkins NA,Yomogida K, Tanaka H, Nishimune Y, Nojima H, Abiko Y1999 Sperizin is a murine RING zinc-finger protein spe-cifically expressed in haploid germ cells. Genomics 57:94–101

30. Tyers M, Jorgensen P 2000 Proteolysis and the cellcycle: with this RING I do thee destroy. Curr Opin GenetDev 10:54–64

31. Joazeiro CA, Weissman AM 2000 RING finger proteins:mediators of ubiquitin ligase activity. Cell 102:549–552

32. Griswold MD, Bishop PD, Kim K-H, Ping R, Siiteri JE,Morales C 1989 Function of vitamin A in normal andsynchronized seminiferous tubules. Ann NY Acad Sci564:154–172

33. Cupp AS, Dufour JM, Kim G, Skinner MK, Kim KH 1999Action of retinoids on embryonic and early postnataltestis development. Endocrinology 140:2343–2352

34. Gaemers IC, van Pelt AM, van der Saag PT, Hooger-brugge JW, Themmen AP, de Rooij DG 1997 Effect ofretinoid status on the messenger ribonucleic acid ex-pression of nuclear retinoid receptors �, �, and �, andretinoid X receptors �, �, and � in the mouse testis.Endocrinology 138:1544–1551

35. Gaemers IC, Van Pelt AM, Themmen AP, De Rooij DG1998 Isolation and characterization of all-trans-retinoicacid-responsive genes in the rat testis. Mol Reprod Dev50:1–6

36. Akmal KM, Dufour JM, Vo M, Higginson S, Kim KH 1998Ligand-dependent regulation of retinoic acid receptor �in rat testis: in vivo response to depletion and repletion ofvitamin A. Endocrinology 139:1239–1248

37. Bouillet P, Oulad-Abdelghani M, Vicaire S, Garnier JM,Schuhbaur B, Dolle P, Chambon P 1995 Efficient cloningof cDNAs of retinoic acid-responsive genes in P19 em-bryonal carcinoma cells and characterization of a novelmouse gene, Stra1 (mouse LERK-2/Eplg2). Dev Biol 170:420–433

38. Rio MC, Bellocq JP, Gairard B, Rasmussen UB, Krust A,Koehl C, Calderoli H, Schiff V, Renaud R, Chambon P1987 Specific expression of the pS2 gene in subclassesof breast cancers in comparison with expression of theestrogen and progesterone receptors and the oncogeneERBB2. Proc Natl Acad Sci USA 84:9243–9247

39. Margolis RL, Abraham MR, Gatchell SB, Li SH, KidwaiAS, Breschel TS, Stine OC, Callahan C, McInnis MG,Ross CA 1997 cDNAs with long CAG trinucleotide re-peats from human brain. Hum Genet 100:114–122

40. Hill DP, Wurst W 1993 Screening for novel pattern for-mation genes using gene trap approaches. Methods En-zymol 225:664–681


41. Friedrich G, Soriano P 1993 Insertional mutagenesis byretroviruses and promoter traps in embryonic stem cells.Methods Enzymol 225:681–701

42. Rickles RJ, Darrow AL, Strickland S 1989 Differentiation-responsive elements in the 5� region of the mouse tissueplasminogen activator gene confer two-stage regulationby retinoic acid and cyclic AMP in teratocarcinoma cells.Mol Cell Biol 9:1691–1704

43. McKenna NJ, O’Malley BW 2002 Combinatorial controlof gene expression by nuclear receptors and coregula-tors. Cell 108:465–474

44. Rosenfeld MG, Glass CK 2001 Coregulator codes oftranscriptional regulation by nuclear receptors. J BiolChem 276:36865–36868

45. Freedman LP 1999 Increasing the complexity of coacti-vation in nuclear receptor signaling. Cell 97:5–8

46. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997GRIP1, a transcriptional coactivator for the AF-2 trans-activation domain of steroid, thyroid, retinoid, and vita-min D receptors. Mol Cell Biol 17:2735–2744

47. Walfish PG, Yoganathan T, Yang YF, Hong H, Butt TR,Stallcup MR 1997 Yeast hormone response element as-says detect and characterize GRIP1 coactivator-depen-dent activation of transcription by thyroid and retinoidnuclear receptors. Proc Natl Acad Sci USA 94:3697–3702

48. Privalsky ML 2001 Regulation of SMRT and N-CoR core-pressor function. Curr Top Microbiol Immunol 254:117–136

49. Wolffe AP 1997 Transcriptional control. Sinful repression[news; comment]. Nature 387:16–17

50. Hauksdottir H, Privalsky ML 2001 DNA recognition by theaberrant retinoic acid receptors implicated in humanacute promyelocytic leukemia. Cell Growth Differ 12:85–98

51. Turkson J, Bowman T, Garcia R, Caldenhoven E, DeGroot RP, Jove R 1998 Stat3 activation by Src inducesspecific gene regulation and is required for cell transfor-mation. Mol Cell Biol 18:2545–2552

52. Gietz R, Schiestl R 1995 Transforming yeast with DNA.Methods Mol Cell Biol 5:255–269

53. Strathern J, Higgins D 1991 In: Guthrie C, Fink G, eds.Guide to yeast genetics and molecular biology, vol. 194.San Diego, CA: Academic Press, Inc.; 319–329

54. Vasios GW, Gold JD, Petkovich M, Chambon P, GudasLJ 1989 A retinoic acid-responsive element is present inthe 5� flanking region of the laminin B1 gene. Proc NatlAcad Sci USA 86:9099–9103

55. Rogers MB, Rosen V, Wozney JM, Gudas LJ 1992 Bonemorphogenetic proteins-2 and 4 are Involved in the reti-noic acid-induced differentiation of embryonal carci-noma cells. Mol Biol Cell 3:189–196


Documents

Trapping and Characterization of Novel Retinoid Response Elements