Changes in Bacterioplankton Composition under Different Phytoplankton Regimens

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2004, p. 6753–6766 Vol. 70, No. 110099-2240/04/$08.00�0 DOI: 10.1128/AEM.70.11.6753–6766.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Changes in Bacterioplankton Composition under DifferentPhytoplankton Regimens†

Jarone Pinhassi,1* Maria Montserrat Sala,1 Harry Havskum,2 Francesc Peters,1Oscar Guadayol,1 Andrea Malits,1‡ and Celia Marrase1

Institut de Ciencies del Mar-CMIMA (CSIC), Barcelona, Catalunya, Spain,1 and Marine BiologicalLaboratory, University of Copenhagen, Helsingør, Denmark2

Received 13 May 2004/Accepted 20 July 2004

The results of empirical studies have revealed links between phytoplankton and bacterioplankton, such asthe frequent correlation between chlorophyll a and bulk bacterial abundance and production. Nevertheless,little is known about possible links at the level of specific taxonomic groups. To investigate this issue, seawatermicrocosm experiments were performed in the northwestern Mediterranean Sea. Turbulence was used as anoninvasive means to induce phytoplankton blooms dominated by different algae. Microcosms exposed toturbulence became dominated by diatoms, while small phytoflagellates gained importance under still condi-tions. Denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments showed that changes inphytoplankton community composition were followed by shifts in bacterioplankton community composition,both as changes in the presence or absence of distinct bacterial phylotypes and as differences in the relativeabundance of ubiquitous phylotypes. Sequencing of DGGE bands showed that four Roseobacter phylotypes werepresent in all microcosms. The microcosms with a higher proportion of phytoflagellates were characterized byfour phylotypes of the Bacteroidetes phylum: two affiliated with the family Cryomorphaceae and two with thefamily Flavobacteriaceae. Two other Flavobacteriaceae phylotypes were characteristic of the diatom-dominatedmicrocosms, together with one Alphaproteobacteria phylotype (Roseobacter) and one Gammaproteobacteria phy-lotype (Methylophaga). Phylogenetic analyses of published Bacteroidetes 16S rRNA gene sequences confirmedthat members of the Flavobacteriaceae are remarkably responsive to phytoplankton blooms, indicating thesebacteria could be particularly important in the processing of organic matter during such events. Our datasuggest that quantitative and qualitative differences in phytoplankton species composition may lead to pro-nounced differences in bacterioplankton species composition.

Studies of marine bacterioplankton diversity have provided acomprehensive inventory of the major groups of bacteria fre-quently observed in the water column (17, 22). Despite this,factors that determine the abundance of these bacteria remainrelatively unknown. Factors strongly correlated with bulk bac-terioplankton growth and abundance would be expected to beimportant in determining the success of different groups andspecies of bacteria. One such factor is phytoplankton biomass,which is frequently estimated as the concentration of chloro-phyll a (Chl a) (6, 8). The concentration of Chl a is a widelyused reference variable for planktonic life in aquatic environ-ments, and the distribution of marine bacterial populations isfrequently reported in relation to the spatial and temporaldistribution of Chl a (18, 50, 68). However, it appears likelythat bacterial community composition is influenced not only bythe Chl a concentration but also by the species composition ofthe algal assemblage (28, 51). Phytoplankton community com-position has a large impact on the survival and growth oforganisms in the grazing food chain (36). However, the impor-tance of phytoplankton community composition for the struc-

ture of the microbial food web in general, and bacterioplank-ton species composition in particular, is much less known.

Phytoplankton blooms dominated by diatoms typically occurin coastal seas and upwelling areas where currents bring nu-trients to the photic zone. In temperate regions, spring diatomblooms typically occur when high nutrient concentrations co-incide with increased solar irradiance. The species compositionof algal blooms can be modified by variations in the stability ofthe water column. For example, extended periods of calmweather during summer may lead to blooms of dinoflagellatesor filamentous cyanobacteria (3, 34). During phytoplanktonbloom senescence, bacterial abundance typically increases sub-stantially, coupled with large increases in per-cell activity inhydrolytic enzyme activity and growth rates (66). Few studieshave investigated the composition of bacterioplankton assem-blages in relation to naturally occurring or experimentally in-duced blooms of phytoplankton. However, it appears thatchanges in bacterial activity are associated with significantshifts in bacterioplankton species composition (48, 55). Bacte-ria shown to increase in abundance during the decay of algalblooms belong to such different phylogenetic groups as theBacteroidetes phylum and the Alpha- and Gammaproteobacteria(14, 55, 61, 72). The ecology of marine representatives of thesebacteria remains largely unknown. However, considering theample phylogenetic diversity within each of these groups, it canbe expected that they contain substantial physiological andmetabolic variability. Thus, insights into factors that contributeto the success of defined groups of bacteria will increase un-

* Corresponding author. Present address: Marine Microbiology, De-partment of Biology and Environmental Science, University of Kal-mar, S-39182 Kalmar, Sweden. Phone: 46 (0)480 446000. Fax: 46(0)480 447305. E-mail: [email protected].

† This is ELOISE contribution no. 496/40.‡ Present address: Laboratoire d’Oceanographie de Villefranche,

Station Zoologique, 06234 Villefranche-sur-Mer Cedex, France.

6753

derstanding of marine microbial processes. Comparative anal-ysis of the growth response of particular bacteria during algalblooms dominated by different algae or blooms occurring indifferent seas could provide a means to decipher the ecologicalroles of these bacteria.

Theoretical considerations based on hydrodynamics and dif-fusion rates indicate that turbulence can significantly increasethe flow of nutrients to algal cells larger than 60 �m (27). Theformation of chains by algae may cause an additional increasein the rate of diffusion to algal cells in turbulent water. Fur-thermore, turbulence may contribute to maintaining in suspen-sion cells that would otherwise sink. Thus, it is expected thatboth large or chain-forming phytoplankton may be favoredunder turbulent conditions, while small motile phytoplanktonwould dominate under still conditions. Indeed, nutrient enrich-ment experiments with seawater incubated under differentmixing regimens show that, other things being equal, turbu-lence results in phytoplankton assemblages dominated by dia-toms larger than 50 �m (1, 13). In the same experiments,microcosms maintained under still conditions became domi-nated by small phytoflagellates (diameters of �20 �m). Bac-teria, on the other hand, are too small to be directly affected bynaturally occurring levels of turbulence (35). However, turbu-lence may indirectly cause changes in bacterial abundance,gross bacterial production, and bacterial cell morphologythrough food web interactions in the plankton community (38,40, 46). Such interactions include turbulence-induced shifts ingrazing pressure on phytoplankton and bacteria (46, 57). It hastherefore been speculated that turbulence could indirectlymodify the structure of the bacterial assemblage in the upperwater column of the sea (40),

Given that turbulence has a significant impact on phyto-plankton community composition, we set out to investigatewhether such differences could be accompanied by comparablechanges in the bacterioplankton assemblage. In the presentstudy, microcosm phytoplankton blooms were induced by nu-trient enrichment. Turbulent or still conditions were then usedto induce phytoplankton assemblages dominated by differentalgae. In this way, manipulations to induce changes in phyto-plankton were avoided that could otherwise also have haddirect effects on the bacterioplankton species composition(e.g., addition of nutrients in different proportions or distinctalgal inocula). Here we report on the growth of bacterioplank-ton assemblages in general, and on specific phylotypes in par-ticular, under different phytoplankton regimens induced byturbulence. Furthermore, as a way to identify general patternsin the occurrence of bacterial phylotypes under different phy-toplankton bloom conditions, we expanded our analysis andcompared the identities of bacterial phylotypes in our experi-ments to the identities of bacteria found during phytoplanktonblooms in previously published studies.

MATERIALS AND METHODS

Sampling and experimental design. Three experiments were performed withsamples of surface water. The water samples were from the northwestern Med-iterranean Sea collected 1 km offshore from the Catalan coast at Masnou(41°28�N, 2°18�E, 20 km north of Barcelona, Spain). The water samples werecollected from a depth of 0.5 m.

Control experiment without phytoplankton. On 4 November 2002, seawaterwas collected for a dilution culture experiment to monitor the growth of bacteriaunder turbulent and still conditions without other components of the microbial

community. For each culture, approximately 4.5 liters of sampled water to beused as growth medium was filtered through a 0.2 �m-pore-size filter (Sterivex;Millipore) using a peristaltic pump. A total of 500 ml of inoculum, prepared bygravity filtration of sampled water through 47-mm-diameter, 0.8-�m-pore-sizefilters (Nuclepore), was added to each culture to give a 10-fold dilution. Dupli-cate cultures were maintained under still (Sa and Sb) and turbulent (Ta and Tb)conditions in an environmental chamber at 17 °C � 1°C (in situ temperature)under a 12-h light/12-h dark cycle and a light irradiance of 225 �mol of photonsm�2 s�1. Cultures were maintained in 15-liter Plexiglas cylinders (24.2-cm innerdiameter and 34.5-cm depth). Small-scale turbulence was generated by verticallyoscillating grids, with a mesh size of 1.42 cm and bar thickness of 0.38 cm. Thegrid moved down to 1 cm from the bottom. The stroke length was 9 cm, and theoscillation frequency was set at 4.6 rpm. This gave an estimated energy dissipa-tion rate of 0.050 cm2 s�3 (45). This is within the range of turbulence intensitiesin surface waters in coastal areas with moderate winds (29). All material incontact with the samples was rinsed with 1 M hydrochloric acid and extensivelywashed with MilliQ-water prior to use. The cultures received nitrogen (NaNO3),phosphorus (Na2HPO4), and silicon (NaSiO3), added to final concentrations of16, 1, and 30 �M, respectively. Bacterial growth in the dilution cultures wasmonitored for 4 days.

Phytoplankton bloom experiment 1. Seawater was collected on 30 April 2001.For each microcosm, 15 liters of seawater was filtered through a 150-�m-meshnet in order to remove large zooplankton and enclosed in eight Plexiglas cylin-ders (see above) within 3 h after sampling. The experiment was performed in anenvironmental chamber at 15°C � 1°C (in situ temperature) under the sameirradiance as in the above experiment. Inorganic nutrients consisting of N(NaNO3), P (Na2HPO4), and Si (NaSiO3) were added to final concentrations of16, 1, and 30 �M, respectively. Microcosms received nutrients either by a singlebatch addition on day 0 (SB and TB) or by daily additions (SD and TD). Dailyadditions consisted of N, P, and Si to final concentrations of 2, 0.12, and 3.75 �M,respectively. Duplicates of each treatment were maintained under still (S) orturbulent (T) conditions until day 6, and one microcosm for each treatment wasmaintained until day 8. Small-scale turbulence was generated by vertically oscil-lating grids (see above), with a stroke length of 20 cm and an oscillation fre-quency of 3.75 rpm, giving an energy dissipation rate of 0.055 cm2 s�3. When thevolume of water decreased due to sampling, the stroke length was corrected tomaintain the initial energy dissipation rate. The final volume in the containers atthe end of the experiment was approximately 5 liters.

Phytoplankton bloom experiment 2. Seawater samples collected on 29 April2002 were used in an experiment with an experimental design similar to that ofphytoplankton bloom experiment 1. Microcosms were enriched with differentconcentrations of nutrients in this experiment. Control microcosms without nu-trient additions were maintained under still or turbulent conditions (S0 and T0).Enriched microcosms all received P (Na2HPO4), and Si (NaSiO3) at final con-centrations of 1 and 30 �M, respectively, while the concentration of N (NaNO3)was varied between 16 �M (S16 and T16) and 24 �M (S24 and T24). Microcosmswere incubated for 4 days at 15°C under a 12-h light/12-h dark cycle and irradi-ance as in previous experiments.

Nutrients and Chl a. Initial concentrations of total inorganic N, PO4, and Sibefore nutrient addition in our experiments were �0.78, 0.09, and 0.20 �M,respectively. These concentrations were low compared to the nutrient concen-trations added: the additions of P corresponded to maximum values after watercolumn mixing in winter, and N was added in Redfield ratio to P. Silica wasadded in excess to avoid Si limitation during the experiments. The Chl a con-centration was estimated fluorometrically from 20-ml samples filtered throughWhatman GF/F filters. The filters were ground in 90% acetone and left in thedark at room temperature for at least 2 h. The fluorescence of the extract wasmeasured with a Turner Designs fluorometer.

Microplankton enumeration and biomass calculation. Samples for determi-nation of microplankton biomass (i.e., phytoplankton and heterotrophicdinoflagellates and ciliates) in phytoplankton bloom experiment 1 were collectedon day 6. In addition, heterotrophic dinoflagellates and ciliates were quantifiedin detail on a daily basis throughout the experiment. Abundance and biomass ofheterotrophic and phototrophic dinoflagellates was determined as previouslydescribed (24). Samples were fixed with 2% glutaraldehyde (final concentration),which gave the cells a greenish color under blue fluorescence, and filtered ontoblack 0.8-�m-pore-size black polycarbonate filters. The filters were frozen on thesampling day and stored at �20°C to preserve Chl a autofluorescence, and themicroplankton were counted within 6 months by epifluorescence microscopy ata magnification of �600 or �1,000. The dinoflagellates were assigned to eightgroups according to their size and taxonomic relationships. Samples of micro-plankton other than dinoflagellates were fixed in formaldehyde buffered withhexamine (0.4% final concentration; pH 7.2). These microplankton were exam-

6754 PINHASSI ET AL. APPL. ENVIRON. MICROBIOL.

ined using inverted microscopy and were assigned to nine groups according totheir size and taxonomic relationships by the method of Havskum and Hansen(24). At least 100 cells of each group were counted, and cell volumes werecalculated from the average cell dimensions of 50 cells in each group. Thedimensions of naked flagellates and ciliates were multiplied by a factor of 1.1 tocompensate for shrinkage due to fixation. Cell volume was converted to cellcarbon using a conversion factor of 0.13 pg of C �m�3 for thecate dinoflagellatesand 0.11 pg of C �m�3 for other flagellates and ciliates. Diatom cell carbon wascalculated from cell volume after subtracting the vacuole volume, assuming aplasma layer thickness of 2 �m, and the remaining volume was converted tocarbon content using conversion factor 0.11 pg of C �m�3 (conversion factorsused by Havskum and Hansen [24]).

Bacterial heterotrophic production and abundance. Bacterial heterotrophicproduction was measured in phytoplankton bloom experiment 1, using[3H]leucine incorporation with the microcentrifuge protocol (65). For each sam-ple, triplicate aliquots (1.2 ml) and a trichloroacetic acid-killed control wereincubated with 20 nM [3H]leucine (final concentration) for 1 to 2 h at 15 or 17°C.The theoretical conversion factor of 3.1 kg of C mol�1 was used to convertleucine incorporation rates to bacterial carbon production.

In the control experiment, bacterial abundance was determined by epifluores-cence microscopy. Samples were preserved with glutaraldehyde (filtered througha 0.2-�m-pore-size filter) (final concentration, 1% [wt/vol]) and were countedwithin 48 h. Bacteria were stained with a final concentration of 5 �g of 4�,6-diamidino-2-phenylindole (DAPI) ml�1 for 10 min and filtered onto black 0.2�m-pore-size polycarbonate filters at a pressure of 100 to 200 mm Hg (52).

In the phytoplankton bloom experiments, bacterial abundance was determinedby flow cytometry. Samples were preserved with a mixture of 1% paraformalde-hyde and 0.05% glutaraldehyde (final concentrations) and stored frozen at�70°C. Cell counts were done with a Becton Dickinson FACSCalibur flowcytometer after the cells were stained with Syto13 at a final concentration of 5�M (16).

Ectoenzymatic activity. Hydrolytic ectoenzyme activity was determined usingfluorogenic substrates by the method of Sala et al. (58). The activities of �- and-glucosidase were assayed as the hydrolysis rate of methylumbelliferone(MUF)-�-D-glucoside and 4-MUF--D-glucoside, respectively. Alkaline phos-phatase was assayed using 4-MUF-phosphate. Aminopeptidase was assayed us-ing leucine 7-amido-4-methylcoumarin. Briefly, 0.9 ml of a sample was incubatedwith substrate (final concentration, 0.1 mM) for 60- to 90-min incubation in thedark at room temperature. The increase of fluorescence during incubation wasmeasured with a spectrofluorometer (Shimadzu RF-540) with 365-nm-wave-length excitation and 446-nm-wavelength emission radiation. Fluorescence wastransformed into activity units using a standard curve of the end product of thereaction: 4-MUF was used for �-glucosidase, -glucosidase, and alkaline phos-phatase, and 7-amino-4-methylcoumarin was used for aminopeptidase.

Collection of microbial community DNA and extraction procedure. For ex-traction of community DNA, microbial biomass from approximately 700 ml ofseawater was collected onto 0.2-�m-pore-size polycarbonate filters (Durapore;Millipore) by vacuum filtration at �150 mm Hg. Filters were stored frozen at�70°C in sucrose buffer (0.75 M sucrose, 40 mM EDTA, 50 mM Tris [pH 8.3]).In phytoplankton bloom experiment 1, samples for community DNA were col-lected at the beginning of the experiment (day 0) and on every second day untilday 8. In the other experiments, samples were collected at the beginning and end(day 4). DNA was extracted as previously described (63). Briefly, cells weretreated with lysozyme, proteinase K, and sodium dodecyl sulfate followed byphenol-chloroform-isoamyl alcohol extraction. Extracted DNA was desalted andconcentrated using a Centricon-100 filter device (Millipore).

PCR and denaturing gradient gel electrophoresis (DGGE). A 16S rRNA genefragment (approximately 550 bp long) was amplified by PCR, using the bacteri-um-specific primer 358f (5�-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) that is complementary topositions 341 to 358 (Escherichia coli numbering) and has a GC clamp (under-lined) and the universal primer 907rm [5�-CCGTCAATTC(A/C)TTTGAGTTT]that is complementary to positions 927 to 907. The reaction mixture volumeswere 50 �l, containing 10 ng of template, 200 �M concentration of each de-oxynucleoside triphosphate, standard 1� PCR buffer, 1.5 mM MgCl2, 0.3 �Mconcentration of each primer, 200 �g of bovine serum albumin, and 1 U of Taqpolymerase (GIBCO BRL). After an initial denaturation step (5 min at 94°C),samples were amplified with 10 touchdown cycles, with 1 cycle consisting ofdenaturation (1 min at 94°C), annealing (1 min at 65 to 55 °C [temperature of 65°C in the first cycle, with the temperature decreasing 1°C each cycle and endingat 55°C in the last cycle]), and extension (3 min at 72°C). This was followed by 20standard cycles, with 1 cycle consisting of denaturation (1 min at 94°C), annealing(1 min at 55°C), and extension (3 min at 72°C), and a final extension step (7 min

at 72°C). PCR products were quantified by agarose gel electrophoresis with amolecular size standard in the gel (Low DNA Mass ladder; GIBCO BRL).

A total of 800 ng of PCR product for each sample was loaded on a 6% (wt/vol)polyacrylamide gel (acrylamide and N,N�-methylene bisacrylamide at a ratio of37:1) with a denaturing gradient that ranged from 40 to 80% (where 100% isdefined as 7 M urea and 40% deionized formamide). Electrophoresis was per-formed with a DGGE-2000 system (CBS Scientific Company). The gel was runat 100 V for 16 h at 60°C in 1� TAE running buffer (40 mM Tris [pH 7.4], 20 mMsodium acetate, 1 mM EDTA). The gel was stained with the nucleic acid stainSYBR Gold (1:10,000 dilution; Molecular Probes) for 45 min, rinsed with 1�

TAE running buffer, removed from the glass plate to a UV transparent gel scoop,and visualized with UV in a Fluor-S MultiImager (Bio-Rad) with the Multi-Analyst software (Bio-Rad).

Bacterial assemblage DGGE fingerprints of samples collected during phyto-plankton bloom experiment 1 were used to generate a dendrogram using theDiversity Database software (Bio-Rad), applying Jaccard coefficients, Euclideansquare distances, and unweighted paired group means analysis (gel image notshown). A complementary DGGE gel from this experiment was prepared tovisualize details in the structure of the bacterial assemblage from days 4 to 8.

In our hands, repeated PCR and DGGE analyses consistently yielded the samebanding patterns and nearly identical band intensities. The methodological lim-itations of the approach using PCR amplification and DGGE analysis have beendiscussed extensively elsewhere (33, 42, 63). The approach gives an estimate ofmicrobial community structure in a semiquantitative manner, with variations inthe banding pattern of samples indicating relative changes in the microbialcommunity, rather than changes in the absolute abundance of particular taxa.Thus, this approach may be indicative of possible changes in bacterial communitystructure in response to different experimental conditions.

Sequencing of DGGE bands. DGGE bands were excised using a sterile razorblade and eluted in 20 �l of MilliQ water overnight at 4°C, followed by afreeze-thaw cycle. A total of 5 �l of the eluate was used for reamplification withthe original primer set. A portion of the PCR product was analyzed by DGGEtogether with the original sample to verify the correct position of the band, andin cases where more than one band was present, the target band was processedagain as described above. PCR products were purified with the QIAquick PCRpurification kit (QIAGEN) and quantified in an agarose gel. Ten to 20 ng of thePCR product was used for the sequencing reaction, using primer 358f without theGC clamp, with the BigDye terminator cycle-sequencing kit (Perkin-Elmer Cor-poration) and an ABI PRISM model 377 (v3.3) automated sequencer (per-formed by QIAGEN GmbH Sequencing Services).

Phylogenetic analyses. Our 16S rRNA gene sequences were compared toexisting prokaryotic sequences in GenBank (National Center for BiotechnologyInformation) using BLAST. Comparison of BLAST results from databasesearches with different regions of the sequences showed that our sequences werenot chimeras. Sequences were aligned using the Pileup command in the Wis-consin Package (also called GCG package) (version 9.1; Genetics ComputerGroup [GCG], Madison, Wis). Phylotypes that were present in 50% or more ofthe samples from either the still or turbulent microcosms and that showed doubleor greater relative intensity in the DGGE fingerprints in one mixing regimenwere considered characteristic for the treatment.

A phylogenetic tree of our 16S rRNA gene sequences was constructed usingJukes-Cantor distances with the PHYLIP package (version 3.5) (15). The treewas calculated from sequences corresponding to approximately nucleotide posi-tions 500 to 900 (E. coli numbering) and rooted with an actinomycete as anoutgroup. Sequences from representative type species of currently describedgenera in the Bacteroidetes phylum were included as references. Sequences de-posited in GenBank from isolates and phylotypes of Bacteroidetes from previousstudies of bacterioplankton species composition during natural or experimentalmarine algal blooms were also included in the phylogenetic tree.

Published Bacteroidetes 16S rRNA gene sequences that were derived fromalgal blooms and that did not overlap sufficiently with our sequences to yield aphylogenetic tree with reliable branching order were included in complementaryphylogenetic trees (data not shown). These phylogenetic trees also included theBacteroidetes reference sequences and encompassed nucleotides between ap-proximately nucleotide positions 50 to 500 or 350 to 500 (E. coli numbering). Thephylogenetic affiliations obtained from the phylogenetic trees were verified byBLAST searches with the search string limited by the terms “bacteria[ORGN]AND sp nov[WORD]” to reveal the closest matching characterized bacterialspecies. Pair-wise sequence comparisons were performed using the BestFit com-mand in the GCG package. The results of our phylogenetic analyses consistentlyagreed with those presented in the original publications.

VOL. 70, 2004 BACTERIOPLANKTON COMPOSITION DURING ALGAL BLOOMS 6755

RESULTS

Control experiment without phytoplankton. A dilution cul-ture experiment, in which bacteria were grown in the absenceof other components of the microbial community, was per-formed to determine whether turbulence per se could affectthe structure of the bacterioplankton assemblage. The exper-iment lasted 4 days to avoid the growth of heterotrophic flagel-lates that might not have been eliminated by filtration of theinoculum and because bacterial abundance had increased sub-stantially in 4 days.

Initial bacterial abundance in the seawater cultures was 0.2� 106 cells ml�1. After 4 days of incubation, bacterial abun-dance had increased 10-fold to ca. 4.4 � 106 and 2.3 � 106 cellsml�1 in the turbulent (Ta and Tb) and still cultures (Sa and Sb),respectively (Fig. 1A).

The structure of the bacterial assemblage in all seawatercultures changed substantially and in a similar way from day 0(initial sample) until day 4 (final sample). In the final samples,the same 21 bands were detected in both the turbulent and stillcultures (Fig. 1B). Only minor differences in relative bandintensity between the two treatments were observed.

Phytoplankton bloom experiment 1. Phytoplankton bloomexperiment 1 was performed to study the response of thebacterioplankton species composition to different mixing reg-imens in the presence of the entire microbial community. Theexperiment lasted 8 days to allow sampling both during theinduced phytoplankton blooms and their decay.

The initial Chl a concentrations were 1.5 �g liter�1. Chl aconcentrations in the turbulent microcosms (TB and TD)peaked at approximately 25 �g liter�1 on day 5 (Fig. 2A) andthen fell to below 10 �g liter�1 by day 8. Chl a concentrationsin the still microcosms increased more slowly and reached 8 or4 �g liter�1 in the microcosms with a single batch addition ofnutrients (SB) or with daily nutrient additions (SD), respec-tively.

During the phytoplankton bloom, the chain-forming diatomChaetoceros socialis (cell length, 8 �m; chain lengths up to afew millimeters) dominated the phytoplankton biomass in theturbulent microcosms, with a significant contribution also byPseudonitzschia sp. and other diatoms (Table 1). These dia-toms together reached a biomass of ca. 100 �g of C liter�1 inthe microcosms exposed to turbulence (approximately 90% ofthe total algal biomass). In the still microcosms, the diatombiomass was 10-fold lower than that in the turbulent micro-cosms. The biomass of phytoflagellates (i.e., cells �10 �mlong, mostly prasinophytes and haptophytes) was approxi-mately 5 to 10 �g of C liter�1 in all microcosms. Thus, in theturbulent microcosms, the biomass ratio of phytoflagellates todiatoms was ca. 0.08, while in the still microcosms, the ratioswere 0.37 and 0.62.

Microzooplankton reached nearly 10-fold-higher biomass inthe turbulent microcosms compared to the biomass of the stillmicrocosms (Table 1). On day 6, a tintinnid ciliate biomass ofup to 19 �g of C liter�1 was observed in the turbulent micro-cosms, and the biomass of the heterotrophic dinoflagellateProtoperidinium bipes was around 3 �g of C liter�1. Dailymeasurements of the biomass of P. bipes during the experimentshowed that it increased from an initial biomass below detec-tion to 5.54 �g of C liter�1 on day 8 in the microcosms exposed

to turbulence. Observation of live samples from the micro-cosms showed that P. bipes was actively feeding on cells ofPseudonitzschia sp. (H. Havskum, unpublished data). In thestill microcosms, the biomass of heterotrophic dinoflagellateswas slightly higher than the biomass of heterotrophic ciliates.

Heterotrophic bacterial production showed an initial peakon day 2. Starting on day 4, heterotrophic bacterial productionincreased again in all microcosms and reached approximately200 �g of C liter�1 day�1 toward the end of the experiment(Fig. 2B). Lower bacterial production and abundance was ob-served in the SB microcosms from day 6 on. Cell-specific car-bon production rates ranged from 20 to 89 fg of C cell�1 day�1

in the still microcosms and 18 to 50 fg of C cell�1 day�1 in theturbulent microcosms, with the highest values from days 4 to 6.

The dynamics of bacterial abundance was similar to that ofbacterial production, with an initial peak on day 2, followed by

FIG. 1. Bacterial abundance (A) and DGGE profiles of bacterialassemblages (B) in the control experiment without phytoplankton.Seawater cultures with bacteria only (fraction � 0.8 �m) were main-tained under turbulent (T) and still (S) conditions, with two replicatesof each treatment (a and b). Values are the means � standard devi-ations (error bars) of duplicate cultures. Community DNA was col-lected on day 0 (initial) and day 4. The sampling time is shown in days(d).


a period of decreasing abundance (Fig. 2C). Thereafter, theabundance increased again from day 5 on. On day 8, thehighest abundance of bacteria was recorded in the TB micro-cosm (1.3 � 107 cells ml�1) and the lowest abundance wasobserved in the SB microcosm (2.5 � 106 cells ml�1).

The activities of alpha- and beta-glucosidase, aminopepti-dase, and alkaline phosphatase remained low for the first 4days. From day 5 on, enzyme activities increased nearly 20-foldin the turbulent microcosms and 5- to 10-fold in the still mi-crocosms, concomitant with the peak and decay of the phyto-plankton blooms (Fig. 3, left panels). The highest activitieswere recorded for aminopeptidase (up to 1.0 � 104 �molliter�1 h�1) and alkaline phosphatase (up to 3.3 � 103 �molliter�1 h�1). Bacterial cell-specific hydrolysis rates of alpha-and beta-glucosidase and aminopeptidase peaked midwaythrough the experiment at values that were 5- to 10-fold higherthan the initial rates (Fig. 3, right panels). A peak in alkalinephosphatase activity normalized to bacterial abundance wasobserved on day 5 after an increase of more than 20-fold.

When normalized to total microbial biomass, including phyto-plankton, alkaline phosphatase activity showed a ninefold in-crease during the last 4 days of the experiment (Fig. 3, insert).

DGGE analysis of samples from days 0 to 8 revealed be-tween 11 and 20 bands in each sample, with a total of 32different bands (data not shown). Cluster analysis of theDGGE banding patterns from the microcosms indicated thatgradual changes in the composition of the bacterial assem-blages occurred during the experiment both with and withoutturbulence (Fig. 4). At first, bacterioplankton composition wasrelatively similar, as indicated by the tight clustering of theinitial and day 2 samples from all microcosms. A clear divisionof still and turbulent samples in separate clusters was foundfrom day 4 on for the microcosms with a batch addition ofnutrients (TB and SB) and from day 6 on for the microcosmswith daily nutrient additions (TD and SD). DGGE analysisshowed that the structure of the bacterial assemblage in du-plicate microcosms that were maintained until day 6 was highlyreproducible (data not shown). The DGGE gel image of thebacterial assemblages in the microcosms from days 4 to 8 andthe excised bands that were sequenced are shown in Fig. 5.

The phylotypes that were abundant during the experimentwere mainly affiliated with bacteria in the Bacteroidetes phylumand the Roseobacter group in the Alphaproteobacteria (Fig. 5and Table 2). The phylogenetic affiliations of Bacteroidetesphylotypes detected in the microcosms are presented in Fig. 6.

All four phylotypes unique to or mainly found in the still

FIG. 2. Dynamics in microbial growth variables during phytoplank-ton bloom experiment 1. (A) Chl a concentrations. (B) Bacterial pro-duction estimated by leucine incorporation. (C) Bacterial abundance.Data were from seawater microcosms including the microbial commu-nity (fraction � 150 �m) incubated under turbulent (T) and still(S) conditions. Microcosms received nutrients as a batch addition onday 0 (TB and SB) or as daily additions (TD and SD). Values are themeans � standard deviations (error bars) for samples from duplicatemicrocosms maintained until day 6. Chl a concentrations are shown inmicrograms per liter, bacterial production is shown in micrograms ofcarbon per liter per day, and the sampling time is shown in days (d).

TABLE 1. Biomass of microplankton in the still and turbulentmicrocosms on day 6

Plankton groupBiomass (�g of C liter�1)a

TB TD SB SD

DiatomsChaetoceros socialis 86.23 126.13 8.74 11.85Pseudonitzschia sp. 2.91 5.32 1.27 1.06Other diatoms 2.98 5.79 0.12 ND

Phototrophic dinoflagellatescf. Cachonina niei 0.19 0.65 0.55 0.33Pentapharsodinium sp. 0.62 0.45 0.26 0.53Scrippsiella cf. trochoidea 1.28 0.40 1.38 0.81Other pigmented dinoflagellates ND 0.44 0.09 ND

Other algaeEuglenophyceae 0.42 ND ND NDDinobryon sp. 0.20 ND ND NDPhytoflagellates �10 �m

(prasinophytes, haptophytes,and others)

7.56 9.95 6.28 4.72

Heterotrophic dinoflagellatesGyrodinium sp. 0.41 0.20 0.09 0.40Protoperidinium bipes 3.23 3.23 0.58 0.28Katodinium glaucum ND ND 0.59 NDOther heterotrophicdinoflagellates

0.46 1.17 0.74 0.71

Heterotrophic ciliatesTintinnids 9.72 19.44 1.67 0.56Strombidium sp. 1.54 ND ND NDStrombilidium sp. 1.33 ND ND ND

a Biomass values above 2 �g of C liter�1 are shown in boldface type. ND, notdetected.


FIG. 3. Activities of the four hydrolytic ectoenzymes measured during phytoplankton bloom experiment 1 (left panels) and cell-specifichydrolysis rates obtained by normalizing enzyme activities to bacterial abundance (right panels). Enzyme activity is shown in micromoles per literper hour, and the hydrolysis rate is shown in femtomoles per cell per hour. The insert graph shows alkaline phosphatase activities (APA)normalized to total bacterial and algal biomass (expressed as micromoles per microgram of C per liter). Microcosms are labeled as described inthe legend to Fig. 2. Values are the means � standard deviations (error bars) for samples from duplicate subsamples. AMA, aminopeptidaseactivity; d, days.


microcosms belonged to the Bacteroidetes (Fig. 5 and Table 2).The phylotypes MED-S1, -S2, and -S4 were absent in the initialsamples and appeared from day 4 on. MED-S1 clustered withmembers of the family Flavobacteriaceae but was only distantlyrelated to previously reported sequences. The very intenseband in the still microcosms corresponding to phylotypeMED-S2 was affiliated with bacteria in the genus Tenacibacu-lum in the Flavobacteriaceae (Fig. 6). This phylotype showedhigh sequence similarity to clone CF10 obtained from a 16SrRNA gene clone library from water collected from the Dela-ware estuary (31). Phylotype MED-S4 showed low sequencesimilarities (�90%) to previously reported bacteria in the fam-ily Cryomorphaceae. Phylotype MED-S5, which was present inthe initial sample, was maintained in the still microcosms butdisappeared with turbulent conditions. This phylotype was re-lated to bacteria in the newly described genus Brumimicrobiumin the Cryomorphaceae (7). Furthermore, MED-S5 was closelyrelated to a phylotype associated with the diatom Dytilumbrightwellii from the Gulf of Mexico (60). The DGGE bandMED-S3 showed high similarity to a chloroplast sequence ofthe diatom Chaetoceros socialis (the dominant algal speciesduring the experiment).

The bacterial assemblages in the turbulent microcosms werecharacterized by two phylotypes affiliated with bacteria in theBacteroidetes phylum (MED-T6 and -T7), one Gammapro-teobacteria phylotype (MED-T8), and a Roseobacter phylotype(MED-T9) (Fig. 5 and Table 2). The MED-T6 phylotype waspresent in the initial samples and was maintained in turbulentmicrocosms, while it disappeared in the still microcosms.MED-T6 showed a sequence similarity of 96.6% to theMED-S2 phylotype that was dominant in the still microcosms,

FIG. 4. Dendrogram comparing DGGE fingerprints of the bacte-rial assemblages in the turbulent (T) and still (S) microcosms duringphytoplankton bloom experiment 1. The subscript letters indicatebatch (TB and SB) or daily (TD and SD) mode of nutrient addition. Thenumbers after the microcosm are the day the sample was taken. expt.,experiment.

Time (d)

S1

S2S3

S4S5

T6

T7

T8

T9

ST10ST11ST12ST13

4 6 8SD SDSDSB SBSB

4 6 8TBTD TB TBTD TD

FIG. 5. Bacterioplankton composition during phytoplankton bloom experiment 1 visualized by DGGE of PCR-amplified partial 16S rRNAgenes. Bands that were cut from the gel and sequenced are indicated by their codes at the sides of the gel. Bands with S or T prefix, followed byband number, denote phylotypes mainly found in the still or turbulent microcosms, respectively. Bands with ST prefix, followed by band number,indicate ubiquitous phylotypes. All bands in Table 2 were given the prefix MED. The sampling time is shown in days (d).


and both probably represent separate species in the genusTenacibaculum (Fig. 6). MED-T7 appeared as a novel phylo-type in the microcosms exposed to turbulence. It clustered withmembers of the genera Cellulophaga and Zobellia in the Fla-vobacteriaceae, but the relatively low sequence similarity indi-cated that this phylotype may represent a novel genus.MED-T8 was affiliated with methylotrophic Gammaproteobac-teria able to process methylated sulfur compounds. MED-T9was 96.5% similar to Roseobacter litoralis and showed 96%sequence similarity to many bacterial isolates and sequencesfrom 16S rRNA gene clone libraries from various seas.

At least four different Roseobacter group phylotypes (MED-ST10, -ST11, -ST12, and -ST13) were members of the micro-cosm bacterial assemblages independent of mixing regimen(Fig. 5). The sequence similarity among these phylotypes was94.5%. The sequence similarity among all members affiliatedwith the Roseobacter group is �90% (21), indicating that alimited subset of this group was present in our experiment.MED-ST10 and -ST13 were new phylotypes that appeared inboth the still and turbulent microcosms. MED-ST11 and -ST12were present in the initial samples and were maintained in allmicrocosms throughout the experiment. MED-ST11 was iden-tical to clone NAC11-3 found in the North Atlantic (21), andit was 96.7% similar to an isolate that was abundant in unen-riched seawater cultures from the Red Sea (49). MED-ST13

was closely related to the taxonomically defined species Ro-seobacter gallaeciensis.

Phytoplankton bloom experiment 2. Phytoplankton bloomexperiment 2 was performed to verify that the different bacte-rioplankton species compositions during phytoplanktonblooms generated under turbulent and still conditions werereproducible. The experiment lasted 4 days, since the phyto-plankton blooms evolved faster than in phytoplankton bloomexperiment 1.

Initial Chl a concentrations were 3 �g liter�1 in all micro-cosms (Fig. 7A). Peaks in Chl a concentrations were reachedon day 2 in the enriched microcosms. The highest Chl a con-centrations, 24 �g liter�1, were observed in the turbulent mi-crocosms (T16 and T24). Chl a concentrations in the still mi-crocosms (S16 and S24) on day 2 peaked at 16 �g liter�1. Chl ain the unenriched microcosms (T0 and S0) remained around 3�g liter�1 during the experiment.

Initial bacterial abundance in the microcosms was 1.8 � 106

cells ml�1 (Fig. 7B). After 24 h, bacteria declined from 1.5 �106 to 2.0 � 106 cells ml�1 to 0.5 to 0.7 � 106 cells ml�1.Bacteria remained low until day 4, when the abundance in allmicrocosms increased to approximately 1.1 � 106 cells ml�1.

DGGE analysis indicated the presence of 15 to 17 phylo-types in each of the microcosms, with a total of 25 differentbands (Fig. 7C). In the microcosms exposed to turbulence (T16

TABLE 2. Phylogenetic affiliation of 16S rRNA gene sequences from excised DGGE bands obtained during phytoplankton bloomexperiment 1

Phylotype and band GenBankaccession no. Relative in GenBanka Similarity

(%) Family Taxonb

Still microcosm phylotypesMED-S1 AY573520 Uncultured marine bacterium AY-56; AJ298372 94.5 Flavobacteriaceae CFB

Cellulophaga fucicola; AJ005973 92.7MED-S2 AY573521 Bacteroidetes clone CF10; AY274847 98.3 Flavobacteriaceae CFB

Tenacibaculum copepodarum; AB078044 97.6MED-S3 AY573522 Chaetoceros socialis chloroplast; AJ319825 97.9 Diatom AlgaeMED-S4 AY573523 Uncultured marine bacterium BY-71; AJ298380 91.1 Cryomorphaceae CFB

Cryomorphaceae bacterium UST02; AB125062 90.0MED-S5 AY573524 Uncultured bacterium SB-42-DB; AJ319829 98.7 Cryomorphaceae CFB

Brumimicrobium glaciale; AF521195 93.9

Turbulent microcosm phylotypesMED-T6 AY573525 Uncultured marine bacterium BY-65; AJ298376 100.0 Flavobacteriaceae CFB

Tenacibaculum sp. strain UST99; AF465364 97.8MED-T7 AY573526 Bacteroidetes clone CF2; AY274851 98.8 Flavobacteriaceae CFB

Bacteroidetes bacterium ANT9105; AY167316 92.3MED-T8c Methylophaga marina; X95459 90 Piscirickettsiaceae GammaMED-T9 AY573527 Marine alpha-proteobacterium AS-21; AJ391182 100.0 Roseobacter Alpha

Rhodobacteraceae bacterium TL; AY177716 100.0

Ubiquitous phylotypesMED-ST10 Marine eubacterium DDGE-6; AJ242823 96 Roseobacter Alpha

Roseobacter sp. strain KT0202; AF305498 96MED-ST11 AY573528 Roseobacter clone NAC11-3; AF245632 100.0 Roseobacter Alpha

Roseobacter RED68; AY136132 96.7MED-ST12 AY573529 Proteobacterium clone EBAC36F02; AF268234 100.0 Roseobacter Alpha

Sulfitobacter pontiacus; Y13155 97.7MED-ST13 AY573530 Marine bacterium ATAM407-56; AF359535 99.0 Roseobacter Alpha

Roseobacter gallaeciensis; Y13244 97.7

a For each phylotype, the closest relative in GenBank and the closest cultured relative are shown together with their accession number (after semicolon) and sequencesimilarity.

b CFB, Cytophaga-Flavobacterium-Bacteroides or Bacteroidetes phylum; Alpha, Alphaproteobacteria; Gamma, Gammaproteobacteria.c Sequence of low quality and was not submitted to GenBank.


and T24), a very strong band was located in the upper part ofthe gel, while nine bands with similar and low intensities werefound in the lower part of the gel. In the still microcosms (S16

and S24), four bands were visible in the upper part of the gel(Fig. 7C). In these samples, seven bands identical to those inthe turbulent microcosms were visible in the lower part of thegel, two of which were relatively intense. The DGGE gel pat-terns from the microcosms without nutrient addition (S0 andT0) showed some similarities to those from the enriched still

microcosms, containing several bands in the upper region ofthe gel, and a higher intensity of some of the multiple bands inthe lower part of the gel (Fig. 7C).

DISCUSSION

Both theoretical and empirical evidence indicate that thegrowth of marine bacterioplankton is mostly unaffected byturbulence (27, 40, 46). This is mainly due to the small size of

FIG. 6. Phylogenetic tree depicting relationships among partial 16S rRNA gene sequences of Bacteroidetes phylotypes detected duringphytoplankton bloom experiment 1 (shown in boldface type) compared to type species of representative genera in the phylum. The approximateposition of phylotype MED-S4 is indicated by the short boldface broken line; the sequence was not included in the alignment due to its shorterlength. Phylotypes found in natural and experimental algal blooms in previous articles are also included. Phylotype codes are as follows: S and T(this paper), AY and BY (61), AWS (72), BB (5), and DI (J. Pinhassi, unpublished data). Phylotype and isolate names are followed by theirGenBank accession number. The scale bar depicts 0.1 substitution per nucleotide position.


bacteria, which precludes significant gains in bacterial nutrientuptake even with relatively high turbulence. Our control ex-periment without phytoplankton confirmed that the structuresof the bacterial assemblages growing under turbulent or stillconditions were generally similar. Nevertheless, some differ-ences in bacterial abundance were observed, similar to thosefound in a recent freshwater study (2). Many phytoplanktongroups, however, are sufficiently large to be directly affected byturbulence, and the mixing regimen plays an important role in

structuring phytoplankton communities (1, 3, 13, 23). In accor-dance with previous studies (1, 13), we found that diatoms andphytoflagellates increased their share of the total phytoplank-ton biomass under turbulent and still conditions, respectively.Although the direct effect of turbulence on bacteria is limited,significant effects of turbulence on gross bacterial productionand abundance are observed in the presence of phytoplankton(38, 40, 46). Here we show that changes in the phytoplanktoncomposition between microcosms maintained under turbulentor still conditions were paralleled by shifts in the compositionof the bacterial community. The differences in bacterioplank-ton were apparent from both the appearance and disappear-ance of unique phylotypes and changes in the relative abun-dance (i.e., band intensity) of ubiquitous phylotypes. Thisimplies that changes in phytoplankton community compositionand other subsequent associated changes in the microbial foodweb caused the differences in the bacterioplankton speciescomposition. Our results support previous speculations thatthe composition of algal assemblages is an important factor indetermining the development of different bacterial populationsin waters with contrasting phytoplankton (28, 51).

Algal classes differ substantially in their biochemical com-position, in terms of C/N/P ratios and in terms of relativeproportions of cellular protein, fatty acids, and nucleic acids(53, 70). Differences in the biochemical composition of domi-nant phytoplankton could cause differences in the stoichiom-etry of particulate and dissolved organic matter and in theavailability of mineral nutrients in seawater, all of which couldprofoundly affect the growth of bacteria (37). Studies of algalcultures, including diatoms and dinoflagellates, have suggestedthe existence of specific associations between phytoplanktonand bacterioplankton species, possibly due to the differentialrelease of organic matter from the algae (25, 60). To this end,van Hannen et al. showed that enrichment of lake water con-tinuous cultures with detritus from either a green alga or cya-nobacterium resulted in the growth of different bacterial as-semblages (71). These findings are in agreement with generalconclusions concerning the importance of the quality of theorganic matter for bacterial community composition and ac-tivity (10, 11, 32, 48, 49). This suggests the possibility of findingcommon patterns in the distribution of particular bacterialgroups or species during blooms dominated by different phy-toplankton.

Quantitative and qualitative differences in planktonic grazerpopulations have important consequences both for the patternof nutrient regeneration and the release of dissolved organicmatter. Furthermore, higher nutrient recycling rates resultingfrom increased grazing rates on phytoplankton under turbulentconditions have been suggested to affect bacterial growth, pos-sibly in combination with decreased grazing rates on bacteria(46, 47). We observed greater microzooplankton biomass inthe microcosms dominated by diatoms (turbulent microcosms)than in the microcosms with a higher proportion of phyt-oflagellates (still microcosms). Moreover, ciliates accountedfor a majority of the microzooplankton in the diatom blooms,while heterotrophic dinoflagellates were the dominant grazersin blooms with higher proportion of phytoflagellates. Thus,variation in substrate supply to bacteria due to differences inphytoplankton community composition could have been fur-ther amplified by different grazer assemblages.

FIG. 7. Time course of Chl a concentration (A) and bacterial abun-dance (B) in phytoplankton bloom experiment 2. DGGE profiles ofthe bacterial assemblages (C). Seawater microcosms including the mi-crobial community (fraction � 150 �m) were incubated under turbu-lent (T) or still (S) conditions. Microcosms without nutrient additions(T0 and S0) and enriched with N, P, and Si (T16, 24, and S16, 24). Valuesare the means � standard deviations (error bars) of pooled data fromthe enriched microcosms. Community DNA was collected on day 0(initial) and on day 4. Chl a concentration is shown in micrograms perliter. The sampling time is shown in days (d).


A majority of the bacterial phylotypes identified in our studybelonged to the Roseobacter group (Alphaproteobacteria) or theBacteroidetes phylum. Phylotypes belonging to these groupshad different patterns in our microcosms. Whereas most of theRoseobacter phylotypes were ubiquitous, pronounced differ-ences were observed in the occurrence of Bacteroidetes phylo-types between the microcosms dominated by diatoms andthose with a higher proportion of phytoflagellates. This couldindicate that these bacterial groups responded to differentstimuli in our experiments. Possibly, Roseobacter phylotypesrepresented a response to the nutrient additions, while theBacteroidetes phylotypes were responding more to the turbu-lence-induced differences in the phytoplankton.

Bacteria in the Roseobacter group are widespread and abun-dant in the oceans and coastal areas of the world (20, 64).Members of the Roseobacter group have 16S rRNA gene se-quence similarities of �90% (21), and novel genera in thisgroup are continuously being described. Many characteristicshave been ascribed to the marine members of the Alphapro-teobacteria. For example, they are important in mediatingtransformations of dimethylated sulfur compounds (41), andmembers of the Roseobacter group have been suggested to beactive colonizers of particles under algal bloom conditions(55). Pinhassi and Berman (49) found that several Roseobacterspecies became dominant in cultures of unamended seawatercollected from the oligotrophic eastern Mediterranean Sea andthe Red Sea, suggesting that these bacteria are good compet-itors under low-nutrient conditions. Most of the Roseobacterphylotypes detected in the present study were found through-out our microcosms and were affiliated with different repre-sentatives of the group, such as Roseobacter gallaeciensis, Sul-fitobacter pontiacus, and the Atlantic Ocean clone librarysequence NAC11-3. The persistence and growth of a substan-tial subset of Roseobacter phylotypes in our microcosms may atfirst suggest that these are generalist bacteria. However, in adetailed study of a Roseobacter clade-affiliated cluster, whichincludes the clone NAC11-3, Selje et al. (64) described signif-icant differences in the geographic distribution of phylotypesthat differed by only a few base pairs in the 16S rRNA gene.Future comprehensive phylogenetic analyses and genomecomparisons of members of the Roseobacter group will clarifywhether the large variety of characteristics ascribed to thesebacteria can be explained by a high degree of phenotypic dif-ferentiation by phylogenetically relatively closely related bac-teria.

The Bacteroidetes phylum is highly diverse; at this time, itconsists of 12 families and 79 described genera. Several ofthese taxa contain representatives from marine environments,documented by culture-independent techniques or by culturedisolates. Bacteria belonging to the Bacteroidetes are abundantin seawater (12, 19, 30), and previous studies have emphasizedtheir importance under algal bloom conditions (48, 55). How-ever, it remains unclear whether particular taxa within theBacteroidetes are more commonly found than others in themarine environment (31, 44) and whether certain growth con-ditions selectively favor certain taxa in this phylum. Two phy-lotypes (MED-S4 and -S5) belonging to the family Cryomor-phaceae were unique to the microcosms with a higherproportion of phytoflagellates, although they formed relativelyfaint bands on the DGGEs. The most intense bands in the

upper region of the DGGE were identified as phylotypes be-longing to the family Flavobacteriaceae. Two Flavobacteriaceaephylotypes (MED-S1 and -S2) were dominant in the micro-cosms with a higher proportion of phytoflagellates. Two othermembers of this family were dominant in the microcosms dom-inated by diatoms. These phylotypes, MED-T6 and -T7, wereidentical to the BY-65 and BY-66 phylotypes, respectively (Fig.6), which were originally detected in 1996 during a diatombloom experiment performed 200 km northeast of the site ofthe present experiment (61). This surprisingly consistent re-sponse to diatom bloom conditions of a few Flavobacteriaceaephylotypes in the Mediterranean Sea could indicate that somebacteria in this family harbor physiological or ecological traitsthat make them tightly coupled to diatom species.

Bacteria responding to experimental treatments in a singlelocation may be particular to that location rather than repre-senting general trends in the growth potential of different bac-teria. Therefore, we extended our phylogenetic analysis to in-clude 16S rRNA gene sequences of Bacteroidetes phylotypesand isolates from all published studies of marine bacterio-plankton diversity associated with natural or experimental al-gal blooms (Table 3 and Fig. 6). Our analyses showed that eventhough the Bacteroidetes phylum can be divided into at least 12families, as much as 80% of the Bacteroidetes phylotypes inthese studies (among a total of 63 sequences) belonged to onesingle family, the Flavobacteriaceae. In particular, phylotypesaffiliated with the Tenacibaculum and Cellulophaga or Zobelliagenera were frequently found. Other recurrently detected gen-era in this family included Chryseobacterium, Polaribacter, Ge-lidibacter, and Psychroserpens. Therefore, we suggest that mem-bers of the family Flavobacteriaceae represent bacterialpopulations that play particularly important roles during andafter algal bloom events.

At this time, efforts are being made to revise the taxonomyof the Bacteroidetes phylum using phylogenetic analysis of the16S rRNA gene. This has contributed to the recent redefinitionof the family Flavobacteriaceae (4). As a consequence of thisrevision, bacteria previously named Cytophaga and foundthroughout the phylum have been renamed, and the type spe-cies of the genus Cytophaga is actually well separated from theFlavobacteriaceae. Bacteria in the Flavobacteriaceae havemenaquinone 6 (MK-6) as a major respiratory quinone, andthis family has therefore been called the marine MK-6 group(67). Suzuki et al. (67) observed that the members of Flavobac-teriaceae in their study were unable to use nitrate or ammo-nium as nitrogen sources, indicating that they required anorganic nitrogen source for growth. If confirmed, this obser-vation would substantiate previous findings that bacteria in thisgroup show a high growth capacity when dissolved proteins areabundant (9, 48), which may contribute to explaining why bac-teria in the family Flavobacteriaceae are recurrently found dur-ing the decay of algal blooms.

We have interpreted the changes in bacterioplankton spe-cies composition primarily as a consequence of the differencesin dominant phytoplankton groups, which in turn were depen-dent on the mixing regimen. It is also possible that the totalphytoplankton biomass played a role, since nearly three- tosevenfold-higher peaks in Chl a were recorded under turbulentconditions compared to still conditions. Even though thehigher bacterial abundance in the final samples in the micro-


cosms with pronounced diatom blooms could have resultedfrom the higher phytoplankton biomass achieved under turbu-lence, cell-specific bacterial growth rates and enzymatic activ-ities reached relatively similar levels in all microcosms. Differ-ences in the structure of the bacterial assemblage were alsoevident in our second bloom experiment, where peak Chl aconcentrations were only 50% higher under turbulent condi-tions compared to still conditions. We note that studies ofhorizontal variability in bacterial community structure repeat-edly find relatively similar bacterial assemblages over substan-tial distances despite apparent differences in Chl a concentra-tions (54, 56). At the same time, considerable variability inbacterial diversity is commonly found with depth, which maydepend largely on the stratification of phytoplankton popula-tions (see reference 51 and references therein).

For most of the year, the growth of bacteria in northwesternMediterranean waters is primarily limited by the availability ofP (59, 69). The first peak in bacterial production and abun-dance observed in phytoplankton bloom experiment 1 maytherefore be interpreted as a direct effect of the addition ofnutrients. The subsequent increase in bacterial production andabundance from day 5 on coincided with the peak and subse-quent senescence of the algal blooms. Concomitantly, alpha-and beta-glucosidase and aminopeptidase activities indicatedan increase of nearly an order of magnitude or more in the rateof bacterial utilization of carbohydrates and protein. The in-crease in phosphatase activity could result from the depletionof inorganic phosphate (data not shown) coupled with in-creased availability of organically bound P. Monitoring bacte-rioplankton species composition during the experimentshowed that the initial bacterial assemblage evolved into dif-ferent final assemblages in the microcosms dominated by dia-toms (turbulent microcosms) and in the microcosms with agreater proportion of phytoflagellates (still microcosms).

These findings corroborate previous results obtained primarilyfrom mesocosm experiments with water collected off ScrippsPier, California (39, 48, 55), which showed that changes inbacterial growth and activity during algal blooms were duemainly to shifts in bacterioplankton species composition.

Experimental phytoplankton bloom cycles usually take placewithin a week or two. The rapid shifts in bacterial activity andcommunity composition during such experiments result from arapid release of large quantities of organic matter and nutri-ents due to algal lysis and/or intense grazing during the decayphase of the blooms. Although sudden mass lysis of phyto-plankton blooms in the sea has been reported (43), phyto-plankton succession is mostly a gradual process, with changestaking place on a time scale of several weeks (23). As a con-sequence, the opportunity for rapid shifts in bacterioplanktonspecies composition could be limited by a relatively low supplyrate of organic matter and/or inorganic nutrients to bacteriaunder natural algal bloom conditions. This could explain inpart why the rate of seasonal succession in bacterioplankton isrelatively slow (i.e., several weeks), despite the high growthpotential of marine bacteria (50, 62). Still, we find it likely thata sustained release of organic matter and nutrients by live algalcells or by grazers in the long term could profoundly influencethe growth of particular bacterial populations, whether underalgal bloom or nonbloom conditions. Thus, the greater lengthof time that natural phytoplankton blooms persist compared tothat of experimental phytoplankton blooms could result inlarger differences in the bacterioplankton species associatedwith natural than with experimental blooms.

We have shown that changes in phytoplankton communitycomposition were accompanied by shifts in the composition ofthe bacterial assemblages. The most pronounced changes wereobserved for bacterial populations belonging to the phylumBacteroidetes, principally members of the family Flavobacteri-

TABLE 3. Number of 16S rRNA gene sequences affiliated with the family Flavobacteriaceae compared to other families in thephylum Bacteroidetesa

System Location

No. of phylotypes

ReferenceFlavobacteriaceae Other

Bacteroidetes

Natural algal bloomsDinoflagellates Southern California Bight 10 2 14Diatoms Chukchi Sea (Arctic) 3 0 72

Experimental bloomsDiatoms Southern California Bight 3 1 55Diatoms NW Mediterranean Seab 6 5 61Diatoms or flagellates NW Mediterranean Sea 4 2 This paperFlagellates Mexican Gulf 3 2 J. Pinhassi

(unpublished data)

Decomposition exptsProtein (bovine serum albumin) Southern California Bight 7 0 48Phaeocystis mucopolysaccharides North Sea and Balsfjord 4 1 26Diatom debris Southern California Bight 10 0 5

Total no. 50 13

a The 16S rRNA gene sequences were derived from studies of marine bacterioplankton diversity associated with natural and experimental algal blooms anddecomposition experiments with natural bacterial assemblages. Sequences from both phylotypes detected by culture-independent techniques and from cultured isolatesare included.

b NW, northwestern.


aceae, indicating that flavobacteria could be particularly im-portant in the processing of organic matter during algalblooms.

ACKNOWLEDGMENTS

We thank Jose M. Gonzalez for knowledgeable advice on phyloge-netic analysis. We greatly appreciate the valuable critical and helpfulcomments on the manuscript by Tom Berman, Josep M. Gasol, ConnieLovejoy, Carlos Pedros-Alio, and two anonymous reviewers.

This work was supported in part by the European Union (EVK3-CT-2000-00022 NTAP and EVK3-CT-2002-00078 BASICS) and by afellowship grant cofinanced by the Spanish Secretaría de Estado deEducacion y Universidades and the European Social Fund to J.P.

REFERENCES

1. Arin, L., C. Marrase, M. Maar, F. Peters, M.-M. Sala, and M. Alcaraz. 2002.Combined effects of nutrients and small-scale turbulence in a microcosmexperiment. I. Dynamics and size of osmotrophic plankton. Aquat. Microb.Ecol. 29:51–61.

2. Bergstedt, M., M. M. Hondzo, and J. B. Cotner. 2004. Effects of small scalefluid motion on bacterial growth and respiration. Freshwater Biol. 49:28–40.

3. Berman, T., and B. Shteinman. 1998. Phytoplankton development and tur-bulent mixing in Lake Kinneret (1992–1996). J. Plankton Res. 20:709–726.

4. Bernardet, J.-F., Y. Nakagawa, and B. Holmes. 2002. Proposed minimalstandards for describing new taxa of the family Flavobacteriaceae andemended description of the family. Int. J. Syst. Evol. Microbiol. 52:1049–1070.

5. Bidle, K. D., and F. Azam. 2001. Bacterial control of silicon regenerationfrom diatom detritus: significance of bacterial ectohydrolases and speciesidentity. Limnol. Oceanogr. 46:1606–1623.

6. Bird, D. F., and J. Kalff. 1984. Empirical relationships between bacterialabundance and chlorophyll concentration in fresh and marine waters. Can. J.Fish. Aquat. Sci. 41:1015–1023.

7. Bowman, J. B., C. M. Nichols, and J. A. E. Gibson. 2003. Algoriphagusratkowskyi gen. nov., sp. nov., Brumimicrobium glaciale gen. nov., sp. nov.,Cryomorpha ignava gen. nov., sp. nov., and Crocinitomix catalasitica gen. nov.,sp. nov., novel flavobacteria isolated from various polar habitats. Int. J. Syst.Evol. Microbiol. 53:1343–1355.

8. Cole, J. J., S. Findlay, and M. L. Pace. 1988. Bacterioplankton production infresh and saltwater ecosystems: a cross-system overview. Mar. Ecol. Prog.Ser. 43:1–10.

9. Cottrell, M. T., and D. L. Kirchman. 2000. Natural assemblages of marineproteobacteria and members of the Cytophaga-Flavobacter cluster consum-ing low- and high-molecular-weight dissolved organic matter. Appl. Environ.Microbiol. 66:1692–1697.

10. Covert, J. S., and M. A. Moran. 2001. Molecular characterization of estua-rine bacterial communities that use high- and low-molecular weight fractionsof dissolved organic carbon. Aquat. Microb. Ecol. 25:127–139.

11. Eilers, H., J. Pernthaler, and R. Amann. 2000. Succession of pelagic marinebacteria during enrichment: a close look at cultivation-induced shifts. Appl.Environ. Microbiol. 66:4634–4640.

12. Eilers, H., J. Pernthaler, J. Peplies, F. O. Glockner, G. Gerdts, and R.Amann. 2001. Isolation of novel pelagic bacteria from the German Bight andtheir seasonal contributions to surface picoplankton. Appl. Environ. Micro-biol. 67:5134–5142.

13. Estrada, M., M. Alcaraz, and C. Marrase. 1987. Effects of turbulence on thecomposition of phytoplankton assemblages in marine microcosms. Mar.Ecol. Prog. Ser. 38:267–281.

14. Fandino, L. B., L. Riemann, G. F. Steward, R. A. Long, and F. Azam. 2001.Variations in bacterial community structure during a dinoflagellate bloomanalyzed by DGGE and 16S rDNA sequencing. Aquat. Microb. Ecol. 23:119–130.

15. Felsenstein, J. 1989. PHYLIP—Phylogeny Inference Package. Cladistics5:164–166.

16. Gasol, J. M., and P. A. del Giorgio. 2000. Using flow cytometry for countingnatural planktonic bacteria and understanding the structure of planktonicbacterial communities. Sci. Mar. 64:197–224.

17. Giovannoni, S., and M. Rappe. 2000. Evolution, diversity and molecularecology of marine prokaryotes, p. 47–84. In D. Kirchman (ed.), Microbialecology of the oceans. Wiley-Liss, New York, N.Y.

18. Giovannoni, S. J., M. S. Rappe, K. L. Vergin, and N. L. Adair. 1996. 16SrRNA genes reveal stratified open ocean bacterioplankton populations re-lated to the green non-sulfur bacteria. Proc. Natl. Acad. Sci. USA 93:7979–7984.

19. Glockner, F. O., B. M. Fuchs, and R. Amann. 1999. Bacterioplankton com-position of lakes and oceans: a first comparison based on fluorescence in situhybridization. Appl. Environ. Microbiol. 65:3721–3726.

20. Gonzalez, J. M., and M. A. Moran. 1997. Numerical dominance of a group

of marine bacteria in the �-subclass of the class Proteobacteria in coastalseawater. Appl. Environ. Microbiol. 63:4237–4242.

21. Gonzalez, J. M., R. Simo, R. Massana, J. S. Covert, E. O. Casamayor, C.Pedros-Alio, and M. A. Moran. 2000. Bacterial community structure associ-ated with a dimethylsulfoniopropionate-producing North Atlantic algalbloom. Appl. Environ. Microbiol. 66:4237–4246.

22. Hagstrom, A., T. Pommier, F. Rohwer, K. Simu, W. Stolte, D. Svensson, andU. L. Zweifel. 2002. Use of 16S ribosomal DNA for delineation of marinebacterioplankton species. Appl. Environ. Microbiol. 68:3628–3633.

23. Harris, G. P. 1986. Phytoplankton ecology, structure, function and fluctua-tion. Cambridge University Press, Cambridge, United Kingdom.

24. Havskum, H., and A. S. Hansen. 1997. Importance of pigmented and co-lourless nano-sized protists as grazers on nanoplankton in a phosphate-depleted Norwegian fjord and in enclosures. Aquat. Microb. Ecol. 12:139–151.

25. Hold, G. L., E. A. Smith, M. S. Rappe, E. W. Maas, E. R. B. Moore, C.Stroempl, J. R. Stephen, J. I. Prosser, T. H. Birkbeck, and S. Gallacher.2001. Characterization of bacterial communities associated with toxic andnon-toxic dinoflagellates. FEMS Microbiol. Ecol. 37:161–173.

26. Janse, I., G. Zwart, M. J. E. C. van der Maarel, and J. C. Gottschal. 2000.Composition of the bacterial community degrading Phaeocystis mucopo-lysaccharides in enrichment cultures. Aquat. Microb. Ecol. 22:119–133.

27. Karp-Boss, L., E. Boss, and J. E. Jumars. 1996. Nutrient fluxes to planktonicosmotrophs in the presence of fluid motion. Oceanogr. Mar. Biol. Annu.Rev. 37:71–107.

28. Kerkhof, L. J., M. A. Voytek, R. M. Sherrell, D. Millie, and O. Schofield.1999. Variability in bacterial community structure during upwelling in thecoastal ocean. Hydrobiologia 401:139–148.

29. Kiøorboe, T., and E. Saiz. 1995. Planktivorous feeding in calm and turbulentenvironments, with emphasis on copepods. Mar. Ecol. Prog. Ser. 122:135–145.

30. Kirchman, D. L. 2002. The ecology of Cytophaga-Flavobacteria in aquaticenvironments. FEMS Microbiol. Ecol. 39:91–100.

31. Kirchman, D. L., L. Yu, and M. T. Cottrell. 2003. Diversity and abundanceof uncultured Cytophaga-like bacteria in the Delaware Estuary. Appl. Envi-ron. Microbiol. 69:6587–6596.

32. Kisand, V., R. Cuadros, and J. Wikner. 2002. Phylogeny of culturable estu-arine bacteria catabolizing riverine organic matter in the northern Baltic Sea.Appl. Environ. Microbiol. 68:379–388.

33. Kisand, V., and J. Wikner. 2003. Limited resolution of 16S rDNA DGGEcaused by melting properties and closely related DNA sequences. J. Micro-biol. Methods 54:183–191.

34. Kononen, K., J. Kuparinen, K. Makela, J. Laanemets, J. Pavelson, and S.Nommann. 1996. Initiation of cyanobacterial blooms in a front region at theentrance to the Gulf of Finland, Baltic Sea. Limnol. Oceanogr. 41:98–112.

35. Lazier, J. R. N., and K. H. Mann. 1989. Turbulence and the diffusive layersaround small organisms. Deep-Sea Res. 36:1721–1733.

36. Legendre, L., and F. Rassoulzadegan. 1995. Plankton and nutrient dynamicsin marine waters. Ophelia 41:153–172.

37. Maar, M., L. Arin, R. Simo, M.-M. Sala, F. Peters, and C. Marrase. 2002.Combined effects of nutrients and small-scale turbulence in a microcosmexperiment. II. Dynamics of organic matter and phosphorous. Aquat. Mi-crob. Ecol. 29:63–72.

38. Malits, A., F. Peters, M. Bayer, C. Marrase, A. Zoppini, O. Guadayol, andM. Alcaraz. Effects of small-scale turbulence on bacteria: a matter ofsize. Microb. Ecol., in press.

39. Martinez, J., D. C. Smith, G. F. Steward, and F. Azam. 1996. Variability inectohydrolytic enzyme activities of pelagic marine bacteria and its signifi-cance for substrate processing in the sea. Aquat. Microb. Ecol. 10:223–230.

40. Moeseneder, M. M., and G. J. Herndl. 1995. Influence of turbulence onbacterial production in the sea. Limnol. Oceanogr. 40:1466–1473.

41. Moran, M. A., J. M. Gonz alez, and R. P. Kiene. 2003. Linking a bacterialtaxon to sulfur cycling in the sea: studies of the marine Roseobacter group.Geomicrobiol. J. 20:1–14.

42. Muyzer, G., T. Brinkhoff, U. Nubel, C. Santegoeds, H. Schafer, and C.Wawer. 1998. Denaturing gradient gel electrophoresis (DGGE) in microbialecology, p. 1–27. In A. D. L. Akkermans, J. D. van Elsas, and F. J. de Bruijn(ed.), Molecular microbial ecology manual. Kluwer Academic Publishers,Dordrecht, The Netherlands.

43. Napier, I. R. 1995. Growth and collapse of a spring phytoplankton bloom inthe Firth of Clyde, Scotland. Mar. Biol. 123:189–195.

44. O’Sullivan, L. A., K. E. Fuller, E. M. Thomas, C. M. Turley, J. C. Fry, andA. J. Weightman. 2004. Distribution and culturability of the uncultivated“AGG58 cluster” of the Bacteroidetes phylum in aquatic environments.FEMS Microbiol. Ecol. 47:359–370.

45. Peters, F., and T. Gross. 1994. Increased grazing rates of microplankton inresponse to small-scale turbulence. Mar. Ecol. Prog. Ser. 115:299–307.

46. Peters, F., C. Marrase, J. M. Gasol, M. M. Sala, and L. Arin. 1998. Effectsof turbulence on bacterial growth mediated through food web interactions.Mar. Ecol. Prog. Ser. 172:293–303.

47. Peters, F., C. Marrase, H. Havskum, F. Rassoulzadegan, J. Dolan, M. Al-caraz, and J. M. Gasol. 2002. Turbulence and the microbial food web: effects


on bacterial losses to predation and on community structure. J. PlanktonRes. 24:321–331.

48. Pinhassi, J., F. Azam, J. Hemphala, R. A. Long, J. Martinez, U. L. Zweifel,and A. Hagstrom. 1999. Coupling between bacterioplankton species compo-sition, population dynamics, and organic matter degradation. Aquat. Microb.Ecol. 17:13–26.

49. Pinhassi, J., and T. Berman. 2003. Differential growth response of colony-forming �- and �-proteobacteria in dilution culture and nutrient additionexperiments from Lake Kinneret (Israel), the eastern Mediterranean Sea,and the Gulf of Eilat. Appl. Environ. Microbiol. 69:199–211.

50. Pinhassi, J., and A.. Hagstrom. 2000. Seasonal succession in marine bacte-rioplankton. Aquat. Microb. Ecol. 21:245–256.

51. Pinhassi, J., A. Winding, S. Binnerup, U. L. Zweifel, B. Riemann, and A.Hagstrom. 2003. Spatial variability in bacterioplankton community compo-sition at the Skagerrak-Kattegat front. Mar. Ecol. Prog. Ser. 255:1–13.

52. Porter, K. G., and Y. S. Feig. 1980. The use of DAPI for identifying andcounting aquatic microflora. Limnol. Oceanogr. 25:943–948.

53. Quigg, A., Z. F. Finkel, A. J. Irwin, Y. Rosenthal, T.-Y. Ho, J. R. Reinfelder,O. Schofield, F. M. M. Morel, and P. G. Falkowski. 2003. The evolutionaryinheritance of elemental stoichiometry in marine phytoplankton. Nature425:291–294.

54. Riemann, L., and M. Middelboe. 2002. Stability of bacterial and viral com-munity compositions in Danish coastal waters as depicted by DNA finger-printing techniques. Aquat. Microb. Ecol. 27:219–232.

55. Riemann, L., G. F. Steward, and F. Azam. 2000. Dynamics of bacterialcommunity composition and activity during a mesocosm diatom bloom.Appl. Environ. Microbiol. 66:578–587.

56. Riemann, L., G. F. Steward, L. B. Fandino, L. Campbell, M. R. Landry, andF. Azam. 1999. Bacterial community composition during two consecutive NEmonsoon periods in the Arabian Sea studied by denaturing gradient gelelectrophoresis (DGGE). Deep Sea Res. Part II 46:1791–1811.

57. Rothchild, B. J., and T. R. Osborn. 1988. Small-scale turbulence and plank-ton contact rates. J. Plankton Res. 10:465–474.

58. Sala, M. M., M. Karner, L. Arin, and C. Marrase. 2001. Measurement ofectoenzyme activities as an indication of inorganic nutrient imbalance inmicrobial communities. Aquat. Microb. Ecol. 23:301–311.

59. Sala, M. M., F. Peters, J. M. Gasol, C. Pedros-Alio, C. Marrase, and D.Vaque. 2002. Seasonal and spatial variations in the nutrient limitation ofbacterioplankton growth in the northwestern Mediterranean. Aquat. Mi-crob. Ecol. 27:47–56.

60. Schafer, H., B. Abbas, H. Witte, and G. Muyzer. 2002. Genetic diversity of“satellite” bacteria present in cultures of marine diatoms. FEMS Microbiol.Ecol. 42:25–35.

61. Schafer, H., L. Bernard, C. Courties, P. Lebaron, P. Servais, R. Pukall, E.Stackebrandt, M. Troussellier, T. Guindulain, J. Vives-Rego, and G.Muyzer. 2001. Microbial community dynamics in Mediterranean nutrient-enriched seawater mesocosms: changes in the genetic diversity of bacterialpopulations. FEMS Microbiol. Ecol. 34:243–253.

62. Schauer, M., V. Balague, C. Pedros-Alio, and R. Massana. 2003. Seasonalchanges in the taxonomic composition of bacterioplankton in a coastal oli-gotrophic system. Aquat. Microb. Ecol. 31:163–174.

63. Schauer, M., R. Massana, and C. Pedros-Alio. 2000. Spatial differences inbacterioplankton composition along the Catalan coast (NW Mediterranean)assessed by molecular fingerprinting. FEMS Microbiol. Ecol. 33:51–59.

64. Selje, N., M. Simon, and T. Brinkhoff. 2004. A newly discovered Roseobactercluster in temperate and polar oceans. Nature 427:445–448.

65. Smith, D. C., M. Simon, A. L. Alldredge, and F. Azam. 1992. Intense hydro-lytic enzyme activity on marine aggregates and implications for rapid particledissolution. Nature 359:139–142.

66. Smith, D. C., G. F. Steward, R. A. Long, and F. Azam. 1995. Bacterialmediation of carbon fluxes during a diatom bloom in a mesocosm. Deep-SeaRes. 42:75–97.

67. Suzuki, M., Y. Nakagawa, S. Harayama, and S. Yamamoto. 2001. Phyloge-netic analysis and taxonomic study of marine Cytophaga-like bacteria: pro-posal for Tenacibaculum gen. nov. with Tenacibaculum maritimum comb.nov. and Tenacibaculum ovolyticum comb. nov., and description of Te-nacibaculum mesophilum sp. nov. and Tenacibaculum amylolyticum sp. nov.Int. J. Syst. Evol. Microbiol. 51:1639–1652.

68. Suzuki, M. T., C. M. Preston, F. P. Chavez, and E. F. DeLong. 2001. Quan-titative mapping of bacterioplankton populations in seawater: field testsacross an upwelling plume in Monterey Bay. Aquat. Microb. Ecol. 24:117–127.

69. Thingstad, T. F., U. L. Zweifel, and F. Rassoulzadegan. 1998. P limitation ofheterotrophic bacteria and phytoplankton in the northwest Mediterranean.Limnol. Oceanogr. 43:88–94.

70. van den Hoek, C., D. G. Mann, and H. M. Jahns. 1995. Algae: an introduc-tion to phycology. Cambridge University Press, Cambridge, United King-dom.

71. van Hannen, E. J., W. Mooij, M. P. van Agterveld, H. J. Gons, and H. J.Laanbroek. 1999. Detritus-dependent development of the microbial com-munity in an experimental system: qualitative analysis by denaturing gradientgel electrophoresis. Appl. Environ. Microbiol. 65:2478–2484.

72. Yager, P. L., T. L. Connelly, B. Mortazavi, K. E. Wommack, N. Bano, J. E.Bauer, S. Opsahl, and J. T. Hollibaugh. 2001. Dynamic bacterial and viralresponse to an algal bloom at subzero temperatures. Limnol. Oceanogr.46:790–801.


Documents

Changes in Bacterioplankton Composition under Different Phytoplankton Regimens