Differential contribution of PB1-F2 to the virulence of highly pathogenic H5N1 influenza A virus in mammalian and avian species

Differential Contribution of PB1-F2 to the Virulence ofHighly Pathogenic H5N1 Influenza A Virus in Mammalianand Avian SpeciesMirco Schmolke1, Balaji Manicassamy1, Lindomar Pena2, Troy Sutton2, Rong Hai1, Zsuzsanna T Varga1,

Benjamin G Hale1, John Steel1,3, Daniel R Perez2, Adolfo Garcıa-Sastre1,4,5*

1 Department of Microbiology, Mount Sinai School of Medicine, New York, New York, United States of America, 2 Department of Veterinary Medicine, University of

Maryland, College Park, Maryland, United States of America, 3 Department of Microbiology and Immunology, School of Medicine, Emory University, Rollins Research

Center, Atlanta, Georgia, United States of America, 4 Institute of Global Health and Emerging Pathogens, Mount Sinai School of Medicine, New York, New York, United

States of America, 5 Department of Medicine, Mount Sinai School of Medicine, New York, New York, United States of America

Abstract

Highly pathogenic avian influenza A viruses (HPAIV) of the H5N1 subtype occasionally transmit from birds to humans andcan cause severe systemic infections in both hosts. PB1-F2 is an alternative translation product of the viral PB1 segment thatwas initially characterized as a pro-apoptotic mitochondrial viral pathogenicity factor. A full-length PB1-F2 has been presentin all human influenza pandemic virus isolates of the 20th century, but appears to be lost evolutionarily over time as the newvirus establishes itself and circulates in the human host. In contrast, the open reading frame (ORF) for PB1-F2 is exceptionallywell-conserved in avian influenza virus isolates. Here we perform a comparative study to show for the first time that PB1-F2is a pathogenicity determinant for HPAIV (A/Viet Nam/1203/2004, VN1203 (H5N1)) in both mammals and birds. In amammalian host, the rare N66S polymorphism in PB1-F2 that was previously described to be associated with high lethalityof the 1918 influenza A virus showed increased replication and virulence of a recombinant VN1203 H5N1 virus, whiledeletion of the entire PB1-F2 ORF had negligible effects. Interestingly, the N66S substituted virus efficiently invades the CNSand replicates in the brain of Mx+/+ mice. In ducks deletion of PB1-F2 clearly resulted in delayed onset of clinical symptomsand systemic spreading of virus, while variations at position 66 played only a minor role in pathogenesis. These dataimplicate PB1-F2 as an important pathogenicity factor in ducks independent of sequence variations at position 66. Our datacould explain why PB1-F2 is conserved in avian influenza virus isolates and only impacts pathogenicity in mammals whencontaining certain amino acid motifs such as the rare N66S polymorphism.

Citation: Schmolke M, Manicassamy B, Pena L, Sutton T, Hai R, et al. (2011) Differential Contribution of PB1-F2 to the Virulence of Highly Pathogenic H5N1Influenza A Virus in Mammalian and Avian Species. PLoS Pathog 7(8): e1002186. doi:10.1371/journal.ppat.1002186

Editor: Andrew Pekosz, Johns Hopkins University - Bloomberg School of Public Health, United States of America

Received February 8, 2011; Accepted June 15, 2011; Published August 11, 2011

Copyright: � 2011 Schmolke et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study is partly supported by NIAID grants U19AI083025 (AG-S) and P01AI058113 (AG-S), and by CRIP, and NIAID funded Center for Research inInfluenza Pathogenesis, HHSN266200700010C (AG-S and DRP). John Steel is supported by a Career Development Fellowship from the Northeast BiodefenseCenter (U54-AI057158-Lipkin). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Direct bird-to-human transmission of highly pathogenic avian

influenza A viruses (HPAIV) of the H5N1 subtype was first

reported in 1997 [1]. Since then, 518 human cases have been

confirmed (WHO: updated January 20th, 2011). Unlike seasonal

influenza A viruses, HPAIVs do not yet have the ability to spread

directly from human-to-human, a likely consequence of multiple

species barriers, including their preferential attachment to alpha

2,3-linked sialic acids which are rarely present in the upper regions

of the human respiratory tract [2]. However, human infections

with these viruses often clinically manifest with an unusual

hyperactivation of the host immune response, vast overproduction

of cytokines and chemokines, severe inflammatory response

syndrome, fever, pneumonia, pulmonary hemorrhage, acute

respiratory distress syndrome, lymphopenia, prominent hemopha-

gocytosis, disseminated intravascular thrombosis, diarrhea and

multiorgan failure [3,4,5,6,7]. Despite the low number of cases so

far, the overall human mortality rate of HPAIV (,60%, WHO:

updated January 20th, 2011) is of serious concern, and the

possibility that these HPAIVs might reassort with a circulating

human strain, thereby potentially integrating lethality and

transmissibility, is a continuous public-health risk.

Waterfowl, particularly ducks, are an important natural reservoir

for a variety of influenza A viruses [8]. Infections with low

pathogenic avian influenza A virus are usually asymptomatic in

ducks [9]. The virus mainly replicates in enterocytes in the digestive

tract of infected animals and is shed in the feces [10,11]. Even most

HPAIV infections only cause mild clinical signs in ducks and

immune competent animals usually recover from infection [12]. In

contrast, chickens often die abruptly by infection with HPAIV.

Despite similar multi-organ tropism in ducks and chicken, HPAIV

apparently replicates better in chicken, as higher viral titers are

commonly observed [12]. Exceptions to this are clade 2.2 H5N1

HPAIVs, which cause death in experimentally infected ducks [13].

PB1-F2 was identified ,10 years ago during the screening of

MHC presented epitopes of alternative ORF gene products from

influenza A virus infected cells [14]. This 90 amino acid

PLoS Pathogens | www.plospathogens.org 1 August 2011 | Volume 7 | Issue 8 | e1002186

polypeptide is translated from the PB1 mRNA from an alternative

start codon in the +1 reading frame, approximately 100 base pairs

downstream of the PB1 start codon. Initially PB1-F2 was

characterized as a pro-apoptotic peptide, integrating into the

inner mitochondrial membrane and disrupting mitochondrial

membrane potential, apparently with a preference for monocytic

cells [14,15,16,17]. In this regard, later studies showed that PB1-

F2 can interact with the mitochondrial membrane proteins

VDAC-1 and ANT3 [18], both of which are involved in

maintaining the mitochondrial membrane potential [19]. For the

mouse-adapted human H1N1 isolate A/PR/8/1934 (PR8), PB1-

F2 can increase the viral polymerase function, presumably due to

its interaction with the polymerase subunit PB1 [20]. Recent

studies have confirmed both the pro-apoptotic and polymerase

enhancing functions of PB1-F2, but have clearly shown that these

activities are highly dependent upon the specific virus isolate used

[21].

With parallels to the current sporadic bird-to-human transmis-

sions of H5N1 HPAIV, the causative agent of the devastating 1918

‘‘Spanish flu’’ (1918 H1N1 virus) was proposed to have originated

in humans as a direct transmission from birds. The PB1-F2 of this

virus is unusual in that it contains a serine at position 66 instead of

asparagine. A recombinant mutant 1918 virus with a substitution

of asparagine for serine at position 66 (S66N) showed increased

MLD50, which was approximately two to three orders of

magnitude higher than for the wild type recombinant virus [22].

The molecular mechanism for enhanced pathogenesis caused by

the 66S polymorphism is not fully understood. However, recent

experiments with PB1-F2 derived peptides suggest that the C-

terminus of PB1-F2, which includes residue 66, can induce

proinflammatory cytokines [23]. In addition, PB1-F2 of

1918:H1N1 has been shown to increase secondary bacterial

infections of mice [24].

Descendents of the 1918 H1N1 virus still circulate in humans to

date, but soon after their introduction into humans they acquired

an asparagine at position 66, and in the early 1950s much of the

PB1-F2 ORF was lost by introduction of a premature stop codon

at position 58, thus leaving the polypeptide without its C-terminal

mitochondrial targeting sequence. Furthermore, an identical

truncation occurred independently in human isolates after the

reintroduction of H1N1 viruses expressing a 90aa PB1-F2 in the

late 1970s. For human H2N2 and H3N2 viruses, the original

pandemic viruses had a PB1 gene derived by reassortment from an

avian influenza virus strain, containing a full-length PB1-F2 ORF.

Recently published data suggest that at least the PB1-F2s encoded

by current human H3N2 viruses might not be functional [21].

Thus, it has been suggested that in humans there is no selective

pressure to maintain full-length and/or functional PB1-F2 and

that PB1-F2 might have a different role in mammalian versus

avian hosts [25]. In this regard, reintroduction of the PB1-F2 ORF

by reverse genetics into the novel 2009 pandemic H1N1 virus did

not significantly increase pathogenicity of this virus in mouse [26].

In stark contrast to the situation in human influenza A viruses, full

length PB1-F2 ORFs are highly conserved in viruses isolated from

avian species [25], especially waterfowl. For example, in duck virus

isolates the prevalence of full length PB1-F2 is almost 96%.

Nevertheless, the role of PB1-F2 in avian species is unknown and

comprehensive studies in avian systems have been limited.

The PB1-F2s of all human influenza A virus pandemics of the

last century were derived from avian strains. In this study, we

compared effects of PB1-F2 expression and sequence variation at

position 66 on viral pathogenesis and host response in two

prototype mammalian and avian model organisms, mice and

ducks. We sought to delineate host dependent functions of PB1-F2

from a highly pathogenic H5N1 avian influenza virus that has

crossed the bird-mammal species barrier and caused severe

infections in both host systems.

Materials and Methods

Ethics StatementThis study was carried out in strict accordance with recom-

mendations in the Guide for the Care and Use of Laboratory

Animals of the National Institutes of Health. All mouse procedures

were approved by Institutional Animal Care and Use Committee

(IACUC) of Mount Sinai School of Medicine and performed in

accordance with the IACUC guidelines (Protocol # LA08-00594:

‘‘Contribution of NS1 to pathogenicity and evasion of innate

immunity’’). Duck experiments were conducted under ABSL-3

conditions in a USDA approved facility and performed according

to protocol R-09-93 ‘‘Transmissibility of Influenza A Viruses’’,

approved by the Institutional Animal Care and Use Committee of

the University of Maryland.

Antibodies and ReagentsA customized polyclonal serum against the N-terminal 37aa of

A/Viet Nam/1203/2004 PB1-F2 was raised in rabbits (Gene-

script). Monoclonal mouse anti-influenza A virus anti-NP (clone

28D8) was generated against RNPs of A/Puerto Rico/8/1934 in

the hybridoma facility of MSSM, NY. Mouse monoclonal

antibody against prohibitin was purchased from Abcam (clone

II-14-10).

Viruses and CellsAll recombinant influenza A/Viet Nam/1203/2004 (VN1203)

viruses and the low pathogenic version thereof were described

previously [27]. The PB1-F2 deletion mutant of this virus was

generated by substitution of bases T96C (in PB1-F2-ORF: ATG-

.ACG), C129G (TCA-.TGA), C198G (TCA-.TGA), T210C

(ATG-.ACG) and T231C (ATG-.ACG) in the PB1 ORF of

pPol1-PB1 A/Viet Nam/1203/2004, thus eliminating all 3 ATGs

and introducing 2 additionally two stop codons in the PB1-F2

Author Summary

Influenza A viruses can infect avian and mammalian hosts.Human infections with seasonal influenza virus strains areusually confined to the respiratory tract and are clearedwithin days by the immune system. In contrast, highlypathogenic avian influenza viruses can spread throughoutthe whole body, usually resulting in multi-organ failureand even death in immune competent hosts. Here, weinvestigated the species-specific function of an influenza Avirus protein, PB1-F2, that is highly conserved in avianinfluenza virus strains but which is lost in many isolatesfrom mammalian hosts. Our data indicate that PB1-F2allows successful spreading of the virus throughout thebody in experimentally infected ducks. In contrast, PB1-F2does not contribute to the severity of HPAIV infections inmice. Nevertheless, a polymorphism at position 66 of PB1-F2 (N66S) that was found in the devastating 1918pandemic virus and in several early H5N1 HPAIV isolatesclearly increased pathogenicity of a HPAIV influenza virusin mice. Our findings might explain why the whole PB1-F2ORF is conserved in avian influenza viruses, since itcontributes to viral dissemination and pathogenicity, butcan be lost in mammalian hosts as it has minimal effectson virulence.

Distinct Role of HPAIV PB1-F2 in Mice and Ducks


ORF, using the Quick Change Site directed mutagenesis kit

(Stratagene) according to the manufacturer’s instructions. The

PB1-F2 N66S mutant was generated by introducing the A291G

substitution (in PB1-F2-ORF: AAT-.AGT). None of the

mutations result in non-synonymous changes in the ORF of PB1

or N40. The same mutations were introduced into a low

pathogenic mutant of VN1203 lacking the multi-basic cleavage

site of HA (HAlo). All viruses were plaque purified and successful

PB1-F2 mutagenesis was confirmed by sequencing the viral RNA

of stocks used for infection experiments. No additional mutations

were found in any other gene segment of the recombinant viruses .

Madin Darby canine kidney (MDCK) cells, murine lung

epithelial adenoma cells (LA-4) and duck embryonic fibroblasts

(DEF) were purchased from ATCC and cultured according to the

manufacturer’s instructions. Murine bone marrow derived mac-

rophages (BMDMs) were generated and cultured as described

previously [28]. Murine bone marrow derived dendritic cells

(BMDDCs) were isolated as BMDMs, but differentiated in the

presence of recombinant murine GM-CSF at 20 ng/ml (R&D)

[29].

Animal ModelsC57/BL/6 mice were purchased from Jackson Laboratories.

C57/BL/6/A2G-Mx1, a mouse line expressing functional Mx1,

was kindly provided by Peter Staeheli, University of Freiburg,

Germany. These mice were generated in a fashion similar to the

previously described BALBc/A2G-Mx1 mice [30]. All viral

infections of mice were performed in accordance with CDC and

USDA guidelines in the ABSL-3+ facility of Mount Sinai School of

Medicine, New York, NY. Briefly, mice were anesthetized by

intraperitoneal injection of ketamine-xylazine and infected intra-

nasally with 50 ml of virus diluted in PBS. The mice were

monitored for clinical signs and weight loss daily. Animals were

humanely euthanized upon reaching 75% of initial body weight.

MLD50 was calculated according to the method of Reed and

Muench. Viral lung titers were determined by standard plaque

assay on MDCK cells [31].

Two-week old White Peking ducks (McMurray Hatchery, IA,

USA) were randomly divided into four treatment groups (n = 16)

and housed in separate isolators. Following the acclimatization

period, animals were mock inoculated with PBS or infected

through natural routes with 104 pfu of the recombinant viruses

diluted in 1 ml PBS (0.5 ml intratracheal, 0.3 ml into the nares,

and 0.2 ml into the eyes). Clinical signs (depression, cyanosis of the

skin, respiratory involvement, diarrhea, edema of the face and/or

head, and neurological signs) were monitored and scored daily. A

pathogenicity index was calculated as previously described [32].

Tracheal and cloacal swabs were taken on days 1, 3 and 5 post-

infection. Viral load of multiple organs were determined on day 1

and 3 post infection using the TCID50 method as described

previously [33].

Quantitative PCR (qPCR) and Primer SequencesTotal RNA was isolated by Qiagen RNeasy Mini Kits (Qiagen)

or TRIzol (Invitrogen) according to the manufacturer’s instruc-

tions. 1–5 mg of total RNA was used for reverse transcription by

oligo-dT priming in a 20 ml volume (1st Strand cDNA synthesis kit,

Roche). 0.5 ml of 1:10 diluted cDNA, 2 ml of 10 mM gene specific

primer mix (sequences for murine cDNAs, duck cDNAs and

influenza segment 7 see Table 1) and 5 ml of 2x SYBR-Green

qPCR Mastermix (Roche) were used for qPCR in a Light-

Cycler480 (Roche). Mean N-fold expression levels of cDNA from

three individual biological samples, each measured in triplicates,

were normalized to 18S rRNA levels and calibrated to mock

treated samples according to the 22DDCT method [34].

Immunofluorescence MicroscopyImmunofluorescence microscopy was performed using a Zeiss

Axioplan fluorescence microscope and Axiovision image acquisi-

tion and analysis software at the MSSM-Microscopy Shared

Resource Facility, supported with funding from NIH-NCI shared

resources grant (5R24 CA095823-04), NSF Major Research

Instrumentation grant (DBI-9724504) and NIH shared instru-

mentation grant (1 S10 RR0 9145-01).

SDS-PAGE and Western Blot AnalysisSDS PAGE and western blot were performed as described

previously [35]. Briefly, total cell lysates were obtained by

collecting adherant and floating cells in disruption buffer

containing 6 M urea, 2 M b-mercaptoethanol and 4% SDS.

Genomic DNA was fragmented by brief sonication on ice. Lysates

were not centrifuged before gel electrophoresis since this method

of disruption does not yield a visible pellet after centrifugation.

Total protein lysates were separated on 4–15% or 4–20% gradient

Ready-Gels (Biorad) and transferred to PVDF membranes for

western blot analysis.

Polymerase AssayThe murine RNA-polymerase I driven negative sense luciferase

reporter plasmid (pcDNA3.1-IVAR-Luc) was cloned by replacing

the CMV promotor of pcDNA3.1 (Invitrogen) with bp -2150 - +1

of the murine 45S ribosomal RNA promotor. We used pMrTsp-9-

T10 plasmid, kindly provided by Dr. Gernoth Langst, University

of Regensburg, Germany, as template for amplification of murine

RNA polymerase I promotor and terminator sequences [36]. A

negatively orientated firefly luciferase coding sequence, flanked by

influenza NP promotor elements was inserted downstream. The

murine RNA Pol1 terminator of 45S ribosomal RNA was

introduced downstream of the negatively oriented reporter gene.

Murine 3T3 fibroblasts were transfected in 24 well format with

50–400 ng of pCAGGS PB1 (VN1203 WT or mutants PB1-F2

generated as described for the recombinant viruses), 100 ng

pCAGGS-PB2 and -PA and 200 ng of pCAGGS-NP (all

VN1203), 100 ng of pcDNA3.1-IVAR-Luciferase and 50 ng of

pCMV-Renilla-luciferase, using Lipofectamin 2000 (Invitrogen)

according to the manufacturers instructions. Cells were lysed 24 h

post transfection according to the manufacturers instruction (Dual

Luciferase Kit Promega). Firefly-Luciferase activity was normal-

ized by Renilla activity. Samples were measured in independent

biological triplicates.

Statistical AnalysisAll statistical analyses were performed using GraphPad Prism

Software Version 5.00 (GraphPad Software Inc., San Diego, CA).

Comparison between two treatment means was achieved using a

two-tailed Student t-test, whereas multiple comparisons were

carried out by analysis of variance (ANOVA) followed by

Dunnett’s test using the WT virus as the control. Survival analyses

were carried out following the Kaplan Meier procedure. The

differences were considered statistically significant at p,0.05.

Results

PB1-F2 has been associated with a spectrum of functions within

influenza A virus infected cells. Some of these functions are

believed to be host cell type and/or virus strain specific. To

comparatively study the role of a HPAIV PB1-F2 in both



mammalian and avian hosts, we used reverse genetics to generate

the wild-type recombinant VN/1203/04 (H5N1) (VN1203) virus

(WT), together with a PB1-F2 deficient mutant (dF2) and a

substitution mutant bearing a serine at position 66 (N66S).

VN1203 was selected as this viral strain can efficiently infect both

mice and ducks [37,38], and causes severe disease in these species.

PB1-F2 with the N66S Mutation Increases H5N1 ViralReplication in Murine Cells

We first studied the replication kinetics of VN1203 WT, dF2

and N66S viruses in the murine lung epithelial adenoma cell-

line LA-4. Although similar or higher levels of viral nucleopro-

tein (NP) were observed for the mutant viruses as compared to

WT, the expression of the N66S mutant form of PB1-F2 was

lower than that of WT and barely detectable at 24 h post

infection (Fig. 1A, panel 2, long exposure). Treatment with

10 mM lactocystin resulted in increased levels of PB1-F2 N66S

but not WT, suggesting specific proteasomal degradation of the

mutant PB1-F2 (Fig. 1B). Interestingly, the N66S substituted

PB1-F2 migrates slower in the gel, possibly indicating a

posttranslational modification. Interestingly, the PB1-F2 defi-

cient virus generates higher amounts of NP 4 h post infection.

These levels adjust to WT at later timepoints, implying an early

deregulation of protein expression. However, deletion of the

PB1-F2 ORF does not change polymerase activity (Fig. 1C) or

viral multi-cycle growth in these cells: the WT and PB1-F2

deficient viruses grow to identical titers. Notably, the N66S

substituted virus grows to 10-fold higher titers than WT or dF2

after 72 h (Fig. 1D).

Previous studies have suggested that PB1-F2 may play a role in

monocytic cells. To address the potential cell-type specific effects

of VN1203 PB1-F2, we infected murine bone marrow derived

macrophages (BMDM) and dendritic cells (BMDDC) as a model

system for monocytic cells (Fig. 1E). Notably, in macrophages and

dendritic cells, we were unable to detect PB1-F2 expression (data

not shown), possibly as a result of low protein stability and/or

lower levels of protein expression. Interestingly, in both these bone

marrow derived cells, the N66S virus appeared to replicate better

than the WT and dF2, as estimated by western blot against viral

nucleoprotein at 8 and 16 h post-infection.

VN1203 PB1-F2 Does Not Predominantly Co-Localizewith Mitochondria

PB1-F2 was initially described to localize predominantly to

mitochondria (as shown for A/Puerto Rico/8/1934 [14]) but also in

the cytoplasm and nucleus [39], depending on the virus strain

studied. The mitochondrial localization and interaction with

mitochondrial membrane proteins VDAC-1 and ANT-3 were

proposed to be the basis for the PB1-F2 pro-apoptotic function [18].

Since the N66S substitution is localized in close proximity to the

mitochondrial localization sequence, we tested whether this

substitution alters the sub-cellular localization of VN1203 PB1-F2

in mouse epithelial cells. By immunofluorescent staining of LA-4

murine lung epithelial cells infected with the WT, dF2 or N66S

mutants of VN1203, we could detect WT PB1-F2 as early as 8 h p.i.

(Fig. S1A, panel 2). At 4 h p.i. no PB1-F2 specific signal was

detectable (data not shown). In agreement with our western blot

data the N66S substituted PB1-F2 was not detectable at 8h p.i.. WT

Table 1. qPCR primers for murine and duck cDNAs and influenza segment 7.

mouse gene forward (59 -39) reverse (59 -39)

IL1beta GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT

IL18 GACTCTTGCGTCAACTTCAAGG CAGGCTGTCTTTTGTCAACGA

IFNbeta CAGCTCCAAGAAAGGACGAAC GGCAGTGTAACTCTTCTGCAT

Mx1 GACCATAGGGGTCTTGACCAA AGACTTGCTCTTTCTGAAAAGCC

IFNgamma TGCTGATGGGAGGAGATGTCTAC TTTCTTTCAGGGACAGCCTGTTAC

IL6 TGAGATCTACTCGGCAAACCTAGTG CTTCGTAGAGAACAACATAAGTCAGATACC

ISG15 GGTGTCCGTGACTAACTCCAT TGGAAAGGGTAAGACCGTCCT

MIP1alpha CGAGTACCAGTCCCTTTTCTGTTC AAGACTTGGTTGCAGAGTGTCATG

MIP1beta AAGCTGCCGGGAGGTGTAAG TGTCTGCCCTCTCTCTCCTCTTG

IFNalpha1 TCAAAGGACTCATCTGCTGCTTG CCACCTGCTGCATCAGACAAC

CCL5 TTGACCCGTAAATCTGAAGCTAAT TCACAGTCCGAGTCACACTAGTTCAC

OAS1 ATGGAGCACGGACTCAGGA TCACACACGACATTGACGGC

IL10 GGGTTGCCAAGCCTTATCG TCTCACCCAGGGAATTCAAATG

CX3CL1 GGACAACACCATTACTGTGCCTTAG CACACAGGGATGGCTGAGTTCTAC

IP10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA

18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG

IAV segment forward (59 -39) reverse (59 -39)

influenza M AGATGAGTCTTCTAACCGAGGTCG TGCAAAAACATCTTCAAGTCTCTG

Duck gene forward (59 -39) reverse (59 -39)

GAPDH ATGTTCGTGATGGGTGTGAA CTGTCTTCGTGTGTGGCTGT

IL6 GTGCGAGAACAGCATGGAGATG GAATCTGGGATGACCACTTCATC

IFNB CCTCAACCAGATCCAGCATT GGATGAGGCTGTGAGAGGAG

doi:10.1371/journal.ppat.1002186.t001



PB1-F2 was expressed predominantly in the nucleus, with a few cells

showing diffuse staining of the whole cell body. Remarkably, co-

staining against the NP of influenza virus revealed that only a minor

portion of infected (NP positive) cells showed PB1-F2 staining,

underlining the low expression or stability levels of the PB1-F2

peptide. In agreement with our western blot data, the N66S

substituted PB1-F2 was not detectable at 8 h p.i. However, at 24 h

post infection both WT and N66S variants of PB1-F2 were

detectable, although again not all NP positive cells were positive for

PB1-F2, especially for the N66S mutant (Fig. S1B). At this time

point both variants of PB1-F2 were distributed throughout the

cytoplasm and nucleus. To test if the cytoplasmic PB1-F2 is

Figure 1. Effects of PB1-F2 expression on replication of A/Viet Nam/1203/2004 in murine cells in vitro. A) Time course of viral proteinexpression. Murine lung epithelial cells (LA-4) were infected with 2MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S. Cells were lysed afterindicated time points. Whole cell extracts were analyzed by western blot with specific antibodies against PB1-F2 (upper two panels, short and longexposure, respectively, PB1-F2 is indicated by black arrows), viral nucleoprotein (NP) or beta-Actin. B) PB1-F2 expression in presence or absence of10 mM lactocystin. LA4 were infected with 2MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S. Cells were lysed after 24 h. Whole cell extracts wereanalyzed by western blot with specific antibodies against PB1-F2 (upper three panels, short, medium and long exposure, respectively, PB1-F2 isindicated by black arrows), equal loading is indicated by an unspecific background band (lower panel). C) Polymerase Assay. Murine fibroblasts (3T3)were transfected with indicated amounts of pCAGGS-PB1 A/Viet Nam/1203/2004 wild type (blue), dF2 (red) or N66S (green) and constant amounts ofPB2, PA, NP and reporter gene expressing plasmids as described in Material and Methods. Mean firefly-luciferase activity of three independenttransfections normalized to renilla-luciferase activity is depicted. Error bars represent SD. No significant differences were detected. D) Multi-cyclegrowth curve of A/Viet Nam/1203/2004 wild type (blue), dF2 (red) or N66S (green) on LA-4. Cells were infected with 0.05MOI of virus. Viralsupernatants were taken at the indicated time points. Viral titers were determined by standard plaque assay on MDCK in absence of trypsin. Meanpfu/ml of independent triplicates 6SD indicated by the error bar are depicted. P-values are indicated (*p,0.05) using WT as standard. E) Time courseof viral protein expression in LA-4 (upper panel), bone marrow derived macrophages (BMDM, middle panel) and bone marrow derived dendritic cells(BMDDC). Cells were infected with 2MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S and lysed after indicated time points. Whole cell extractswere analyzed by western blot with specific antibodies against viral nucleoprotein (NP) and tubulin.doi:10.1371/journal.ppat.1002186.g001



localized at mitochondria, we co-stained the infected LA-4 cells for

prohibitin, an inner mitochondrial membrane protein. As shown in

Fig. S1C (and enlarged in Fig. S1D), we did not detect predominant

co-localization of PB1-F2 WT or N66S with prohibitin, but rather a

diffuse distribution throughout the cytoplasm and nucleus.

N66S Substitution in VN1203 PB1-F2 Reduces AntiviralResponses in Murine Monocytic Cells

Recent findings implicate an interferon-antagonistic function as

a new role for PB1-F2 during viral infection. Using whole genome

transcriptome analysis, Connenello et al showed increased levels of

type I interferon and interferon stimulated genes (ISGs) in BALB/

c mice infected with a recombinant A/WSN/1933 virus

containing a A/Hong Kong/483/97 PB1 segment with a N66

PB1-F2 substitution, as compared to a virus containing the S66

PB1-F2 [40]. Thus, we tested whether the substitution (N66S) in a

wild type VN1203 H5N1 background would also lead to altered

cellular innate responses in LA-4 cells as well as in BMDMs and

BMDDCs. In all cell types, we could not detect major differences

in the mRNA levels of types I and III interferon induced by

VN1203 WT or dF2 virus. Accordingly, the induction levels of

ISGs (IP10, MxA, ISG15) did not significantly depend on presence

of PB1-F2 (Fig. 2A, B, C). In both BMDMs and BMDDCs, the

dF2 virus induced significantly higher levels of proinflammatory

cytokines IL1beta and IL6. We could not see these differences in

epithelial cells (Fig. 2A). Interestingly, despite higher levels of

replication, the N66S mutant virus clearly induced lower levels of

interferon dependent antiviral responses in BMDMs and

BMDDCs (Fig. 2B and C). Presumably as a consequence of this,

mRNA levels of ISGs and cytokines and chemokines were

significantly reduced in N66S virus infected BMDMs and

BMDDCs. Similar results were seen at early time points of

infection in vivo by Connenello and colleagues [40]. Surprisingly,

this effect was not visible in LA-4 cells, suggesting a monocytic cell

type specific effect of PB1-F2 with regards interferon antagonism.

PB1-F2 N66S Increases Pathogenesis of Highly VirulentH5N1 in Mice

Next we were interested in determining whether deletion of the

PB1-F2 ORF or the N66S substitution would affect viral

pathogenesis in vivo. The mouse 50% lethal dose (MLD50) of

recombinant WT VN1203 in C57/BL/6 is ,3 pfu (John Steel,

unpublished data). Since we hypothesized that the N66S

substitution might potentially reduce the MLD50, (based on the

higher replication observed in murine lung epithelial cells), we

decided to conduct this experiment in C57/BL/6/A2G-Mx1 mice

that express a functional Mx1 gene product. Previous studies have

shown a dramatically increased resistance of Mx1+/+ mice to both

highly pathogenic avian influenza H5N1 viruses and the 1918

pandemic H1N1 virus [38]. As expected, the MLD50 for

recombinant WT VN1203 was more than 200,000 times higher

in C57/BL/6/A2G-Mx1 mice (MLD50 = 6.7610E5 pfu) com-

pared to C57/BL/6 (MLD50 = 3.16 pfu) (Fig. 3G). Interestingly,

only animals infected with 2.5610E6 of the wild type virus showed

weight loss and decreased survival (Fig. 3A and D). The mice

infected with lower doses of virus were completely asymptomatic.

Deletion of the PB1-F2 ORF resulted in a slightly decreased

pathogenicity as compared with WT (Fig. 2B, E and G:

MLD50 = 1.7610E6 pfu). Interestingly, the N66S substituted virus

showed an increased pathogenicity compared to the wild type

virus (Fig. 3C and F; MLD50 = 1.1610E5 pfu). Moreover, we

observed sustained weight loss, clear signs of sickness (ruffled fur,

lethargy) and death in these animals, even in the groups infected

with 2.5610E4 and 2.5610E3 pfu. Interestingly, in these lower

dose infected animals (2.5610E3 and 2.5610E4) onset of death

occurred unusually late around day 10 post infection. We noted

that prior to death, starting at day 9 post infection, 3 out of 6 mice

infected with 2.5610E3 pfu VN1203 N66S showed neurologic

symptoms (e.g. hemi-paralysis) indicating a potential viral infection

of the central nervous system (CNS). Notably, this was not

observed for the WT or dF2 viruses at any dose used. Also, it was

not observed in animals infected with higher doses of the N66S

virus, likely due to death from pulmonary infection.

Surprisingly, when using a low pathogenic mutant of VN1203

(HAlo) lacking the multi-basic cleavage site, we did not observe

differences in lethality (Fig. 3G right panel) or viral lung titers (data

not shown) between WT, dF2 or N66S viruses. Given that without

the multi-basic cleavage site HAlo viruses are likely to be confined

to the respiratory tract, these data suggest that tissue tropism has a

role in determining the impact of PB1-F2.

PB1-F2 N66S Increases H5N1 Viral Replication andNeurotropic Spreading in Mice

In the murine lung epithelial cells (LA-4) the N66S virus replicated

to titers 10-fold higher than WT and dF2 (Fig. 1B). Similarly, we

observed almost 100-fold higher titers in N66S virus infected mouse

lungs on days 2 and 5 post infection, as compared to WT and dF2

infected mice (Fig. 4A). The late neurological symptoms observed in

low dose VN1203 N66S virus infected mice suggested spreading of

the virus to the CNS at later stages of infection. We thus conducted a

separate infection study in C57/BL/6/A2G-Mx1 mice using a sub

lethal dose of 2.5610E3 pfu and measured viral titers in the lung,

spleen and brain on day 8 post infection, a day before the onset of

neurological symptoms. At this time-point none of the groups showed

any detectable levels of virus in the lung (data not shown). As

described for highly pathogenic influenza A virus infections in Mx1

positive mice [38], we did not detect systemic spread of WT or dF2

VN1203 into brain or spleen by plaque assay. However, in 6 out of 7

animals infected with N66S virus, we detected virus in the brain

(Fig. 4B), but not in spleen or lung (data not shown), suggesting a

specific function of N66S PB1-F2 in neurotropism. To further show

the replication advantage of the N66S substituted virus in neuronal

tissue, we infected mice intracranially with either 10 or 100 pfu and

measured viral titers in the brain 2 days post infection (Fig. 4C). The

N66S substituted virus replicated significantly better in brain tissue

compared to the WT or dF2 viruses in the mice inoculated with 100

pfu (Fig. 4C lower panel). We even observed replication of N66S virus

in one out of three animals inoculated with 10 pfu. It should be

mentioned that 2 out of 4 animals of the WT infected group showed

viral brain titers, but this difference was not significant compared to

the PB1-F2 deficient virus infected mice.

In summary, substitution of serine for asparagine at position 66

of PB1-F2 enhances replication of VN1203 in murine in vitro

models and reduces the IFN response in infected murine

monocytes. In an in vivo mouse model, this substitution enhances

pathogenicity, replication and neurotropism. However, we could

not detect major differences in viral lung titers and only a mildly

altered LD50 in mice when comparing the WT and PB1-F2

deficient viruses. Nevertheless, we observed enhanced mRNA

levels of the proinflammatory cytokines IL-6 and IL-1b in dF2

virus infected monocytic cells.

Expression of PB1-F2 Does Not Alter Viral Replication inDuck Cells in vitro

The PB1-F2 ORF is highly conserved in viruses isolated from

ducks. More than 95% of viruses express a PB1-F2 of 87 amino acids



or longer (NCBI Influenza virus resource: http://www.ncbi.nlm.nih.

gov/genomes/FLU/FLU.html and Influenza Research Database

(IRD): http://www.fludb.org/brc/home.do?decorator = influenza).

We thus hypothesized a specific need to retain PB1-F2 in an avian

host environment and consequently envisaged a different outcome to

our infection study in an avian host as compared to a mammalian

host. To test the growth properties of the three recombinant VN1203

viruses in avian cells we first performed infection experiments in duck

fibroblast cells (DEF). As shown for the murine lung epithelial cells,

the N66S mutant protein was present in lower amounts in infected

cells and expression levels increased in the presence of the proteasome

inhibitor lactocystin (Fig. 5B).

In stark contrast to the murine cell models, we did not observe

any increase in viral replication or viral NP levels by substituting

serine for asparagine at position 66 of VN1203 PB1-F2 (Fig. 5A

and B). Similar to what we observed in the murine lung cell line, in

Figure 2. PB1-F2 alters host response against A/Viet Nam/1203/2004 in murine cells. A–C) LA-4 (A), BMDM (B) and BMDDC (C) wereinfected with 2 MOI of A/Viet Nam/1203/2004 wild type (blue), dF2 (red) or N66S (green). Transcriptional response was measured by gene specificanalysis of cDNA amounts from total lysates 8 h post infection. Expression is depicted as mean nfold of mock samples +SD from three independentsamples. P-values are indicated (*p,0.05, ** p,0.01) using WT as standard.doi:10.1371/journal.ppat.1002186.g002



the infected DEFs the WT PB1-F2 is expressed to higher levels

(already detectable after 4 h post infection, Fig. 5A), than the

N66S variant (first detectable after 24 h). Interestingly, the N66S

PB1-F2 shows a slower migrating form in western blot, as shown in

murine cells, which may indicate a post-translational modification.

Of note, the proteasome inhibition mainly affected the levels of

low molecular weight PB1-F2, again indicating that the higher

molecular weight form could be protected from degradation

(Fig. 5B).

As shown in LA-4 the polyclonal serum raised against the N-

terminus of PB1-F2 detects a higher migrating band only present

in infected duck cells (24 h post infection).

Next we examined the localization of PB1-F2s in infected DEFs.

The WT PB1-F2 was localized mainly to the nucleus at 8 h pi (Fig.

S2A). Similar to infected LA-4 cells, not all NP positive cells were

also positive for PB1-F2. At 24 h post infection, we could detect

both the WT and the N66S PB1-F2 distributed throughout the

whole cell (Fig. S2B). Co-staining for the mitochondrial protein

prohibitin did not reveal predominant mitochondrial localization

of WT or N66S PB1-F2 (Fig. S2C and enlarged in Fig. S2D) as

observed previously in LA-4 cells. This suggests that the inability of

this PB1-F2 to localize to mitochondria is not a species-specific

phenomenon.

Deletion of PB1-F2 Reduces Pathogenicity of H5N1 inDucks

To address a potential impact of PB1-F2 deletion or N66S

substitution in vivo, we next conducted pathogenicity studies in

two-week-old white Peking ducks. The infected ducks were

monitored for clinical signs and scored daily as described

Figure 3. Effects of PB1-F2 expression on viral pathogenesis in vivo. A–C) Weight loss curves of C57/BL/6/A2G-Mx1 mice infected withindicated doses of A/Viet Nam/1203/2004 wild type (A), dF2 (B) or N66S (C). Animals were excluded from analysis when reaching less than 75% initialbody weight. Mean %-body weight of 5-9 (initial group size) animals normalized to initial weight +SD is depicted. D–F) Survival curves of C57/BL/6/A2G-Mx1 mice infected with indicated doses of A/Viet Nam/1203/2004 wild type (D), dF2 (E) or N66S (F). %-survival of 5–9 (initial group size) animalsis depicted. (G) MLD50 of A/Viet Nam/1203/2004 wild type, dF2 or N66S (high and low pathogenic version) in C57/BL/6/A2G-Mx1 and C57/BL/6 mice.doi:10.1371/journal.ppat.1002186.g003



previously [32,33]. In the first two days of infection, we could

clearly detect differences in the onset of clinical signs between the

three groups of animals (Table 2 and Fig. 6A and B). The WT

virus infected animals show sickness (n = 7) or severe sickness

(n = 3) by day 2 of infection (pathogenicity index (PI) of 2.28). In

contrast the N66S virus infected ducks show a slightly faster

disease progression (day 1: sick n = 9, severely sick n = 1,

(PI = 2.4)). However, both viruses efficiently killed the ducks (9/

10 animals) after 10 days of infection. In contrast, the dF2 virus

infected animals progressed showed significantly slower progres-

sion of clinical signs of sickness (day 2: sick n = 1, (PI = 1.66) as

compared to the WT and N66S virus infection. Furthermore, the

dF2 virus infected animals showed a greater survival rate (3/10),

although this difference is not statistically significant. It has to be

pointed out that all three viruses clearly have a pathogenicity index

of .1.2, defining each as a highly pathogenic virus in birds.

Expression of WT and N66S PB1-F2 Accelerates SystemicSpreading of VN1203 in Ducks but Does Not InfluenceShedding

To test if PB1-F2 plays a role in viral dissemination to organs in

infected ducks, we measured viral titers in different organs at

various time post infection. By day 1 post infection TCID50 in

colon, liver, spleen and kidney are higher in WT and N66S virus

infected animals compared to dF2 virus infected animals (Fig. 6C).

However, likely due to the use of outbred animals, the variation

within each group was high and by day 3 post infection no

statistically significant differences were detectable (Fig. 6D).

Surprisingly, we did not observe enhanced viral titers in cloacal

swabs of WT or N66S virus infected ducks compared to dF2 virus

infected animals (Fig. 6E and F) implicating similar shedding rates.

In ducks, we could not detect different levels of type I interferon

mRNA on day 1 or 3 post infection in spleen, lung or colon of the

three groups of infected animals (data not shown). Thus it is

possible, at least for VN1203, that PB1-F2 has an interferon-

antagonist independent role in enhancing pathogenicity in avian

hosts.

Overall, we observed that the VN1203 WT and N66S viruses

behave very similarly in ducks with respect to replication and

pathogenicity. Both viruses spread systemically to spleen and

kidney by day 1 post infection and onset of severe clinical signs

occurs by day 1 or 2 post infection. In contrast the deletion of PB1-

F2 resulted in delayed onset of clinical symptoms and systemic

spread of the virus is first detectable only by day 3 post infection.

Our data suggest that the full length PB1-F2 ORF is important for

rapid systemic viral dissemination of HPAIV in birds. This

contrasts with our mammalian host data, in which deletion of PB1-

F2 has only a minor impact on replication and pathogenicity,

although variations at position 66 can enhance virulence.

Discussion

HPAIV infections are associated with hyper-production of

inflammatory cytokines and chemokines, systemic viral spreading

and severe multi-organ damage in both mammalian and avian

hosts. The viral and host factors contributing to this unusually

severe outcome have been studied for years, but are still not

completely identified or understood. Here we analyzed the impact

of PB1-F2, a non-structural viral protein, on viral pathogenesis

and host response in mammalian and avian model systems. PB1-

F2 is present in the majority of avian isolates of all subtypes, but

the full length open reading frame is lost over time in many

mammalian isolates. To our knowledge this is the first comparative

Figure 4. Effects of PB1-F2 expression on viral replication and spreading to the brain in mice. A) C57/BL/6/A2G-Mx1 mice were infectedwith 2.5610E6 pfu of VN1203 wild type (blue), dF2 (red) or N66S (green). Viral lung titers were determined on day 2 and 5 post infection in 3 animalsby standard plaque assay on MDCK cells. Titers of individual animals (pfu/ml) are depicted, the detect ion limit of the assay was 50 pfu/ml. P-values forthe mean plaque titers are indicated (*p,0.05) using WT as standard. B) C57/BL/6/A2G-Mx1 mice were infected with 2.5610E3 pfu of VN1203 wildtype (blue), dF2 (red) or N66S (green). Viral brain titers on day 8 post infection of individual animals are depicted. The detection limit of the assay was50 pfu/ml. C) Direct brain-inoculation of VN1203 wild type (blue), dF2 (red) or N66S (green) (10pfu upper panel, 100pfu lower panel). Viral brain titers(pfu/ml) 48 h post infection are shown for each animal.doi:10.1371/journal.ppat.1002186.g004



study using an iso-genic approach to test the function of PB1-F2 in

a HPAIV in birds and mammals. We further analyzed the impact

of a N66S substitution in PB1-F2, which was previously shown to

be associated with viral pathogenesis of the 1918:H1N1 pandemic

virus [22] and that was recently proposed to promote interferon

antagonistic properties of PB1-F2 in mice [40].

In the murine cell system, the three tested viruses showed

differences in growth and host response depending on the cell

model used. In monocytic cells (BMDMs and BMDDCs) the N66S

substituted virus replicated faster as indicated by higher levels of

NP and induced lower levels of type I interferon, ISGs and

proinflammatory cytokines and chemokines. Interestingly, the

PB1-F2 deleted virus induced higher levels of IL-6 and IL-1beta in

monocytic cells. In contrast, in lung epithelial cells the host

response was similar among the three viruses. A cell type specific

function of PB1-F2 was already proposed when PB1-F2 was

initially described ,10 years ago. Chen et al provided experi-

mental evidence for a pro-apoptotic function of PR8 PB1-F2 that

predominantly affects monocytes [14]. We found that the tested

VN1203 PB1-F2 used in this study does not predominantly

localize to mitochondria. Chen et al showed, that two leucine

residues in the C-terminus of PB1-F2 are essential for mitochon-

drial localization of PB1-F2 (L69 and L75) [39]. They could show

that PB1-F2 of A/Hong Kong/156/1997 does not localize to

mitochondria due to alternative amino acids at position 69 and 75

(Q69 and H75). Interestingly substitution of these residues with

leucine changes the subcellular localization of PB1-F2 to the

mitochondria, but does not affect virus induced apoptosis levels in

vitro or viral pathogenicity in mice when tested in a 7+1 PR8

system with segment 2 of A/Hong Kong/156/1997. Notably,

PB1-F2 of VN1203 does not contain the essential leucines for

mitochondrial localization at position 69 (69Q) and 75 (75R),

which is in full agreement with what we have observed by

immunofluorescence in infected murine and duck cells. It is thus

unclear if VN1203 shares the published pro-apoptotic function of

PB1-F2s from other viruses (e.g. PR8) or if the cytoplasmic PB1-F2

can still interact with mitochondrial host factors such as VDAC

and ANT3 [18].

When PB1-F2 was initially described [14], it was shown that this

short polypeptide is highly unstable and degraded in proteasome

dependent way. We did not observe changes in the levels of WT

PB1-F2 when blocking proteasome function. However, we show

Figure 5. Effects of PB1-F2 expression on replication of A/Viet Nam/1203/2004 in duck fibroblasts in vitro. A) Time course of viralprotein expression. Duck embryonic fibroblasts (DEF) were infected with 2MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S. Cells were lysed afterindicated time points. Whole cell extracts were analyzed by western blot with specific antibodies against PB1-F2 (upper two panels, short and longexposure, respectively), viral nucleoprotein (NP) or beta-Actin. B) PB1-F2 expression in presence or absence of 10 mM lactocystin. DEF were infectedwith 2MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S. Cells were lysed after 24 h. Whole cell extracts were analyzed by western blot withspecific antibodies against PB1-F2 (upper three panels, short, medium and long exposure, respectively, PB1-F2 is indicated by black arrows), equalloading is indicated by GAPDH levels (lower panel). C) Multi-cycle growth curve of A/Viet Nam/1203/2004 wild type (blue), dF2 (red) or N66S (green)on DEF. Cells were infected with 0.05MOI of virus. Viral supernatants were taken at the indicated time points. Viral titers were determined by standardplaque assay on MDCK in absence of trypsin. Mean pfu/ml of independent triplicates 6SD indicated by the error bar are depicted.doi:10.1371/journal.ppat.1002186.g005



here in murine and duck cells that the protein levels of the N66S

mutant can be increased by exposing the infected cells to

lactocystin. This increase mainly affects the faster migrating

protein species and could implicate that a modified version of PB1-

F2 N66S is protected from proteasomal degradation. At this point

it is unclear if and how the stability of N66S affects its function in

increasing pathogenicity of the virus.

We consistently observed an increase of viral proteins and/or

viral titers in the N66S virus infected murine cells. Mazur et al

have shown that PB1-F2 of PR8 can interact with the polymerase

subunit PB1 and enhance polymerase function. Nevertheless, this

does not affect viral replication and pathogenicity in vitro and in

vivo [20,21]. McAuley et al could show that PB1-F2 of VN1203

can increase the polymerase function of a PR8 derived polymerase

complex in human 293T [21]. However, it did not affect

pathogenesis of a recombinant PR8 with a VN1203 PB1-F2 in

mice. Nevertheless, none of these studies addressed a potential

effect of sequence variations at position 66. In our mouse fibroblast

system (3T3 cells), we did not detect changes in viral polymerase

function in the presence or absence of PB1-F2. Moreover the

N66S substitution did not enhance viral polymerase activity in this

in vitro assay, as could be suspected from the enhanced replication

and enhanced viral protein levels. This is contradictory to the data

presented by McAuley et al. However, it has to be pointed out that

this group combined PR8 polymerase subunits with PB1-F2 from

different viruses [21]. We cannot exclude that the PR8 polymerase

function is specifically modulated by certain PB1-F2s.

We clearly observed enhanced replication of the N66S

substituted virus in vitro and in vivo, resulting in increased

pathogenicity and higher lung titers in mice, consistent with earlier

work using a 7+1 influenza A/WSN/33 virus with an HK/483

PB1 segment [22]. Interestingly, the N66S variant was the only

virus that was able to spread to the CNS of Mx1 positive mice,

leading to detectable viral brain titers 8 days post infection. This

infection of the CNS is most likely responsible for the observed

paralysis in mice infected with low doses of virus and the unusual

second wave of deaths in infected mice around day 10 of infection.

When Mx1 positive mice were initially infected with H5N1 and

the 1918 H1N1 virus [38], no systemic replication could be

detected. We also did not detect systemic viral spreading after

infection with low doses of WT H5N1 virus. Mechanistically it is

not clear at this point how PB1-F2 potentiates spread of the N66S

virus to the central nervous system. It is also intriguing that we

only detected virus in the brain and not in other organs. Direct

viral inoculation of the brain resulted in sustained replication of

the N66S substituted virus, while the WT and dF2 mutant did not

replicate or replicated poorly. This implies that PB1-F2 N66S

supports neuronal dissemination of the virus, and whether this is

due to its specific interaction with a host factor in the brain

remains to determined. Very recently Shinya et al investigated

neuropathogenicity of different H5N1 influenza A virus isolates in

ferrets [41]. Interestingly the authors could show that influenza A/

Hong Kong/483/1997, which contains a serine at position 66 of

PB1-F2 disseminates wider throughout the brain tissue, most likely

by infecting vascular cells, since severe vascular lesions were

observed. These lesions were not found in ferrets infected with a

closely related isolate, A/Hong Kong/486/1997, which contains

an asparagine at positione 66 of PB1-F2. It remains elusive if the

observed phenotype is based on the N66S substitution or other

changes between the two isolates.

To our surprise, we did not observe enhanced viral replication

or pathogenicity of the N66S virus when using a low pathogenic

mutant background of VN1203 lacking the multi-basic cleavage

site in HA. The multi-basic cleavage site is essential for systemic

spreading of HPAIV in mammals, allowing HPAIV to replicate

independently of lung resident extracellular proteases [32]. It

appears then that both a multi-basic cleavage site in HA and a S66

amino-acid residue in PB1-F2 are required to achieve high levels

of replication and spread to the brain in Mx1 competent mice. At

this juncture, we cannot exclude that the enhanced lethality of the

N66S mutant virus and the neurotropism in mice are linked.

Newly developed viral tracking systems, may allow us to find more

details on the type of cells infected by these viruses in vivo [42].

In the Mx1 positive mouse system, the expression of a PB1-F2

with a serine at position 66 clearly enhances viral replication and

pathogenicity in vivo. Interestingly, deletion of the PB1-F2 ORF

had little effect on replication or lethality of the virus, when

compared to the WT virus. This was described earlier for PR8

virus, where the deletion of PB1-F2 did not affect replication and

lethality in mice [24]. In the human H1N1 isolates, the full length

PB1-F2 ORF is lost by introduction of a premature stop codon at

position 59, [25]. This could indicate, that full length PB1-F2 per

se is not essential for viral fitness in humans/mammals and could

explain why the deletion of PB1-F2 had no major effect on

pathogenicity of the viruses tested here and in other studies

[21,24]. Accordingly, the currently circulating swine origin H1N1

virus has no functional PB1-F2 ORF, and is nevertheless spreading

Table 2. Pathogenicity-Index of VN1203 WT, dF2 and N66S inwhite peking ducks.

Group 1* 2 3 4 5 6 7 8 9 10 Total Weight Sum Index**

PBS

Healthy 10 10 10 10 10 10 10 10 10 10 100 0 0 0

Sick 0 0 0 0 0 0 0 0 0 0 0 1 0

Severelysick

0 0 0 0 0 0 0 0 0 0 0 2 0

Dead 0 0 0 0 0 0 0 0 0 0 0 3 0

Total 100 0

WT

Healthy 7 0 0 0 0 0 0 0 0 1 8 0 0 2.28

Sick 3 7 0 2 0 0 0 1 1 0 14 1 14

Severelysick

0 3 8 5 2 1 1 0 0 0 20 2 40

Dead 0 0 2 3 8 9 9 9 9 9 58 3 174

Total 100 228

dF2

Healthy 9 9 0 0 0 0 0 0 3 3 24 0 0 1.66

Sick 1 1 8 6 5 3 3 3 0 0 30 1 30

Severelysick

0 0 0 1 0 1 0 0 0 0 2 2 4

Dead 0 0 2 3 5 6 7 7 7 7 44 3 132

Total 100 166

N66S

Healthy 0 0 0 0 0 0 0 0 0 0 0 0 0 2.40

Sick 9 6 0 0 0 0 0 0 0 0 15 1 15

Severelysick

1 4 8 6 2 2 2 2 2 1 30 2 60

Dead 0 0 2 4 8 8 8 8 8 9 55 3 165

Total 100 240

*days post infection.**calculated as previously described [32].doi:10.1371/journal.ppat.1002186.t002



successfully [26]. At this point, the function of a C-terminally

truncated PB1-F2 in humans remains elusive. PB1-F2 is expressed

from a +1 ORF of segment 2 of IAV. Besides PB1 and PB1-F2 this

segment also encodes for N40, an N-terminally truncated version

of PB1 that was first described in 2009 [43]. Deletion of the PB1-

F2 ORF, by mutation of the start AUG enhances expression of

N40 as a consequence of ribosomal shifting. Deletion of N40

results in attenuation of the virus, but this also changes the PB1

sequence. In contrast, enhanced expression of N40, as shown for

PB1-F2 deficient virus mutants, has no effect on viral replication in

vitro and in ovo [43]. Thus, the function of N40 remains elusive.

We cannot exclude the possibility that in our systems deletion of

the PB1-F2 ORF might cause phenotypes that are indirectly

influenced by the levels of N40.

Despite the lack of differences in replication in vitro and in vivo

or major impact on pathogenicity in mice, we observed increased

mRNA levels of IL1beta and IL6 in murine BMDMs and

BMDDCs infected with PB1-F2 deficient viruses in vitro. So far,

no correlations have been made between PB1-F2 and inflamma-

tory responses. It is striking that this effect is more pronounced in

Figure 6. Diminished pathogenicity of PB1-F2 deficient virus in ducks. Ten 2-week old white Peking ducks were infected with 10E4 pfu of A/Viet Nam/1203/2004 wild type, dF2 or N66S. A) Three representative pictures of infected ducks were taken on day 4 p.i.. B) Survival curves of 10 2-week old white peking ducks were infected with 10E4 pfu of A/Viet Nam/1203/2004 wild type (blue), dF2 (red) or N66S (green). Survival (%) isdepicted. C and D) Viral titers of indicated organs from day 1 (C) and day 3 (D) post infection with wild type (blue), dF2 (red) or N66S (green). TCID50/ml of organs from individual animals are depicted. E) Mean viral titers (TCID50/ml) cloacal swabs from 10 animals per group (initial group size) aredepicted. P-values are indicated (*p,0.05, ** p,0.01) using dF2 as standard.doi:10.1371/journal.ppat.1002186.g006



monocytic cells, since these cells have previously been shown to be

more susceptible to the pro-apoptotic function of PB1-F2 [14]. In

contrast to the wildtype and PB1-F2 deficient virus, the N66S virus

induces significantly lower amounts of type I and type III

interferon and consequently ISGs in BMDM and BMDDCs.

Recent work showed that in a WSN/33 virus encoding the HK/

483 PB1, the N66S substitution in the PB1-F2 ORF resulted in

reduced type I interferon levels by day one of infection, despite

higher viral titers [40]. Since pDCs and alveolar macrophages are

the main producers of type I interferon and proinflammatory

cytokines, it is possible that PB1-F2 primarily acts in these cells by

a yet undetermined mechanism. In parallel to this work, a study by

Varga et al (accepted for publication), showed that PB1-F2

expression can decrease RIG-I and MAVS induced IFN-bproduction. The detailed mechanism is still unknown, but PB1-

F2 seems to act at the level of MAVS. It is so far unclear to what

extent PB1-F2 contributes to antagonism of the type I interferon

response and why deletion of PB1-F2 (as in the pandemic 2009

H1N1 strains) does not result in diminished viral replication.

In ducks, deletion of PB1-F2 had a more striking effect on

pathogenesis. We clearly observed a delayed onset of clinical

symptoms in the animals infected with the PB1-F2 deficient virus.

Moreover, the systemic spreading of the virus was significantly

delayed, when compared to the wild type and N66S virus.

Nevertheless, the deletion of PB1-F2 did not reduce lethality to the

levels of low pathogenic avian viruses. Moreover, we did not

observe statistically significant differences in the type I interferon

levels present in infected animals. Although this could be a

consequence of the high inner group variation, due to the

outbread nature of the animals, it may also be that the proposed

anti-interferon function of PB1-F2 is specific for mammals. We are

currently testing this hypothesis.

We also did not see major differences in viral loads in the cloacal

swabs of these animals, indicating that PB1-F2 does not affect viral

shedding. A recent study by Marjuki et al has shown that three

point mutations in PB1-F2 of VN1203 can affect polymerase

function in chicken cells and pathogenicity in mallard ducks [37].

Interestingly, these three mutations change the PB1-F2 of the

highly pathogenic VN1203 into the PB1-F2 of the low pathogenic

A/chicken/Vietnam/C58/04. The same group showed in a

previous study that the PB1 segment essentially contributes to

pathogenicity of VN1203 in birds [44]. Taken together, these data

and our data imply that PB1-F2 is important for the pathogenicity

of H5N1 HPAIV. Moreover, the high conservation of PB1-F2 in

avian isolates suggests a yet to be determined, but essential,

function of PB1-F2 for these viruses.

It is intriguing that the N66S substitution of PB1-F2, a

polymorphism associated with increased pathogenicity of the

1918 H1N1 and the highly pathogenic H5N1 isolates from Hong

Kong 1997, significantly enhances the pathogenicity of VN1203 in

mice, but has little detectable effect in ducks. Intriguingly, in many

avian isolates the serine at position 66 is common. This could

mean that the molecular mechanism for the enhanced pathoge-

nicity of viruses with this substitution in mammals does not apply

to avian hosts.

In summary, our study shows that PB1-F2 is an important,

evolutionary conserved pathogenicity factor of HPAIV in avian

species that supports faster viral spreading into different organs. In

mammals the 1918:H1N1-like N66S substitution supports spread-

ing and replication in the CNS, by a yet to be defined mechanism.

The increase in viral pathogenicity of N66S mutant is possibly due

to inhibition of type I interferon and proinflammatory responses in

monocytic cells.

Supporting Information

Figure S1 Subcellular localization of PB1-F2 in LA-4during viral infection. LA-4 were infected for 8h (A) or 24h (B)

with 2 MOI of A/Viet Nam/1203/2004 wild type, dF2 or N66S.

Nuclei were stained with DAPI (blue), PB1-F2 was stained with a

polyclonal rabbit serum and anti rabbit-Alexa-488 (green) and NP

was stained with a monoclonal mouse antibody and anti-mouse-

Alexa-555 (red). Merged pictures are shown in the right panel. All

pictures were taken with a 40x objective using identical exposure

settings for the green and red channel. Representative cells are

shown. C) LA-4 were infected for 24h as described for A/B. Nuclei

were stained with DAPI (blue), PB1-F2 was stained with a

polyclonal rabbit serum and anti rabbit-Alexa-488 (green) and

prohibitin was stained with a monoclonal mouse antibody and

anti-mouse-Alexa-555 (red). All pictures were taken with a 63x

objective using identical exposure settings for the green and red

chanel. D) enlarged version of VN1203 WT and N66S from Fig.

S1C.

(TIFF)

Figure S2 Subcellular localization of PB1-F2 in duckembryonic fibroblasts during viral infection. DEF were

infected for 8h (A) or 24h (B) with 2 MOI of A/Viet Nam/1203/

2004 wild type, dF2 or N66S. Nuclei were stained with DAPI

(blue), PB1-F2 was stained with a polyclonal rabbit serum and anti

rabbit-Alexa-488 (green) and NP was stained with a monoclonal

mouse antibody and anti-mouse-Alexa-555 (red). Merged pictures

are shown in the right panel. All pictures were taken with a 40x

objective using identical exposure settings for the green and red

channel. Representative cells are shown. C) DEF were infected for

24h as described for A/B. Nuclei were stained with DAPI (blue),

PB1-F2 was stained with a polyclonal rabbit serum and anti

rabbit-Alexa-488 (green) and prohibitin was stained with a

monoclonal mouse antibody and anti-mouse-Alexa-555 (red). All

pictures were taken with a 63x objective using identical exposure

settings for the green and red chanel. D) enlarged version of

VN1203 WT and N66S from Fig. S2C.

(TIFF)

Acknowledgments

We thank Osman Lizardo and Richard Cadagan (Microbiology MSSM),

Sookil Shin (A-BSL3, MSSM) and the Center for Comperative Medicine

and Surgery (CCMS at MSSM) for excellent technical support. We would

like to thank Theresa Wolter and Brian Kimble for their assistance with the

duck studies. We are also indebted to Andrea Ferrero for her excellent

laboratory managerial skills.

Author Contributions

Conceived and designed the experiments: MS BM LP DRP AGS.

Performed the experiments: MS BM LP TS RH BGH ZTV JS. Analyzed

the data: MS LP DRP AGS. Contributed reagents/materials/analysis

tools: MS LP ZTV JS. Wrote the paper: MS BM LP RH ZTV BGH JS

DRP AGS.

References

1. No authors listed (1997) Isolation of avian influenza A(H5N1) viruses from humans—

Hong Kong, May-December 1997. MMWR Morb Mortal Wkly Rep 46: 1204–1207.

2. Shinya K, Ebina M, Yamada S, Ono M, Kasai N, et al. (2006) Avian flu:

influenza virus receptors in the human airway. Nature 440: 435–436.



3. Yuen KY, Chan PK, Peiris M, Tsang DN, Que TL, et al. (1998) Clinical

features and rapid viral diagnosis of human disease associated with avianinfluenza A H5N1 virus. Lancet 351: 467–471.

4. Tran TH, Nguyen TL, Nguyen TD, Luong TS, Pham PM, et al. (2004) Avian

influenza A (H5N1) in 10 patients in Vietnam. N Engl J Med 350: 1179–1188.5. Beigel JH, Farrar J, Han AM, Hayden FG, Hyer R, et al. (2005) Avian influenza

A (H5N1) infection in humans. N Engl J Med 353: 1374–1385.6. Abdel-Ghafar AN, Chotpitayasunondh T, Gao Z, Hayden FG, Nguyen DH,

et al. (2008) Update on avian influenza A (H5N1) virus infection in humans.

N Engl J Med 358: 261–273.7. Korteweg C, Gu J (2008) Pathology, molecular biology, and pathogenesis of

avian influenza A (H5N1) infection in humans. Am J Pathol 172: 1155–1170.8. Olsen B, Munster VJ, Wallensten A, Waldenstrom J, Osterhaus AD, et al. (2006)

Global patterns of influenza a virus in wild birds. Science 312: 384–388.9. Munster VJ, Baas C, Lexmond P, Waldenstrom J, Wallensten A, et al. (2007)

Spatial, temporal, and species variation in prevalence of influenza A viruses in

wild migratory birds. PLoS Pathog 3: e61.10. Webster RG, Yakhno M, Hinshaw VS, Bean WJ, Murti KG (1978) Intestinal

influenza: replication and characterization of influenza viruses in ducks.Virology 84: 268–278.

11. Kida H, Yanagawa R, Matsuoka Y (1980) Duck influenza lacking evidence of

disease signs and immune response. Infect Immun 30: 547–553.12. Perkins LE, Swayne DE (2003) Comparative susceptibility of selected avian and

mammalian species to a Hong Kong-origin H5N1 high-pathogenicity avianinfluenza virus. Avian Dis 47: 956–967.

13. Kim JK, Seiler P, Forrest HL, Khalenkov AM, Franks J, et al. (2008)Pathogenicity and vaccine efficacy of different clades of Asian H5N1 avian

influenza A viruses in domestic ducks. J Virol 82: 11374–11382.

14. Chen W, Calvo PA, Malide D, Gibbs J, Schubert U, et al. (2001) A novelinfluenza A virus mitochondrial protein that induces cell death. Nat Med 7:

1306–1312.15. Chanturiya AN, Basanez G, Schubert U, Henklein P, Yewdell JW, et al. (2004)

PB1-F2, an influenza A virus-encoded proapoptotic mitochondrial protein,

creates variably sized pores in planar lipid membranes. J Virol 78: 6304–6312.16. Gibbs JS, Malide D, Hornung F, Bennink JR, Yewdell JW (2003) The influenza

A virus PB1-F2 protein targets the inner mitochondrial membrane via apredicted basic amphipathic helix that disrupts mitochondrial function. J Virol

77: 7214–7224.17. Yamada H, Chounan R, Higashi Y, Kurihara N, Kido H (2004) Mitochondrial

targeting sequence of the influenza A virus PB1-F2 protein and its function in

mitochondria. FEBS Lett 578: 331–336.18. Zamarin D, Garcia-Sastre A, Xiao X, Wang R, Palese P (2005) Influenza virus

PB1-F2 protein induces cell death through mitochondrial ANT3 and VDAC1.PLoS Pathog 1: e4.

19. Vyssokikh MY, Brdiczka D (2003) The function of complexes between the outer

mitochondrial membrane pore (VDAC) and the adenine nucleotide translocasein regulation of energy metabolism and apoptosis. Acta Biochim Pol 50:

389–404.20. Mazur I, Anhlan D, Mitzner D, Wixler L, Schubert U, et al. (2008) The

proapoptotic influenza A virus protein PB1-F2 regulates viral polymeraseactivity by interaction with the PB1 protein. Cell Microbiol 10: 1140–1152.

21. McAuley JL, Zhang K, McCullers JA (2010) The effects of influenza A virus

PB1-F2 protein on polymerase activity are strain specific and do not impactpathogenesis. J Virol 84: 558–564.

22. Conenello GM, Zamarin D, Perrone LA, Tumpey T, Palese P (2007) A singlemutation in the PB1-F2 of H5N1 (HK/97) and 1918 influenza A viruses

contributes to increased virulence. PLoS Pathog 3: 1414–1421.

23. McAuley JL, Chipuk JE, Boyd KL, Van De Velde N, Green DR, et al. (2010)PB1-F2 proteins from H5N1 and 20 century pandemic influenza viruses cause

immunopathology. PLoS Pathog 6: e1001014.24. McAuley JL, Hornung F, Boyd KL, Smith AM, McKeon R, et al. (2007)

Expression of the 1918 influenza A virus PB1-F2 enhances the pathogenesis of

viral and secondary bacterial pneumonia. Cell Host Microbe 2: 240–249.

25. Zell R, Krumbholz A, Eitner A, Krieg R, Halbhuber KJ, et al. (2007) Prevalence

of PB1-F2 of influenza A viruses. J Gen Virol 88: 536–546.

26. Hai R, Schmolke M, Varga ZT, Manicassamy B, Wang TT, et al. (2010) PB1-

F2 expression by the 2009 pandemic H1N1 influenza virus has minimal impact

on virulence in animal models. J Virol 84: 4442–4450.

27. Steel J, Lowen AC, Pena L, Angel M, Solorzano A, et al. (2009) Live attenuated

influenza viruses containing NS1 truncations as vaccine candidates against

H5N1 highly pathogenic avian influenza. J Virol 83: 1742–1753.

28. Franchi L, Amer A, Body-Malapel M, Kanneganti TD, Ozoren N, et al. (2006)

Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1beta

in salmonella-infected macrophages. Nat Immunol 7: 576–582.

29. Franchi L, Eigenbrod T, Nunez G (2009) Cutting edge: TNF-alpha mediates

sensitization to ATP and silica via the NLRP3 inflammasome in the absence of

microbial stimulation. J Immunol 183: 792–796.

30. Staeheli P, Dreiding P, Haller O, Lindenmann J (1985) Polyclonal and

monoclonal antibodies to the interferon-inducible protein Mx of influenza virus-

resistant mice. J Biol Chem 260: 1821–1825.

31. Solorzano A, Webby RJ, Lager KM, Janke BH, Garcia-Sastre A, et al. (2005)

Mutations in the NS1 protein of swine influenza virus impair anti-interferon

activity and confer attenuation in pigs. J Virol 79: 7535–7543.

32. Munster VJ, Schrauwen EJ, de Wit E, van den Brand JM, Bestebroer TM, et al.

(2010) Insertion of a multibasic cleavage motif into the hemagglutinin of a low-

pathogenic avian influenza H6N1 virus induces a highly pathogenic phenotype.

J Virol 84: 7953–7960.

33. Pena L, Vincent AL, Ye J, Ciacci-Zanella JR, Angel M, et al. (2011)

Modifications in the polymerase genes of a swine-like triple-reassortant influenza

virus to generate live attenuated vaccines against 2009 pandemic H1N1 viruses.

J Virol 85: 456–469.

34. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:

402–408.

35. Hale BG, Steel J, Medina RA, Manicassamy B, Ye J, et al. (2010) Inefficient

control of host gene expression by the 2009 pandemic H1N1 influenza A virus

NS1 protein. J Virol 84: 6909–6922.

36. Nemeth A, Guibert S, Tiwari VK, Ohlsson R, Langst G (2008) Epigenetic

regulation of TTF-I-mediated promoter-terminator interactions of rRNA genes.

EMBO J 27: 1255–1265.

37. Marjuki H, Scholtissek C, Franks J, Negovetich NJ, Aldridge JR, et al. (2010)

Three amino acid changes in PB1-F2 of highly pathogenic H5N1 avian

influenza virus affect pathogenicity in mallard ducks. Arch Virol 155: 925–934.

38. Tumpey TM, Szretter KJ, Van Hoeven N, Katz JM, Kochs G, et al. (2007) The

Mx1 gene protects mice against the pandemic 1918 and highly lethal human

H5N1 influenza viruses. J Virol 81: 10818–10821.

39. Chen CJ, Chen GW, Wang CH, Huang CH, Wang YC, et al. (2010)

Differential localization and function of PB1-F2 derived from different strains of

influenza A virus. J Virol 84: 10051–10062.

40. Conenello GM, Tisoncik JR, Rosenzweig E, Varga ZT, Palese P, et al. (2011) A

single N66S mutation in the PB1-F2 protein of influenza A virus increases

virulence by inhibiting the early interferon response in vivo. J Virol 85: 652–662.

41. Shinya K, Makino A, Hatta M, Watanabe S, Kim JH, et al. (2011) Subclinical

Brain Injury Caused by H5N1 Influenza Virus Infection. J Virol 85: 5202–5207.

42. Manicassamy B, Manicassamy S, Belicha-Villanueva A, Pisanelli G,

Pulendran B, et al. (2010) Analysis of in vivo dynamics of influenza virus

infection in mice using a GFP reporter virus. Proc Natl Acad Sci U S A 107:

11531–11536.

43. Wise HM, Foeglein A, Sun J, Dalton RM, Patel S, et al. (2009) A complicated

message: Identification of a novel PB1-related protein translated from influenza

A virus segment 2 mRNA. J Virol 83: 8021–8031.

44. Salomon R, Franks J, Govorkova EA, Ilyushina NA, Yen HL, et al. (2006) The

polymerase complex genes contribute to the high virulence of the human H5N1

influenza virus isolate A/Vietnam/1203/04. J Exp Med 203: 689–697.



Documents

Differential contribution of PB1-F2 to the virulence of highly pathogenic H5N1 influenza A virus in mammalian and avian species