Functional characterization of the pathogenesis-related protein family 10 gene, PgPR10-4, from Panax ginseng in response to environmental stresses

ISSN 1021�4437, Russian Journal of Plant Physiology, 2014, Vol. 61, No. 5, pp. 664–671. © Pleiades Publishing, Ltd., 2014.

664

12 INTRODUCTION

Higher plants have developed various defensemechanisms against biotic and abiotic stresses, such aspathogen invasions, wounding, exposure to heavymetal, salinity, cold, and ultraviolet rays (UV). Thesedefense mechanisms include the synthesis of patho�genesis�related (PR) proteins. When the pathogensattack, the generation of reactive oxygen species(ROS) strengthens plant cell walls, PR proteins areinduced, phytoalexins are accumulated, and antimi�crobial compounds are synthesized [1]. PR proteinsare known to function in higher plants against abioticand biotic stresses, especially against pathogen infec�tion. PRs are accumulated after the attacks by virus,bacteria, fungi, nematodes, insects, and herbivores aswell as after wounding and certain abiotic stress condi�tions [2]. PR was first observed in tobacco plantsinfected with tobacco mosaic virus [3]. Since the dis�covery of PRs in 1970, PRs were identified in manyplants species; currently, 17 PR families have beengrouped based on amino acid sequences, serologicalrelationship, and/or enzymatic or biological activity[2]. The specific functions of PRs are not fully under�

1 This text was submitted by the authors in English.2 These authors contributed equally to this work.

stood, although several proteins are postulated to playa role in preventing pathogen invasion.

Among the 17 groups of PR proteins, pathogene�sis�related protein 4 (PR4) family proteins contain acommon Barwin domain in C�terminus, derived froma basic barley seed protein barwin, which contains sixcysteine residues that can form three disulfide bridgesand has the ability to bind saccharides [4]. PR4 pro�teins have been regarded as endochitinases becauseone of them, tobacco CBP20 [5] was reported to man�ifest weak chitinase activity [6]. PR4 proteins can bedivided into two classes according to the presence ofthe cysteine�rich domain in N�terminus [7]. Class IPR4 proteins (also known as hevein�like proteins)contain a conserved N�terminal cysteine�rich chitin�binding domain (or hevein domain), which corre�sponds to an antifungal protein from rubber tree latex(Hevea brasiliensis) [8]. They possess binding ability tochitin and thereby have strong antifungal activities [9].However, class II PR4 proteins, which lack the chitin�binding domain, are less extensively studied and theirfunctions are divergent. They are reported to beinvolved in defense responses against various biotic orabiotic stresses [10]. At present, the role of PR4 pro�tein in defense of ginseng remains to be elucidated.

In this study, we isolated cDNA (PgPR4, for Panaxginseng PR4 protein, which shared significantsequence similarity with PR4 from other plants.

Cloning and Characterization of Pathogenesis�Related Protein 4 Gene from Panax ginseng1

Y. J. Kim2, H. J. Lee2, M. G. Jang, W. S. Kwon, S. Y. Kim, and D. C. YangDepartment of Oriental Medicinal Materials and Processing, College of Life Science,

Kyung Hee University, Suwon 449�701, Korea;fax: +82�31�202�2687; e�mail: [email protected]

Received October 11, 2013

Abstract—The family of pathogenesis�related protein 4 (PR4) is a group of proteins with a Barwin domainin C�terminus and generally thought to be involved in plant defense responses. In the present study, PR4 (des�ignated as PgPR4) cDNA was isolated from the leaf of Panax ginseng C.A. Meyer. and characterized. TheORF is 513 bp with a deduced amino acid sequence of 170 residues. A GenBank BlastX search revealed thatthe deduced amino acid of PgPR4 shares the highest sequence similarity to PR4 of Sambucus nigra (72%identity). Sequence and structural analysis indicated that PgPR4 belongs to class II of PR4 proteins. This isthe first report on the isolation of PR4 gene from the P. ginseng genome. The high�level expression of PgPR4was observed in the root as revealed by quantitative real�time PCR. The temporal expression analysis dem�onstrated that PgPR4 expression could be up�regulated by pathogen infection, salt, wounding, and hormonestresses. These results suggest that PgPR4 could play a role in the molecular defense response of ginseng toabiotic stress and pathogen attack.

Keywrds: Panax ginseng, abiotic stress, biotic stress, pathogenesis�related protein 4, gene expression

DOI: 10.1134/S1021443714050100

Abbreviations: JA—jasmonic acid; PR—pathogenesis related;SA—salicylic acid.

RESEARCH PAPERS

RUSSIAN JOURNAL OF PLANT PHYSIOLOGY Vol. 61 No. 5 2014

CLONING AND CHARACTERIZATION OF PATHOGENESIS�RELATED 665

Korean ginseng (Panax ginseng Meyer) is cultivated forits highly valued root used for medicinal purposes. Theproduction of ginseng roots required 4–6�year cultiva�tion period; thus, it is sensitive to environmentalstresses as well as diseases caused by both foliar andsoil�born root�infecting fungi [11, 12]. To effectivelymanage ginseng diseases and other disorders, it is valu�able to study and identify functional genes related todefense mechanism in ginseng. To understand thedefense response of ginseng to stress, we have isolatedPR genes from ginseng. In this study, we report on thecloning of PR4 gene from P. ginseng and provide theanalysis of the expression profile of this gene in thedefense responses to abiotic and biotic stresses.

MATERIALS AND METHODS

RNA purification and construction of a cDNAlibrary. Total RNA was isolated from ginseng callus(provided by Ginseng Bank) using the aqueous phenolextraction procedure as described by Morris et al. [13].Poly(A)+ RNA was isolated by using the oligo (dT)cellulose column using the Poly(A) Quick mRNA iso�lation kit (Stratagene, United States). A cDNA syn�thesis kit was used to construct library according to themanufacturer’s instruction manual (Clontech, United

States). Size�selected cDNA was ligated into λTriplEx2vector and was packaged in vitro using Gigapack IIIGold Packaging Extract kits (Stratagene).

Nucleotide sequencing and sequence analysis. pTri�plEx phagemids were excised from the λpTriplEx2 andused as templates for sequence analysis. The 5' ends ofcDNA inserts were sequenced by an automatic DNAsequencer (ABI prism 3700 DNA sequencer, Perkin�Elmer, United States). Homologous sequences of PR4EST were searched against the GenBank databases usinga BLASTX algorithm. A pTriplEx phagemid for PR4cDNA was excised from the λpTriplEx2 and used astemplates for sequence analysis. Nucleotide andamino acid sequence analyses were performed usingDNASIS program (Hitachi, Japan).

The deduced amino acid sequences were searchedfor homologous proteins in the databases usingBLAST network services at the NCBI. We used Clust�alX with default gap penalties to perform multiplealignment of PR4 isolated in ginseng and previouslyregistered in other species. Based on this alignment, aphylogenetic tree was constructed according to theneighbor�joining method using the MEGA4 pro�grams. The protein properties were estimated usingProtParam [14]. Identification of conserved motifswithin PR4 was accomplished with MEME [15].

80160240

320

400

480

560

640

720

800880

916

Fig. 1. Nucleotide and deduced amino acid sequence of PgPR4 isolated from P. ginseng. The deduced amino acid sequence is shown in a single�letter code below the nucleotide sequence. The position of nucleotides isshown on the right. Two black boxes show the transcription start codon (ATG) and termination codon (TGA), respectively. Thearrows indicate the conserved six cysteine residues for forming intra�disulfide linkages.

666


KIM et al.

A three�dimensional model was prepared using PR4as a template on a SWISS�MODEL WORKSPACE inautomated mode [16]. The generated 3D structure wasvisualized using the UCSF Chimera package.

Plant, environmental stress, and pathogen. P. gin�seng cv. Hwang�Sook seeds (provided by GinsengBank) were used, and cultivated three�week�old plant�lets were used for the treatments and RNA extraction,

as described previously [17]. For chemical stress treat�ments, the plantlets were placed for various periods onMS medium containing indicated concentrations ofchemicals: 100 mM NaCl, 10 mM H2O2, 0.1 mMABA, 0.2 mM jasmonic acid (JA), and 0.2 mM sali�cylic acid (SA). Chilling stress was applied by exposingthe plantlets to 4°C. For mechanical wounding stress,healthy leaves and stems of plantlets were wounded

Signal peptideHevein domain(a)

10 20 30 40 50 60 70 80 90

PgPR4

SnPR4

NtPR4

PsPR4

TmPR4

VvPR4

DdPR4

LrPR

BrPR4

HvPR4

OsPR4

Motif 2

Motif 1 Motif 3Barwin domainC�term extension

PgPR4

SnPR4

NtPR4

PsPR4

TmPR4

VvPR4

DdPR4

LrPR

BrPR4

HvPR4

OsPR4

100 110 120 130 140 150 160 170

* *** ** * ** * ***

********************************************

PgPR4SnPR4

NtPR4PsPR4

TmPR4VvPR4

DdPR4LrPR

BrPR4

HvPR4

OsPR496

7236

2029

34

27

56

(b)

0.05

Fig. 2. Sequence homology analysis of PgPR4 with other PR protein genes. (a) Comparison of the putative amino acids sequences of PgPR4 with those of PR4 genes from other plants: Sambucus nigra(CAA87070.1), Nicotiana tabacum (CAA41437.1), Pisum sativum (AAF61434.1), Brassica rapa subsp. Pekinensis (AAN23106.2),Lycoris radiata (ACI31201.1), Dioscorea bulbifera (AAB94514.1), Vitis vinifera (AAC33732.1), Triticum monococcum(AAT67050.1), Oryza sativa (AAR08364.1), and Hordeum vulgare (CAA71774.1). Hyphen was inserted within amino acidsequence to denote gap. Shadow box indicates well conserved residues, * represents conserved amino acid, and : represents verysimilar amino acid. The barwin domain and the N�terminal signal peptide are marked, but the hevein domain (chitin�bindingdomain) and C�terminal extension [23, 27], indicated as triangles, are missing in PgPR4. Three conserved motifs obtained byMEME analysis contain 50 conserved amino acid residues, respectively. (b) A phylogenetic tree of PgPR4 with PR4 isozymesfrom various plants as shown in (a). The neighbor�joining method was used, and the branch lengths are proportional to the diver�gence, with the scale of 0.1 representing 10% changes.



with a sterile scalpel. In all cases, stress treatmentswere carried out on MS media and 10 plantlets weretreated with each stress for 1, 4, 8, 24, 48, or 72 h.

The fungal strains, Colletotrichum gloeosporoides(KACC 40003) and Rhizoctonia solani (KACC40101), were obtained from Korean Agricultural Col�lection Center, South Korea. The isolates of fungiwere grown for three days at 25°C on potato dextroseagar to obtain mycelium for the inoculation of ginsengseedlings. For the infection experiments, mycelialplug excised from the actively growing margin of a col�ony were suspended in sterile water and sprayed. Afterinoculation, plants were kept at 100% humidity toattain moisture condition. Plants were harvested at 0,6, 24, 48, and 72 h after infection. Control plants wereheld in a growth room at 25°C under a 16�h photope�riod. The stressed plant material from all completed

treatments were immediately frozen in liquid nitrogenand stored at –70°C until required.

Real�time quantitative RT�PCR. Total RNA wasextracted from seedlings of P. ginseng using RNeasymini kit (Qiagen, United States). For RT�PCR,200 ng of total RNA was used as a template for reversetranscription using oligo(dT)15 primer (0.2 mM) andAMV Reverse Transcriptase (10 U/μL) (iNtRON Bio�technology, South Korea) according to the manufac�turer’s instructions. Real�time quantitative PCR wasperformed using 100 ng of cDNA in a 10�μL reactionvolume using SYBR® Green SensimixPlus MasterMix (Quantace, England). Specific primers forPgPR4, 5'�ATGGACAGCCTTCTGTGGTC�3' and5'�CTTGAGCATTACCCCTTCCA�3' were used forperform real�time PCR. The thermal cycler condi�tions recommended by the manufacturer were used asfollows: 10 min at 95°C, followed by 40 cycles of 95°C

(a)

(b)

90°

PgPR4

20 40 60 80 100 120

SnPR4

NtPR4

PsPR4

20 40 60 80 100 120

20 40 60 80 100

20 40 60 80 100 120 140

Fig. 3. The predicted 3D structure and secondary structure of PR4.(a) Comparative representation was performed by UCSF Chimera package. (b) Comparison of PR4 secondary structures bySOMPA. The helix, sheet, turn, and coil are indicated in order from the longest to the shortest. Gene designations see in Fig. 2legend.

668


KIM et al.

for 10 s, 58°C for 10 s, and 72°C for 20 s. The fluores�cent product was detected at the last step of each cycle.Amplification, detection, and data analysis were car�ried out with a Rotor�Gene 6000 real�time rotary ana�lyzer (Corbett Life Science, Australia). Thresholdcycle (Ct) represents the number of cycles, at whichthe fluorescence intensity was significantly higher thanthe background fluorescence at the initial exponentialphase of PCR amplification. To determine the relativefold differences in template abundance for each sample,the Ct value for PgPR4 was normalized to the Ct value forginseng β�actin (DC03005B05) (5'�AGAGATTC�CGCTGTCCAGAA�3' and 5'�ATCAGCGATAC�CAGGGAACA�3') and calculated relative to a cali�brator using the formula 2ΔΔCt. Three independentexperiments were performed. The primer efficiencieswere determined according to the method describedby Livak and Schmittgen [18] for validating the ΔΔCtmethod used in our experiment. The observed slopeswere close to zero, indicating that the efficiencies ofthe gene and the internal β�actin control were equal.

RESULTS

Isolation and Sequence Analysis of a PgPR4

From our expressed sequence tags (EST) analysisof a cDNA library, which was prepared with the leavesof P. ginseng, we identified a cDNA clone encoding aPR4 gene. We named this gene PgPR4 (P. ginsengpathogenesis�related protein 4 gene); the sequencedata of PgPR4 have been deposited in GenBank underaccession number KF691748. The full�length cDNAof PgPR4 was 916 nucleotides long and had the puta�tive open reading frame of 513 bp (Fig. 1). This ORFencodes a pathogenesis�related protein of 170 aminoacids, beginning at the start codon ATG (position 161)

and terminating at the stop codon TGA (position 673)of the cDNA, with the predicted mol wt of 18.8 kDand an isoelectric point of 9.14. The instability index(II) is to be calculated 24.77 and the aliphatic index,defined as a positive factor for increased thermostabil�ity, is computed as 84.48 by using ProtParam [14].

Homology Analysis

A GenBank BlastX search revealed that theinferred amino acid sequence of PgPR4 has a highdegree of sequence homologies with PR4 from otherplants. Figure 2 shows the alignment of PgPR4 withsimilar proteins from other plants. PgPR4 showed thehighest sequence similarity with that of Sambucusnigra (CAA87070.1, 72% identity), Nicotiana tabacum(CAA41437.1, 68% identity), and Pisum sativum(AAF61434.1, 66% identity). Secondary structureanalysis and molecular modeling for PgPR4 were car�ried with SOMPA (Fig. 3). The secondary structureanalysis showed that PgPR4 consisted of 32 α�helices,21 β�turns jointed by 58 extended strands, and 59 ran�dom coils. This result is highly comparable to the sec�ondary structure of S. nigra that contains 24 α�helices,14 β�turns jointed by 44 extended strands, and 58 ran�dom coils and PR4 of N. tabacum, which contains49 α�helices, 12 β�turns jointed by 33 extendedstrands, and 53 random coils.

Expression Patterns of PgPR4 mRNA.

To examine the expression profiles of PgPR4 gene,quantitative RT�PCR was carried out using the cDNAtemplates from three organs, e.g., leaf, stem, and root.As shown in Fig. 4, PgPR4 was expressed preferentiallyin the ginseng root.

To observe the response of this gene to differentenvironmental stresses, the expression of PgPR4 at dif�ferent time points after various treatments was ana�lyzed by real�time PCR (Fig. 5). All the stress treat�ments did not show any significant difference fromcontrol in plant habitus, which means that the con�centration and time for stress treatment were enoughto survive for ginseng plant, similarly to previous stud�ies [17, 99]. Figure 5a shows the expression of PgPR4against salt stress. At 4 h after treatment, the PgPR4transcription level was increased to 4.23�fold of con�trol and then dramatically increased to 8.59�fold at72 h. Figure 5b shows the expression pattern of PgPR4in response to chilling stress. The level of PgPR4mRNA was rather decreased until 24 h but increasedto 2.11�fold at 48 h. In the case of wounding stress,PgPR4 expression increased to 4.18�fold at 4 h and thendecreased similar to control level until 24 h but dramati�cally increased to 7.44�fold at 48 h (Fig. 5c). To checkPgPR4 gene expression against pathogen infections, thefungal strains, R. solani, and C. gloeosporioides, were used(Fig. 5d). Rhizoctonia inoculation maintained controlexpression level until 6 h after treatment and brought a

7

6

5

4

3

2

1

0Leaf Stem Root

Different ginseng tissues

Rel

ativ

e ge

ne

exp

ress

ion

of

PgP

R4

Fig. 4. Expression of PgPR4 gene in leaves, stems, androots of Panax ginseng. Vertical bars indicate the mean values ± SE from threeindependent experiments.



200

150

100

50

01 4 8 24 48 72Time of JA treatment, h

(g)

Rel

ativ

e ge

ne

exp

ress

ion

of

PgP

R4

0

3000

01 4 8 24 48 72

Time of H2O2 treatment, h

(e)

Rel

ativ

e ge

ne

exp

ress

ion

of

PgP

R4

0

2500

2000

1500

1000

500

10

01 4 8 24 48 72

Time after wounding treatment, h

(c)

0

8

6

4

2

10

01 4 8 24 48 72

Time of NaCl treatment, h

(a)

0

8

6

4

2

2.5

01 4 8 24 48 72

Time of chilling treatment, h

(b)

0

2.0

1.5

1.0

0.5

6

06 24 48 72

Time after fungal inoculation, h

(d)

0

5

4

3

11 2

2

2500

01 4 8 24 48 72

Time of ABA treatment, h

(f)

0

2000

1500

1000

500

600

01 4 8 24 48 72Time of SA treatment, h

(h)

0

500

400

300

200

100

Fig. 5. Relative quantities of PgPR4 mRNA at various time points (h) after treatment with various stresses.(a) 100 mM NaCl, (b) chilling, (c) wounding, (d) fungal treatment with Rhizoctonia solani (1) and Colletotrichum gloeosporoides(2), (e) 10 mM H2O2, (f) 0.1 mM ABA, (g) 0.2 mM JA, and (h) 0.2 mM SA. The error bars represent the standard errors of themeans of three independent replicates.

670


KIM et al.

highest expression level of PgPR4 to 4.2�fold at 24 h. Onthe other hand, during Colletotrichum infection, thePgPR4 expression was gradually increased until 72 hafter treatment. On exogenous application of H2O2,the level of transcripts of PgPR4 was increased to 688�fold at 48 h and up to 2829�fold at 72 h (Fig. 5e).Under several hormonal treatments, the PgPR4 tran�script level was increased remarkably. In the case of ABAtreatment, the PgPR4 showed a high expression level to1032�fold at 4 h and reduced at 8 h, then continuouslyincreased until 72 h (2319�fold) (Fig. 5f). At a JAstress, the PgPR4 transcript level was slightlyincreased and peaked at 8�h time�point (158.5�fold)(Fig. 5g). SA treatment also caused an increase in thePgPR4 transcript level to maximum accumulation(556.7�fold) at 8 h (Fig. 5h).

DISCUSSION

In this study, we first described the isolation andcharacterization of the gene encoding PR4 fromP. ginseng. The putative amino acid sequence exhib�ited high similarity to PR4 proteins from other plantspecies, containing three conserved motifs (Fig. 2).Moreover, it contained a Barwin domain which was ahighly conserved structural feature of PR4 protein [8]analyzed by BlastP search. As the similarity of Barwindomain and three motifs in PgPR4 with those of otherPR4 proteins, the secondary structure of PR4 was welldefined except a different N�terminal sequence(Fig. 3b). Three�dimensional structure of PgPR4 con�sists mainly of a large four�stranded antiparallel beta�sheets like in other PR4 [4].

Most PR4 proteins characterized from differentplant species have an N�terminal signal peptide ofvarying length. The PgPR4 possess N�terminal signalpeptide but lacking a C�terminal elongation, suggest�ing that it is most likely not targeted to the vacuole[20], but rather localized in the extracellular space, asother class II PR4 proteins [21, 22]. The extracellularregion is likely to be the first space of defense againstenvironmental stresses or pathogen attack [23].Therefore, the accumulation of PR4 protein in theapoplast implies that this protein plays an importantrole for the first�line defense response. However, forthe lack of cysteine�rich sequence of the heveindomain, PgPR4 protein seems not have fungus�bind�ing activity mediated by the N�terminal cysteine�richdomain as the case in the class I PR4 family [9].

Examining the expression of PgPR4 gene is helpfulin understanding its physiological function. Thestrong expression of PgPR4 in the root as in the case ofother reported PR4 genes [10, 22] suggests that PgPR4may play a role for defense mostly in the ginseng root.The high mRNA accumulation in the ginseng seed�lings infected by ginseng soil�born fungi suggests thatthis gene is involved in the defense responses of gin�seng plants against Botrytis and Rhizoctonia infection.PgPR4 exhibited expression specifically against these

fungi rather than against their broad spectrum. Theantifungal activity has been also reported previouslyfor other class II PR4 proteins [24, 25], but the anti�fungal mechanism of them still remains unclear.Recently, class II PR4 from Malus domestica(MdPR4) showed antifungal activity by the inhibitionof hyphal growth of pathogenic fungi [26].

Like previously it was reported that PR4 genescould be induced by fungal infection or other stimuli[19, 27], the expression of PgPR4 gene could also beup�regulated by salinity stress as well as fungal infec�tion. This finding further supports the existence ofoverlapping between biotic and abiotic stresses for therole of PgPR4 in the response mechanisms [10].Maize PR4 was induced by wounding and by treatmentwith ABA or MeJA and accumulated at the pathogenattack [27]. Rice PR4 genes were also expressed at thepathogen attack, including that with R. soloni [28], aswell with abiotic stresses [10]. PgPR4 expression couldbe strongly induced by stress�related signaling mole�cules, such as H2O2, ABA, SA, and JA. MdPR4 genewas also positively regulated by both SA and JA signal�ing pathways [26], and similar results have beenalready reported for wheat [25] and tomato [29],where PR4 were induced by both exogenous JA and SAtreatments. The corresponds to the fact that the SAand JA signaling pathways share some common com�ponents [30].

In conclusion, we observed that PR4 gene from gin�seng was induced strongly against salinity, fungalinfection, and hormones, such as ABA, JA, and SA,implying its involvement in the defense mechanisms ofbiotic and abiotic stress functioning in ginseng. Gin�seng cultivation has difficulties with pathogen infec�tion. Relatively little is known about the molecularstudy of ginseng PR genes. Class II PgPR4 mightaccumulate abundantly in the apoplast to protectagainst the imbalance and impart the increased toler�ance to high�salt and pathogen stresses, utilizing ABA,SA, and JA signaling pathways. Further studies mayfocus on the specific roles of the PR4 gene in stress�induced signal transduction pathways.

ACKNOWLEDGMENTS

This research was supported by iPET (312064�03�1�HD040), Korea Institute of Planning and Evalua�tion for Technology in Food, Agriculture, Forestryand Fisheries, Republic of Korea.

REFERENCES

1. Sels, J., Mathys, J., de Coninck, B.M.A., Cammue, B.P.A.,and de Bolle, M.F.C., Plant pathogenesis�related (PR)proteins: a focus on PR peptides, Plant Physiol. Bio�chem., 2008, vol. 46, pp. 941–950.

2. Van Loon, L.C., Rep, M., and Pieterse, C.M.J., Signif�icance of inducible defense related proteins in infectedplants, Annu. Rev. Phytopathol., 2006, vol. 44, pp. 1–28.



3. Van Loon, L.C. and van Kammen, A., Polyacrylamidedisc electrophoresis of the soluble leaf proteins fromNicotiana tabacum var. 'Samsun' and 'Samsun NN’. II.Changes in protein constitution after infection with tobaccomosaic virus, Virology, 1970, vol. 40, pp. 199–211.

4. Ludvigsen, S. and Poulsen, F.M., Three�dimensionalstructure in solution of barwin, a protein from barleyseed, Biochemistry, 1992, vol. 31, pp. 8783–8789.

5. Neuhaus, J.M., Fritig, B., Linhorst, H.J.M., Meins, F., Jr.,Mikkelsen, J.D., and Ryals, J., A revised nomenclaturefor chitinase genes, Plant Mol. Biol. Rep., 1996, vol. 14,pp. 102–104.

6. Ponstein, A.S., Bres�Vloemans, S.A., Sela�Buurlage, M.B., van den Elzen, P.J., Melchers, L.S.,and Cornelissen, B.J., A novel pathogen and wound�inducible tobacco (Nicotiana tabacum) protein withantifungal activity, Plant Physiol., 1994, vol. 104,pp. 109–118.

7. Guevara�Morato, M.A., de Lacoba, M.G., García�Luque, I., and Serra, M.T., Characterization of apathogenesis�related protein 4 (PR�4) induced in Cap�sicum chinense L3 plants with dual RNase and DNaseactivities, J. Exp. Bot., 2010, vol. 61, pp. 3259–3271.

8. Broekaert, I., Lee, H.I., Kush, A., Chua, N.H., andRaikhel, N., Wound�induced accumulation of mRNAcontaining a hevein sequence in laticifers of rubber tree(Hevea brasiliensis), Proc. Natl. Acad. Sci. USA, 1990,vol. 87, pp. 7633–7637.

9. Odintsova, T.I., Vassilevski, A.A., Slavokhotova, A.A.,Musolyamov, A.K., Finkina, E.I., Khadeeva, N.V.,Rogozhin, E.A., Korostyleva, T.V., Pukhalsky, V.A.,Grishin, E.V., and Egorov, T.A., A novel antifungal hev�ein�type peptide from Triticum kiharae seeds with aunique 10�cysteine motif, FEBS J., 2009, vol. 276,pp. 4266–4275.

10. Wang, N., Xiao, B., and Xiong, L., Identification of acluster of PR4�like genes involved in stress responses inrice, J. Plant Physiol., 2011, vol. 168, pp. 2212–2224.

11. Lee, S.W., Kim, G.S., Park, K.C., Lee, S.H.,Jang, I.B., Eo, J., and Cha, S.W., Growth characteris�tics and ginsenosides content of 4�year�old ginseng byspraying lime�bordeaux mixture in Panax ginsengC. A. Meyer, Kor. J. Med. Crop Sci., 2012, vol. 20,pp. 89–93.

12. Lee, O.R., Sathiyaraj, G., Kim, Y.J., In, J.G., Kwon, W.S.,Kim, J.H., and Yang, D.C., Defense genes induced bypathogens and abiotic stresses in Panax ginsengC.A. Meyer, J. Ginseng Res., 2011, vol. 35, pp. 1–11.

13. Morris, P.C., Kumar, A., Bowles, D.J., and Cuming, A.C.,Osmotic stress and abscisic acid regulate the expressionof the Em gene of wheat, Eur. J. Biochem., 1990,vol. 190, pp. 625–630.

14. Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S.,Wilkins, M.R., Appel, R.D., and Bairoch, A., Proteinidentification and analysis tools on the ExPASy ServerThe Proteomics Protocols Handbook, Walker, J.M, Ed.,Humana Press, 2005, pp. 571–607.

15. Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E.,Clementi, L., Ren, J., Li, W.W., and Noble, W.S.,MEME SUITE: tools for motif discovery and search�ing, Nucleic Acids Res., 2009, vol. 37, pp. 202–208.

16. Arnold, K., Bordoli, L., Kopp, J., and Schwede, T.,The SWISS�MODEL workspace: a web�based envi�ronment for protein structure homology modelling,Bioinformatics, 2006, vol. 22, pp. 195–201.

17. Kim, Y.J., Lee, O.R., Lee, S., Kim, K.T., andYang, D.C., Isolation and characterization of a thetaglutathione S�transferase gene from Panax ginseng C.A.Meyer, J. Ginseng Res., 2012, vol. 36, pp. 449–460.

18. Livak, K.J. and Schmittgen, T.D., Analysis of relativegene expression data using real�time quantitative PCRand the 2(–ΔΔC(T)) method, Methods, 2001, vol. 25,pp. 402–408.

19. Parvin, S., Lee, O.R., Sathiyaraj, G., Khorolragchaa, A.,Kim, Y.J., Miah, Md.G., and Yang, D.C., Modulationof polyamine levels in ginseng hairy root cultures sub�jected to salt, Russ. J. Plant Physiol., 2012, vol. 59,pp. 757–765.

20. Neuhaus, J.M., Sticher, L., Meins, F., Jr., and Boller, T.,A short C�terminal sequence is necessary and sufficientfor the targeting of chitinases to the plant vacuole, Proc.Natl. Acad. Sci. USA, 1991, vol. 88, pp. 10362–10366.

21. Caruso, C., Bertini, L., Tucci, M., Caporale, C.,Leonardi, L., Saccardo, F., Bressan, R.A., Veronese, P.,and Buonocore, V., Isolation and characterization ofwheat cDNA clones encoding PR4 proteins, DNA Seq.,1999, vol. 10, pp. 301–307.

22. Islam, M.A., Sturrock, R.N., andEkramoddoullah, A.K.M., Molecular cloning andgene transcription analyses of barwin�type PR�4 genesfrom Phellinus sulphurascens�infected Douglas�firseedlings, Forest Pathol., 2012, vol. 42, pp. 279–288.

23. Baker, C.J., Roberts, D.P., Mock, N.M.,Whitaker, B.D., Deahl, K.L., and Aver’yanov, A.A.,Apoplastic redox metabolism: synergistic phenolic oxi�dation and a novel oxidative burst, Physiol. Mol. PlantPathol., 2005, vol. 67, pp. 296–303.

24. Li, X., Xia, B., Jiang, Y., Wu, Q., Wang, C., He, L.,Peng, F., and Wang, R., A new pathogenesis�relatedprotein, LrPR4, from Lycoris radiata, and its antifungalactivity against Magnaporthe grisea, Mol. Biol. Rep.,2010, vol. 37, pp. 995–1001.

25. Caruso, C., Caporale, C., Chilosi, G., Vacca, F., Ber�tini, L., Magro, P., Poerio, E., and Buonocore, V.,Structural and antifungal properties of a pathogenesis�related protein from wheat kernel, J. Protein Chem.,1996, vol. 15, pp. 35–44.

26. Bai, S., Dong, C., Li, B., and Dai, H., A PR�4 geneidentified from Malus domestica is involved in thedefense responses against Botryosphaeria dothidea,Plant Physiol., 2013, vol. 62, pp. 23–32.

27. Bravo, J.M., Campo, S., Murillo, I., Coca, M., andSegundo, B.S., Fungus� and wound�induced accumu�lation of mRNA containing a class II chitinase of thepathogenesis�related protein 4 (PR�4) family of maize,Plant Mol. Biol., 2003, vol. 52, pp. 745–759.

28. Zhu, T., Song, F., and Zheng, Z., Molecular character�ization of the rice pathogenesis�related protein, OsPR�4b,and its antifungal activity against Rhizoctonia solani,J. Phytopathol., 2006, vol. 154, pp. 378–384.

29. Kan, J.A.L., Cozijnsen, T., Danhash, N., andWit, P.J.G.M., Induction of tomato stress proteinmRNAs by ethephon, 2,6�dichloroisonicotinic acidand salicylate, Plant Mol. Biol., 1995, vol. 27,pp. 1205–1213.

30. Schenk, P.M., Kazan, K., Wilson, I., Anderson, J.P.,Richmond, T., Somerville, S.C., and Manners, J.M.,Coordinated plant defense responses in Arabidopsisrevealed by microarray analysis, Proc. Natl. Acad. Sci.USA, 2000, vol. 97, pp. 11 655—11 660.

Documents

Functional characterization of the pathogenesis-related protein family 10 gene, PgPR10-4, from Panax ginseng in response to environmental stresses