Embed Size (px)
Citation preview
1
IFN-α-induced miR-122 inhibition negatively affects the anti-HBV 1
efficiency of IFN-α 2
3
Junli Haoa, Wensong Jina, Xinghui Lia, Saifeng Wanga, Xiaojun Zhanga , Hongxia 4
Fana, Changfei Lia, Lizhao Chena, Bin Gaoa, Guangze Liu b*, Songdong Menga* 5
6
a CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of 7
Microbiology, Chinese Academy of Sciences (CAS), Beijing, 100101. 8
b Transgenic Engineering Research Laboratory, Infectious Disease Center, 458th 9
Hospital, Guangzhou, China. 10
11
*Corresponding authors. Tel: +86-10-64807350; Fax: +86-10-64807381. 12
E-mail address: [email protected] (G. Liu); [email protected] (S. Meng); 13
14
Running title: miR-122 sponge limits anti-HBV effect of IFN-α 15
16
ABSTRACT 17
Interferon (IFN)-α based therapy can effectively treat chronic hepatitis B virus 18
(HBV) infection which causes life-threatening complications. Responses to IFN-α 19
therapy vary greatly in chronic hepatitis B (CHB) patients but underlying mechanisms 20
are almost unknown. In this study, we found that IFN-α treatment induced marked 21
decrease of miR-122 expression in hepatocytes. We next showed that IFN-α-induced 22
miR-122 down-regulation was only partly due to transcriptional suppression. One 23
IFN-stimulated gene (ISG) NT5C3 which was identified as a miR-122 target, 24
efficiently inhibited miR-122 by binding and sequestering miR-122 with its mRNA 25
3’-UTR, indicating that ISG is involved in IFN-α-mediated miR-122 suppression. 26
Notably, the inhibitory effect of IFN-α on miR-122 was completely abolished by 27
blocking IFN-α-induced up-regulation of NT5C3 mRNA expression by RNAi. 28
Meanwhile, we observed that miR-122 dramatically inhibited HBV expression and 29
replication. Finally, we showed that IFN-α-mediated HBV inhibitory effects could be 30
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.01710-12 JVI Accepts, published online ahead of print on 10 October 2012
2
significantly enhanced when blocking IFN-α-induced down-regulation of miR-122. 31
We therefore conclude that IFN-α-induced inhibition of miR-122 may negatively 32
affect the anti-HBV function of IFN-α. These data provide valuable insight for better 33
understanding of the anti-viral mechanism of IFN-α and raise further potential interest 34
in enhancing its anti-HBV efficacy. 35
36
Around 400 million people worldwide are infected with hepatitis B virus (HBV). 37
Chronic hepatitis B (CHB), which is triggered by HBV infection, poses a huge health 38
burden on the global community as it is correlated with a significant increased risk for 39
the development of cirrhosis, liver failure and hepatocellular carcinoma (HCC) (24). 40
Currently the treatment of CHB mainly consists of pegylated interferon (IFN)-α and 41
nucleoside or nucleotide analogs (e.g. lamivudine, adefovir, and entecavir). IFN-α 42
was the first drug licensed to treat HBV infection. As an important first-line treatment 43
option, pegylated IFN-α can effectively treat CHB in 25-40% of patients as 44
monotherapy, and greater sustained virological response (SVR) and hepatitis B e 45
antigen (HBeAg) seroconversion rates in HBeAg-positive patients were observed with 46
addition of nucleos(t)ide analogue therapies (29, 37). In fact, treatment with pegylated 47
IFN results in the highest rate of off-treatment sustained response among currently 48
available drugs (5). Moreover, responses to IFN-based therapy are accompanied by 49
the potential for hepatitis B surface antigen (HBsAg) loss or seroconversion, and early 50
serum HBsAg loss has been recently reported to have predictive values of SVR to 51
IFN in both HBeAg positive and negative CHB patients (23, 35, 47). 52
As a member of type I interferons, IFN-α can initiate activation of Jak/STAT and 53
NF-κB signaling, which induces hundreds of IFN-stimulated genes (ISGs) and may 54
play an important role in IFN-mediated anti-HBV activity. Both in vitro and in vivo 55
studies showed that besides a stimulating effect on cytotoxic T lymphocytes and 56
natural killer cell function, IFN-based therapy (IFN-α-2b and pegylated IFN-α-2a or 57
-2b) also has a direct anti-viral effect by preventing the formation or accelerating 58
decay of viral capsids, and/or inducing anti-viral ISGs that inhibit HBV expression 59
and replication (50, 21, 30, 44, 43, 51). Inhibition of IFN-α signaling by HBV has 60
3
been suggested to antagonize the IFN response (20). Nevertheless, these studies also 61
strongly suggest that there is in principle significant potential to modulate the 62
effectiveness of IFN-mediated anti-HBV activities. Moreover, the anti-viral activity of 63
ISGs remains elusive and still awaits further investigation (39). Responses to IFN-α 64
therapy vary greatly in CHB patients but underlying mechanisms are almost unknown 65
(23, 35, 5). Notably, IFNα/β was recently found to suppress HBV replication when 66
viral load is high whereas enhance HBV replication when viral load is low in HBV 67
transgenic mice, indicating its dual function for HBV (38). Taken together, the precise 68
mechanism of action of IFN-α has not been fully understood. 69
MicroRNAs (miRNAs) are a class of small RNAs of approximately 22 70
nucleotides in length, which interact with complementary target sites usually in the 71
3'-untranslated region (UTR) of target mRNAs and induce their translational 72
repression, deadenylation and degradation. MicroRNA-122 (miR-122), a mammalian 73
liver-specific microRNA, is highly expressed in the liver, which constitutes 70% of 74
the total miRNA population. There is growing literature on biological functions of 75
miR-122 in the control of hepatocyte growth and neoplastic transformation (10, 49, 4, 76
46), regulation of lipid metabolism (22), liver development (45) and modulation of 77
HBV and hepatitis C virus (HCV) replication (17, 19, 25, 28, 8). 78
Previous studies showed that IFN-β treatment leads to a significant decrease in the 79
expression of miR-122 both in vitro and in vivo (27, 31), but its regulatory 80
mechanisms are totally unknown. In addition, our recent study showed that miR-122 81
inhibits HBV replication and transcription through cyclin G1-modulated P53 activity 82
(42). Given the importance of IFN-α-based therapy against HBV and the essential 83
roles of miR-122 in hepatic function, it is worthwhile to assess the regulation of 84
miR-122 in response to IFN-α and its impact on HBV replication. We identified at 85
least one IFN-α induced ISG as a miR-122 target gene, which may act as a sponge to 86
bind and sequester endogenous miR-122. The results could shed light on the 87
mechanism of action of IFN-α on HBV replication. 88
89
Materials and methods 90
4
Reagents and antibodies. The chemically synthesized miR-122 inhibitor and 91
non-specific control, the miR-122 mimic and non-specific control were purchased 92
from RiboBio Co., Ltd. (Guangzhou, China). The sequence of miR-122 mimic was 93
obtained from the miRBase Database (http://www.mirbase.org) 5’-3’: UGGAGUGU 94
GACAAUGGUGUUUG and the sequence of miR-122 inhibitor is completely 95
complementary to miR-122. The siRNAs of NT5C3 and p53 were synthesized from 96
RiboBio Co., Ltd. (Guangzhou, China). The sense and antisense NT5C3 siRNA were 97
5’-3’: CCAACAUGUCAUAAUAUCAdTdT (sense), 5’-3’: UGAUAUUAUGACAU 98
GUUGGdTdT (antisense), and the sense and antisense p53 siRNA were 5’-3’: 99
GACUCCAGUGGUAAUCUACdTdT (sense), 5’-3’: GUAGAUUACCACUGGAGU 100
CdTdT (antisense). The following reagents and antibodies were obtained as indicated: 101
IFN-α (Recombinant Human Interferon α-2b injection, Anke Biotechnology, Anhui, 102
China); Deoxyribonuelease�(D8071-25, Solarbio Science & technology Co., Ltd, 103
Beijing, China); Proteinase K (D9033, Takara BioInc., Shiga, Japan); DNase I 104
(RNase-free) (Invitrogen); SuperscriptTM RT reagent kit (DRR037A, Takara BioInc., 105
Shiga, Japan); the rabbit anti-human cyclin G1 (clone F-5, Santa Cruz Biotechnology); 106
the mouse anti-p53 monoclonal antibody (clone 1C12, Cell Signaling Technology); 107
the mouse anti-human actin and the horseradish peroxidase-conjugated secondary 108
antibodies (Zhongshan Goldenbridge Biotechnology, China); and the ECL-Plus 109
chemiluminescence system (Applygen Technologies, Beijing, China). 110
Cell culture and constructs. Two human hepatoma cell lines (Huh-7 and HepG2) 111
were obtained from the ATCC (Manassas, VA, USA). For transfection studies, Huh-7 112
and HepG2 cells were washed twice with Opti-MEM (Invitrogen), and miR-122 113
inhibitor or mimic was transfected using Lipofectamine 2000 (Invitrogen). HBV 114
replication plasmid pHBV, containing 1.3 copies of the HBV genome (D genotype) 115
(36), was maintained in the lab. HBV-luciferase plasmid (pHBV-Luc), a HBV 116
expressing construct containing a luciferase ORF under the HBV enhancers and core 117
promoter, is a gift kindly provided by Dr. Yosef Shaul (The Weizmann Institute of 118
Science, Israel) (34). The construct pGL-122 with a luciferase reporter gene under 119
miR-122 promoter was provided by Dr. Shi-Mei Zhuang (Sun Yat-sen University, 120
5
China) (49). 121
Southern blot and Northern blot analysis. Core-particle related HBV DNA was 122
isolated as described (26). The HBV DNA was analyzed by Southern blot 123
hybridization using AP-labeled HBV DNA as the probe (42). For miRNA Northern 124
blot, the probes were labeled at their 5′-end using polynucleotide kinase (New 125
England Biolabs) and [γ-32P]ATP. The probe sequence of miR-122 was completely 126
complementary to miR-122 (5’-3’: CAAACACCATTGTCACACTCCA), and the 127
sequence of the U6 snRNA probe was 5’-3’: GCAGGGGCCATGCTAATCTTCTCTG 128
TATCG. Total RNA was isolated using the Trizol Reagent (Invitrogen, USA). 30μg of 129
total RNA for each lane was denatured and separated on 17% polyacrylamide gels, 130
transferred to Hybond-N Plus membrane (GE Healthcare) by semi-dry blotting, and 131
hybridized with the labeled probes overnight. Blots were washed and the 32P blot was 132
exposed to film. 133
Immunoblot analysis. An equal amount of protein from each cell lysate was 134
separated in a 15% SDS–polyacrylamide gel and probed with an anti-p53 or 135
anti-cyclinG1 and an anti-human actin antibody. The bound antibodies were 136
visualized using an ECL detection kit with appropriate HRP-conjugated secondary 137
antibodies (Santa Cruz Biotech.). 138
Luciferase Reporter Assays. Dual luciferase reporter assays were performed 139
following the manufacturer’s protocol (Promega). The 3’-UTR of NT5C3 was cloned 140
into downstream of the firefly luciferase gene in the pGL3 plasmid. Huh-7 cells were 141
transfected with a firefly luciferase reporter plasmid carrying either the wild-type 142
(NT5C3-wt) or mutant (NT5C3-mut) 3’-UTR of NT5C3. At 48 hr post-transfection, 143
firefly luciferase and Renilla luciferase activities were measured, and the luciferase 144
activity was normalized to Renilla luciferase. 145
RNA, DNA extraction and real-time PCR. Total RNA was extracted from treated 146
cells using the Trizol Reagent (Invitrogen). RNA extracts were treated with 147
RNase-free DNAse I (Invitrogen), as recommended by the manufacturer. 500 ng of 148
cellular RNA was reverse transcribed with 0.5μl each of oligo dT and Random 6 mers 149
primers by using the SuperscriptTM RT reagent kit (Takara), and samples processed 150
6
without reverse transcriptase were used as negative controls to examine residual DNA 151
contamination (40). Specific primers used to detect HBV pgRNA and total mRNAs 152
by real time PCR were as follows: pgRNA: forward primer, 5’-TCTTGCCTTACTTT 153
TGGAAG-3’, reverse primer, 5’-AGTTCTTCTTCTAGGGGACC-3’, and total 154
mRNAs designed on HBx region: forward primer, 5′-ACGTCCTTTGTTTACGTCCC 155
GT-3′, reverse primer, 5′-CCCAACTCCTCCCAGTCCTTAA-3′ (1). GAPDH was 156
used as an internal standard for the quantification of the PCR. The primers used to 157
detect NT5C3 and GAPDH have been described previously (33, 48). 158
Cells were washed three times with PBS to remove the input plasmid DNA after 159
pHBV transfection. After 24 or 48 hr culture, the cell supernatants were harvested and 160
digested with 100 UI/ml DNAaseⅠat 37°C for at least 3 hours to remove the input 161
plasmid. The supernatants were then digested with 1% sodium dodecyl sulfate, 0.5 162
mg/ml proteinase K at 55°C for 2 hours to release viral DNA in the capsids. Viral 163
DNA copy numbers were detected by real time PCR. The primes designed on HBx 164
region were as follows: forward primer 5′-ACGTCCTTTGTTTACGTCCCGT-3′ (nt 165
1414-1435), reverse primer 5′-CCCAACTCCTCCCAGTCCTTAA-3′ (nt 1744-1723) 166
(1, 41). The supernatants without proteinase digestion were used as the negative 167
control. No HBV DNA in the control supernatants were detected by real-time PCR, 168
indicating that the input plasmid was totally removed. 169
Real-time fluorescence quantitative PCR was performed using the SYBR Green 170
Premix Reagent (Takara BioInc., Shiga, Japan). 2 μL of cDNA or DNA was used as 171
input template for each real-time PCR assay. Each experiment was performed in 172
triplicate. PCR cycling conditions were two steps as follows: 30 s at 95°C, followed 173
by 40 cycles of 95°C for 15 s and 60°C for 45 s. Melt-curve analysis was used to 174
estimate the specificity of primers. 175
Preparation of standard HBV DNA. PCR product for HBx (nt 1374-1838) was 176
cloned into pcDNA3.1 (Invitrogen). The plasmid was quantified using a NanoDrop at 177
OD 260 nm (1). For a standardized evaluation, the number of HBV DNA copies/ml in 178
the cell supernatant was calculated from a standard curve with 10-fold series dilution 179
7
of the plasmid pcDNA3.1-HBx ranging from 103 to 109 HBV copies/ml. 180
TaqMan miRNA analysis. Real-time PCR analysis for miR-122 was performed 181
using the TaqMan miRNA analysis Kit (Applied Biosystems, Foster City, CA, USA). 182
A U6 endogenous control was used for normalization. Pri-miR-122 was detected 183
using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and 184
TaqMan pri-miRNA Assay. Actin was used as an internal standard gene. 185
Detection of HBsAg and HBeAg by enzymed-linked immunosorbent assay 186
(ELISA). ELISA tests for detection of HBsAg and HBeAg were performed as 187
described previously (28). 188
Statistical analysis. Each experiment was performed in triplicate, and all 189
experiments were repeated at least two times. The results are presented as the means ± 190
standard deviation. Student’s t-test was used for comparison between groups. A p 191
value <0.05 was considered a significant difference. 192
193
Results 194
IFN-α induces down-regulation of miR-122 and suppresses HBV replication. 195
In this study, Huh-7 cells were selected for testing whether miR-122 was subject to 196
regulation by IFN-α because this is the only human hepatoma cell line with 197
constitutive expression of miR-122. We first analyzed miR-122 expression in 198
response to IFN-α in Huh-7 cells by real-time PCR. As shown in Fig.1A, 199
down-regulation of miR-122 followed a dose-response curve between 1 and 1000 200
U/ml of IFN-α at 4 hr after treatment. Treatment with 1000 U/ml of IFN-α caused 201
about 60% reduction of miR-122. Time course analysis showed a decrease of 202
miR-122 levels with maximum between 4 and 8 hr, which almost reached to normal 203
level at 48 hr (Fig. 1B). To determine if the restoration of miR-122 level was due to 204
IFN-α degradation, we added 1000 U/ml of IFN-α to the cell culture for every 12 hr. 205
As seen in Fig. 1C and D, persistent decreases of miR-122 were observed by real time 206
PCR and Northern blot assays. In the mean time, Huh-7 cells transfected with the 207
HBV replication plasmid pHBV were treated with 1000 U/ml of IFN-α. Significant 208
decreases of HBsAg and HBeAg expression were detected in Huh-7 cells at 24, 48 209
8
and 72 hr after treatment with IFN-α (Fig. 1E), and significant reduction of 210
HBV-DNA levels in the cell supernatant was observed at all time points (Fig. 1F). We 211
further quantified HBV replication by Southern blot analysis (Fig. 1G). Significant 212
reductions in HBV replicative intermediates were observed in IFN-α-treated cells. 213
Consistently, treatment with IFN-α significantly decreased HBV pgRNA and total 214
mRNA transcripts (Fig. 1H), suggesting that IFN-α affects HBV replication at least 215
partly at the transcriptional level. 216
IFN-α-induced ISG with a complementary binding site to miR-122 sequesters 217
endogenous miR-122. Next, we explored the mechanism of IFN-α-induced miR-122 218
down-regulation. To evaluate the role of IFN-α in regulation of miR-122 transcription, 219
we performed a luciferase reporter assay using the construct pGL-122 with a 220
luciferase reporter gene under miR-122 promoter (49). IFN-α caused moderate 221
reductions (about 20-30%) in the promoter activity at 12 and 24 hr after treatment 222
(Fig. 2A). As can be seen in Fig. 1B, maximum decrease of miR-122 level occurred 223
around 4 hr post-treatment, whereas there was no significant change in miR-122 224
transcriptional activity at this time period, indicating that IFN-α affects miR-122 level 225
not mainly through transcriptional modulation. Real-time PCR assay also revealed no 226
obvious change in miR-122 primary transcript (pri-miR-122) levels between 4 and 8 227
hr after IFN-α treatment (Fig. 2B), validating that IFN-α does not influence miR-122 228
transcription. 229
Considering the quick decrease of miR-122 and hundreds of induced ISGs by 230
IFN-α treatment, we hypothesized that IFN-α-induced mRNAs which harbor miR-122 231
complementary binding sites may sequester and deplete endogenous miR-122. To 232
search for the potential “sponge” mRNAs to miR-122, we focused primarily on the 233
verified genes which are significantly induced by IFN-α (12). Among 107 genes 234
identified as significantly upregulated at 6 hr after IFN-α treatment, the 3’-UTRs of 235
cytoplasmic 5'-nucleotidase-III (NT5C3) and Interleukin-1 receptor antagonist 236
(IL-1RN) were identified as predicted targets of miR-122 by TargetScan 237
(http://www.targetscan.org). We focused on NT5C3 because transfection with its 238
3’-UTR in Huh-7 cells led to more decreased miR-122 levels compared with IL-1RN 239
9
3’-UTR. A putative miR-122 complementary region in the NT5C3 sequence (position 240
183-189 of NT5C3 3’-UTR) is listed in Fig. 3A. Obviously, miR-122 reduced the 241
activity of firefly luciferase with the wild-type but not mutant 3’-UTR of NT5C3. As 242
shown in Fig. 3B, compared with the mutant 3’-UTR, ectopic overexpression of the 243
wild-type 3’-UTR of NT5C3 by transfection with pGL-NT5C3wt vector in Huh-7 244
cells led to decreased miR-122 levels by 82% and 43% respectively at 24 and 48 hr 245
post-transfection by real-time PCR analysis (both P<0.01). Decrease of miR-122 was 246
confirmed by Northern blot (Fig. 3C). In addition, inhibition of miR-122 by the 247
3’-UTR of NT5C3 was further confirmed by Western blot analysis of expression of a 248
verified miR-122 target cyclin G1 (11). Transfection of miR-122 mimic led to a 249
decreased expression of cyclin G1, whereas the depletion of endogenous miR-122 by 250
its inhibitor resulted in an increase of cyclin G1 (Fig. 3D). As can be seen in Fig. 3E, 251
the wild-type but not the mutant 3’-UTR transfected Huh-7 cells showed an increase 252
of cyclin G1 expression, indicating that the 3’-UTR of NT5C3 rescued the expression 253
of the miR-122 target cyclin G1 by inhibition of miR-122. Moreover, time course 254
analysis showed dramatic increase (about 2.5-fold) of NT5C3 mRNA levels with 255
maximum between 4 and 12 hr after treatment with IFN-α (Fig. 3F). As demonstrated 256
in Fig. 1B, decrease of miR-122 levels was synchronized with the increase of NT5C3 257
mRNA levels. 258
To further demonstrate that IFN-α-induced NT5C3 mRNA sequesters endogenous 259
miR-122, Huh-7 cells were treated with NT5C3 siRNA. Significant increase of 260
miR-122 was observed by real-time PCR and Northern blot analyses (Fig. 4A). Next, 261
Huh-7 cells were treated with IFN-α and NT5C3 siRNA, as indicated in Fig. 4B. 262
Analysis of NT5C3 expression by real-time PCR revealed approximately equal 263
amount of mRNA levels between IFN-α plus NT5C3 RNAi treated cells and untreated 264
cells, suggesting that up-regulation of NT5C3 by IFN-α could be attenuated by 265
transfection of NT5C3 siRNA. As expected, IFN-α treatment caused a decrease of 266
miR-122, whereas knock-down of NT5C3 led to an increased miR-122 level. Notably, 267
the inhibitory effect of IFN-α on miR-122 was completely abolished by blocking 268
IFN-α-induced up-regulation of NT5C3 mRNA expression using RNAi (P>0.05). 269
10
Taken together, these results suggest that the rapid decline of miR-122 induced by 270
IFN-α occurs via up-regulation of NT5C3 mRNA expression and the subsequent 271
saturation and depletion of miR-122 by binding to the complementary binding site 272
located in the 3’-UTR of NT5C3. 273
Inhibition of miR-122 by IFN-α can compromise the anti-HBV activity of 274
IFN-α. To investigate the potential effect of IFN-α-induced miR-122 down-regulation 275
on HBV replication, Huh-7 cells were treated with 25 nM of chemically synthesized 276
miR-122 inhibitor or 25 nM miR-152 or miR-642 as negative controls or a 277
randomized oligonucleotide control as mock 24 hr before transfection with pHBV. 278
Compared with mock-treated cells, significant increases of HBsAg and HBeAg 279
expression were detected in Huh-7 cells after treatment with miR-122 inhibitor at 48 280
hr after transfection (both P<0.01) (Fig. 5A). Treatment with miR-122 inhibitor led to 281
an increase of HBV DNA level by about 4-fold (Fig. 5B). We chose to use 25 nM of 282
miR-122 inhibitor for the experiment because this concentration caused about 50-60% 283
reduction of miR-122 (data not shown), which was the similar amount of 284
down-regulation induced by IFN-α (Fig. 1A and B). 285
Conversely, overexpression of miR-122 was performed in HepG2 cells as the cells 286
express very low level of miR-122. HepG2 cells were co-transfected with pHBV 287
together with 50 nM of chemically synthesized miR-122 mimic or 50nM miR-152 or 288
miR-642 as negative controls or a randomized oligonucleotide control as mock. A 289
significant decrease of HBsAg and HBeAg expression was observed 48 hr after 290
miR-122 transfection (both P<0.01) (Fig. 5C). Treatment with miR-122 mimic led to 291
decreases of HBV total mRNA level by about 50% (Fig. 5D), and DNA level by 292
about 64% (Fig. 5E), and a dramatic reduction in HBV replication was observed by 293
Southern blot analysis (Fig. 5F). The results were consistent with the finding in Huh-7 294
cells that miR-122 inhibits HBV replication. 295
The miR-122 level in Huh-7 cells was decreased by about 50-60% under IFN-α 296
treatment, which was similar to the reduction induced by miR-122 inhibitor. The 297
decrease of miR-122 by its inhibitor resulted in significant increase of HBV 298
replication. We therefore conclude that inhibition of miR-122 by IFN-α negatively 299
11
impacts the IFN-α-mediated inhibition of HBV. 300
To rule out the possibility that competition for RISC complexes may interfere with 301
test results, we also used miR-152 and miR-642 as negative controls in the NT5C3 302
luciferase reporter assay (Fig. 3A) and HBV expression and replication assay (Fig. 5), 303
and no obvious differences were observed among the random control oligonucleotides, 304
miR-152 and miR-642, indicating the miR-122-specific effects in these assays. 305
To further demonstrate that IFN-α-mediated regulation of miR-122 through NT5C3 306
plays a negative role in the HBV inhibitory function of IFN-α, Huh-7 cells were 307
transfected with pGL-NT5C3wt vector to mimic IFN-α-induced up-regulation of 308
NT5C3 expression. As seen in Fig. 6A, overexpression of the 3’-UTR of NT5C3 309
resulted in pronounced increase of HBV replication compared with transfection with 310
pGL-NT5C3mut vector carrying mutant 3’-UTR of NT5C3 (P<0.01). Furthermore, 311
pHBV transfected Huh-7 cells were treated with 500 U/ml of IFN-α and 25 nM of 312
miR-122 mimic, as indicated in Fig. 6B. As expected, IFN-α treatment and miR-122 313
mimic caused a significant decrease of HBV replication levels. Notably, the inhibitory 314
effect was greatly enhanced by blocking IFN-α-induced down-regulation of miR-122 315
by mimic transfection (P<0.05 or 0.01). In addition, pHBV-transfected Huh-7 cells 316
were treated with 1000 U/ml of IFN-α and 50 nM of miR-122 inhibitor, as indicated 317
in Fig. 6C. IFN-α treatment caused 31.2% reduction of HBV DNA level in 318
mock-treated Huh-7 cells, while it caused 46.7% reduction of HBV DNA level in 319
miR-122 inhibitor-treated cells, indicating the anti-HBV efficiency of IFN-α could be 320
increased under miR-122 depletion. The data support the notion that down-regulation 321
of miR-122 by IFN-α plays a negative role in the anti-HBV activity of IFN-α. 322
Finally, as our previous study showed that miR-122 inhibits HBV replication 323
through transcription repression by cyclin G1-mediated p53 activity (42), we 324
determined to investigate if the mutant p53 (Tyr220Cys) in Huh-7 cells could target 325
HBV enhancers and regulate viral transcription and replication. Huh-7 was 326
cotransfected with p53-specific siRNA and an HBV-luciferase plasmid (pHBV-Luc), 327
a HBV expressing construct containing a luciferase ORF under the HBV enhancer I/II 328
and core promoter. Transfection of p53 RNAi led to decrease of p53 in both mRNA 329
12
(Fig. 7A) and protein levels (Fig. 7B). Depletion of p53 in Huh-7 cells caused a 330
significant increase in the HBV promoter activity (P<0.01), indicating the mutant p53 331
could regulate HBV transcription. Moreover, p53 RNAi led to increased secretion of 332
HBsAg and HBeAg (Fig. 7D), and a clear increase (more than 1-fold) of viral DNA 333
level in the supernatant (Fig. 7E). The result is consistent to the finding of a previous 334
study showing that the mutant p53 with an increased protein level and prolonged 335
half-life still maintains the transcription activity in Huh-7 cells (13). 336
Together, these data indicate that down-regulation of miR-122 by IFN-α plays a 337
negative role in the anti-HBV activity of IFN-α. 338
339
Discussion 340
IFN-α has been extensively used as one of the major standard treatments for CHB 341
for more than 2 decades. However, its anti-viral activity is limited and the mechanism 342
against HBV awaits further investigation (39, 44, 38, 23, 35). Here, we demonstrated 343
that IFN-α inhibited miR-122 by transcriptional suppression, as well as by inducing at 344
least one ISG NT5C3 which mRNA acted as a sponge to bind and sequester 345
endogenous miR-122. Moreover, our finding revealed that IFN-α-induced inhibition 346
of the most abundant liver-specific microRNA miR-122 may negatively affect the 347
anti-HBV efficiency of IFN-α. This conclusion was further supported by our 348
observations that the inhibitory effect of IFN-α on HBV can be significantly enhanced 349
by blocking IFN-α-induced miR-122 down-regulation (Fig. 6B), and that transfection 350
with the NT5C3 3’-UTR expression vector, which mimics IFN-α-induced NT5C3 351
expression, led to increased HBV replication (Fig. 6A). In addition, the results suggest 352
that IFN-α and miR-122 may both inhibit HBV replication at transcriptional level (see 353
Fig. 1H and Fig. 5D). Our current work may therefore provide further dissection of 354
the anti-viral mechanism of IFN-α, and may help to design a more efficient 355
combination anti-HBV therapy for this first-line drug. 356
The miRNA sponge method by delivering the sponge transgene with multiple 357
target sites of complementary to a miRNA of interest, has been widely used for 358
miRNA loss-of-function studies (7, 9, 18). The phenomenon of endogenous miRNA 359
13
saturation or sponge by the target mRNAs was noted in previous studies (15, 6), but 360
the precise mechanism has not been formally documented. In this study we first 361
systematically screened more than one hundred ISGs induced by IFN-α to explore the 362
potential targets of miR-122, and identified at least one IFN-induced gene, NT5C3, 363
which harbors a putative miR-122 complementary region in its mRNA 3’-UTR. We 364
then checked whether NT5C3 mRNA 3’-UTR could inhibit miR-122. The results 365
showed that overexpression of the 3’-UTR significantly reduced miR-122 levels and 366
its activity. Moreover, we observed about 2.5-fold induction of NT5C3 mRNA in 367
IFN-α-treated cells compared with untreated cells, and the decrease of miR-122 was 368
perfectly synchronized with the increase of NT5C3 mRNA levels at 4 and 8 hr 369
post-treatment, whereas miR-122 transcription levels did not show any apparent 370
changes at these time points. Importantly, miR-122 inhibitory effect of IFN-α was 371
shown to be dependent on NT5C3 expression (Fig. 4B). NT5C3 belongs to the 372
5’-nucleotidases family which mainly catalyze the dephosphorylation of pyrimidine 373
nucleoside monophosphates (2), which did not show any obvious effect on HBV 374
replication (data not shown). Interestingly, in a recent study, miR-122 level was found 375
to be negatively correlated with the expression of IRGs in patients with hepatitis C 376
(31). The collective results substantiate that IFN-α-induced ISG may act as a sponge 377
to inhibit miR-122. 378
We further explored the significance of IFN-α-induced miR-122 inhibition on 379
HBV infection. We found that miR-122 acts as an HBV suppressor miRNA, 380
indicating that IFN-α-induced miR-122 inhibition may attenuate the anti-HBV 381
activity of IFN-α. IFN-α is capable of inducing hundreds of genes (ISGs), and their 382
anti-viral effects have been extensively studied (21, 30, 16, 32, 3). However, the exact 383
role of each ISG still remains unclear and even controversial (39, 14). Contrary to the 384
currently accepted paradigm, we here present evidence to suggest that at least one ISG 385
NT5C3, which bears a matched miR-122 target sequence in the 3’-UTR of its mRNA, 386
sequesters and inhibits the HBV suppressor miR-122 by acting as a sponge, thus 387
induced NT5C3 by IFN-α may indirectly enhance HBV replication. Indeed, increased 388
HBV replication was observed under overexpression of the 3’-UTR of NT5C3 (Fig. 389
14
6A). Conceivably, other ISGs or IFN-α-regulated pathways may underlie the marked 390
suppression of HBV by IFN-α. 391
IFN-α therapy generates sustained virological response in a minority of CHB 392
patients (23, 35, 5). A recent study has shown that suppression of HBV replication by 393
IFN-α/β is dependent on viral load (38). These intriguing observations imply a 394
reciprocal effect of IFN-α on HBV replication. Conceivably, the regulation of 395
miR-122 by IFN-α may be one of the contributing reasons for the IFN-α-generated 396
different results. Hence, we believe that our current study not only raises potential 397
interest in increasing miR-122 to enhance the anti-HBV efficacy of IFN-α, but also 398
adds miR-122 as a possible marker for predicating the outcome of IFN therapy, as a 399
significant difference in miR-122 expression is observed among healthy individuals, 400
as well as in patients with CHB, CHC or HCC (6, 31, 42). 401
Finally, HCV and HBV that cause chronic infection, are notorious for their 402
capability to evade host defense and use cellular pathways for the establishment of 403
persistent infection. For HCV, this is the case as miR-122 has been shown to act in an 404
unusual manner to stimulate the replication and expression of HCV (17, 19). However, 405
this is not the case for HBV as we have shown that the most abundant liver-specific 406
miRNA miR-122 actually inhibits hepatotropic HBV replication. From an 407
evolutionary prospective, this intriguing phenomenon deserves further investigation. 408
In conclusion, our work presented herein has identified at least one ISG that 409
sequesters endogenous miR-122 by its mRNA 3’-UTR harboring the 410
miR-122-binding site, which may contribute to the IFN-α-mediated inhibition of 411
miR-122. Moreover, we provide evidence suggesting that miR-122 inhibition by 412
IFN-α attenuates the anti-virus effect of IFN-α as miR-122 leads to pronounced 413
inhibition of HBV replication. Given the broad function of miR-122 in the liver and 414
its anti-HBV activity, our work provides valuable insight for better understanding of 415
IFN-α-elicited anti-viral responses against HBV, and raises further potential interest 416
in enhancing the anti-HBV efficacy of IFN-α by increasing miR-122 expression. 417
418
Acknowledgements 419
15
We thank Fulian Liao and Yanlu Zan for technical help and advices in cell culture 420
and Dr. Wenlin Huang for kindly providing pRL-TK plasmid. 421
This work was supported by grants from the National Natural Science Foundation 422
of China (30970146, 31230026, 91029724, 81021003, 81102018). 423
424
References 425
426
1. Abe A, Inoue K, Tanaka T, Kato J, Kajiyama N, Kawaguchi R, Tanaka S, 427
Yoshiba M, Kohara M. 1999. Quantitation of hepatitis B virus genomic DNA by 428
real-time detection PCR. J Clin Microbiol. 37(9):2899-903. 429
2. Aksoy P, Zhu MJ, Kalari KR, Moon I, Pelleymounter LL, Eckloff BW, 430
Wieben ED, Yee VC, Weinshilboum RM, Wang L. 2009. Cytosolic 431
5'-nucleotidase III (NT5C3): gene sequence variation and functional genomics. 432
Pharmacogenet Genomics. 19(8):567-76. 433
3. Bonvin M, Achermann F, Greeve I, Stroka D, Keogh A, Inderbitzin D, 434
Candinas D, Sommer P, Wain-Hobson S, Vartanian JP, Greeve J. 2006. 435
Interferon-inducible expression of APOBEC3 editing enzymes in human 436
hepatocytes and inhibition of hepatitis B virus replication. Hepatology. 437
43(6):1364-74 438
4. Boutz DR, Collins PJ, Suresh U, Lu M, Ramírez CM, Fernández-Hernando 439
C, Huang Y, Abreu Rde S, Le SY, Shapiro BA, Liu AM, Luk JM, Aldred SF, 440
Trinklein ND, Marcotte EM, Penalva LO. 2011. Two-tiered Approach 441
Identifies a Network of Cancer and Liver Disease-related Genes Regulated by 442
miR-122. J Biol Chem. 286:18066-18078. 443
5. Buster EH, Hansen BE, Lau GK, Piratvisuth T, Zeuzem S, Steyerberg EW, 444
Janssen HL. 2009. Factors that predict response of patients with hepatitis B e 445
antigen-positive chronic hepatitis B to peginterferon-alfa. Gastroenterology. 446
137(6):2002-9. 447
6. Ebert MS, Neilson JR, Sharp PA. 2007. MicroRNA sponges: competitive 448
inhibitors of small RNAs in mammalian cells. Nat Methods. 4(9):721-6. 449
7. Ebert MS, Sharp PA. 2010. MicroRNA sponges: progress and possibilities. 450
RNA. 16(11):2043-50. 451
8. Filipowicz W, Grosshans H. 2001.The liver-specific microRNA miR-122: 452
biology and therapeutic potential. Prog Drug Res. 67:221-38. 453
9. Gatfield, D., G. Le Martelot, C. E. Vejnar, D. Gerlach, O. Schaad, F. 454
Fleury-Olela, A. L. Ruskeepaa, M. Oresic, C. C. Esau, E. M. Zdobnov, and 455
U. Schibler. 2009. Integration of microRNA miR-122 in hepatic circadian gene 456
expression. Genes Dev. 23:1313-26. 457 10. Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude. 2008. A 458
miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 48: 459
648-656. 460
16
11. Gramantieri L, Ferracin M, Fornari F, Veronese A, Sabbioni S, Liu CG, 461
Calin GA, Giovannini C, Ferrazzi E, Grazi GL, Croce CM, Bolondi L, 462
Negrini M. 2007. Cyclin G1 is a target of miR-122a, a microRNA frequently 463
down-regulated in human hepatocellular carcinoma. Cancer Res. 67: 6092-6099. 464
12. He XS, Nanda S, Ji X, Calderon-Rodriguez GM, Greenberg HB, Liang 465
TJ. 2010. Differential transcriptional responses to interferon-alpha and 466
interferon-gamma in primary human hepatocytes. J Interferon Cytokine Res. 467
30(5):311-20. 468
13. Hsieh JL, Wu CL, Lee CH, Shiau AL. 2003. Hepatitis B Virus X Protein 469
Sensitizes Hepatocellular Carcinoma Cells to Cytolysis Induced by E1B-deleted 470
Adenovirus through the Disruption of p53 Function. Clin Cancer Res. 471
9(1):338-45. 472
14. Jost S, Turelli P, Mangeat B, Protzer U, Trono D. 2007. Induction of antiviral 473
cytidine deaminases does not explain the inhibition of hepatitis B virus 474
replication by interferons. J Virol. 81(19):10588-96. 475
15. Kelly EJ, Hadac EM, Cullen BR, Russell SJ. 2010. MicroRNA antagonism of 476
the picornaviral life cycle: alternative mechanisms of interference. PLoS Pathog. 477
6(3):e1000820. 478
16. Kim JH, Luo JK, Zhang DE. 2008. The level of hepatitis B virus replication is 479
not affected by protein ISG15 modification but is reduced by inhibition of UBP43 480
(USP18) expression. J Immunol. 181(9):6467-72. 481
17. Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, Munk 482
ME, Kauppinen S, Ørum H. 2010. Therapeutic silencing of microRNA-122 in 483
primates with chronic hepatitis C virus infection. Science. 327:198-201. 484
18. Li, C., S. Cao, Z. Liu, X. Ye, L. Chen, and S. Meng. 2010. RNAi-mediated 485
downregulation of uPAR synergizes with targeting of HER2 through the ERK 486
pathway in breast cancer cells. Int J Cancer. Oct 1. 127(7):1507-16. 487
19. Li YP, Gottwein JM, Scheel TK, Jensen TB, Bukh J. 2011. MicroRNA-122 488
antagonism against hepatitis C virus genotypes 1-6 and reduced efficacy by host 489
RNA insertion or mutations in the HCV 5' UTR. Proc Natl Acad Sci U S A . 490
108:4991-4996. 491
20. Lütgehetmann M, Bornscheuer T, Volz T, Allweiss L, Bockmann JH, Pollok 492
JM, Lohse AW, Petersen J, Dandri M. 2011. Hepatitis B virus limits response 493
of human hepatocytes to interferon-α in chimeric mice. Gastroenterology. Jun. 494
140(7):2074-83, 2083.e1-2. 495
21. Mao R, Zhang J, Jiang D, Cai D, Levy JM, Cuconati A, Block TM, Guo JT, 496
Guo H. 2011. Indoleamine 2,3-dioxygenase mediates the antiviral effect of 497
gamma interferon against hepatitis B virus in human hepatocyte-derived cells. J 498
Virol. 85(2):1048-57. 499
22. Moore KJ, Rayner KJ, Suárez Y, Fernández-Hernando C. 2011.The role of 500
microRNAs in cholesterol efflux and hepatic lipid metabolism.Annu Rev Nutr. 501
31:49-63. 502
23. Moucari R, Mackiewicz V, Lada O, Ripault MP, Castelnau C, 503
Martinot-Peignoux M, Dauvergne A, Asselah T, Boyer N, Bedossa P, Valla D, 504
17
Vidaud M, Nicolas-Chanoine MH, Marcellin P. 2009. Early serum HBsAg 505
drop: a strong predictor of sustained virological response to pegylated interferon 506
alfa-2a in HBeAg-negative patients. Hepatology. 49(4):1151-7. 507
24. Neuveut C, Wei Y, Buendia MA. 2010. Mechanisms of HBV-related 508
hepatocarcinogenesis. J Hepatol. 52: 594-604. 509
25. Norman KL, Sarnow P. 2010. Modulation of hepatitis C virus RNA abundance 510
and the isoprenoid biosynthesis pathway by microRNA miR-122 involves distinct 511
mechanisms. J Virol. 84:666-670. 512
26. Ono SK, Kato N, Shiratori Y, Kato J, Goto T, Schinazi RF, Carrilho FJ, 513
Omata M. 2001. The polymerase L528M mutation cooperates with nucleotide 514
binding-site mutations, increasing hepatitis B virus replication and drug resistance. 515
J Clin Invest. 107:449-455. 516
27. Pedersen IM, Cheng G, Wieland S, Volinia S, Croce CM, Chisari FV, David 517
M. 2007. Interferon modulation of cellular microRNAs as an antiviral mechanism. 518
Nature. 449(7164):919-22. 519
28. Qiu L, Fan H, Jin W, Zhao B, Wang Y, Ju Y, Chen L, Chen Y, Duan Z, Meng S. 520
2010. MiR-122-induced down-regulation of HO-1 negatively affects 521
miR-122-mediated suppression of HBV. Biochem Biophys Res Commun. 522
398:771-777. 523
29. Rudin, D., S. M. Shah, A. Kiss, R. V. Wetz, and V. M. Sottile. 2007. Interferon 524
and lamivudine vs. interferon for hepatitis B e antigen-positive hepatitis B 525
treatment: meta-analysis of randomized controlled trials. Liver Int. 27:1185-93. 526
30. Sadler, A. J., and B. R. Williams. 2008. Interferon-inducible antiviral effectors. 527
Nat Rev Immunol. 8:559-68. 528
31. Sarasin-Filipowicz, M., J. Krol, I. Markiewicz, M. H. Heim, and W. 529
Filipowicz. 2009. Decreased levels of microRNA miR-122 in individuals with 530
hepatitis C responding poorly to interferon therapy. Nat Med. 15:31-3. 531
32. Sarkis PT, Ying S, Xu R, Yu XF. 2006. STAT1-independent cell type-specific 532
regulation of antiviral APOBEC3G by IFN-alpha. J Immunol. 177(7):4530-40. 533
33. Shimizu S, Seki N, Sugimoto T, Horiguchi S, Tanzawa H, Hanazawa T, 534
Okamoto Y. 2007. Identification of molecular targets in head and neck squamous 535
cell carcinomas based on genome-wide gene expression profiling. Oncol Rep. 536
18(6):1489-97. 537
34. Shlomai, A., N. Paran, and Y. Shaul. 2006. PGC-1alpha controls hepatitis B 538
virus through nutritional signals. Proc Natl Acad Sci U S A. 103:16003-8. 539
35. Sonneveld MJ, Rijckborst V, Boucher CA, Hansen BE, Janssen HL. 2010. 540
Prediction of sustained response to peginterferon alfa-2b for hepatitis B e 541
antigen-positive chronic hepatitis B using on-treatment hepatitis B surface 542
antigen decline. Hepatology. 52(4):1251-7. 543
36. Tang, H., and A. McLachlan. 2001. Transcriptional regulation of hepatitis B 544
virus by nuclear hormone receptors is a critical determinant of viral tropism. Proc 545
Natl Acad Sci U S A. 98:1841-6. 546
18
37. Ter Borg, M. J., B. E. Hansen, G. Bigot, B. L. Haagmans, and H. L. Janssen. 547
2008. ALT and viral load decline during PEG-IFN alpha-2b treatment for 548
HBeAg-positive chronic hepatitis B. J Clin Virol. 42:160-4. 549
38. Tian Y, Chen WL, Ou JH. 2011. Effects of interferon-α/β on HBV replication 550
determined by viral load. PLoS Pathog. 7(7):e1002159. 551
39. Turelli P, Liagre-Quazzola A, Mangeat B, Verp S, Jost S, Trono D. 2008. 552
APOBEC3-independent interferon-induced viral clearance in hepatitis B virus 553
transgenic mice. J Virol. 82(13):6585-90. 554
40. Vivekanandan P, Thomas D, Torbenson M. 2009. Methylation regulates 555
hepatitis B viral protein expression. J Infect Dis. 199(9):1286-91. 556
41. Wang LY, Li YG, Chen K, Li K, Qu JL, Qin DD, Tang H. 2012. Stable 557
expression and integrated hepatitis B virus genome in a human hepatoma cell line. 558
Genet Mol Res. 11(2):1442-8. 559
42. Wang S, Qiu L, Yan X, Jin W, Wang Y, Chen L, Wu E, Ye X, Gao GF, Wang 560
F, Chen Y, Duan Z, Meng S. 2012. Loss of MiR-122 expression in patients with 561
hepatitis B enhances hepatitis B virus replication through cyclin G1 modulated 562
P53 activity. Hepatology. 55(3):730-41. 563
43. Wu M, Xu Y, Lin S, Zhang X, Xiang L, Yuan Z. 2007. Hepatitis B virus 564
polymerase inhibits the interferon-inducible MyD88 promoter by blocking 565
nuclear translocation of Stat1. J Gen Virol. 88(Pt 12):3260-9. 566
44. Xu C, Guo H, Pan XB, Mao R, Yu W, Xu X, Wei L, Chang J, Block TM, Guo 567
JT. 2010. Interferons accelerate decay of replication-competent nucleocapsids of 568
hepatitis B virus. J Virol. 84(18):9332-40. 569
45. Xu H, He JH, Xiao ZD, Zhang QQ, Chen YQ, Zhou H, Qu LH. 2010. 570
Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 571
during liver development. Hepatology. 52(4):1431-42. 572
46. Yang F, Zhang L, Wang F, Wang Y, Huo XS, Yin YX, Wang YQ, Zhang L, 573
Sun SH. 2011. Modulation of the unfolded protein response is the core of 574
microRNA-122-involved sensitivity to chemotherapy in hepatocellular carcinoma. 575
Neoplasia. 13(7):590-600. 576
47. Yang, J., and L. S. Zhao. 2009. Clinical significance of 4 patients with chronic 577
hepatitis B achieving HBsAg clearance by treated with pegylated interferon 578
alpha-2a for less than 1 year: a short report. Virol J. 6:97. 579
48. Y. Shan, J. Zheng, R.W. Lambrecht, H.L. 2007. Bonkovsky, Reciprocal effects 580
of micro-RNA-122 on expression of heme oxygenase-1 and hepatitis C virus 581
genes in human hepatocytes, Gastroenterology. 133(4):1166-74. 582
49. Zeng C, Wang R, Li D, Lin XJ, Wei QK, Yuan Y, Wang Q, Chen W, Zhuang 583
SM. 2010 . A novel GSK-3 beta-C/EBP alpha-miR-122-insulin-like growth factor 584
1 receptor regulatory circuitry in human hepatocellular carcinoma. Hepatology. 585
52(5):1702-12. 586
50. Zhang, Q., Y. Wang, L. Wei, D. Jiang, J. H. Wang, H. Y. Rao, L. Zhu, H. 587
Chen, R. Fei, and X. Cong. 2008. Role of ISGF3 in modulating the anti-hepatitis 588
B virus activity of interferon-alpha in vitro. J Gastroenterol Hepatol . 23:1747-61. 589
19
51. Zhang, S. Y., S. Boisson-Dupuis, A. Chapgier, K. Yang, J. Bustamante, A. 590
Puel, C. Picard, L. Abel, E. Jouanguy, and J. L. Casanova. 2008. Inborn errors 591
of interferon (IFN)-mediated immunity in humans: insights into the respective 592
roles of IFN-alpha/beta, IFN-gamma, and IFN-lambda in host defense. Immunol 593
Rev. 226:29-40. 594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
20
634
635
636
Figure legends: 637
Fig. 1. MiR-122 expression and HBV replication were suppressed by interferon-α 638
treatment. (A) Dose-response analysis of miR-122 induced by IFN-α. Huh-7 cells 639
were treated with the indicated concentration of IFN-α for 4 hr, and miR-122 640
expression was quantified with real-time PCR. The results were normalized to a U6 641
endogenous control RNU6B. (B, C and D) Time course of miR-122 expression in 642
response to IFN-α. Huh-7 cells were treated with 1000 U/ml of IFN-α once, and 643
miR-122 expression was quantified by real-time PCR at the indicated time (B). Huh-7 644
cells were treated with 1000 U/ml of IFN-α for every 12 hr, and miR-122 levels were 645
quantified by real-time PCR (C) and Northern blot (D) analysis at the indicated time. 646
(E-H) HBV expression and replication assays in the HBV replication plasmid pHBV 647
transfected cells under IFN-α treatment. Huh-7 cells were transfected with pHBV, and 648
4 hr later the cells were treated with 1000 U/ml of IFN-α for every 12 hr. The levels 649
of secreted HBsAg and HBeAg were quantified with ELISA and expressed as 650
O.D.450 nm (E). HBV DNA copies in the supernatant were quantified with real-time 651
PCR (F). HBV-DNA levels in cells were detected by Southern blot assay at 48 hr(G). 652
rcDNA, relaxed circular DNA; dsDNA, double-stranded DNA; ssDNA, 653
single-stranded DNA. HBV pgRNA and total RNA levels were measured by real-time 654
PCR (H). GAPDH was used as an internal control. The IFN-α-untreated cells served 655
as control. Error bars, means ± S.D. of three independent experiments. * P<0.05, ** 656
P<0.01 compared with control. 657
658
Fig. 2. Effect of interferon-α on miR-122 transcription. (A) Time course of miR-122 659
promoter activity in response to IFN-α treatment. Huh-7 cells were co-transfected 660
with pGL-122 with a luciferase reporter under miR-122 promoter and pRL-TK, and at 661
18 hr after transfection cells were treated with 1000 U/ml of IFN-α for the indicated 662
time. pGL-122 and Renilla luciferase activities were measured using dual luciferase 663
assay. (B) MiR-122 primary transcript (pri-miR-122) was quantified by real-time PCR 664
21
in Huh-7 cells treated with 1000 U/ml of IFN-α for the indicated time. The 665
IFN-α-untreated cells served as control. Error bars, means ± S.D. from three 666
independent experiments. * P<0.05, ** P<0.01 compared with control. 667
668
Fig. 3. Inhibition of miR-122 by its target mRNA of NT5C3 induced by interferon-α. 669
(A) Confirmation of NT5C3 as the miR-122 target by luciferase reporter assay. 670
Perfect matches are indicated by a line showing predicted binding sequence of 671
miR-122 within the 3’-UTR of NT5C3 mRNA. Mutations are made to the seed region 672
of the miR-122-binding site (NT5C3-mut) for the reporter gene assay. Huh-7 cells 673
were co-transfected with a miR-122 mimic or miR-152 or miR-642 or a randomized 674
oligonucleotide as mock, and a firefly luciferase reporter plasmid carrying either the 675
wild-type (NT5C3-wt) or mutant (NT5C3-mut) 3’-UTR of NT5C3. At 48 hr 676
post-transfection, firefly luciferase and Renilla luciferase activities were measured, 677
and the luciferase activity was normalized to Renilla luciferase. (B and C) The 678
3’-UTR of NT5C3 mRNA sequesters endogenous miR-122. Huh-7 cells were 679
transfected with the reporter plasmid with wild-type (NT5C3-wt) or mutant 680
(NT5C3-mut) 3’-UTR of NT5C3 or the empty plasmid pGL3 as control, and miR-122 681
levels were quantified by real-time PCR 24 and 48 hr after transfection，firefly 682
luciferase and Renilla luciferase activities were measured at 24 and 48hr , and the 683
luciferase activity was normalized to Renilla luciferase (B). The miR-122 levels at 24 684
hr were detected by Northern blot analysis (C). (D) HepG2 cells were transfected with 685
a miR-122 mimic or a randomized oligonucleotide as mock, and Huh-7 cells were 686
transfected with a miR-122 inhibitor or randomized oligonucleotide as mock. The 687
cylinG1 protein levels were measured by immunoblotting 48 hr post-transfection. 688
Actin was used as a loading control. (E) Huh-7 cells were transfected with the reporter 689
plasmid with wild-type (NT5C3-wt) or mutant (NT5C3-mut) 3’-UTR of NT5C3, and 690
the cyclinG1 protein levels were measured by immunoblotting 48 hr post-transfection. 691
Actin was used as a loading control. (F) Time course of NT5C3 mRNA expression in 692
response to IFN-α treatment. Huh-7 cells were treated with 1000 U/ml of IFN-α for 693
22
the indicated time, and NT5C3 mRNA levels were quantified by real-time PCR. Error 694
bars, means ± S.D. from three independent experiments. * P<0.05, ** P<0.01 695
compared with control or mock. 696
697
Fig. 4. Inhibition of miR-122 by interferon-α is dependent on NT5C3 mRNA. (A) 698
Huh-7 cells were transfected with the NT5C3-specific siRNA (siNT5C3) or a 699
scrambled siRNA as mock. The miR-122 levels were determined 24 hr 700
post-transfection by real-time PCR and Northern blot analysis (A). (B) Huh-7 cells 701
were transfected with siNT5C3 or a scrambled siRNA as mock, and at 20 hr after 702
transfection 1000 U/ml of IFN-α was added. NT5C3 mRNA levels and miR-122 703
levels were determined at 4 hr after IFN-α treatment by real-time PCR. Error bars, 704
means ± S.D. from three independent experiments. * P<0.05, ** P<0.01 compared 705
with mock. 706
707
Fig.5. MiR-122 inhibits HBV expression and replication. (A and B) Huh-7 cells were 708
co-transfected with pHBV and 25 nM of miR-122 inhibitor or 25 nM miR-152 or 709
miR-642 or a randomized oligonucleotide as mock. At 48 hr after transfection, the 710
secretion of HBsAg and HBeAg was measured by ELISA (A), and HBV DNA copies 711
in the supernatant were quantified by real-time PCR (B). (C-F) HepG2 cells were 712
co-transfected with pHBV and 50 nM of chemically synthesized miR-122 mimic or 713
50 nM miR-152 or miR-642 or a randomized oligonucleotide as mock. At 48 hr after 714
transfection, the secretion of HBsAg and HBeAg was measured by ELISA (C). HBV 715
total mRNA levels (D) and DNA copies (E) in the supernatant were quantified by 716
real-time PCR. (F) HBV-DNA levels in cells were detected by Southern blot assay. 717
Cells without transfection served as negative control for Southern blot. The cylinG1 718
protein levels were measured by immunoblotting. Actin was used as a loading control. 719
Student’s t-test was used to determine p-values. * P<0.05, ** P<0.01 compared with 720
mock. 721
722
Fig. 6. Abrogation of IFN-α-induced down-regulation of miR-122 results in enhanced 723
23
suppression of HBV by IFN-α. (A) Huh-7 cells were co-transfected with pHBV and a 724
luciferase reporter plasmid carrying either the wild-type (NT5C3-wt) or mutant 725
(NT5C3-mut) 3’-UTR of NT5C3. HBV DNA copies in the supernatant were 726
quantified by real-time PCR 48 hr after transfection. (B) Huh-7 cells were 727
co-transfected with pHBV and 25 nM of miR-122 mimic. At 6 hr after transfection 728
500 U/ml of IFN-α was added to the cell culture. HBV DNA copies in the supernatant 729
were measured by real-time PCR 48 hr post-transfection. (C) Huh-7 cells were 730
co-transfected with pHBV and 50 nM of miR-122 inhibitor. At 6 hr after transfection 731
1000 U/ml of IFN-α was added to the cell culture. HBV DNA copies in the 732
supernatant were measured by real-time PCR 48 hr post-transfection. 733
734
Fig.7. The mutant p53 in Huh-7 cells could regulate HBV transcription and 735
replication. (A and B) Huh-7 cells were transfected with 100 nM specific siRNA or a 736
scrambled siRNA as mock. The p53 mRNA and protein levels were determined 48 hr 737
post-transfection by real-time PCR (A) and Western blot analysis (B), respectively. (C) 738
Huh-7 cells were co-transfected with 1μg pHBV-luc and 50 nM p53 siRNA or a 739
scrambled siRNA as mock. At 48 hr post-transfection, firefly luciferase and Renilla 740
luciferase activities were measured, and the luciferase activity was normalized to 741
Renilla luciferase. (D and E) Huh-7 cells were co-transfected with pHBV and p53 742
siRNA or a scrambled siRNA as mock. At 48 hr after transfection, the levels of 743
HBsAg and HBeAg in the supernatant were measured by ELISA (D), and HBV DNA 744
copies in the supernatant were quantified by real-time PCR (E). Error bars, means ± 745
S.D. from three independent experiments. * P<0.05, ** P<0.01 compared with mock. 746
