Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension

January-March 2015 | Volume 61 | Issue 1

Journ

al o

f Po

stg

rad

uate

Med

icin

e • V

olu

me 6

1 • Issu

e 1

• Jan

uary

-Marc

h 2

015 • P

ages 1

-??

?

Journal of Postgraduate Medicine January 2015 Vol 61 Issue 1 21

Introduction

H ypertension is a major public health problem,[1] with India heading towards becoming the “Hypertension Capital of

the World”.[2] Essential hypertension is a heterogeneous group of diseases with the common characteristic of elevated blood pressure (BP).

One of the major components of blood pressure regulation physiology is the renin-angiotensin system (RAS). The RAS

has several sub-components — angiotensin converting enzyme (ACE), which converts Angiotensin I to Angiotensin II, α adducin (ADD1), which plays a role in renal sodium reabsorption[3] and the β1-adrenoreceptor (β-1 ADR), which stimulates rennin release.

The RAS not only plays a role in the development of hypertension, but also leads to disease progression by promoting vasoconstriction, sodium reabsorption, cardiac remodeling and norepinephrine release among other potentially detrimental actions.[4] Inhibition of the RAS is the mechanism of action of angiotensin converting enzyme inhibitors (ACEIs) — one of the most commonly used classes of drugs for controlling elevated BP. However, significant variation has been observed in the response to Ramipril, an ACEI, among hypertensive patients.[5]

It is believed that this variation in Ramipril pharmacodynamics is the result of polymorphisms in genes coding for the RAS sub-components. The complimentary physiological relationship

ABSTRACTBackground: The renin-angiotensin system (RAS) is an important facet of blood pressure regulation physiology. Treatment of essential hypertension targets the RAS using Angiotensin Converting Enzyme Inhibitors (ACEIs). However, ACEIs are not uniformly effective and show inter-individual pharmacodynamic variations. Aim: To assess the correlation between genetic polymorphisms in the genes coding for RAS components (angiotensin converting enzyme (ACE I/D), α-adducin (ADD1) and β1-adrenoreceptor (β1-ADR)) and response to Ramipril. Materials and Methods: We recruited 120 patients with essential hypertension who were administered Ramipril monotherapy initially, followed by combination therapy, if needed, based on their responses. Relationship between genotypes of the three candidate genes and decrease in the blood pressure (BP) was analyzed. Results: One hundred and six patients were evaluable at the end of the study period and 21 different genotypes were observed among them. Seven of them were classified as responders after 8 weeks and at the end of 12 weeks, an additional 77 (72.64%) were deemed responders. 19/22 non-responders were treated with combination therapy and 7/19 (36.84%) showed a response to the same. There was a significant difference between the proportions of responders and non-responders among the genotypes of the ADD1 and β1-ADR genes (P = 0.005 and 0.003, respectively). The best predictors of response to Ramipril 5 mg daily were the II/GG/SS, II/TG/SS, II/GG/SG, ID/GG/SS, ID/GG/SG and ID/TT/SS and DD/GG/SS; II/GG/GG, II/TT/SG, ID/TG/SG, ID/TT/SG, DD/GG/SG and DD/GG/GG were moderately predictive and II/TT/SS, II/TG/GG, ID/TG/GG, DD/TG/SG and DD/TG/GG were poorly predictive of response. Discussion: Variable responses to Ramipril may be the result of genetic factors. Conclusion: Pre-prescription genotyping may help individualize treatment.

KEY WORDS: ACE inhibitors, essential hypertension, polymorphisms, RAS

Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension Gupta S, Chattopadhyaya I, Agrawal BK1, Sehajpal PK3, Goel RK2

Department of Pharmacology, M. M. College of Pharmacy, 1Department of Medicine, M. M. Institute of Medical Sciences, M. M. University, Mullana (Ambala), Haryana, 2Department of Molecular Biology and Biochemistry, Guru Nanak Dev University, Amritsar, 3Department of Pharmacology, Punjabi University, Patiala, Punjab, India

Address for correspondence: Dr. Sumeet Gupta, E-mail: [email protected]

Access this article onlineQuick Response Code: Website:

www.jpgmonline.com

DOI:

10.4103/0022-3859.147028

PubMed ID:

***

Received : 18-03-2013Review completed : 05-09-2013Accepted : 07-02-2014

Original Article

Nitin

Rectangle

Gupta, et al.: Pharmacogenomics of ramipril in RAS

22 Journal of Postgraduate Medicine January 2015 Vol 61 Issue 1

between ACE I/D, ADD1 and β-1 ADR genetic polymorphisms in the regulation of BP [Figure 1] is hypothesized to influence the response to ACE inhibitors. These polymorphisms are: Insertion (I) or deletion (D) alleles in the ACE gene, Gly460Trp in the ADD1 gene and Ser49Gly in the β-1 ADR gene.[6]

Therefore, the present study was planned to correlate polymorphisms in these 3 candidate genes with variation in the therapeutic response to Ramipril.

Materials and Methods

EthicsThe study was approved by the Institutional Review Board and written informed consent was obtained from all participants.

DesignA cross-sectional study was conducted at the M. M. Institute of Medical Science and Research, Mullana, Haryana.

Inclusion criteriaPatients of the Haryanvi Jat ethnicity living in a rural area for more than 2 generations with occasional travel to the city were included. They were of age 18-80 years; with an average BP > 140/90 mm Hg on 3 separate occasions, in who the proposed management plan included therapy with Ramipril alone or in combination with Hydrochlorthiazide or Metoprolol.

Exclusion criteria Patients who were pregnant, lactating, had elevated liver enzymes, had elevated BP along with (were hypertensives) Diabetes, required 3 or more drugs or commuted daily to the city were excluded from the study.

Sample size calculation A cross-sectional survey conducted by our institute showed that of 35,000 inhabitants in 21 villages of rural Haryana (data validated by the 2001 Census report of India), 1890 individuals

had essential hypertension as defined in the inclusion criteria. Therefore, the disease prevalence for essential hypertension was 5.4%.

Using Daniel’s formula[7], we calculated a sample size of 79 patients with a power of 80% at 5% significance. However, in order to account for loss to follow up, we recruited 120 patients.

Clinical methodology The blood pressure for all participants was recorded by physicians in the outpatient department in a quiet environment using standard procedures.[8]

Once the diagnosis of essential hypertension was made, treatment of cases was initiated with the ACE inhibitor Ramipril, given at the dose of 1.25 mg once daily. Blood pressure was measured again after 4 weeks to assess the response.

Classification of responders and non-respondersIf there was a fall of ≥10 mmHg in systolic and diastolic blood pressures, the patient was classified as a responder to Ramipril therapy. Such patients were continued on the same dose of the drug.

Patients who did not show such a change in their blood pressures were given an increased dose of Ramipril. The dose was increased in a stepwise manner from 1.25 mg to 2.5 mg to 5 mg once a day and response was re-checked every four weeks.

Patients who failed to respond to 5 mg Ramipril once daily for four weeks were classified as non-responders and a second drug was added to their treatment regimens.[9]

Lab methodologyGenomic DNA was extracted from venous blood samples of both cases using the modified salting out procedure described by Miller.[10] Genotyping was performed to detect the insertion (I) or deletion (D) alleles of the ACE gene; the Gly460Trp single

Liver Angiotensinogen Angiotensin-I

Adrenal Gland

RENIN Angiotensin-II

Water and salt retention. Effective circulating volume increases. Perfusion of the Juxtaglomerular apparatus increases

β- 1 ADR

ACE I/D

ADD1

Blood pressure Increases

Increase sympathetic

activity

SS

SG

GG

T T

G G

T G

Arteriolar Vasoconstriction increase in blood

pressure

Tubular Na+ Cl –reabsorption and

K+ excretion, H2O retention

Salt retention more

Salt retention less

Figure 1: Multiple genes contribute to the role of RAS in the development of hypertension



nucleotide polymorphism (SNP) of the ADD1 gene; and the Ser49Gly SNP of the β-1 ADR gene.

Genotyping for ACE I/DThe ACE gene is said to have the insertion (I) or deletion (D) allele based on the presence or absence of a 287 bp sequence in intron 16.

The ACE I/D alleles were detected by polymerase chain reaction (PCR)[11] using primers that would flank the 287 bp sequence. All samples identified as homozygotes for the D allele (DD), were re-tested with an insertion-specific primer pair (Gen bank accession number GQ449380, GQ449383): Forward primer: 5′-GCCACTACGCCCGGCTAAT-3′; Reverse primer: 5-′- GATGTGGCCATCACATTCGTCAGAT-3′. The PCR products were resolved on 2% agarose gel and visualized following ethidium bromide staining (NuSieve, 3:1 agarose, FMC Bioproducts).

Genotyping for ADD1 The SNP that leads to the Gly460Trp variation in the amino acid sequence for α-adducin is located at nucleotide position 614 of exon 10 of the ADD1 gene (Gen bank accession number L29294). This SNP was detected using amplification refractory mutation system PCR.[12] The following primer sets were used: F614G, 5′-GGGGCGACGAAGCTTCCGAGGTAG-3′; F614T5′-GCTGAACTCTGGCCCAGGCCGACGAAGCTTCCGAGGATT-3′; R614 5′-CCTCCGAAGCCCCAGCTACCCA-3′.

The sizes of the PCR products were 220 bp and 234 bp for the 460Gly and 460Trp alleles, respectively, and were resolved clearly on 4% agarose gel [Figure 2b] to determine if the patient had GG, GT or TT genotype (NuSieve, 3:1 agarose, FMC Bioproducts).

Genotyping for β-1 ADR Polymorphism The SNP (Gen bank accession number C_8898494_10) that leads to the Ser49Gly variation in the amino acid sequence for β-1 adrenoceptors is located at position 145 in codon 49. The sequence containing this polymorphism was amplified using PCR.[13] The sense and antisense primers used were: 5′CCGGGCTTCTGGGGTGTTCC3-′ and 5′GGCGAGGTGATGGCGAGGTAGC3-′. The 564 bp PCR

Figure 2: (a) A representative agarose gel photography of PCR products showing the amplification for ACE I/D polymorphism, (b) Representative agarose gel electrophoresis showing the amplification of Gly460Trp α-adducin polymorphism, (c) A representative agarose gel photography of PCR products showing the amplification for Ser49Gly β-1 ADR polymorphism

a b c

product was digested using the enzyme Eco 0109I [New England biolabs] (giving 345 and 219 bp fragments if the polymorphism was present. The fragments were separated using restriction fragment length polymorphism [Figure 2c] to determine if the patient had SS, SG or GG genotype.

Data analysisData was analyzed using the statistical package for social sciences (SPSS 16.0) for Windows and was tested for normality. Continuous variables were expressed as means with standard deviations (SDs). Intergroup comparisons were made using the Student’s t test. Differences between the groups were calculated using one-way analysis of variance. A P-value of <0.05 was considered statistically significant.

Results

Demographic data One hundred and twenty cases (n = 120) with essential hypertension were recruited. This included 71 (59.2%) males and 49 (40.8%) females. The ages of males ranged from 21 to 82 years with a mean age of 52.8 ± 14.3 years and females were aged 40 to 75 years with a mean age of 56.1 ± 8.0 years. Of the 120 cases, 14 (11.67%) were lost to follow-up and a total of 106 (88.33%) patients eventually completed the study protocol.

Responders and non responders At the end of the fourth week, none of the 106 patients could be classified as responders. After 8 weeks, and at a dose of 2.5 mg daily, 7 patients (6.60%) were classified as responders and at the end of 12 weeks, an additional 77 (72.64%) were deemed responders [Table 1].

Thus, 84/106 (79.25%) were eventually classified as responders and 22 (20.75%) were classified as non-responders. A total of 19/22 non-responders agreed to be treated with combination therapy. Of these, 7/19 (36.84%) showed a response to combination therapy and the rest did not.

Genotyping data ACE I/D allelesOf the 106 patients, 49 (46.23%) had the I/D genotype



(40 responders and 9 non-responders), 30 (28.30%) had D/D genotype (21 responders and 9 non-responders) and 27 (25.47%) had I/I genotype (23 responders and 4 non-responders). On comparing the I/I with the I/D genotype, a significant difference in the reduction of [Figure 3] systolic blood pressure was observed (P = 0.028).

ADD1 polymorphismsIt was observed that 61 (57.55%) patients had G/G genotype (55 responders and 6 non-responders), 35 (33.02%) had T / G genotype (23 responders and 12 non-responders) and 10 (9.43%) had T/T genotype (6 responders and 4 non-responders). On comparing the G/G with the T/G genotype, a significant difference in the

Table 1: Distribution of responders and non responders in hypertensive patients after treatment with ACE inhibitor (Ramipril)Genotype 4 week follow up

at 1.25 mg daily P-value 8 week follow up after increasing

the dose at 4 weeks to 2.5 mg dailyP-value 12 week follow up after increasing the

dose (if needed) at 8 weeks to 5 mg dailyP-value

ACE gene R NR — R NR 0.001 R NR 0.315

I/D (n=49) 00 49 (100) 01 (2) 48 (98) 40 (82) 09 (18)

D/D (n=30) 00 30 (100) 00 30 (100) 21 (70) 09 (30)

I/I (n=27) 00 27 (100) 06 (22) 21 (78) 23 (85) 04 (15)

ADD1 gene R NR — R NR 0.281 R NR 0.005

G/G (n=61) 00 61 (100) 06 (10) 55 (90) 55 (90) 06 (10)

T/G (n=35) 00 35(100) 01 (3) 34 (97) 23 (66) 12 (34)

T/T (n=10) 00 10 (100) 00 10 (100) 6 (60) 04 (40)

Β1-ADR gene R NR — R NR 0.307 R NR 0.003

S/S (n=49) 00 49 04 (8) 45 (92) 44 (90) 05 (10)

S/G (n=41) 00 41 03 (7) 38 (93) 32 (78) 09 (22)

G/G (n=16) 00 16 00 21 (100) 08 (50) 08 (50)

Figure 3: Mean reduction of systolic and diastolic blood pressure after treatment with ACE inhibitors (5mg) with respect to ACE, ADD1 & β-1 ADR polymorphism



reduction of systolic and diastolic blood pressures was observed (P=0.032 and 0.012, respectively). A significant difference in the reduction of [Figure 3] diastolic blood pressures also existed on comparing the GG with the TT genotype (P = 0.013) and the T/G with the TT genotype (P = 0.01).

β-1 ADR polymorphisms Forty nine patients (46.23%) were found to have the S/S genotype (44 responders and 5 non-responders), 41 (38.68%) had the S/G genotype (32 responders and 9 non-responders) and 16 (15.09%) had the G/G genotype (8 responders and 8 non-responders). On comparing the S/S with the S/G genotype, a significant difference in the reduction of [Figure 3] systolic blood pressure was observed (P = 0.032).

There was no difference between the proportions of responders and non-responders among the three genotypes of the ACE I/D gene. However, there did exist a significant difference between the proportions of responders and non-responders among the genotypes of the ADD1 and β1-ADR genes (P = 0.005 and 0.003, respectively).

Genotype combinations and prediction of responseIt was observed that 21 different genotype combinations [Table 2] existed in the 106 patients.

The best predictors of response to Ramipril 5 mg daily were the II/GG/SS, II/TG/SS, II/GG/SG, ID/GG/SS, ID/GG/SG and ID/TT/SS and DD/GG/SS. All of the patients who had any of these genotypes were responders.

Less predictive of response were the II/GG/GG, II/TT/SG, ID/TG/SG, ID/TT/SG, DD/GG/SG and DD/GG/GG combinations with 50%-70% of patients with these genotypes being responders.

The genotype combinations that were least predictive of response (≤50% cases with these combinations were responders) were II/TT/SS, II/TG/GG, ID/TG/GG, DD/TG/SG and DD/TG/GG.

Data on 19/22 non-responders who were treated with combination therapy showed that patients with the combinations II/GG/GG (n = 1), DD/TG/SG (n = 2) and II/TG/GG (n = 1) responded to Ramipril plus Metoprolol; non-responders with the II/TT/SS (n = 1) and DD/TG/SS (n = 2) genotypes responded to Ramipril plus Hydrochlorothiazide.

Discussion

This study evaluated gene polymorphisms that could determine response to Ramipril within a cohort of patients with essential hypertension. Patients with the ID and II genotypes were more likely to respond to the drug at the third month as compared to patients with the DD genotype. This may be accounted for by the lower expression of the ACE I/D gene in those with the I allele, leading to decreased serum ACE activity [Table 1]. Two other studies have demonstrated similar results[14-15] while differing results were seen in the study by Staessen et al.[16] Since there is an inconsistency of findings across studies, the extent of effect of these polymorphisms still remains unclear.[17] Patients with the G allele of the ADD1 gene and the S allele

Table 2: Percentage response (responder versus non responder) of ramipril (5mg) in predictor model of three different genotypes combination of respective genes (ACE I/D/ADD1/β-1ADR).Genotype combination

8 weeks 12 weeks P value (Responders vs non responders at 8 weeks)

P value (Responders vs non responders at 12 weeks)R NR R NR

DD/GG/SS (8) — 08 (100) 8 (100) — — —

DD/TG/SS (7) — 07 (100) 5 (71) 2 (29) — 0.0186*

DD/TG/GG (2) — 02(100) 1 (50) 1 (50) — —

DD/TG/SG (3) — 03(100) 1 (33) 2 (67) — —

DD/GG/GG (5) — 05(100) 3 (60) 2 (40) — 0.0398*

DD/GG/SG (5) — 05(100) 3 (60) 2 (40) — 0.783

ID/TG/SG (7) — 07(100) 5 (71) 2 (29) — 0.006**

ID/GG/GG (4) — 04(100) 3 (75) 1 (25) — —

ID/TG/SS (7) — 07(100) 5 (71) 2 (29) — 0.1536

ID/TT/SG (5) — 05(100) 3 (60) 2 (40) — —

ID/GG/SS (11) — 11(100) 11 (100) — — 0.024*

ID/TT/SS (1) — 01 (100) 1 (100) — — —

ID/TG/GG (2) — 02 (100) — 2 (100) — —

ID/GG/SG (11) — 11 (100) 11 (100) — — —

II/GG/SS (8) 3 (27) 05 (63) 8 (100) — 0.0001*** —

II/GG/SG (7) 3 (43) 04 (57) 7 (100) — 0.0639 —

II/TG/SS (6) 1 (17) 05 (83) 6 (100) — — —

II/GG/GG (2) — 02 (100) 1 (50) 1 (50) 0.073 —

II/TT/SG (3) — 03 (100) 2 (67) 1 (33) 0.515 —

II/TT/SS (1) — 01 (100) — 1 (100) — —

II/TG/GG (1) — 01 (100) — 1 (100) — —



of the β1-ADR gene were more likely to respond to Ramipril as compared to patients with other alleles (T allele of ADD1 and G allele of β1-ADR) [Table 1]. This may be explained by the fact that the presence of the T allele of the ADD1 gene is linked to a higher activity of the sodium pump, leading to increased tubular re-absorption of sodium in the kidneys.[18-20]

All patients who were homozygous for the T allele of the ADD1 or the G allele of the β1-ADR gene were non-responders in our study. Patients with the DD genotype were responders when they also had the GG or TG genotypes of the ADD1 and SS genotype of the β1-ADR gene and non-responders when they had the GG or SG genotypes of the β1-ADR gene.

Among non responders (n = 19), patients with the GG or SG genotypes of the β1-ADR gene were found to have greater reduction of BP when treated with a combination of Ramipril and Metoprolol. In vitro studies have shown that the G allele of the β1-ADR gene leads to greater sensitivity to the inhibitory effect of Metoprolol and greater down regulation on long-term agonist stimulation.[21] However, another study reported that patients homozygous for SS polymorphism responded better to beta blockers than those with the GG polymorphism.[21]

An attempt has been made to explain response to Ramipril with respect to ACE I/D, β-1 ADR and ADD1 gene polymorphisms. The I allele of ACE, G allele of ADD1 and S allele of the β1-ADR genes could serve as potential markers of response.

There was a significant difference in the reduction of systolic blood pressures when patients with heterozygous genotypes of any of the three genes (ACE I/D, β-1 ADR and ADD1) were compared with patients with the corresponding wild type genotypes. The change in the diastolic blood pressures was significantly different only when ADD1 wild and polymorphic genotypes were compared. Though, we have a small number of patients treated with combination drug therapy, our results indicate that in patients with the GG or SG genotype of the β1-ADR gene, Ramipril plus Metoprolol may be started at the time that treatment is initiated. The sample size while small, indicates variability in responses to ramipril with respect to different genes polymorphisms. This study could establish some baseline data for future research on larger populations.

Acknowledgments

We would like to thank team of doctors and volunteers M. M. Institute of Medical Science and Research, M. M. University, Mullana, Ambala for the help in collecting the data during whole study. We would also thank Head, Department of Molecular Biology and Biochemistry, Guru Nanak Dev University, Amritsar for analyzing the samples for association studies.

References

1. Patnaik L, Sahani NC, Sahu T, Sethi S. A study on hypertension in urban slum of Brahmapur, Orissa. J Community Med 2007;3:1-10.

2. Joshi SR, Parikh RM. India-diabetes capital of the world: Now heading towards hypertension. J Assoc Physicians India 2007;55:323-4.

3. Manunta P, Bianchi G. Pharmacogenomics and pharmacogenetics of hypertension: Update and perspectives — the adducin paradigm.

How to cite this article: Gupta S, Chattopadhyaya I, Agrawal BK, Sehajpal PK, Goel RK. Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension. J Postgrad Med 2015;61:21-6.

Source of Support: Nil, Conflict of Interest: None declared.

J Am Soc Nephrol 2006;17(4 Suppl 2):S30-5.4. Humma LM, Terra SG. Pharmacogenetics and cardiovascular disease:

Impact on drug response and applications to disease management. Am J Health Syst Pharm 2002;59:1241-52.

5. Ueda S, Meredith PA, Morton JJ, Connell JM, Elliott HL. ACE (I/D) genotype as a predictor of the magnitude and duration of the response to an ACE inhibitor drug (enalaprilat) in humans. Circulation 1998;98:2148-53.

6. Karlsson J, Lind L, Hallberg P, Michaëlsson K, Kurland L, Kahan T, et al. Beta 1-adrenergic receptor gene polymorphisms and response to beta1-adrenergic receptor blockade in patients with essential hypertension. Clin Cardiol 2004;27:347-50.

7. Naing L, Winn T, Rusli BN. Practical in calculating the sample size for prevalence studies. Archives of Orofacial Sciences 2006;1:9-14.

8. Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA, Izzo JL Jr, et al. Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. National Heart, Lung, and Blood Institute; National High Blood Pressure Education Program Coordinating Committee. Seventh report of the Joint National Committee on prevention, detection, evaluation, and treatment of high blood pressure. Hypertension 2003;42:1206-52.

9. Johnson JA, Zineh I, Puckett BJ, McGorray SP, Yarandi HN, Pauly DF. Beta 1-adrenergic receptor polymorphisms and antihypertensive response to metoprolol. Clin Pharmacol Ther 2003;74:44-52.

10. Miller SA, Dykes DD, Polesky HF. A simple salting procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

11. Agrawal S, Singh VP, Tewari S, Sinha N, Ramesh V, Agarwal S, et al. Angiotensin-converting enzyme gene polymorphism in coronary artery disease in North India. Indian Heart J 2004;56:44-6.

12. Shin MH, Chung EK, Kim HN, Park KS, Nam HS, Kweon SS, et al. Alpha-adducin Gly460Trp polymorphism and essential hypertension in Korea. J Korean Med Sci 2004;19:812-4.

13. Fr agoso JM, Rod r íguez -Pé rez JM, Pé rez -V ie lma N, Martínez-Rodríguez N, Vargas-Alarcón G. adrenergic receptor polymorphisms Arg389Gly and Ser49Gly in the Amerindian and Mestizo populations of Mexico. Hum Biol 2005;77:515-20.

14. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343-6.

15. Tiret L, Rigat B, Visvikis S, Breda C, Corvol P, Cambien F, et al. Evidence from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet 1992;51:197-205.

16. Staessen JA, Wang JG, Ginocchio G, Petrov V, Saavedra AP, Soubrier F, et al. The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular-renal risk. J Hypertens 1997;15:1579-92.

17. Scharplatz M, Puhan MA, Steurer J, Bachmann LM. What is the impact of the ACE gene insertion/deletion (I/D) polymorphism on the clinical effectiveness and adverse events of ACE inhibitors? — Protocol of a systematic review. BMC Med Genet 2004;5:23.

18. Manunta P, Burnier M, D’Amico M, Buzzi L, Maillard M, Barlassina C, et al. Adducin polymorphism affects renal proximal tubule reabsorption in hypertension. Hypertension 1999;33:694-7.

19. Manunta P, Cusi D, Barlassina C, Righetti M, Lanzani C, D’Amico M, et al. Alpha-adducin polymorphisms and renal sodium handling in essential hypertensive patients. Kidney Int 1998;53:1471-8.

20. Ferrandi M, Salardi S, Tripodi G, Barassi P, Rivera R, Manunta P, et al. Evidence for an interaction between adducin and Na(+)-K(+)-ATPase: Relation to genetic hypertension. Am J Physiol 1999;277:H1338-49.

21. Levin MC, Marullo S, Muntaner O, Andersson B, Magnusson Y. The myocardium-protective Gly-49 variant of the beta 1-adrenergic receptor exhibits constitutive activity and increased desensitization and down-regulation. J Biol Chem 2002;277:30429-35.

Documents

Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension