Macrophages require distinct arginine catabolism and transport systems for proliferation and for activation

Macrophages require distinct arginine catabolism andtransport systems for proliferation and for activation

Andr�e Yeramian1, Lorena Martin2, Luis Arpa1, Joan Bertran2,Concepci� Soler1, Carol McLeod3, Manuel Modolell4, Manuel Palac�n2,Jorge Lloberas1 and Antonio Celada1

1 Macrophage Biology Group, Institute of Research in Biomedicine, Barcelona SciencePark, Barcelona, Spain

2 Department of Biochemistry and Molecular Biology, Faculty of Biology, and Instituteof Research in Biomedicine, Barcelona Science Park, University of Barcelona,Barcelona, Spain

3 Cancer Center and Department of Medicine, University of California, San Diego, LaJolla, CA, USA

4 Max Planck Institute for Immunobiology, Freiburg, Germany

In murine macrophages, as a result of arginine catabolism during activation, citruline isproduced under the effect of IFN-c and LPS, and ornithine and polyamines by IL-4 andIL-10. For proliferation, arginine is required from the extracellular medium and is usedfor protein synthesis. During activation, most arginine (>95% in 6 h) was metabolized,while under proliferation only half was incorporated into proteins. Under basalconditions, this amino acid was preferentially transported by y+L activity. Duringactivation, arginine transport increased drastically (4–5-fold) through y+ cationicamino acid transporter (CAT) activity. By contrast, M-CSF induced only a modestincrease in uptake (0.5-fold). The increase in arginine transport during activation, butnot proliferation, was mediated by the SLC7A2/Cat2 gene. SLC7A1/Cat1 isconstitutively expressed, and is not modified by proliferating or activating agents.M-CSF-dependent proliferation was not affected in the macrophages of SLC7A2knockout mice; however, these cells showed a drastic reduction in the production ofcitruline or ornithine and polyamines during activation. The data show that a largeincrease in a specific transport system (CAT2) is necessary for activation-inducedarginine metabolism, while arginine is in excess for the requirements of proliferationand a modest increase in transport occurs.

Supporting information for this article is available athttp://www.wiley-vch.de/contents/jc_2040/2006/35694_s.pdf

Introduction

Macrophages originate from undifferentiated stem cellsin the bone marrow, and are transported through theblood to all body tissues where, in most cases, theyundergo apoptosis [1]. Depending on the stimulireceived, in tissues these phagocytes differentiate innumerous cell types including liver Kupffer cells, dermalLangerhans cells, bone osteoclasts, brain microglia, and

Innate immunity

Correspondence: Antonio Celada, Macrophage Biology Group,Institute of Research in Biomedicine, Barcelona Science Park,Josep Samitier 1–5, 08028 Barcelona, SpainFax: +34-93-4034747e-mail: [email protected]

Received 14/11/05Revised 24/2/06

Accepted 4/4/06

[DOI 10.1002/eji.200535694]

Key words:Activation � Arginine

� Macrophages� Proliferation

Abbreviations: CAT: cationic amino acid transporters �NOS2:NO synthase 2 � SLC: solute carrier � TCA: trichloroaceticacid � TLC: thin-layer chromatography

Andr�e Yeramian et al. Eur. J. Immunol. 2006. 36: 1516–15261516

f 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.eji.de

several interdigitating and follicular dendritic cells fromlymphoid organs [2]. In response to M-CSF, macro-phages proliferate in tissues [1]. To carry out theirfunctional activities, these cells must become activatedeither by Th1-type cytokines, such as IFN-c (classicalactivation), or by Th2-type cytokines, such as IL-4, IL-10and IL-13 (alternative activation) [3]. Activationinduces biochemical and morphological modificationsthat allow macrophages to perform their function [4].Activation blocks the proliferation of these cells [5].

Cell proliferation and activation require high con-centrations of arginine either for protein synthesis or toelaborate either NO in classical activation or to producepolyamines and praline in alternative activation [3]. Theextracellular milieu is the main source of arginine andseveral transport systems are involved in carrying thisamino acid across the plasma membrane. Depending onthe cell type, a number of transport activities may beexpressed [6]. The SLC7 (solute carrier) family isdivided into two subgroups, the cationic amino acidtransporters (the CAT family, SLC7A1–4) and theglycoprotein-associated amino acid transportersSLC7A5–11, also called light chains or catalytic chainsof the hetero(di)meric amino acid transporters. The CATgroup includes four members, CAT-1 to CAT-4, whosegene products are SLC7A1 to SLC7A4. The first threemembers transport cationic L-amino acids, whereas thefunction of CAT-4 is not known. The hetero(di)mericamino acid transporters family is composed of sevenproteins, whose genes are SLC7A5 to SLC7A11, but onlyy+LAT2, y+LAT1 and bo+AT transport cationic aminoacids [6].

Macrophages require arginine to proliferate and toelaborate gene products when they become activated,e.g., IFN-c activates more than 300 genes [7]. Conse-quently, to meet their metabolic demands, macrophagesrequire the uptake of exogenous arginine. Therefore, theuptake of this amino acid may be a key regulatory stepfor physiological responses in macrophages. Here westudied how M-CSF-induced proliferation and classicaland alternative activation affect arginine metabolismand transport activity. We used bone marrow-derivedmacrophages, which are non-transformed cells thatrespond to both proliferative and activating stimuliseparately. Here we show that most arginine ismetabolized in activation, while in proliferation it isused for protein synthesis. Under basal conditions,arginine is incorporated through the y+L system, anarginine efflux transport system [8–10]. Activationinduces a considerable increase in arginine transportmediated by the y+ system, while proliferation producesonly a modest increase. The expression of SLC7A2/Cat2is induced for activation, but not for proliferation.

Results

Proliferation requires arginine import bymacrophages

We used bone marrow-derived macrophages, which area homogeneous population of primary and quiescentcells. Treatment with M-CSF induces the proliferation ofthese cells, whereas incubation with several cytokinesblocks this process and causes a series of modificationsthat allow them to develop their functional activity [1].Because proliferation and activation are opposite effectsin macrophage biology, here we examined argininemetabolism under these two conditions. In the presenceof increasing amounts of M-CSF, thymidine uptakeincreased in a dose-dependent manner, which corre-lated with macrophage growth (Fig. 1A) [11]. Inarginine-free media, macrophages did not incorporatethymidine (Fig. 1A, p<0.01). An explanation for thisobservation is that arginine, like many other aminoacids, is required for protein synthesis, and this wouldexplain why, in arginine-free media, M-CSF-dependentmacrophage proliferation was almost abrogated. In fact,in the absence of extracellular methionine, no M-CSF-dependent proliferation was found (data not shown). Tostudy classical activation, we used IFN-c and LPS, whilefor the alternative activation IL-4 and IL-10 were used.When we used IFN-c alone (Th-1-type cytokine) or IL-4(Th-2-type) the same effects, but to a lower degree, wereobserved. Because the aim of this study was to compareactivation versus proliferation, we used the strongestactivation possible and for this reason we added LPS orIL-10. Although these two types of activation regulatedistinct set of genes [12], both require arginine, either toproduce nitrites in the former or as substrate forarginase in the latter. Only molecules of classicalactivation produced nitrites through the induction ofNO synthase 2 (NOS 2), while only cytokines ofalternative activation stimulated arginase activity(Fig. 1B, p<0.01 and C, p<0.01). M-CSF, which inducedproliferation, did not produce either nitrites or arginaseactivity. Moreover, neither of the activators used led tomacrophage proliferation. Therefore, the reagents usedin this study determine whether macrophages prolifer-ate or become activated in the classical or alternativeway.

Arginine catabolism in macrophage proliferationand activation differs

To determine arginine catabolism, macrophages wereincubated with 14C-radiolabeled arginine. The distinctproducts of degradation were then measured in the celland in the supernatant together using thin-layerchromatography (TLC) (Fig. 2A). After 6 h, cells treated

Eur. J. Immunol. 2006. 36: 1516–1526 Innate immunity 1517


with IFN-c and LPS had converted most of the argininein citruline, while those treated with IL-4 and IL-10metabolized arginine into ornithine and spermine(p<0.01 in relation to the controls). In macrophagesincubated with M-CSF or control media, most of thearginine was not catabolized. Even after 6 h ofincubation, less than 10% was converted to spermine.This observation indicates that if arginine is required forproliferation (Fig. 1A), most of the arginine in M-CSF-stimulated macrophages is probably used for proteinsynthesis. Next, we determined whether arginine, once

incorporated into the cell, remains inside or returns tothe extracellular media. For this, we incubated macro-phages for 30 minwith radiolabeled arginine. Cells werewashed and incubated for an additional 6 h, and theamount of radioactivity in the supernatant and in thecells was thenmeasured as bound or non-bound protein.In control cells and those activated with IFN-c and LPS,most of the radioactivity (77% and 89%, respectively)was extracellular and was not bound to proteins(Fig. 2B). In contrast, in M-CSF-treated cells, approxi-mately half of the radiolabeled material was extra-cellular (52%) and half intracellular (47%; p<0.01 inrelation to the controls). However, while the radio-activity outside was not protein bound (49% of thetotal), that inside was associated with proteins (43%;p<0.01 in relation to the controls). The absoluteamounts of arginine are shown in Table S1 insupplementary materials. These data suggest thatduring activation arginine is depleted, while duringproliferation there is more arginine available than thatrequired for protein synthesis and arginine not bound toprotein is exchanged with that present in the media. Instarvation conditions, arginine is required for proteinsynthesis, and the non-bound protein is also exchangedwith that in the extracellular media.

Distinct transport systems in macrophageproliferation and activation

The differences in arginine metabolism in activation andproliferation prompted us to study the L-argininetransporters that are active in macrophages. Thetransport systems that mediate arginine uptake (y+,Bo+, bo+ and y+L) are well characterized [6]. Underbasal conditions, in the presence of sodium, L-leucineinhibited most of the L-arginine transport (p<0.01),indicating that very little y+ activity is present in thesecells and most of the transport is due to the y+L system.The participation of the Bo+ and bo+ systems wasexcluded by measuring transport in the presence andabsence of medium containing sodium and leucine. They+ system was strongly induced in classical and inalternative activation (p<0.01 in relation to thecontrols). In contrast, M-CSF treatment resulted in onlya modest increase in the activity of this system (Fig. 3A).

The y+ system is encoded by the CAT genes Slc7A1[13, 14], Slc7A2 [15, 16] and Slc7A3 [17]. As a firstapproach, we used qualitative PCR, which showed thatthe isoform Slc7A2B is present in macrophages, whileSlc7A2A is expressed in liver and Slc7A3 in brain(Fig. 3B). Using a quantitative PCR reaction, wedetermined the levels of the three members of the y+

system in macrophages treated with M-CSF or duringclassical or alternative activation. Low levels of Slc7A1were found in untreated cells. The expression of this

Figure 1. Arginine is required for M-CSF-dependent macro-phage proliferation and M-CSF does not induce activation. (A)Quiescent macrophages were incubated with increasingamounts of M-CSF for 24 h and thymidine incorporation wasthen measured. (B, C) Macrophages were cultured for 48 h inthe presence M-CSF (1200 U/mL), IFN-c (500 U/mL) and LPS(10 ng/mL) or IL-4 (10 U/mL) and IL-10 (10 U/mL), and nitrites(B) or arginase activity (C) were then determined. The valuesshown correspond to the mean � SD of three independentexperiments (*p<0.01 in relation to the controls).



gene was not modified by any treatment (Fig. 3C).Slc7A2 was not detected in quiescent or M-CSF-treatedcells but was induced by LPS+IFN-c and also byIL-4+IL-10 (p<0.01 in relation to the controls). Slc7A3was not detected. In addition, the expression of thegenes of the y+ system was measured in arginine-freemedium; however, no differences in induction by thedistinct cytokines were observed in relation to thecontrols (Fig. 3C).

Our results so far indicate that in basal conditionsand in proliferation most arginine transport is mediatedby the y+L system and the small increase caused byM-CSF is produced by the y+ system, which mediatesarginine transport through CAT1. In contrast, CAT2 isthe main L-arginine transporter for activated macro-phages. To confirm these data, we used macrophagesfrom mice with disrupted Slc7A2 [18]. In Slc7A2knockout (KO) mice and controls, untreated macro-

Figure 3. Arginine transport differs in macrophage proliferation and activation. (A) Cells were incubated for 24 h with theactivators indicated and arginine uptakewasmeasured in the absence (open bars) or in thepresence of 5 mML-leucine (black bars)under linear conditions. (B, C) Macrophages were incubated as in (A) and gene expression was determined using conventional (B)and real-time (C) PCR. For (A) and (C) results are the mean � SD of three experiments (*p<0.01 in relation to the controls).

Figure 2. Arginine metabolism differs between proliferation and activation. (A) Macrophages were incubated for 24 h with thereagents indicated. After that, cells were incubated for 2 or 6 h with radiolabeled arginine. The total products (outside and insidethe cells) were separated by TLC. The results are indicated as percentage of arginine added at the beginning of the assay. (B)Macrophages were incubated as in (A). Radiolabeled arginine was added for 30 min, cells were washed and incubated for 6 h.Media and cells were obtained separately and radioactivity was determined in the pellets and supernatants after TCA treatment.The levels of arginine remaining in the cells are expressed as thepercentage of the level before 6 h of incubation. Thevalues showncorrespond to the mean � SD of three experiments (*p<0.01 in relation to the controls).



phages and cells stimulated with M-CSF showed similaramounts of arginine transport (Fig. 4A). However, whileclassical and alternative activators produced an increasein the transport of this amino acid in controls, noincrease in cells from Slc7A2 KO mice was observed(Fig. 4A; p<0.01 between WT and KO mice). Whenanalyzed in more detail, the increased transport activitycorresponded to the y+ system (i.e., inhibitable byarginine and resistant to sodium and leucine inhibition;data not shown). Slc7A1 expression was not modified inSlc7A2 KO macrophages or in controls when treatedwith activators, and Slc7A3 was not expressed in thismodel (data not shown). The lack of the CAT2 transportsystem in M-CSF-treated macrophages was demon-strated because, although arginine was required forproliferation in cells from Cat2–/–, this activity was notaffected by this treatment (Fig. 4B; p>0.05 between WTand KO). After incubation with activating agents, Slc7A2KO macrophages showed a reduced catabolism ofarginine and the amounts of citruline and ornithineproduced were decreased in relation to controls(Fig. 4C; p<0.01 between WT and KO). However, inthe M-CSF-treated cells the same amounts of citruline orornithine were produced by cells from WT and Slc7A2KO. These results confirm that macrophage proliferationand activation use distinct arginine transport systems.

The production of polyamines by degradation ofarginine is not a limiting factor for macrophageproliferation

Polyamines are critical mediators of cell growth anddivision because of their capacity to bind directly to DNAand to modulate DNA-protein interactions [19]. More-over, it has been proposed that polyamines are involvedin tumor progression [20]. Because we detectedspermine, spermidine and putrescine as products ofarginine metabolism, we next examined their roles inproliferation. Macrophages cultured with M-CSF in-corporated thymidine in similar amounts when poly-amines were present in the media (Fig. 5). At doses of25 lM spermidine or spermine, these polyaminesinhibited thymidine uptake, which is caused by theinduction of apoptosis [21] (p<0.01 in relation to thecontrols), as shown by annexin V determination, whichis an indicator of phosphatidylserine exposure in anearly apoptotic event. Combinations of the polyaminesdid not increase macrophage proliferation (data notshown). We also measured M-CSF-dependent prolifera-tion using sub-optimal concentrations (50 and100 U/mL), but did not observe an increased effecton proliferation in either case.

Figure 4. The induction of arginine transport inmacrophage activation but not in proliferation is due to CAT2. (A) Arginine uptakewas measured in macrophages from Slc7A2 KOmice and the controls. (B) CAT2 is not required for M-CSF-dependent macrophageproliferation. Macrophageswere incubatedwith increasing amounts ofM-CSF for 24 h and thymidine uptakewas thenmeasured.This figure represents one of three independent experiments. (C) Macrophages were treated as in Fig. 2A. For (A) and (C) valuescorrespond to the mean � SD of three independent experiments (*p<0.01 between WT and KO).



Discussion

Macrophages either proliferate or, under the effect ofdistinct cytokines, stop proliferation and becomeactivated [1]. In both cases, these cells requireexogenous arginine to meet their metabolic demands.Here we used murine bone marrow-derived macro-phages because they are a unique primary culture modelin which proliferation and activation can be studiedseparately [5, 22]. Moreover, these cells, unlikeperitoneal or alveolar macrophages, are not previouslyactivated. For proliferation, arginine is predominantlyrequired for protein synthesis. While this amino acid isneeded to produce NO and citruline in classicalactivation, in the alternative mode it is required toproduce ornithine and polyamines. Interestingly, whilemost of the arginine was catabolized and the productswere found outside the cell during activation, inproliferation this amino acid was not catabolized andonly half returned to the media, the other half beingincorporated into the proteins of the macrophages(Fig. 6). In quiescence, most of the arginine was notcatabolized and returned to the media, while a smallamount was incorporated into proteins. These datasuggest that arginine is a limiting factor for theproduction of NO or polyamines during activation,but this is not the case for proliferation. The availability

of arginine appears to be essential in the regulation ofcellular immune response and the inflammatory processduring critical illness [23]. Mixed leukocyte cultures aresuppressed by the addition of excess macrophagesbecause they deplete arginine from the media [24].Arginine consumption by arginase-expressing macro-phages modulates the expression of the CD3f chain inT lymphocytes [25], and this may have a suppressive rolein tumor immunology [26, 27].

The catabolism of arginine by macrophages throughNOS2 or arginase generates several crucial products forimmune regulation. For example, NOS2 produces NOwhile arginase gives proline and polyamines, therebyinducing the synthesis of collagen, which enhancesinflammation [28]. However, in some cases thedegradation products of arginine have a beneficialeffect on intracellular microbes. For example, poly-amines are required for the intracellular growth ofleishmania [29]. Also, mycobacterium enhances argi-nine transport in infected macrophages, and acquiresthe metabolites required for bacterial growth andtherefore inhibits the capacity of the phagocytes to killbacteria [30].

Given the interest in arginine catabolism duringproliferation and activation of the macrophages, weexamined the transport of this amino acid across theplasma membrane as an essential regulatory first step.The distinct arginine requirements during activation andproliferation correlate with the different amounts ofarginine incorporated into cells under these conditions.Consequently, the increase in arginine transport inM-CSF-treated macrophages is very modest and, as inquiescent conditions, is mostly due to the y+L systemwith little activity of y+ through the CAT1 transporter. Inactivated macrophages, the drastic increase correspondsto an induction of the CAT2 transporter (Fig. 6). Thiswas demonstrated directly by the use of KO mice for theSlc7A2 gene. For CAT1, we were unable to eliminate thefunction activity. Although the KO of CAT1 exists, micedie just after they are born [31]. Moreover, in fibroblastsderived from these KO mice, CAT3 is expressed andreplaces the activity of CAT1 [32]. There are no specificinhibitors or antibodies against CAT1 available. Finally,we also tried siRNA; however, in our hands the controlsalso inhibited M-CSF-dependent proliferation. Amongthe 12 controls used, we even included RNA that are notpresent in macrophages (i.e., luciferase), but in all casesa decreased proliferation was observed. This may be dueto the induction of IFN-a [33, 34], which is a potent anti-proliferative agent. For these reasons we are unable todirectly demonstrate the role of CAT1 in proliferation,but on the basis of our data, CAT1 is probablyresponsible for arginine entry into the cell duringproliferation: i.e., (a) M-CSF induces y+ activity, and (b)from the three genes that support this activity, Slc7A3 is

Figure 5. Polyamines do not increase macrophage prolifera-tion.Macrophageswere treated for 1 hwith polyamines, beforeincubation with M-CSF for 24 h. Thymidine incorporation wasthen measured. The values shown correspond to the mean �SD of three independent experiments (*p<0.01 in relation to thecontrols).



not expressed inmacrophages, and, in the absence of theSlc7A2 gene, proliferation is not impaired; therefore, theonly gene expressed in these KO macrophages andresponsible for the M-CSF-dependent increase inarginine transport is Slc7A1, whose product is CAT1.Although there is no increase in mRNA after M-CSFstimulation, other mechanisms such as post-transcrip-tional modifications may account for the increased y+

activity. Because we do not have the appropriate tools,i.e., antibodies, we were unable to study these mechan-isms further.

To date, the data on arginine transport in macro-phages are very limited and are related to activation butnot to proliferation. In peritoneal macrophages, thistransport is induced by LPS+IFN-c through the y+

system and particularly by CAT2 [18], while in humanmonocytes IFN-c stimulates this transport through they+L system [35]. In rat alveolar macrophages, anincrease in CAT2 has been described after LPS treatment[36].

Our data support the notion of distinct metabolicpathways in macrophage proliferation and activation.Recently, we reported that the transport systems fornucleosides required for DNA and RNA synthesis inmacrophages differ when cells proliferate or when theybecome activated [37, 38]. Similarly, we found differ-ential voltage-dependent K+ channel responses duringproliferation and activation in macrophages [39],indicating that early responses differ. This observationshows that the arginine transport systems used inmacrophages differ when these cells are activated or

when they proliferate. The regulation of Slc7A2 is alimiting factor for the activation of macrophages, as theproduct of this gene restricts the supply of the substrateto the machinery that triggers classical or alternativeactivation. In contrast, in quiescence or under prolif-erative situations arginine is in excess.

Arginine is required for cell proliferation, as shownhere in non-transformed cells, and in tumor models [40,41]. Accordingly, arginase activity has been reported as alimiting factor for cell proliferation [42, 43]. In ourcellular model, most of the arginine was used in proteinsynthesis, but after 6 h of incubation with M-CSF 10%was converted in polyamines. Given the potential role ofpolyamines in cell-cycle progression [19] and in cancerdevelopment [20, 44], a hypothetical role as limitingfactor for proliferation was considered. However, theaddition of polyamines to the media did not increasemacrophage proliferation. The discrepancies betweenour results and those reported in previous publicationsmay be related to the distinct cell types tested. Also,although polyamines play a crucial role in binding tonucleic acids and proteins, which affects their con-formation and biological activity, [45] perhaps onlysmall intracellular amounts may be required. This wouldexplain why the addition of polyamines did not increaseproliferation. In vivo, the role of polyamines may berelated to the production of collagen or other extra-cellular matrix proteins that are involved in cellulargrowth, development and tissue repair. Furthermore,polyamines modulate the functional activities of macro-phages [46]. For example, spermine inhibits pro-

Figure 6. Arginine uptake and catabolism by activated and proliferative macrophages.



inflammatory cytokine synthesis [47–50] and down-regulates arginine transport and NOS2 expression in ratalveolar macrophages [51].

In conclusion, there is a clear distinction between thearginine transport systems used in macrophage pro-liferation and activation. This finding is of particularinterest because the transporters required for activationmay offer suitable new drug targets for the clinicalmanagement of aberrant macrophage activation inseveral diseases.

Material and methods

Reagents

LPS and recombinant cytokines were purchased from SigmaChemical Co. (St. Louis, MO). IL-4 was obtained from R&Dsystems (Minneapolis, MN). In several experiments, the resultsobtained with commercial LPS were compared with highlypurified LPS from Salmonella abortus equi, kindly donated byDr. C. Galanos (Max Planck Institute, Freiburg, Germany)[52], and no differences were found. All other chemicals wereof the highest purity grade available and were purchased fromSigma. Deionized water that had been further purified with aMillipore Milli-Q system (Bedford, MA) was used.

Cell culture

Bone marrow-derived macrophages were isolated from6-week-old BALB/c mice (Charles River Laboratories, SantaPerpetua de Mogoda, Spain) as previously described [53].Macrophages were cultured in plastic tissue-culture dishes(150 mm) in 40 mL DMEM containing 20% FBS (Sigma) and30% L-cell conditioned media as a source of M-CSF. Penicillinand streptomycin were added. Cells were incubated at 37�C ina humidified 5% CO2 atmosphere. After 7 days of culture,macrophages were obtained as a homogenous population ofadherent cells (>99% Mac-1+). To render cells quiescent, at80% confluence, cells were deprived of L-cell-conditionedmedium for 16–18 h before treatment. Macrophages from KOmice and the corresponding WT controls were isolated underthe same conditions. The Slc7A2 KO has been reported [18].Animal experiments were performed in accordance withinstitutional and government guidelines (University of Barce-lona).

Proliferation assay

Cell proliferation was measured as previously described [11]with minor modifications. Quiescent cells (105) were incu-bated for 24 h in 24-well plates (3424 MARK II; Costar Corp.,Cambridge, MA) in 1 mL medium with the concentrations ofM-CSF indicated. The media was aspirated and replaced with0.5 mL medium containing [3H]thymidine (1 lCi/mL; ICNPharmaceuticals Inc., Costa Mesa, CA). After 4–6 h ofincubation at 37�C, the media was removed and the cellswere fixed in ice-cold 70%methanol. After three washes in ice-cold 10% trichloroacetic acid (TCA), the cells were solubilized

in 1% SDS and 0.3 M NaOH at room temperature. Radio-activity was measured by liquid scintillation using a 1400 Tri-Carb Packard scintillation counter. Each point was performedin triplicate and the results were expressed as the mean � SD.

RT-PCR analysis

Cells were washed twice with cold PBS, and total RNA wasextracted with the acidic guanidinium thiocyanate-phenol-chloroform method, as described [54]. RNA was treated withDNase (Ambion, Austin, TX) to eliminate DNA contamination.For cDNA synthesis, 1 lg RNA and TaqMan reverse transcrip-tion reagents (including Multiscribe reverse transcriptase andrandom hexamers) were used, following the manufacturer'sinstructions (Applied Biosystems, Foster City, CA). The primersused to amplify mouse Slc7A1 were CTTGGACCAGTGCAAAT-GACG and TGATCCTGAGGCATGAGTGCA; for Slc7A2,GTGAAGAGGTTCGGAATCCACA and CGTTAAAGCTGCAGA;and for Slc7A3, GGCTCCCTCTGTGCACTTTCTA and TAG-CAAGGACACGGAACAGGA. Real-time monitoring of PCRamplification of cDNA was done using the TaqMan Universalmaster mix (Applied Biosystems) in an ABI Prism 7700sequence Detection System (Applied Biosystems). Relativequantification of gene expression was performed using b-actin,as described in the TaqMan users manual (GCACCACACCTTC-TACAATGAGCTGT and CTGCTGGAAGTCTAGAGCAACATA).The threshold cycle (CT) was defined as the cycle number atwhich the fluorescence corresponding to the amplified PCRproduct is detected. The PCR arbitrary units of each gene weredefined as the mRNA levels normalized to the b-actinexpression level in each sample. The RT-PCR analysis wascontrolled by sequencing the amplification products. Inaddition, we included a sample without RNA in each reaction.

Transport measurements

Cells were plated in 6-well plates 1–2 days before the transportassay (106 cells/well) and treated as indicated in the figures. Tomeasure L-arginine uptake, cells were washed three times inpreheated (37�C) uptake solution (10 mM HEPES, 5.4 mMKCl, 1.2 mM MgSO4�7 H2O, 2.8 mM CaCl2�2 H2O, 1 mMKH2PO4, and 137 mM NaCl, pH 7.4). They were thenincubated at 37�C with 0.5 mL uptake solution containing50 lM L-[3H]arginine (5 lCi/mL) in the presence or absenceof L-leucine (5 mM) or L-arginine (5 mM) for 1 min. Uptakewas stopped by removing the uptake solution and washingcells with 2 mL ice-cold stop solution (10 mM HEPES, 10 mMTris and 137 mM NaCl, pH 7.4 with 10 mM non-radioactiveL-arginine) three times. After the third wash, cells were lysed in200 lL of 0.1% SDS and 100 mM NaOH and 100 lL was usedto measure the radioactivity associated with the cells. Valuesobtained in the presence of 5 mM L-arginine as competitorwere always below 10% of the total transport and weresubtracted to estimate y+ activity.

Catabolism of L-arginine in macrophages

Macrophages were incubated with a number of cytokines in amicroplate (105 cells/well). After 24 h, cells were washed andincubated for 2 or 6 h at 37�C in 0.1 mL arginine-free DMEM



containing 2% FCS, 0.1 lCi of L-[U-14C]arginine (Amersham,UK). Cells were subsequently lysed by two freeze-thaw cycles.The remaining arginine and synthesis of metabolic productswere evaluated by TLC. To identify the spots, 10 lL of asolution containing 2.5 mg/mL arginine, ornithine andspermine was added to the cell lysates, and 20 lL of thesamples was spotted onto TLC plates (Cromatoplates TLC20 � 20 cm, Silica Gel 60 F254, Merck, Germany) and driedfor 1 h at 42�C. Plates were developed in the solvent systemchloroform/methanol/ammonium hydroxide/water(0.5:4.5:2.0/:1.0) and dried. Spots were developed withninhydrin (Spray Solution, Merck) by heating at 120�C for5 min and scraped into scintillation tubes containing 6 mLEcoscintATM (National Diagnostics, GA). Radioactivity wasdetermined by scintillation counting (Beckman Instruments)and the values for each compound were expressed aspercentage of the total radioactivity measured in triplicatecultures � SD.

In several experiments, macrophages were plated in 6-wellplates (106 cells/well) and incubated for 24 h in mediacontaining M-CSF, IL-4+IL-10, or IFN-c +LPS. After removalof incubation media, cells were washed twice with PBS andL-[14C]arginine in PBS (0.5 lCi/well; 300 mCi/mmol ofspecific activity, 200 lL/well final volume) was added to thewells. Loading of L-[14C]arginine was allowed to proceed for30 min. Cells were then washed three times with PBS and thecorresponding media were freshly replaced for the next 6 h.After this incubation, media were harvested into tubes andcells were lysed with 0.06% Triton X-100, 0.06% SDS, 0.03%sodium deoxycholate and 0.03% BSA in PBS containingprotease inhibitors (PMSF, leupeptin and pepstatin). Mediaand lysates were cleared of debris by a brief centrifugation andthe resulting starting materials were counted to assess the totalradioactivity loaded in each condition. Aliquots were used forTCA precipitation by adding FCS (2% final concentration) andTCA (20% final concentration). Next, mixing tubes werecentrifuged at 12 000 l g for 10 min at 4�C, and the super-natants were collected for radioactivity counting. Radioactivityin the pellets was estimated by subtracting the supernatantcount from the total count in the sample prior to precipitation.

Nitrite production and arginase activity

NO was measured as nitrite using the Griess reagent [55].Culture supernatant was mixed with 100 lL 1% sulfanilamide,0.1% N-(1-naphthyl)ethylenediamine dihydrochloride, and2.5 % H3PO4. Absorbance was measured at 540 nm in amicroplate reader (Molecular Devices, Ismaning, Germany).Arginase activity was measured in cell lysates, as previouslydescribed [55] but with slight modifications. Briefly, cells werelysed with 100 lL 0.1% Triton X-100. After 30 min on a shaker,100 lL 25 mM Tris-HCl was added. To 100 lL of this lysate,10 lL 10 mMMnCl2 was added, and the enzyme was activatedby heating for 10 min at 56�C. Arginine hydrolysis wasconducted by incubating the lysate with 100 lL 0.5 ML-arginine (pH 9.7) at 37�C for 15–120 min. The reactionwas stopped with 900 lL 96% H2SO4/85% H3PO4/H2O2

(1:3:7). The urea concentration was measured at 540 nm afteraddition of 40 mL a-isonitrosopropiophenone (dissolved in100% ethanol) followed by heating at 95�C for 30 min. One

unit of enzyme activity was defined as the amount of enzymethat catalyzes the formation of 1 lmol urea/min.

Apoptosis assay

Cell viability in culture conditions was assessed by particlecounting using FACS (Coulter Multisizer II, Midland, Canada)and confirmed by trypan blue exclusion. Cell death was alsoassessed by FACS analysis using the rAnnex V-FITC kit (BenderMedSystems, Burlingame, CA), following the manufacturer'sinstructions. Each point was performed in triplicate and theresults were expressed as the mean � SD.

Statistical analysis

To calculate the statistical differences between the control andtreated samples, we used the Student's paired t-test. Values ofp< 0.05 or lower were considered significant.

Acknowledgements: This work was supported bygrants from the Ministerio de Ciencia y Tecnolog�aBFU2004–05725/BMC to A.C. and SAF03–08940-C02–01to M.P., and by the European Commission GrantEUGINDAT LSHM-CT-2003–502852 (to M. P.). C.S andJ.B. are researchers from the Programa Ram�n y Cajal ofthe Spanish Ministry of Science and Technology. L.M.and L.A. are recipients of fellowships from the Comissi�Interdepartamental de Recerca i Innovaci� Tecnol�gica (CIRIT;Generalitat de Catalunya). A.Y. is recipient of a fellowshipfrom the Ministerio de Asuntos Exteriores, Madrid. Wethank Tanya Yates for editing the manuscript.

References

1 Xaus, J., Comalada, M., Valledor, A. F., Cardo, M., Herrero, C., Soler, C.,Lloberas, J. and Celada, A.,Molecular mechanisms involved inmacrophagesurvival, proliferation, activation or apoptosis. Immunobiology 2001. 204:543–550.

2 VanFurth, R., Production and migration of monocytes and kinetics ofmacrophages.In Van Furth, R. (Ed.) Production and migration of monocytesand kinetics of macrophages.Kluver, Dordrecht 1992, pp 3–12.

3 Gordon, S., Alternative activation of macrophages. Nat. Rev. Immunol.2003. 3: 23–35.

4 Celada, A. and Nathan, C., Macrophage activation revisited. Immunol.Today 1994. 15: 100–102.

5 Xaus, J., Cardo, M., Valledor, A. F., Soler, C., Lloberas, J. and Celada, A.,Interferon gamma induces the expression of p21waf-1 and arrestsmacrophage cell cycle, preventing induction of apoptosis. Immunity 1999.11: 103–113.

6 Verrey, F., Closs, E. I.,Wagner, C. A., Palacin, M., Endou, H. and Kanai, Y.,CATs and HATs: the SLC7 family of amino acid transporters. Pflugers Arch.2004. 447: 532–542.

7 Boehm, U., Klamp, T., Groot, M. and Howard, J. C., Cellular responses tointerferon-gamma. Annu. Rev. Immunol. 1997. 15: 749–795.

8 Chillaron, J., Estevez, R., Samarzija, I., Waldegger, S., Testar, X., Lang,F., Zorzano, A. et al., An intracellular trafficking defect in type I cystinuriarBAT mutants M467T and M467 K. J. Biol. Chem. 1997. 272: 9543–9549.

9 Torrents, D., Estevez, R., Pineda, M., Fernandez, E., Lloberas, J., Shi, Y.B., Zorzano, A. and Palacin, M., Identification and characterization of amembrane protein (y+L amino acid transporter-1) that associates with



4F2hc to encode the amino acid transport activity y+L. A candidate gene forlysinuric protein intolerance. J. Biol. Chem. 1998. 273: 32437–32445.

10 Torrents, D., Mykkanen, J., Pineda, M., Feliubadalo, L., Estevez, R., deCid, R., Sanjurjo, P. et al., Identification of SLC7A7, encoding y+LAT-1, asthe lysinuric protein intolerance gene. Nat. Genet. 1999. 21: 293–296.

11 Celada, A., Borras, F. E., Soler, C., Lloberas, J., Klemsz, M., van Beveren,C., McKercher, S. and Maki, R. A., The transcription factor PU.1 is involvedin macrophage proliferation. J. Exp. Med. 1996. 184: 61–69.

12 Mantovani, A., Sozzani, S., Locati, M., Allavena, P. and Sica, A.,Macrophage polarization: tumor-associated macrophages as a paradigm forpolarized M2 mononuclear phagocytes. Trends Immunol. 2002. 23:549–555.

13 Kim, J. W., Closs, E. I., Albritton, L. M. and Cunningham, J. M., Transportof cationic amino acids by the mouse ecotropic retrovirus receptor. Nature1991. 352: 725–728.

14 Wang, H., Kavanaugh, M. P., North, R. A. and Kabat, D., Cell-surfacereceptor for ecotropic murine retroviruses is a basic amino-acid transporter.Nature 1991. 352: 729–731.

15 MacLeod, C. L., Regulation of cationic amino acid transporter (CAT) geneexpression. Biochem. Soc. Trans. 1996. 24: 846–852.

16 Closs, E. I., Lyons, C. R., Kelly, C. and Cunningham, J. M., Characteriza-tion of the third member of the MCAT family of cationic amino acidtransporters. Identification of a domain that determines the transportproperties of the MCAT proteins. J. Biol. Chem. 1993. 268: 20796–20800.

17 Ito, K. and Groudine, M., A new member of the cationic amino acidtransporter family is preferentially expressed in adult mouse brain. J. Biol.Chem. 1997. 272: 26780–26786.

18 Nicholson, B., Manner, C. K., Kleeman, J. and MacLeod, C. L., Sustainednitric oxide production in macrophages requires the arginine transporterCAT2. J. Biol. Chem. 2001. 276: 15881–15885.

19 Oredsson, S. M., Polyamine dependence of normal cell-cycle progression.Biochem. Soc. Trans. 2003. 31: 366–370.

20 Bachrach, U., Polyamines and cancer: minireview article. Amino Acids 2004.26: 307–309.

21 Schipper, R. G., Penning, L. C. and Verhofstad, A. A., Involvement ofpolyamines in apoptosis. Facts and controversies: effectors or protectors?Semin. Cancer Biol. 2000. 10: 55–68.

22 Valledor, A. F., Comalada, M., Xaus, J. and Celada, A., The differentialtime-course of extracellular-regulated kinase activity correlates with themacrophage response toward proliferation or activation. J. Biol. Chem.2000. 275: 7403–7409.

23 Bansal, V. andOchoa, J. B., Arginine availability, arginase, and the immuneresponse. Curr. Opin. Clin. Nutr. Metab. Care 2003. 6: 223–228.

24 Kung, J. T., Brooks, S. B., Jakway, J. P., Leonard, L. L. and Talmage, D.W., Suppression of in vitro cytotoxic response by macrophages due toinduced arginase. J. Exp. Med. 1977. 146: 665–672.

25 Rodriguez, P. C., Zea, A. H., DeSalvo, J., Culotta, K. S., Zabaleta, J.,Quiceno, D. G., Ochoa, J. B. and Ochoa, A. C., l-Arginine consumption bymacrophages modulates the expression of CD3 zeta chain in T lymphocytes.J. Immunol. 2003. 171: 1232–1239.

26 Rodriguez, P. C., Quiceno, D. G., Zabaleta, J., Ortiz, B., Zea, A. H.,Piazuelo, M. B., Delgado, A. et al., Arginase I production in the tumormicroenvironment by mature myeloid cells inhibits T-cell receptorexpression and antigen-specific T-cell responses. Cancer Res. 2004. 64:5839–5849.

27 Zea, A. H., Rodriguez, P. C., Atkins, M. B., Hernandez, C., Signoretti, S.,Zabaleta, J., McDermott, D. et al., Arginase-producing myeloid suppressorcells in renal cell carcinoma patients: a mechanism of tumor evasion. CancerRes. 2005. 65: 3044–3048.

28 Hesse, M., Modolell, M., La Flamme, A. C., Schito, M., Fuentes, J. M.,Cheever, A. W., Pearce, E. J. and Wynn, T. A., Differential regulation ofnitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo:granulomatous pathology is shaped by the pattern of l-arginine metabolism.J. Immunol. 2001. 167: 6533–6544.

29 Kropf, P., Fuentes, J. M., Fahnrich, E., Arpa, L., Herath, S., Weber, V.,Soler, G. et al., Arginase and polyamine synthesis are key factors in the

regulation of experimental leishmaniasis in vivo. FASEB J. 2005. 19:1000–1002.

30 Peteroy-Kelly, M. A., Venketaraman, V., Talaue, M., Seth, A. and Connell,N. D., Modulation of J774.1 macrophage l-arginine metabolism byintracellularMycobacterium bovis BCG. Infect. Immun. 2003. 71: 1011–1015.

31 Perkins, C. P., Mar, V., Shutter, J. R., del Castillo, J., Danilenko, D. M.,Medlock, E. S., Ponting, I. L. et al., Anemia and perinatal death result fromloss of themurine ecotropic retrovirus receptormCAT-1.Genes Dev.1997.11:914–925.

32 Nicholson, B., Sawamura, T., Masaki, T. and MacLeod, C. L., IncreasedCat3-mediated cationic amino acid transport functionally compensates inCat1 knockout cell lines. J. Biol. Chem. 1998. 273: 14663–14666.

33 Scacheri, P. C., Rozenblatt-Rosen, O., Caplen, N. J., Wolfsberg, T. G.,Umayam, L., Lee, J. C., Hughes, C. M. et al., Short interfering RNAs caninduce unexpected and divergent changes in the levels of untargetedproteins in mammalian cells. Proc. Natl. Acad. Sci. USA 2004. 101:1892–1897.

34 Sledz, C. A., Holko, M., de Veer, M. J., Silverman, R. H. and Williams, B.R., Activation of the interferon system by short-interfering RNAs. Nat. CellBiol. 2003. 5: 834–839.

35 Rotoli, B. M., Bussolati, O., Sala, R., Barilli, A., Talarico, E., Gazzola, G.C. and Dall'Asta, V., IFNgamma stimulates arginine transport throughsystem y+L in human monocytes. FEBS Lett. 2004. 571: 177–181.

36 Messeri Dreissig, M. D., Hammermann, R., Mossner, J., Gothert, M. andRacke, K., In rat alveolar macrophages lipopolysaccharides exert divergenteffects on the transport of the cationic amino acids l-arginine and l-ornithine. Naunyn Schmiedebergs Arch. Pharmacol. 2000. 361: 621–628.

37 Soler, C., Garcia-Manteiga, J., Valdes, R., Xaus, J., Comalada, M.,Casado, F. J., Pastor-Anglada, M. et al., Macrophages require differentnucleoside transport systems for proliferation and activation. FASEB J. 2001.15: 1979–1988.

38 Soler, C., Valdes, R., Garcia-Manteiga, J., Xaus, J., Comalada, M.,Casado, F. J., Modolell, M. et al., Lipopolysaccharide-induced apoptosis ofmacrophages determines the up-regulation of concentrative nucleosidetransporters Cnt1 and Cnt2 through tumor necrosis factor-alpha-dependentand -independent mechanisms. J. Biol. Chem. 2001. 276: 30043–30049.

39 Vicente, R., Escalada, A., Coma, M., Fuster, G., Sanchez-Tillo, E., Lopez-Iglesias, C., Soler, C. et al., Differential voltage-dependent K+ channelresponses during proliferation and activation in macrophages. J. Biol. Chem.2003. 278: 46307–46320.

40 Philip, R., Campbell, E. andWheatley, D. N., Arginine deprivation, growthinhibition and tumour cell death: 2. Enzymatic degradation of arginine innormal and malignant cell cultures. Br. J. Cancer 2003. 88: 613–623.

41 Caso, G., McNurlan, M. A., McMillan, N. D., Eremin, O. and Garlick, P. J.,Tumour cell growth in culture: dependence on arginine. Clin. Sci. (Lond)2004. 107: 371–379.

42 Li, H., Meininger, C. J., Kelly, K. A., Hawker, J. R., Jr., Morris, S. M., Jr.and Wu, G., Activities of arginase I and II are limiting for endothelial cellproliferation. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002. 282:R64–69.

43 Wheatley, D. N., Philip, R. and Campbell, E., Arginine deprivation andtumour cell death: arginase and its inhibition.Mol. Cell. Biochem. 2003. 244:177–185.

44 Gerner, E. W. and Meyskens, F. L., Jr., Polyamines and cancer: oldmolecules, new understanding. Nat. Rev. Cancer 2004. 4: 781–792.

45 Pignatti, C., Tantini, B., Stefanelli, C. and Flamigni, F., Signal transductionpathways linking polyamines to apoptosis. Amino Acids 2004. 27: 359–365.

46 Zhang, M., Wang, H. and Tracey, K. J., Regulation of macrophageactivation and inflammation by spermine: a new chapter in an old story. Crit.Care Med. 2000. 28: N60–66.

47 Zhang, M., Caragine, T., Wang, H., Cohen, P. S., Botchkina, G., Soda, K.,Bianchi, M. et al., Spermine inhibits proinflammatory cytokine synthesis inhuman mononuclear cells: a counterregulatory mechanism that restrainsthe immune response. J. Exp. Med. 1997. 185: 1759–1768.

48 Hasko, G., Kuhel, D. G., Marton, A., Nemeth, Z. H., Deitch, E. A. andSzabo, C., Spermine differentially regulates the production of interleukin-



12 p40 and interleukin-10 and suppresses the release of the T helper 1cytokine interferon-gamma. Shock 2000. 14: 144–149.

49 Kaczmarek, L., Kaminska, B., Messina, L., Spampinato, G., Arcidiacono,A., Malaguarnera, L. andMessina, A., Inhibitors of polyamine biosynthesisblock tumor necrosis factor-induced activation of macrophages. Cancer Res.1992. 52: 1891–1894.

50 Perez-Cano, F. J., Franch, A., Castellote, C. and Castell, M., Immuno-modulatory action of spermine and spermidine on NR8383 macrophage linein various culture conditions. Cell. Immunol. 2003. 226: 86–94.

51 Mossner, J., Hammermann, R. and Racke, K., Concomitant down-regulation of l-arginine transport and nitric oxide (NO) synthesis in ratalveolar macrophages by the polyamine spermine. Pulm. Pharmacol. Ther.2001. 14: 297–305.

52 Merlin, T., Sing, A., Nielsen, P. J., Galanos, C. and Freudenberg, M. A.,Inherited IL-12 unresponsiveness contributes to the high LPS resistance ofthe Lps(d) C57BL/10ScCr mouse. J. Immunol. 2001. 166: 566–573.

53 Celada, A., Gray, P. W., Rinderknecht, E. and Schreiber, R. D., Evidencefor a gamma-interferon receptor that regulates macrophage tumoricidalactivity. J. Exp. Med. 1984. 160: 55–74.

54 Marques, L., Brucet, M., Lloberas, J. and Celada, A., STAT1 regulateslipopolysaccharide- and TNF-alpha-dependent expression of transporterassociated with antigen processing 1 and low molecular mass polypeptide 2genes in macrophages by distinct mechanisms. J. Immunol. 2004. 173:1103–1110.

55 Munder, M., Eichmann, K., Moran, J. M., Centeno, F., Soler, G. andModolell, M., Th1/Th2-regulated expression of arginase isoforms in murinemacrophages and dendritic cells. J. Immunol. 1999. 163: 3771–3777.



Documents

Macrophages require distinct arginine catabolism and transport systems for proliferation and for activation