Indian journal of research in pharmacy and biotechnology vol 1-issue-6-nove-dec 2013

IJRPB 1(6) www.ijrpb.com November-December 2013

Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)

Editor B.Pragati Kumar, M.Pharm, Assistant Professor,

Nimra College of Pharmacy

Consulting editor

Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy

Associate Editors

Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy

Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy

Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy

Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy

Editorial Advisory Board

Dr.Y.Narasimaha Reddy, M. Pharm., Ph D.

Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal.

Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy),

Kerala

Dr.V.Gopal, M. Pharm., Ph D.

Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6

Dr. M.Umadevi, M.Sc. (Agri), Phd Research Associate, Tamil Nadu Agricultural

University, Coimbatore

Dr. J.Balasubramanium, M. Pharm., Ph D. General Manager, FR&D

R A Chem Pharma Ltd., Hyderabad

Dr. V.Prabhakar Reddy, M. Pharm., Ph D.

Principal, Chaitanya College of Pharmacy Education & Research, Warangal

Dr.P.Ram Reddy, M. Pharm., Ph D.

General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad

Dr. S.D.Rajendran, M. Pharm., Ph D.

Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad

IJRPB 1(6) www.ijrpb.com November-December 2013

INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY

Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication

provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the

review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t

copy and paste the article content from internet or other sources like e-books etc. Authors are the sole

responsible persons for the article, article content; results of the research conducted and copy right issues

if any. The editor and the editorial board are not entitled to change the article content, results and

diagrammatic representations which are given by authors. The article will be published only after getting

the approved galley proof from the authors.

Kindly follow the below guidelines for preparing the manuscript:

1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any

decorative borders anywhere in the text including the title page.

2. Don’t leave any space between the paragraphs.

3. Divide the research article into

a. Abstract

b. Introduction

c. Materials and Methods

d. Results

e. Discussion

f. conclusion

g. References

4. References should include the following in the same order given below

a) Author name followed by initials

b) Title of the book/ if the reference is an article then title of the article

c) Edition of the book/ if the reference is an article then Journal name

d) Volume followed by issue of the journal

e) Year of publication followed by page numbers

5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it

after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post

or scanned attachment to [email protected].

6. Keep in touch with the editor through mail or through phone for further clarifications as well as

for timely publication of your article.

Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna

District, Andhra Pradesh, India-521456 Printed at:

F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456

Visit us at www.ijrpb.com

Contact us/ send your articles to: Email: [email protected]

Phone no: 9490717845; 9704660406

http://www.ijrpb.com/

mailto:[email protected]

http://www.ijrpb.com/



Volume 1 Issue 6 www.ijrpb.com November-December 2013

S.No. Contents Page No.

1 Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker

Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif 765-771

2 Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release

tablets in QbD environment

V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala

Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja

772-777

3 Development and validation of a stability indicating HPLC method for analysis of Altretamine

in bulk drug and pharmaceutical formulations

M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao

778-785

4 A review of various analytical methods on Atrovastatin

N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana 786-792

5 A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular

cancer

Praveen D, Ranadheer Chowdary P

793-796

6 Method development and validation for the simultaneous estimation of Ofloxacin and

Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method

Y.Bhargav, K Haritha Pavani, S Amareswari

797-802

7 Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against

Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats

Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S

803-807

8 Method development and validation for the simultaneous estimation of Atazanavir and

Ritonavir in tablet dosage form by RP-HPLC

Nuli Vasavi, Afroz Patan

808-814

9 Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats

Marri Praveen, M.Janarthan 815-818

10 Some H.R. methodology/ techniques for costs reduction in companies to improve profit

M. Sarkar, B. K. Sarkar, M. D. Gora, S. C. Verma 819-821

11 Analytical method development and validation of Artesunate and Amodiaquine hydrochloride

in tablet dosage form by RP-HPLC P RajaRao, Nanda Kishore Agarwal

822-827

12 Analytical method development and validation for the simultaneous estimation of

Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by

RP-HPLC

Syed Shaheda, Nanda Kishore Agarwal

828-834

13 Formulation and evaluation of herbal anti-dandruff shampoo

Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel

835-839


Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms

V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy

840-845

15 Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and

Gentamycin induced nephrotoxicity in Albino rats

Radha.B, Janarthan M, Durraivel S

846-849


Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid

chromatography

M. Sumalatha, K.Haritha Pavani

850-856

17 A new development and validated RP-HPLC method for the assay and related substances of

Itraconazole in capsule dosage form

Sarvani Paruchuri, Haritha Pavani K

857-865

18 Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca

againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats

Thirumala K, Janarthan M, Firasat Ali M

866-868

19 Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride

Hardeep Singh Dhaliwal, Dhruba Sankar Goswami 869-874


Volume 1 Issue 6 www.ijrpb.com November-December 2013

20 Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic

treatment of osteoarthritis of the knee: a randomized controlled trial

Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy

875-880

21 Analytical method development and validation for the estimation of Olmesartan medoxomil

by RP-UPLC in bulk and pharmaceutical dosage forms

Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M

881-885

22 Modern hygienic industrial canteen amenity: A change factor for healthy physical work

environment of the work force in Indian industrial units

TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash

886-892

23 Design and development of Metformin hydrochloride Trilayered sustained release tablets

Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K

893-897

24 Amlodipine: the upcoming threat to Periodontist

Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, 898-900

25 Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets

of Diltiazem hydrochloride

Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3

901-907

26 Development and optimization of Diltiazem hydrochloride loaded microspheres by using

different Eudragit polymers

V. Kamalakkannan, K.S.G.Arul Kumaran

908-914

27 Formulation, characterization and optimization of Methotrexate loaded sodium alginate

chitosan Nanoparticles using 32

factorial design

S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar

915-921

28 Strategies in Dendritic architecture for drug delivery – An over review

Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan 922-934

Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

IJRPB 1(6) www.ijrpb.com November – December 2013 Page 765

Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker

Showkat Hussain Ganie1, Deepak Yadav

1, Altaf Ahmad

2, Anis Chadhry

1, Mohd Asif

1*

1. Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India

2. Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062

*Corresponding author: Email: [email protected], Phone: 8860142069

ABSTRACT

Nigella sativa, commonly known as kalongi is an important drug of traditional system of

medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and

jaundice. Because of increased demand and high price, there are chances that the herb could be

adulterated in the trade by other related species. Therefore, a reliable authentication method is needed

to facilitate identification of this genuine material from its adulterants. To carry out the work, the

market samples were procured from the crude-drug markets of different geographical regions of India.

The RAPD derived LAMP technique was employed for the characterization of different accessions of

Kalongi. 19 primers were used of which one unique band, common in all accessions were eluted,

cloned and sequenced. LAMP primers were designed and LAMP product formation was detected at

60°C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands.

One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was

developed into LAMP marker for identification of N. Sativa. The primers successfully amplified the

genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification. The

LAMP markers developed in this study may provide guidance for the authentication of plant materials

traded as Kalongi.

Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP);

Molecular markers; kalongi; RAPD.

1. INTRODUCTION

The traditional knowledge of herbal

medicine is widespread- ranging from tribal folklore

use to age-old practices and closely guarded recipes

handed down from generation to generation, to

highly evolved systems of medicine like Ayurveda,

Unani and Siddha. These systems have served the

humanity through the centuries and it is certain that

they will continue to be in use for times to come.

However, in the process of urbanization the contact

with nature was cut off and, consequently, the

knowledge about the identification of medicinal

plants deteriorated to a great extent. Additionally,

the crude drugs sold in the market are adulterated,

sophisticated or substituted by quite unrelated plant

materials. The adulteration of market samples is one

of the greatest drawbacks in promotion of herbal

products (Dubey, 2004). Plant samples in the market

are stored under undesirable conditions over the

years and often contain a mixture of other plant

species (Khatoon, 1993), thus, adversely affecting

their bio efficacy. The efficacy of many of the drugs

has become suspect because of the adulterated, dried

raw materials profusely available in the indigenous

market (Anonymous, 1996). Very often the identity

of market drugs is taken for granted without

subjecting the plant material to stringent methods of

botanical identification. This result in the loss of

therapeutic potential of the preparations if the plant

used is adulterated or substituted. It results in the

production of misleading or overlapping data on

phytochemical, pharmacological, pharmacognostical

and clinical aspects.

Nigella sativa (Family: Ranunculaceae) is

considered one of the most important medicinal herb

used in various Indigenous System of Medicine. The

plant cultivated almost all over India, is an annual

herb with linear- lance late leaves. Pale blue flowers

are solitary, fruit is capsule; seeds are black,

flattened, angular and funnel shaped. Seeds of the

herb are mostly used in medicine. Many

formulations containing Kalongi as a single drug or

in combination with other drugs are available in

Indian market. The important Unani formulations

using the drug are “Anquriya Kabir, Habe-e-Halteet,

Roghan Kalan, Qairuti Arad Karsana, Mujun

Nankhaw”. Traditionally the drug is used against

cough, fever, abdominal disorders, skin infections,

paralysis and jaundice (Paarakh, 2010). Seed oil is

used as a local anaesthetic (Paarakh, 2010). As far

as its pharmacological activities are concerned, the

drug is hypoglycaemic, hypocholestermic

(Bamosaet, 2002) and antioxidant (Kanter, 2003).

Thymoquinone (constituent of seed oil extract) is

antitumor, found to kill the pancreatic cancer cells

and its derivatives are used in blood, skin and breast

cancers (Paarakh, 2010).

The aqueous decoction of kalonji revealed

significant antibacterial potential against

Staphylococcus aureus, Micrococcus roseus,

Streptococcus mutans, Streptococcus morbillorium,

Streptococcus sanguis, Streptococcus intermedius,



Klebsiella ozaenae, Aeromonas hydrophila, and

Streptococcus salivarius (Chaudhry and Tariq,

2008). Considering the medicinal importance of

Kalongi, the authentication of this herb is highly

mandatory. DNA fingerprinting techniques are very

useful for correct identification of taxa. Among

various DNA markers, loop-mediated isothermal

amplification (LAMP) is convenient because the

reaction could be conducted under isothermal

conditions, thereby facilitating amplification and the

results could be achieved in less than 1 hr.

To the best of our knowledge, no attempt

has been made to characterize this herb using

molecular biology. To fill this gap, we employed

LAMP markers to authenticate the said drug. For

this, samples were collected from the crude drug

dealers of North and West India.

2. MATERIALS ANDMETHODS

2.1. Plant material: The samples of N. Sativa were

collected from crude drug dealers of Delhi,

Kolkatta, Uttarakhand and Uttar Pradesh. Voucher

specimens of these samples were prepared and kept

in the Herbarium, Department of Botany, Hamdard

University, New Delhi, 110062. The seeds are

stored in seed bank, Department of Botany,

Hamdard University, New Delhi, 110062. The

identified specimens were compared with

authenticated voucher specimens preserved in the

herbarium of National Institute of Science and

Information Resources (NISCAIR). The seeds were

used for DNA isolation.

2.2. DNA Isolation: The modified CTAB protocol

of Doyle and Doyle (1990) and purification kit

(HiPurA, India) were used to extract DNA from the

overnight soaked seeds.

2.2.1. Reagents and Solutions: CTAB extraction

buffer (2M Sodium Chloride, 100mM TrisHCl (pH

8), 20 mM EDTA) 0.2% β-mercaptoethanol,

Chloroform:Isoamylalcohol (24:1), absolute alcohol,

3M Potassium acetate, Isoamyl alcohol. All the

chemicals chemical were of analytic grade.

Enzymes (Taq polymerase, Bst polymerase and

RNAase A), Taq buffer, MgCl2 and dNTPs were

purchased from Bangalore Genei (Bangalore, India).

2.2.2. Protocol: In order to avoid surface

contamination, the seeds were washed with 0.2%

Cetrimide for 3 min, followed by treatment with

0.5% streptomycin sulphate and 0.5% bavistine for

5 min each. After these treatments the seeds were

rinsed with 70% alcohol for 1 min andfinally

washed with sterile double distilled water and kept

overnight. 1g seeds were pulverized to fine powder

by liquid nitrogen in a chilled mortar and pestle

followed by the addition of 100 mg of poly vinyl

pyrollidone (PVP, insoluble) and 10 ml pre-heated

CTAB buffer (containing 0.2 % β-mercaptoethanol).

The slurry was transferred into autoclaved 50 ml

centrifuge tube and incubated at 60oC for 1 hr. 10 ml

of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1)

was added to the centrifuge tubes and mixed

carefully for 15 min.

The content was centrifuged at 8000 rpm for

15 min. at 15oC. The upper phase was transferred

into new autoclaved centrifuge tubes. 10µl of

RNAase was added and the tubes were incubated at

37oC for 30 min. 10 ml of CHCl3: IAA (24:1) was

added carefully and the tubes were centrifuged at

8000 rpm for 15min at 15oC. The upper phase was

transferred again into autoclaved centrifuge tube and

0.5 vol. of 3M Potassium acetate (pH 5.2) was

added. For DNA precipitation equal volume of

chilled isopropanol (chilled absolute ethanol was

also used) was used and the tubes were kept at -20oC

for 2 hrs. It was recentrifuged at 8000 rpm for 15

min at 4oC. The supernatant was discarded and the

pellet was washed with 70% ethanol, air dried and

dissolved in 250 µl of sterile water. The DNA thus

obtained was purified by DNA purification

(HiPurA, India) kit according to manufacturer’s

instructions.

2.3. Polymerase Chain Reaction (PCR)

Amplification: The PCR was carried out in 20 µl

reaction volume containing 50ng DNA, 0.5 u/µl Taq

DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer

primers, 200 µM of each dNTPs, 2x Taq polymerase

buffer with minor changes as described by Shaik et

al. (2006). The final volume was made-up with

sterile MilliQ water. The amplifications were carried

out in DNA thermal cycler (Eppendorf, Germany).

The PCR amplification conditions for RAPD

consisted of initial step of denaturation at 94°C for 4

min, 35 cycles of denaturation at 94°C for 1 min,

annealing at 35°C for 1 min, extension at 72°C for 2

min, followed by final extension at 72°C for 10 min.

The amplified DNA was loaded on 1.2% agarose gel

in 0.5x TBE buffer containing 10 µl of EtBr

(10mg/ml) and photographed using gel

documentation system (UVP, Germany). Twenty

10-mer RAPD primer series OPAA, purchased from

Qiagen, USA and five (BG series) from Bangalore

Genei (India) were screened.

2.4. Gel purification, Cloning and sequencing of

RAPD amplified product: RAPD fragment was

excised from the gel with a sharp and sterile scalpel

to avoid any contamination. Elution of DNA from

agarose gel was carried out using MiniElute® kit

from Qiagen (USA) following manufacturer’s

instructions and the product was run on 1.2% gel

along with the Gene Rular DNA ladder, to check the

presence of the desired product. The eluted DNA

was ligated into pGEM®-T easy vector (Promega,



USA). Ligation reaction was carried out in 10μl

reaction containing 10x ligase buffer (5.0 μl),

pGEM®-T easy vector (0.5 μl), T4 DNA Ligase

(1.0 μl) and PCR product 3.0 μl) and the final

volume was set up with autoclaved Milli Q water.

Competent cells of E. coli DH5α were prepared by

CaCl2 method (Sambrook et al. 2001) and 5μl of the

ligation mixture was mixed with an aliquot of 100 μl

competent cells. The transformed cells were plated

on LB-X-gal/Amp plates and the recombinant

colonies were selected through blue-white

screening. The plasmid was isolated from the

positive bacterial colonies using plasmid isolation

kit (Qiagen, Germany). The cloned fragments were

sequenced using T7 primers through the centre for

Genomic Application, New Delhi, India.

2.5. Design of LAMP Oligonucleotides: A total set

of four LAMP primers were designed using Primer

Explorer V3

(http://primerexplorer.jp/elamp3.0.0/index.html) for

the specific detection of PCR product. The primer

set consisted of two outer (F3 and B3), and two

inner (FIP and BIP); the inner primers cover two

distinct sequences of the target (F1c/B1c and

F2c/B2c). Sequences of the LAMP primers are

given in table 1.

2.6. LAMP reaction: The LAMP reaction was

carried out in a 25 µl reaction volume containing

60pmol each of the primers FIP and BIP, 10 pmol

each of the outer primers F3 and B3, 8mM MgSO4,

1.4mM dNTPs, 0.8M betaine, 10 units of the Bst

DNA polymerase and 2 µl of DNA template. The

optimum temperature for the LAMP reaction was

60°C. 1μlSYBR Green-Ι dye was added at the end

of the reaction. Visual inspection for amplifications

was performed through observation of colour

change following addition of 1μl of SYBR Green I

(fluorescent dsDNA intercalating dye) to the tube.

3. RESULTS

RAPD reaction was performed in order to

find out unique specie specific monomorphic bands

present in all the samples, meant for LAMP

analysis. Twenty five 10-mer RAPD primers were

used of which six did not amplify the DNA. Each

RAPD reaction was repeated thrice and only

reproducible bands were taken in to account. A total

of 524RAPD bands (table 2) were obtained and to

develop the LAMP marker, we analyzed the

nucleotide sequences of 5 species-specific RAPD

amplicons, consisting of 5 DNA fragments for N.

saitva. From the resulting nucleotide sequences, one

unique RAPD amplicon from primer OPAA-9 has

been registered in the NCBI Gene Bank dbGSS, and

used to develop RAPD derived LAMP marker (Fig.

1). The specific amplicon of 600bp (fig.2) RAPD

fragment, specific for all the accessions of N. sativa,

was used for designing primers of LAMP reaction.

The reaction was carried out using genomic

DNA as a template to determine the optimal

temperature and reaction time and to evaluate the

use of primers. LAMP product formation was

detected at a temperature range of 60−64°C and

consequently, 60°C was considered to be the

optimal reaction temperature for the LAMP assay.

The tube containing the amplified products were

visualised in the presence of fluorescent

intercalating dye SYBR Green I under UV

transilluminator. In case of positive amplification,

the original colour of the dye was changed into

green that was judged under natural light as well as

under UV light (302 nm) with the help of UV

transilluminator. In case of negative control

(Catharanthus roseus) there was no amplification,

the original orange colour of the dye was retained

(Figure.3)

Figure.1. RAPD profile of Kalonji (N. sativa) representing specific band present in all accessions amplified with

OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1–K5 corresponds to the 5 accessions (K1-

Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- Dehradun-

Uttarakhand)



Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N. sativa used for development LAMP marker

Figure.3.Analysis of LAMP under UV light (A) and natural light (B). 1-5 accessions of Nigella sativa.(1- Kolkatta,

2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, C-

Negative control (Catharanthus roseus)

Table 1.Primer Sequences used in this study

Name sequence (5′ → 3′) Bases

F3 catttgccccgacggc 16

B3 cggctgctgtagaccga 17

FIP (F1c+F2) tcggccactgcactctgcgcgaggacaccctgctct 36

BIP (B1+B2c) tccgcctctgcctggaggaccacaggttctcgaagagc 38

Table 2.Number of amplified products generated by 20 arbitrary primers in 5 accessions of Kalonji (Nigella

sativa)

Primer code sequence (5′ → 3′) No. of amplification products Fragment size (kb)

OPAA -01 AGACGGCTCC 37 0.45-1.20

OPAA -02 GAGACCAGAC 31 0.3-1.15

OPAA -03 TTAGCGCCCC 29 0.3-1.20

OPAA -04 AGGACTGCTC 0 0

OPAA -05 GGCTTTAGCC 20 0.3-1.00

OPAA -06 TCAAGCTAAC 11 0.5-1.10

OPAA -07 CTACGCTCAC 24 0.2-1.20

OPAA -08 TCCGCAGTAG 29 0.4-1.40

OPAA -09 AGATGGGCAG 35 0.5-1.20

OPAA -10 TGGTCGGGTG 34 0.3-1.15

OPAA -11 ACCCGACCTG 32 0.35-1.10

OPAA -12 GGACCTCTTG 40 0.35-1.20

OPAA -13 GAGCGTCGCT 26 0.35-1.10

OPAA -14 AACGGGCCAA 14 0.5-1.00

OPAA -15 ACGGAAGCCC 14 0.3-1.20

OPAA -16 GGAACCCACA 33 0.3-1.20

OPAA -17 GAGCCCGACT 23 0.3-1.10

OPAA -18 TGGTCCAGCC 39 0.4-1.15

OPAA -19 TGAGGCGTGT 28 0.3-1.20

OPAA-20 TTGCCTTCGG 32 0.4-1.20

Total 524

gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga

ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca

gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa

cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct

tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct

acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac

ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac



4. DISCUSSION

Correct identification of plants forming

the drug is a prerequisite and fundamental to

whole realm of medicine and science. Most of

the regularity guidelines and pharmacopoeia

recommend macro- and microscopic evaluation

and chemical analysis of botanical material for

quality and quantity control and standardization

(Anonymous, 1996). Morphological or

macroscopic identification of plant materials is

based on parameters like shape, size, texture,

colour, surface feature, odour, taste and other

organoleptic characters that are compared to

standard reference materials. Though this

method is simple and direct, its accuracy and

authenticity which are sometimes subjective,

depends on examiners.

Histological or microscopic

examinations are done to study comparative

microscopic inspection of broken as well as

powdered, crude, botanical materials to reveal

the characteristics of tissue structure and

arrangement of cells in different organs and

tissues. Chemical authentication establishes a

chemical composition of plant, which is used

for differentiation. The variation of chemical

composition may hinder the authentication, and

in some cases, may be misleading if the samples

are adulterated. Moreover, it is difficult to

distinguish closely related species due to similar

chemical compounds. Molecular or DNA-based

markers are now becoming a popular means for

the identification of medicinal plants (Yip,

2007).

Molecular markers have the advantage

over chemical markers as the genetic

composition is unique for each individual and is

least affected by age (Kumble, 2003),

environmental factors and physiological

conditions (Macbeath and Schreiber, 2000),

harvest, storage and processing of the samples

(Schweitzer, 2003). Molecular markers are not

stage and tissue specific and thus can be

detected at any stage of development. Ours is

the first attempt to characterize Kalongi using

LAMP markers. Although in earlier reports

RAPDs were used for the authentication

purpose (Rivera-Arce, 2007; Shinde, 2007;

Hammad and Qari 2010; Ganie, 2012),

however, these markers are very sensitive and

the big blow to these markers are

reproducibility problem. Therefore, in the

present study RAPDs were converted into

LAMP markers. These markers are very

specific and highly reproducible because these

markers could amplify a specific gene from the

whole genome discriminating a single

nucleotide difference (Parida, 2008). As the

reaction is carried out under optimal and

isothermal conditions, therefore, there are

negligible chances of inhibition reaction at the

later stage of amplification compared with the

PCR.

The results can be easily monitored by

checking the turbidity obtained from the

precipitate and most importantly the detection

of the desired gene could be completed in a

single step by incubating mixture of gene

sample, primers, DNA polymerase with strand

displacement activity and substrates at constant

temperature (Parida, 2008). In our study, the

amplification was not detected when the

concentration of the template was 0.3 ng,

however when the template concentration was

in the range of 0.8-1.5 ng, amplifications

occurred; therefore, it was thought that DNA

concentration of 0.8 ng is the detection limit in

N. sativa. Such type of results was also

observed in the studies of P. Ginseng (Sasaki,

2008) in which 0.5 ng of template was the

detection limit.

The optimized reaction parameters that

showed positive results were 10 ng template

DNA, 10pmol of outer primers (F3 and B3),

60pmol of each of forward internal and

backward outer primers (FIP and BIP), 20 mM

reaction buffer, 10 mmMgSO4, 0.8 M betaine

and 10 units of Bst DNA polymerase. The

optimum temperature for the reaction was set at

60°C, which is considered optimum for the

activity of Bst DNA polymerase. The use of

LAMP markers for the authentication of

medicinal plants, although is rare; however,

there are some recent reports in which the

technique has been successfully applied for the

identification purposes and some of which

include Curcuma longa (Sasaki and Nagumo;

2007), Panex ginseng (Sasaki, 2008),

Catharanthus roseus (Choudhry, 2011).

We have developed LAMP, a rapid,

highly sensitive, and specific method for the

authentication of N. sativa. The present study



could be applicable to identify N. Sativa to

differentiate the herb from the spurious and

adulterated drugs sold in the market in the name

of geniuine drugs. Efforts are in progress to

develop LAMP markers to medicinal plants in

order to provide accurate method for

authenticating the medicinal plants.

5. CONCLUSION

LAMP technology could be efficiently used to

characterize the medicinal plants like of N.

sativa. By analysing the genetic profiling it is

possible to identify the said drug; this

information could be employed for

identification of authenticN. sativa devising

from the spurious and adulterated drugs.

ACKNOWLEDGMENTS

This work was financed by the CCRUM,

AYUSH, Ministry of Health and Family

Welfare, Government of India.

REFERENCES

Anonymous, The Useful Plants of India. PID,

CSIR, 1996, New Delhi

Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The

effects of thymoquinone on blood lipids on rats,

Indian. J. Physio. Pharmacol, 46, 2002, 195-

201.

Chaudhary A.A, Hemant, Mohsin M, Ahmad A,

Application of loop-mediated isothermal

amplification (LAMP)-based technology for

authentication of Catharanthus roseus (L.) G.

Don. Protoplasma, 249, 2012, 417-422.

Chaudhry N.M.A, Tariq P, In-vitro anti

bacterial activities of Kalonji, Cumin and Poppy

Seed. Pak. J. Bot, 40, 2008, 461-467.

Doyle J.J, Doyle J.J, Isolation of plant DNA

from fresh tissue, Focus, 12, 1990, 13-15.

Dubey N.K, Kumar R, Tripathi P, Global

promotion of herbal medicine: India’s

opportunity. Curr. Sci. 86, 2004, 37-41.

Ganie S.H, Srivastava P.S, Narula A, Ali Z,

Sharma M.P., Authentication of shankhpushpi

by RAPD markers. Eurasia. J. Biosci, 6, 2012,

39-46.

Hammad I, Qari S.H, Genetic diversity among

Zygophyllum (Zygophyllaceae) populations

based on RAPD analysis. Genet. Mol. Res. 9,

2010, 2412-2420.

Kanter, M., Meral, I.,Dede, S., Effects of

Nigella sativa L. and Urticadioica L. on lipid

peroxidation, antioxidant enzyme systems and

some liver enzymes in CCl4-treated rats. J. Vet.

Med. Physiol. Pathol. Clin. Med. 50, 2003, 264-

268.

Khatoon, S., Mehrotra, S., Shome, U.,

Mehrotra, B.N., Analysis of commercial

Ratanjot; by TLC fluorescence fingerprinting.

Int. J. Pharmacol. 31, 1993, 269-277.

Kumble, K.D., Protien microarrays, new tools

for pharmaceutical development. Analyt. Bio.

Chem. 377, 2003, 812-819.

MacBeath, G., Schreiber, S.L., Printing proteins

as microarrays for high-throughput function

determination. Sci., 289, 2000, 1760-1763.

Paarakh, P.M., Nigella sativa Linn.- A

Comprehensive Review. Ind. J. Nat. Prod.

Resour. 1, 2010, 409-429.

Parida, M., Sannarangaiah, S., Dash, P.K., Rao,

P.V.L., Morita, K., Loop mediated isothermal

amplification (LAMP): a new generation of

innovative gene amplification technique;

perspectives in clinical diagnosis of infectious

diseases. Rev. Med. Virol. 18, 2008, 407-421.

Rivera-Arce, E., Gattuso, M., Alvarado, R.,

Zarate, E., Aguero, J., Feria, I., Lozoya, X.,

Pharmacognostical studies of the plant drug

Mimosa tenuifloraecortex. J. Ethnopharmaco.

113, 2007, 400-408.

Sasaki, Y., Komatsu, K., Nagumo, S., Rapid

detection of Panax ginseng by loop-mediated

isothermal amplification and its application to

authentication of Ginseng. Biol. Pharm. Bull,

31, 2008, 1806-1808.

Sasaki, Y., Nagumo, S., Rapid identification of

Curcuma longa and C. aromatic by LAMP.

Biol. Pharm. Bull, 30, 2007, 2229-2230.

Schweitzer, B., Predki, P., Synder, M.,

Microarrays to characterize protein interactions

on a whole-protoeme scale. Proteomics. 3,

2003, 190-199.

Shaik Y.B, Castellani M.L, Perrella A, Conti

F, Salini V, Tete S, Madhappan B, Vecchiet

J, De Lutiis M.A, Caraffa A, Cerulli G, Role of

quercetin (a natural herbal compound) in allergy



and inflammation, J. Biol. Regul. Homeost.

Agents, 20(3-4), 2006, 47-52.

Shinde M, Dhalwal K, Mahadik K.R, Joshi,

K.S, Patwardhan B.K, RAPD Analysis for

Determination of Components in Herbal

Medicine, Evi. Based Complemen. Alterna.

Med, 4, 2007, 21-23.

Yip P.Y, Chau C.F, Mak C.Y, Kwan H.S, DNA

methods for identification of Chinese medicinal

materials, J. Chin. Med, 2, 2007, 1-19.

Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed

release tablets in QbD environment V Malleswari Bai*

1, M Prasada Rao

1, M Chandana

1, K Naga Harini

1, B Naga Deepthi

1, K Thirumala Devi

1,

P Lakashmana Rao1, Vinay U rao

2 and J Naga raja

1

1. Department o f Pharmaceuitical Analysis, Medarametla Anjamma Masthanrao College of Pharmacy, Narasarao

Pet, Guntur district, Andhra Pradesh, India.

2. Institutes of Pharmaceutical Sciences, Hyderabad-500049

*Corresponding author: E.Mail:[email protected]

ABSTRACT

Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release

tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide

the resistance of drug release in acidic environment of stomach and allow the drug to be released in

alkaline environment of the intestine. A large number of enteric polymers are available which provide

excellent protection to drug release in acidic environment. However, each polymer dissolves at different

alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH

6.5 and above. HPMC Phthalate P5.5 dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at

pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on

which enteric polymer is used to provide the delayed release. The aim of the current work was to

comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which

brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing

was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that brand 1 and 5 are equivalent to

each other while brands 2, 3 and 4 are equivalent to each other. Similarity factor f2 was used for

comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to

withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping

test. This indicates that patients may have to counsel not to concomitantly consume alcohol while on

Diclofenac sodium delayed release tablets.

Key words: Diclofenac sodium, Quality by design (QbD), Delayed release, Dissolution test

INTRODUCTION Quality by Design (QbD) is a concept first

outlined by well-known quality expert Joseph M

Juran in various publications, most notably Juran on

Quality by Design. Juran believed that quality could

be planned, and that most quality crises and problems

relate to the way in which quality was planned in the

first place. While Quality by Design principles has

been used to advance product and process quality in

every industry, and particularly the automation

industries, they have most recently been adopted by

the U.S Food and Drug administration (FDA) as a

vehicle for the transformation of how drugs are

discovered, developed, and commercially

manufactured (Juran, 1992).

MATERIALS AND METHODS

Development of a predictive dissolution method:

The effects of dissolution medium pH, stirring speed,

volume of the dissolution medium, type of apparatus

used were systemically evaluated to develop the

predictive dissolution method

Effect of dissolution medium: An initial attempt at

developing the discriminating dissolution method that

would be predictive of in vivo performance was made

using USP apparatus 2 .Effect of dissolution medium

pHof both the innovator product and the four brands

were subjected to dissolution testing using USP

apparatus 2 at 50 rpm in 900 mL of various media

including water, 0.1 N HCl, pH 5.5 phosphate buffer,

and pH 6.8 phosphate buffer. The drug release of the

marketed samples in comparison with the innovator at

different time intervals was obtained in all the

mediums. The similarity factor of the brands using

innovator product as the reference is calculated

Effect of dissolution medium volume: The drug

release of innovator products and all the marked

brands was evaluated using pH 1.2(0.1N HCl)

dissolution medium volumes of1000ml and 500ml.

The stirring speed was 50 rpm in each case. The drug

release profile of the marketed samples in comparison

with the innovator product at various time intervals

were obtained in all two volumes. The similarity

factor of the brands using innovator product as the

reference is calculated

Effect of stirring speed: Dissolution testing of all the

marketed samples and the innovator product was

conducted at25, 50, 75, and 100 rpm in 900 mL of pH

1.2(0.1NHCl) dissolution medium. The similarity



factor of the brands using innovator product as the

reference is calculated

Effect of type of dissolution apparatus: Dissolution

testing of all the marketed samples and the innovator

product was conducted using both USP1 (Basket) and

USP2 (Paddle) apparatus in 900ml of pH

1.2(0.1NHCl) dissolution medium. The drug release

profiles of all the marketed samples in comparison

with the innovator product at various time intervals

were obtained. The similarity factor of the brands

using innovator product as the reference is calculated

QbD development process includes:

Begin with the target product profile that

describes the use, safety and efficacy of the

product.

Defining a target quality profile that will be

used by formulators and process engineers as

a quantitative surrogate for aspects of clinical

safety and efficacy during product

development.

Gather relevant prior knowledge about the

substance, potential excipients and process

operation.

Design a formulation and identify the quality

attributes to the final product that must be

controlled to meet the target product quality

profile.

Design a manufacturing process to produce a

final product having this critical material

attributes.

Identify the critical process parameters and

raw material attributes that must be controlled

to achieve these critical material attributes of

the final product.

Establish a control strategy for the entire

process that may include input material

controls, process controls and monitors design

space around individual or multiple unit

operation and/ or final product tests.

Continually monitor and update the process to

assure consistent quality.

Quality by Design for drug release

Two primary aspects:

1. Clinical relevance of release and stability

specifications

2. Correlation between process parameters

and ability to achieve specifications (and

therefore remain clinically relevant)

Dissolution testing and drug release:

Dissolution testing has been widely used as

the primary tool to evaluate drug release

Dissolution is the process by which a solid

solute enters a solution, and is characterized

by rate (amount dissolved by time).

In the pharmaceutical industry, it may be

defined as the amount of drug substance that

goes into solution per unit time under

standardized conditions of liquid/solid

interface, temperature and solvent

composition.

Dissolution is the quality control measure and

potential to provide in sight into the in vivo

performance of the drug product.

In vitro release test that predicts the drug in

vivo would be optimal and highly desirable.

A variety of designs of apparatus for

dissolution testing have been proposed and

tested, varying from simple beaker with stirrer

to complex systems.

Different apparatus, procedures and

techniques are required for different dosage

forms because of significant differences in

formulation design and the physicochemical

properties of the drugs.

Dissolution tests have been developed for

various drug delivery systems including

immediate release solid dosage forms, several

controlled release solid dosage forms and

many novel and special dosage forms.

Most of the tests with recommended apparatus and

other specifications are now available as compendial

standards in Pharmacopoeias and are used in

pharmaceutical analysis and drug development for the

various drug delivery systems.

RESULTS AND DISCUSSION

Five brands of Diclofenac sodium delayed

release tablets 50 mg were procured from the market

and subjected to assay and comparative dissolution

profile testing as per USP guidelines for determining

in vitro equivalence of modified release products.

Assay of Diclofenac sodium delayed release tablets:

Twenty tablets were weighed and crushed using

mortar and pestle. Quantity of powder equivalent to

100 mg of Diclofenac sodium was weighed accurately

and transferred to 100 ml volumetric flask.

Approximately 70 ml of methanol AR grade was

added and syndicated for 15 minutes. The volume was

made up to 100 ml with methanol and filtered. From

the clear filtrate and aliquot equivalent to 100 ppm

was pipette out and transferred to 10 ml volumetric

flask. The volume was made up to 10 ml with

Methanol (10 µg/ml solution). The absorbance of this



solution was measured on UV spectrophotometer at

276 nm wavelength. The drug content was calculated

by simultaneously measuring the absorbance of a

standard 10 µg/ml solution of Diclofenac sodium. The

assay values for all five brands are given in Table 1.

Disintegration test for Enteric coated tablets (IP):

The DT test for enteric coated tablets as described in

IP was performed for 6 tablets of each brand and it

was observed that all brands pass this test

Comparative dissolution testing in 0.1N HCl: It is

mandatory for all delayed release products to show <

10% drug release in 0.1N HCl when in vitro

dissolution testing is performed for 2 hours in this

medium. The results for the dissolution testing of the

5 brands are given in Table 2 and shown in Figure.1.

All five brands passed the criteria of <10% in two

hours in pH 1.2 medium.

Comparative dissolution testing in pH 5.5: pH 5.5

simulates the duodenum and upper intestinal portion.

Comparative dissolution testing was conducted in pH

5.5 acetate buffer for 1 hour (Figure.2)

The dissolution profiles were statistically

compared by calculating the similarity factor (f2). The

f2 factor for brand 2, 3, 4 and 5 was calculated by

comparing with brand 1. Only brand 5 showed f2 >

50. Hence this may be considered as equivalent to

brand 1 for dissolution profile testing in pH 5.5. The


comparing with brand 2. Brand 3 and 4 showed f2 >

50. Hence these may be considered as equivalent to



comparing with brand 3. Brand 5 showed f2 > 50.

Hence this may be considered as equivalent to brand 3

for dissolution profile testing in pH 5.5. The f2 factor

for brand 1, 2, 3 and 5 was calculated by comparing

with brand 4. Brand 2 showed f2 > 50. Hence this may

be considered as equivalent to brand 4 for dissolution

profile testing in pH 5.5. The f2 factor for brand 1, 2,

3 and 4 was calculated by comparing with brand 5 as

standard. Only brand 1 showed f2 > 50. Hence this

may be considered as equivalent to brand 5 for

dissolution profile testing in pH 5.5.


simulates the duodenum and upper intestinal portion.


6.0 Phosphate buffer for 1 hour. (Figure.3)




comparing with brand 1. Only brand 5 showed f2 >

50. Hence this may be considered as equivalent to

















brand 5 for dissolution profile testing in pH 6.0.


simulates the middle and lower portion of the gut.


6.0 Phosphate buffer for 1 hour. (Figure.4).




















comparing with brand 5. Brand 1, 2 and 3 showed f2 >


brand 5 for dissolution profile testing in pH 6.8.

The multimedia dissolution study indicates

that the differences in the rate and extent of

dissolution between different brands are significantly

more at pH 5.5 and pH 6 than at pH 6.8. This may

most likely be due to the fact that each brand may

have been coated with enteric materials of different

chemistries having different solubility profiles in



alkaline pH. For e.g. the reported solubility of

Eudragit L100 is pH 6 and above while that of

Eudragit L100-55 is pH 5.5 and above. Consequently,

tablets coated with L-100-55 will show significantly

faster and more complete dissolution at pH 5.5 as

compared to Eudragit L-100. All pH dependent

enteric polymers completely dissolve at pH 6.8 and

above. Hence the difference between the brands is

significantly reduced in case of dissolution profile

testing in pH 6.8 buffer.

In order to simulate the way the dosage form is

exposed to pH change in vivo, dissolution profile

testing for all brands was conducted by using the in

situ pH change method. The in situ pH change method

of dissolution testing indicates that all five brands

achieve > 80% release within 30 minutes of reaching

the pH 6.8. However, dissolution profiles for Brand 1

and brand 5 are significantly faster at pH 6 than those

of brands 2, 3 and 4. Hence, from this study it may be

predicted that Brands 1 and 5 may show therapeutic

equivalence to each other while brands 2, 3 and 4 may

be equivalent to each other. But brand 1 and 5 may

not show therapeutic equivalence to brands 2, 3 and

4.(Figure.7).

Alcohol dumping study: For modified release

products, different types of polymers are used to get

the same kind of effect. Each of these polymers has

different solubility profiles in commonly used

solvents. The probability that this may affect the

intended release profile in vivo is very genuine if we

consider that patients may consume alcohol when

under treatment with modified release products. The

solubility profile of the polymer in alcohol may

adversely affect the release rate of the drug from the

dosage form and the actual drug release may be

entirely different from the intended release.

Hence, the US FDA in its latest guidelines has

mandated that the alcohol dumping studies should be

carried out for modified release products in order to

demonstrate that the dosage form is able to perform

within its specified standards even in presence e of

significant levels of alcohol. For the five marketed

brands of Diclofenac sodium delayed release tablets, a

comparative alcohol dumping study was performed in

0.1N HCl without alcohol, and 0.1N HCl with 5%,

10% 20% and 40% v/v of alcohol respectively. The

dissolution profile testing was carried out for two

hours. The study indicates that only Brand 1 is able to

maintain the enteric effect of < 10% release in acidic

pH even in presence of 40% alcohol. All other brands

fail the alcohol dumping test at 40% level of alcohol.

Brand 2 fails the test even at 10% and 20% level of

alcohol. (Figure.8).

Table.1. Assay values for all five Brands of Diclofenac sodium 50 mg delayed release tablets BRANDS Brand 1 Brand 2 Brand 3 Brand 4 Brand 5

% Assay 98.76 99.27 97.54 98.04 97.56

Table.2.Comparative dissolution profile testing in 0.1N Hcl Time Brand1 Brand2 Brand3 Brand4 Brand5

0 0 0 0 0 0

30 2.78 1.45 2.87 2.87 1.56

45 5.8 3.55 4.07 3.09 2.34

60 7.9 5.07 6.27 4.13 4.09

120 9.17 6.17 6.59 5.87 4.35

Figure.1. Dissolution profiles for 5 brands of Diclofenac

sodium delayed release tablets in 0.1N HCl

Figure.2.Comparative dissolution profile of five brands in

ph 5.5



Figure.3.Comparative Dissolution Profile In Ph 6.0

Phosphate Buffer


Phosphate Buffer

Figure.5. Comparative Dissolution Profile In Ph 6.0

Phosphate Buffer


Phosphate Buffer

Figure.7. Dissolution profile by in situ ph change method Figure.8.Alcohol Dumping study for Diclofenac sodium

delayed release tablets market brands

SUMMARY AND CONCLUSION

Diclofenac sodium tablets are available as

delayed release tablets in the market. Delayed release

tablets are typically produced by coating the tablet

with enteric coating polymers. These polymers

provide the resistance of drug release in acidic

environment of stomach and allow the drug to be

released in alkaline environment of the intestine. A

large number of enteric polymers are available which

provide excellent protection to drug release in acidic

environment. However, each polymer dissolves at

different alkaline pH. For e.g. Eudragit L-100

dissolves at pH 6 and above while Eudragit S-100

dissolves at pH 6.5 and above. HPMC Phthalate P5.5

dissolves at pH 5.5 and above while HPMC Phthalate

P dissolves at pH 6 and above. Hence, for the same

drug the bioavailability can subtly but significantly

change based on which enteric polymer is used to

provide the delayed release.

The aim of the current work was to

comparatively evaluate five brands of Diclofenac

sodium enteric coated tablets and determine which

brands may be equivalent to each other based on in

vitro testing. Comparative dissolution profile testing

was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It

was determined that Brand 1 and 5 are equivalent to

each other while brands 2, 3 and 4 are equivalent to

Page 776



each other. Similarity factor f2 was used for

comparing the dissolution profiles.

Alcohol dumping studies indicated that only

brand 1 was able to withstand the enteric effect at

40% level of alcohol. All other marketed brands fail

the alcohol dumping test. This indicates that patients

may have to counsel not to concomitantly consume

alcohol while on Diclofenac sodium delayed release

tablets.

ACKNOWLEDGEMENT

The authors are grateful thanks to Indian

Pharmaceutical Sciences, Arabindo pharma lim,

EMCO industries-hyd, FMC-US, Ashaland specialty

chemicals-US for providing gift samples of

Diclofenac Sodium.

REFFERECES

1. Juran JM, Juran on Quality by Design, The Free

Press, A Division of Macmillan, Inc., New York,

1992, 407-425

2. Kearney PM, Baigent C, Godwin J, Halls H,

Emberson JR, Patrono C: Do selective cyclo-

oxygenase-2 inhibitors and traditional non-steroidal

anti-inflammatory drugs increase the risk of

atherothrombosis? Meta-analysis of randomised trials,

BMJ, 3, 2006, 1302

3. Solomon DH, Avorn J, Sturmer T, Glynn RJ,

Mogun H, Schneeweiss S: Cardiovascular outcomes

in new users of coxibs and Nonsteroidal anti-

inflammatory drugs: high-risk subgroups and time

course of risk, Arthritis Rheum, 54(5), 2006, 1378-

89.

4. FitzGerald GA, Patrono C, The coxibs, selective

inhibitors of cyclooxygenase-2, N Engl J Med, 345(6),

2001, 433-42.

5. Graham DJ: COX-2 inhibitors, other NSAIDs, and

cardiovascular risk: the seduction of common sense,

JAMA, 296(13), 2006, 1653-6.

6. Brater DC, Renal effects of cyclooxygyenase-2-

selective inhibitors, J Pain Symptom Manage, 23(4

Suppl), 2002, 15-20.

7. Sigma Aldrich Gan TJ: Diclofenac: an update on its

mechanism of action and safety profile, Curr Med

Res Opin, 26(7), 2010, 1715-31.

Page 777

Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Development and validation of a stability indicating HPLC method for analysis of

Altretamine in bulk drug and pharmaceutical formulations M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao

*

V.V. Institute of Pharmaceutical Sciences, Gudlavalleru, Andhra Pradesh, India. *Corresponding author: E-mail: [email protected]

ABSTRACT

A simple, sensitive and accurate stability indicating HPLC method has been developed and

validated for determination of Altretamine in its bulk form and pharmaceutical formulations.

Chromatographic separation was achieved on a Hypersil BDS C18 column (100 mm x 4.6 mm I.D.,

particle size 5 µm) by a mobile phase consisted of phosphate buffer and acetonitrile (90:10, v/v) with

apparent pH of 3.1±0.5 and a flow rate of 1.0 mL/min. The detection wave length was set at 227 nm. An

excellent linearity was observed for Altretamine in the concentration range of 25-150 µg/mL with a

correlation coefficient of 0.999. The retention time was 2.533 min. The percentage assay of Altretamine

was 99.98%. The method developed was validated for accuracy, precision, linearity, ruggedness,

robustness, solution stability, selectivity and forced degradation studies like acidic, alkaline, oxidative,

thermal, hydrolytic and photolytic stress conditions were performed as per ICH guidelines. The results

demonstrated that the method would have a great value when applied in quality control and stability

studies of Altretamine.

Key Words: HPLC, Altretamine, Stability, Formulation.

INTRODUCTION

Altretamine (Figure 1) is a synthetic cytotoxic

antineoplastic agent (Neil, 2006). Chemically it is

N,N,N',N',N'',N''-hexamethyl-1,3,5-triazine-2,4,6-

triamine. Altretamine is indicated for use as a single

agent in the palliative treatment of patients with

persistent or recurrent ovarian cancer following first-

line therapy with a cisplatin and/or alkylating agent-

based combination (Wiernik, 1992). Altretamine is

structurally related to the alkylating agents. Its precise

mechanism of action is unknown but hydroxy methyl

intermediates in the metabolism process are possibly

the reactive species, and may act as alkylating agents

(Rhoda, 1995). Altretamine interferes with the growth

of cancer cells and slows their growth and spread in

the body.

Literature survey revealed that few HPLC

methods (Ghiorghis, 1991; Barker, 1994) were

reported for the determination of Altretamine. But no

stability indicating HPLC method was reported.

Hence the objective of this method is to develop and

validate a simple, rapid and accurate stability

indicating HPLC method (Snyder, 1997) in

accordance with ICH guidelines (ICH Q2(R1), 2005;

ICH Q1A(R2), 2003) for the determination of

Altretamine in bulk sample and its pharmaceutical

formulations.


Chemicals and solvents: The working standard

of Altretamine was provided as gift sample from

Spectrum Labs, Hyderabad, India. The market

formulation CANTRET capsules (Altretamine 50

mg) were procured from local market. HPLC

grade acetonitrile and water were purchased from

E.Merck (India) Ltd, Mumbai, India. Potassium

dihydrogen phosphate, orthophosphoric acid and

triethylamine of AR grade were obtained from

S.D. Fine Chemicals Ltd, Mumbai, India.

Instrumentation: To develop a high

performance liquid chromatographic method for

quantitative determination of Altretamine using

Waters HPLC system on Hypersil BDS C18

column (100 mm x 4.6 mm I.D., particle size 5

µm) was used. The instrument is equipped with

an auto sampler and UV detector. A 10 μL

rheodyne injector port was used for injecting the

samples. Data was analyzed by using Empower 2

software.

Chromatographic conditions: A mixture of

phosphate buffer pH 3.1 and acetonitrile (90:10,

v/v) was found to be the most suitable mobile

phase for ideal chromatographic separation of

Altretamine. The solvent mixture was filtered

through 0.45 μ membrane filter and sonicated

before use. It was pumped through the column at

a flow rate of 1.0 mL/min. Injection volume was

10 µL and the column was maintained at a

temperature of 300C. The column was

equilibrated by pumping the mobile phase

through the column for at least 30 minutes prior

http://www.rxlist.com/script/main/art.asp?articlekey=10703

http://www.rxlist.com/script/main/art.asp?articlekey=25441



to the injection of the drug solution. The detection

of the drug was monitored at 227 nm. The run

time was set at 6 minutes.

Preparation of phosphate buffer pH 3.1: 2.72

grams of potassium dihydrogen phosphate was

weighed and transferred into a 1000 mL beaker

and dissolved. 1 mL of triethylamine solution was

added to the above solution and diluted to 1000

mL with HPLC water. pH was adjusted to 3.1

with orthophosphoric acid solution.

Preparation of mobile phase and diluent: 900

mL of phosphate buffer was mixed with 100 mL

of acetonitrile and was used as mobile phase. The

solution was degassed in an ultrasonic water bath

for 5 minutes and filtered through 0.45 µ filter

under vacuum. The mixture of 800 mL of water

and 200 mL of acetonitrile was used as diluent.

Preparation of standard solution: 10 mg of

Altretamine was accurately weighed, transferred

to 10 mL volumetric flask and is dissolved in 7

mL of the diluent. Sonicated the solution for few

minutes to dissolve the drug completely. Then it

is filtered through 0.45 μ filter and the volume is

made up to 10 mL with diluent to get a

concentration of 1 mg/mL stock solution. Further

pipetted 1.0 mL of the above stock solution into a

10 mL volumetric flask and diluted up to the

mark with diluent to obtain required

concentrations.

Preparation of sample solution: Twenty

commercial capsules were emptied and

powdered. A quantity of the powder equivalent to

10 mg of Altretamine was accurately weighed,

transferred to 10 mL volumetric flask and is

dissolved in 7 mL of the diluent. Sonicated the

solution for few minutes to dissolve the drug

completely. Then it is filtered through 0.45 μ

filter and the volume is made up to 10 mL with

diluent to get a concentration of 1 mg/mL stock

solution. Further pipetted 1.0 mL of the above

stock solution into a 10 mL volumetric flask and

diluted up to the mark with diluent to obtain

required concentrations of Altretamine in

pharmaceutical dosage forms. Inject 10 µL of the

above solution into the HPLC system. All

experiments were conducted in triplicate.

Linearity: Several aliquots of standard solution

of Altretamine was taken in different 10 mL

volumetric flasks and diluted up to the mark with

diluent such that the final concentrations of

Altretamine were in the linearity range of 25-150

µg/mL. Evaluation of the drug was performed

with UV detector at 227 nm, peak area was

recorded for all the peaks. The response for the

drug was linear and the regression equation was

found to be y=19094x-10685 and correlation

coefficient value of Altretamine was found to be

0.999. The results show that an excellent

correlation exists between peak area and

concentration of drug within the concentration

range indicated.

Limit of detection and limit of quantification:

The limit of detection (LOD) and limit of

quantification (LOQ) of the developed method

were determined by injecting progressively low

concentrations of the standard solution using the

developed HPLC method. The LOD and LOQ for

Altretamine were found to be 0.46 μg/mL and

1.39 μg/mL respectively.

System suitability: System suitability parameters

like retention time, theoretical plates and tailing

factor were calculated and compared with

standard values.

Accuracy: The accuracy of the method was

assessed by recovery study of Altretamine in the

dosage form at three concentration levels. A fixed

amount of preanalyzed sample was taken and

standard drug was added at 50%, 100% and 150%

levels. The standard concentration was fixed as

100 μg/mL and three concentration levels of 50

μg/mL, 100 μg/mL and 150 μg/mL were added to

the standard concentration. Each level was

repeated three times. The content of Altretamine

per capsule was calculated. The percentage

recovery ranges from 99.62-100.27% and the

mean recovery of Altretamine was 99.92% and

the recovery values of Altretamine indicate the

method is accurate.

Precision: The precision was determined for

Altretamine in terms of system and method

precision. For system precision evaluation,

%RSD for Altretamine was 0.32% (limit %RSD

< 2.0%). In addition, the method precision was



studied and the %RSD for Altretamine was

0.77% (limit %RSD < 2.0%).

Ruggedness and robustness: The ruggedness of

the method was determined by carrying out the

experiment on different instruments by different

operators using different columns of similar

types. Robustness of the method was determined

by making slight changes in the chromatographic

conditions like changes in flow rate and mobile

phase composition. It was observed that there

were no marked changes in the chromatograms,

which demonstrated that the HPLC method so

developed is rugged and robust.

Solution stability: The stability of solution under

study was established by keeping the solution at

room temperature for 24 hrs. The result showed

no significant change in concentration and thus

confirms the stability of the drug in the mobile

phase used for the analysis.

Analysis of the marketed formulations: The

proposed method was applied for the

determination of Altretamine in pharmaceutical

formulatons of Altretamine capsules. 10 µL of

each standard and sample solution were injected

and from the peak area of Altretamine, amount of

drug present in samples were computed. The

result of assay undertaken yielded 99.98% of

label claim of Altretamine. The assay obtained is

more than 99% and no interference of impurity

peak observed in Altretamine peak.

Acidic degradation s tudies: To 1 mL of stock

solution of Altretamine, 1 mL of 2N hydrochloric

acid was added and refluxed for 30 mins at 600C.

The resultant solution was diluted to obtain 100

µg/mL solution and 10 µL solution were injected

into the system and the chromatograms were

recorded to assess the stability of sample.

Alkaline degradation s tudies: To 1 mL of

stock solution of Altretamine, 1 mL of 2N

sodium hydroxide was added and refluxed for

30 mins at 600C. The resultant solution was

diluted to obtain 100 µg/mL solution and 10 µL

solution were injected into the system and the

chromatograms were recorded to assess the

stability of sample.

Oxidative degradation studies: To 1 mL of

stock solution of Altretamine, 1 mL of 20%

hydrogen peroxide (H2O2) was added separately.

The solutions were kept for 30 mins at 600C.

The resultant solution was diluted to obtain

100 µg/mL solution and 10 µL solution were

injected into the system and the chromatograms

were recorded to assess the stability of sample.

Thermal degradation s tudies: The standard

Al t re t amine solution was placed in oven at

1050C for 6 hrs to study thermal degradation.

The resultant solution was diluted to obtain 100

µg/mL solution and 10 µL solution were

injected into the system and the chromatograms

were recorded to assess the stability of the

sample.

Hydrolytic degradation s tudies: Stress testing

under hydrolytic conditions was studied by

refluxing the s t a n d a r d A l t r e t a m i n e

s o l u t i o n in water for 6 h r s at a temperature

of 60ºC. The resultant solution was diluted to

obtain 100 µg/mL solution and 10 µL solution

were injected into the system and the


stability of the sample.

Photolytic degradation studies: The photolytic

stability of the drug Altretamine was studied by

exposing the standard Altretamine solution to UV

light by keeping the beaker in UV chamber for 7

days or 200 Watt hours/m2

in photo stability

chamber. The resultant solution was diluted to

obtain 100 µg/mL solution and 10 µL solution

were injected into the system and the


stability of sample.


In the present work, a simple, accurate

and precise stability indicating HPLC method has

been optimized, developed and validated for the

determination of Altretamine in pharmaceutical

formulations with UV detector by using Hypersil

BDS C18 column (100 mm x 4.6 mm I.D.,

particle size 5 µm) in isocratic mode with mobile

phase composition of phosphate buffer pH 3.1:

acetonitrile (90:10, v/v) and pH adjusted to 3.1

with orthophosphoric acid. The use of phosphate

buffer and acetonitrile in the ratio of 90:10, v/v

resulted in peak with good shape and resolution.



The flow rate was 1.0 mL/min and the drug

component was measured with UV detector at

227 nm. The results of optimized HPLC

conditions were shown in Table 1.

The method was linear in the range of 25-

150 µg/mL for Altretamine with correlation

coefficient of 0.999. The linearity results were

shown in Table 2 and the linearity curve of

Altretamine was shown in Figure 2. The %

recoveries of Altretamine were found in the range

of 99.62-100.27% and the % mean recovery was

found to be 99.92% for Altretamine, which

indicate the method is accurate. The results of

recovery studies were shown in Table 3. The

%RSD for system precision and method precision

for Altretamine were found to be 0.32 and 0.77,

which indicate the method is precise. The results

of precision studies were shown in Table 4 and

Table 5. The retention time of Altretamine was

2.533 min, cuts down on overall time of sample

analysis and the method was more cost effective

as it utilizes very less quantity of mobile phase.

The number of theoretical plates was 4253 and

tailing factor was 1.49 for Altretamine, which

indicates efficient performance of the column.

Typical chromatogram of drug Altretamine was

shown in Figure 3.

Selectivity of the method was

demonstrated by the absence of any interfering

peaks at the retention time of the drug. The

limit of detection and limit of quantification for

Altretamine were found to be 0.46 μg/mL and

1.39 μg/mL, which indicate the sensitivity of

the method. A system suitability test was

performed to evaluate the chromatographic

parameters and the summary of system

suitability parameters were shown in Table 6.

Validated method was applied for the

determination of Altretamine in commercial

formulations. The % assay was found to be

99.98% for Altretamine and the assay results

were shown in Table 7.

HPLC studies of Altretamine under

different stress conditions indicated the following

degradation behavior. In acidic degradation, the

degradation product of Altretamine was appeared

at retention time of 2.522 min and the %

degradation is 9.08%. In alkaline degradation, the



degradation is 6.96%. In oxidative degradation,

the degradation product of Altretamine was

appeared at retention time of 2.504 min and the %

degradation is 7.40%. In thermal degradation, the



degradation is 5.27%. In hydrolytic degradation,



degradation is 0.21%. In photolytic degradation,



degradation is 1.05%. The results of analysis are

given in Table 8. The typical chromatograms of

degradation behavior of Altretamine in different

stress conditions are shown in Figure 4 to Figure

9.

Figure.1. Molecular structure of Altretamine



Figure.2. Calibration curve of Altretamine

Figure.3. Typical chromatogram of Altretamine

Figure.4. Acidic degradation chromatogram of Altretamine

Figure.5. Alkaline degradation chromatogram of Altretamine



Figure.6. Oxidative degradation chromatogram of Altretamine

Figure.7. Thermal degradation chromatogram of Altretamine

Figure.8. Hydrolytic degradation chromatogram of Altretamine

Figure.9. Photolytic degradation chromatogram of Altretamine



Table.1. Optimized chromatographic conditions of Altretamine

Parameter Condition

Mobile phase Phosphate buffer:acetonitrile (90:10, v/v)

pH 3.1±0.5

Diluent Water:acetonitrile (80:20, v/v)

Column Hypersil BDS C18 column (100 mm x 4.6 mm, 5 μm)

Column temperature 300C

Wave length 227 nm

Injection volume 10 µL

Flow rate 1.0 mL/min

Run time 6 min

Table.2. Linearity results of Altretamine

Concentration (μg/mL) Area

25 450417

50 968416

75 1393682

100 1884563

125 2406916

150 2845543

Table.3. Recovery results of Altretamine

Level Concentration

added (μg/mL)

Concentration

found (μg/mL) % Recovery Mean recovery

50% 50 49.81 99.62%

99.92% 100% 100 99.88 99.88%

150% 150 150.42 100.27%

Table.4. System precision data of Altretamine Table.5. Method precision data of Altretamine

S. No. Area of Altretamine

1 1889572

2 1891733

3 1888707

4 1883428

5 1894047

Average 1891566

SD 6188.9

%RSD 0.32

S. No. Area of Altretamine

1 1903347

2 1883489

3 1880659

4 1911086

5 1879578

6 1907331

Average 1894248

SD 14512.7

%RSD 0.77

Table.6. System suitability parameters of Altretamine

Parameter Results

Linearity range (μg/mL) 25-150

Correlation coefficient 0.999

Theoretical plates (N) 4253

Tailing factor 1.49

LOD (μg/mL) 0.46

LOQ (μg/mL) 1.39

Retention time (min) 2.533



Table.7. Assay results of Altretamine

Formulation Label claim Amount found %Assay

CANTRET 50 mg 49.99 mg 99.98%

Table.8. Degradation studies of Altretamine

Stress conditions Degradation

time

Area of

peak

%

Degradation

% of active drug present

after degradation

Standard Drug - 1891733 - -

Acidic 30 mins 1720141 9.08% 90.92%

Alkaline 30 mins 1760088 6.96% 93.04%

Oxidative 30 mins 1751783 7.40% 92.60%

Thermal 6 hours 1792116 5.27% 94.73%

Hydrolytic 6 hours 1887905 0.21% 99.79%

Photolytic 7 days 1872031 1.05% 98.95%

CONCLUSION

The present study represents the first report

that deals with the development of a stability

indicating HPLC method for determination of

Altretamine. This study is a typical example for

development of a stability indicating assay established

by following the recommendations of ICH guidelines.

The proposed method showed acceptable accuracy,

precision, selectivity and wide linear concentration

range. The results of analysis proved that the method

is suitable for the determination of Altretamine in bulk

and capsule dosage forms without any interference

from the degradation products and it is recommended

for routine quality control analysis of the Altretamine

in pharmaceutical formulations.

REFERENCES

Barker IK, Crawford SM and Fell AF, Determination

of Altretamine in human plasma with high-

performance liquid chromatography, Journal of Liquid

Chromatography B, 660(1), 1994, 121-126.

Ghiorghis A and Talebian AH, High-pressure liquid

chromatography separation of potential impurities of

Altretamine, Journal of Liquid Chromatography,

14(12), 1991, 2331-2349.

ICH Harmonised Tripartite Guideline, Stability

Testing of New Drug Substances and Products,

Q1A(R2), International Conference on

Harmonization, 2003, 1-18.

ICH Harmonised Tripartite Guideline, Validation of

analytical procedures: Text and methodology, Q2(R1),

International Conference on Harmonization, 2005, 1-

13.

Neil OJM, The Merck Index, An Encyclopedia of

Chemicals Drug and Biologicals, 14th Ed., Merck

Research Laboratories, Division of Merck and Co.

Inc., White House Station, NJ, 2006, 57.

Rhoda LC and Diana F, Altretamine: A review of its

pharmacodynamic and pharmacokinetic properties

and therapeutic potential in cancer chemotherapy,

Drugs, 49(6), 1995, 932-953.

Snyder LR, Kirkland JJ and Glajch JL, Practical

HPLC Method Development, 2nd

Ed., New York, John

Wiley and Sons, 1997, 184-185.

Wiernik PH, Hexamethylmelamine and low or

moderate dose cisplatin with or without pyridoxine for

treatment of advanced ovarian carcinoma: a study of

the eastern cooperative oncology group, Cancer

Investigation, 10(1), 1992, 1-9.

Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A review of various analytical methods on Atrovastatin

N.Delhiraj*, P.Ashok,U.Ravikiran,P.Abhinandhana

Department of pharmaceutical analysis, A.S.N Pharmacy College, Tenali, Andhra Pradesh

*Corresponding author E.Mail:[email protected]

ABSTRACT

There is a review of analytical methods for atorvastatin, such as spectrophotometry, derivative

spectrophotometry and various chromatographic procedures such as, high-performance liquid

chromatography (HPLC), high-performance thin-layer chromatography (HPTLC), and liquid

chromatography tandem mass spectrometry (LC-MS). This review is based on representative publications

that were published between 2000 and 2013.

Key Words: hypolipideamic drugs, HMG-COA analysis, review, spectrophotometry, chromatography

INTRODUCTION

Atorvastatin is the most efficacious and best

tolerated hypolipideamic drugs introduced in

1980.They competitively inhibit conversion of 3-

hydroxy 3-methyl glutaryl coenzyme and (HMG-

COA) to mevalonate Atorvastatin is the most

efficacious and best tolerated hypolipideamic drugs.

They competitively inhibit conversion of 3-hydroxy 3-

methyl glutaryl coenzyme and (HMG-COA) to

mevalonate (rate limiting step in cholesterol (CH)

synthesis) by the HMG-COA reductase. Therapeutic

doses reduce cholesterol synthesis by 20-50%. This

results in compensatory increases in Low density

lipoprotein (LDL) receptor expression on liver cell

leads to increased receptor mediated uptake and

catabolism of Intermediate density lipoprotein (IDL)

and LDL. Over long term feedback induction of

HMG-COA reductase tends to increase CH synthesis

but a steady is finally attained with a dose dependent

lowering of LDL-CH levels. The daily dose of

Atorvastatin for lowering LDL-CH levels by 30-35%

is 10 mg. Morever at their maximum recommended

doses atorvastatin can reduce CH up to 45-55%.5. The

more efficacious atrovastatin given at their higher

doses effectively reduce Triglycerides (TGs) (by 25-

35%) when they are moderately raised but not when

they are markedly raised. Because HMG-COA

reductase activity is maximum at midnight, statins are

administered at bed time to obtain maximum

effectiveness. All statins except rosuvastatin are

metabolized primarily by CYP3A4. Inhibitors and

inducers of this isoenzyme respectively increase and

decrease statin blood levels. (Tripathi,KD 2008)

Chromatographic and spectrophotometric

methods: A novel, precise, accurate and rapid

isocratic reversed-phase high performance liquid

chromatographic/ultraviolet (RP-HPLC/UV)

method was developed, optimized and validated

for simultaneous determination of rosuvastatin

and atorvastatin in human serum using naproxen

sodium as an internal standard. Effect of different

experimental parameters and various particulate

columns on the analysis of these analytes was

evaluated. The method showed adequate

separation for rosuvastatin and atorvastatin and

best resolution was achieved with Brownlee

analytical C18 column (150×4.6 mm, 5 μm) using

methanol-water (68:32, v/v; pH adjusted to 3.0

with trifluoroacetic acid) as a mobile phase at a

flow rate of 1.5 ml/min and wavelength of 241

nm. The calibration curves were linear over the

concentration ranges of 2.0-256 ng/ml for

rosuvastatin and 3.0-384 ng/ml for atorvastatin.

The lower limit of detection (LLOD) and lower

limit of quantification (LLOQ) for rosuvastatin

were 0.6 and 2.0 ng/ml while for atorvastatin

were 1.0 and 3.0ng/ml, respectively. All the

analytes were separated in less than 7.0 min. The

proposed method could be applied for routine

laboratory analysis of rosuvastatin and

atorvastatin in human serum samples,

pharmaceutical formulations, drug-drug

interaction studies and pharmacokinetics studies.

(Shah Y, 2011)

Two simple and accurate methods to

determine atorvastatin calcium and ramipril in

capsule dosage forms were developed and

validated using HPLC and HPTLC. The HPLC

separation was achieved on a Phenomenex Luna

C18 column (250 x 4.6 mm id, 5 microm) in the

isocratic mode using 0.1% phosphoric acid-

acetonitrile (38 + 62, v/v), pH 3.5 +/- 0.05,

mobile phase at a flow rate of 1 ml/min. The

retention times were 6.42 and 2.86 min for

atorvastatin calcium and ramipril, respectively.

Quantification was achieved with a photodiode



array detector set at 210 nm over the

concentration range of 0.5-5 µg/ml for each, with

mean recoveries (at three concentration levels) of

100.06 +/- 0.49% and 99.95 +/- 0.63% RSD for

atorvastatin calcium and ramipril, respectively.

The HPTLC separation was achieved on silica gel

60 F254 HPTLC plates using methanol-benzene-

glacial acetic acid (19.6 + 80.0 + 0.4, v/v/v) as the

mobile phase. The Rf values were 0.40 and 0.20

for atorvastatin calcium and ramipril,

respectively. Quantification was achieved with

UV densitometry at 210 nm over the

concentration range of 50-500 ng/spot for each,

with mean recoveries (at three concentration

levels) of 99.98 +/- 0.75% and 99.87 +/- 0.83%

RSD for atorvastatin calcium and ramipril,

respectively. Both methods were validated

according to International Conference on

Harmonization guidelines and found to be simple,

specific, accurate, precise, and robust. The mean

assay percentages for atorvastatin calcium and

ramipril were 99.90 and 99.55% for HPLC and

99.91 and 99.47% for HPTLC, respectively. The

methods were successfully applied for the

determination of atorvastatin calcium and

ramipril in capsule dosage forms without any

interference from common excipients. (Panchal

HJ, 2010)

Charged aerosol detector (CAD) detection

approach was applied in a new HPLC method for

the determination of three of the major statins

used in clinical treatment-simvastatin, lovastain

and atorvastatin. The method was optimized and

the influence of individual parameters on CAD

response and sensitivity was carefully studied.

Chromatography was performed on a Zorbax

Eclipse XDB C18 (4.6 mm x 75 mm, 3.5

microm), using acetonitrile and formic acid 0.1%

as mobile phase. The detection was performed

using both charged aerosol detector (CAD) (20

pA range) and diode array detector-238

nm(DAD) simultaneously connected in series. In

terms of linearity, precision and accuracy, the

method was validated using tablets containing

atorvastatin and simvastatin. The CAD is

designated to be a non-linear detector in a wide

dynamic range, however, in this application and

in the tested concentration range its response was

found to be perfectly linear. The limits of

quantitation (0.1 µg/ml) were found to be two

times lower than those of UV detection. (Patil

UP, 2010)

A simple, specific, accurate and precise

high-performance thin-layer chromatographic

method for analysis of Telmisartan and

Atorvastatin calcium in fixed dose combination

has been developed. The method uses aluminium

plates coated with silica gel 60 F254 as stationary

phase and toluene: methanol (7: 3, v/v) as mobile

phase. Densitometric evaluation of the separated

bands was performed at 280 nm. The two drugs

were satisfactorily resolved with RF values 0.50

± 0.01 and 0.29 ± 0.00 for Telmisartan and

Atorvastatin calcium, respectively. The respective

calibration plots were found to be linear over the

range 200–1000 and 200–700 ng/band for

Telmisartan and Atorvastatin calcium,

respectively. This method has been successfully

validated and applied for the analysis of drugs in

pharmaceutical formulation. (Novakova, 2009)

A number of analytical methods were

reported for the estimation of atorvastatin and

ramipril from their individual dosage forms or in

combination with other drugs (Valiyare, 2004;

Vachareau and Neirinck, 2000). Here successful

reverse phase-high performance liquid

chromatographic method and spectroscopic

methods were developed then validated for the

analysis of combined dosage form of atorvastatin

and ramipril. Individual lambda-max for

atorvastatin is 247 nm and that of ramipril is 208

nm. They intersect at 215 nm which is fixed as

wavelength for reverse phase-high performance

liquid chromatographic method. (Joseph, 2008)

A simple, accurate and precise high-

performance thin-layer chromatographic method

has been developed for the estimation of

Atorvastatin Calcium and Metoprolol Tartarate

simultaneously from a capsule dosage form. The

method employed Silica gel 60F254 precoated

plates as stationary phase and a mixture of

Chloroform: Methanol: Glacial acetic acid (dil.)

(9:1.5:0.2 ml %v/v) as mobile phase.

Densitometric scanning was performed at 220 nm

using Camag TLC scanner 3. The method was

linear in the drug concentrations' range of 500 to

2500 ng/spot for Atorvastatin Calcium, also for

http://www.ncbi.nlm.nih.gov/pubmed?term=Panchal%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=21140656

http://www.ncbi.nlm.nih.gov/pubmed?term=Panchal%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=21140656



Metoprolol Tartarate with correlation coefficient

of 0.984 for Atorvastatin Calcium and 0.995 for

Metoprolol Tartarate respectively. The retention

factor for Atorvastatin Calcium was 0.45 ± 0.04

and for Metoprolol Tartarate was 0.25 ± 0.02.

The method was validated as per ICH

(International Conference on Harmonization)

Guidelines, proving its utility in estimation of

Atorvastatin Calcium and Metoprolol Tartarate in

combined dosage form. (Patole SM, 2011)

A rapid high performance liquid

chromatographic method was developed and

validated for determination of atorvastatin in

pharmaceutical dosage forms, and for evaluation

of its stability in the solid phase. Separation of

atorvastatin was successfully achieved on a C-18

column utilizing water--acetonitrile at the

volumetric ratio of 48:52, adjusted to pH 2.0 with

80% ortho-phosphoric acid. The detection

wavelength was 245 nm. The method was

validated and the response was found to be linear

in the drug concentration range of 0.04 mg/mol -

0.4 mg/mol. The mean values percentage relative

standard deviation+/- (RSD) of the slope and the

correlation coefficient were 8.192 +/- 0.260 and

0.999, respectively. The RSD values for intra-

and interday precision were < 1.00% and 0.90%,

respectively. The degradation kinetic of

atorvastatin at 363 K in a relative humidity of

76.4% was observed to be autocatalytic first order

reaction. The kinetic parameters were as follows:

k (where k represents the velocity constant; s (-1)

= (1.42 +/- 0.19) 10(-6); t (0.5) (where t (0.5)

represents the time needed for a 50% decay of

atorvastatin; days) = 32.82 +/- 0.9; t (0.1) (where

t (0.1) represents the time needed for a 10%

decay of atorvastatin; days) = 13.86 +/- 0.8.

(Stains B, 2006)

A simple, precise and accurate reversed-

phase liquid chromatographic method has been

developed for the simultaneous estimation of

atorvastatin calcium and telmisartan in tablet

formulations .The chromatographic separation

was achieved on (Waters symmetry C18, 250mm

x 4.6mm, 5μ) analytical column. A mixture of

ammonium acetate (0.02M, pH 4.0 adjusted with

glacial acetic acid) and acetonitrile in ratio (40:60

v/v) at flow rate of 1.0ml/min and detector

wavelength 254 nm. The retention time of

atorvastatin calcium and telmisartan was found to

be 4.6 and 6.1 minutes respectively. The

validation of the proposed method was carried out

for its specificity, linearity, accuracy, precision,

limit of detection and quantification for both

atorvastatin calcium and telmisartan. The

developed method can be used for routine quality

analysis of titled drugs in combination in tablet

formulation (Suresh Kumar GV, 2010).

A simple, specific, accurate and stability

indicating reversed phase high performance liquid

chromatographic method was developed for the

simultaneous determination of atorvastatin

calcium and amlodipine besylate in tablet dosage

forms. A Phenomenex Gemini C-18, 5 mm

column having 250´4.6 mm i.d. in isocratic mode,

with mobile phase containing 0.02 M potassium

dihydrogen phosphate:acetonitrile:methanol

(30:10:60, v/v/v) adjusted to pH 4 using ortho

phosphoric acid was used. The flow rate was 1.0

ml/min and effluents were monitored at 240 nm.

The retention times of atorvastatin calcium and

amlodipine besylate were 11.6 min and 4.5 min,

respectively. The calibration curves were linear in

the concentration range of 0.08-20 µg/ml for

atorvastatin calcium and 0.1-20 µg/ml for

amlodipine besylate. Atorvastatin calcium and

amlodipine besylate stock solutions were

subjected to acid and alkali hydrolysis, chemical

oxidation and dry heat degradation. The degraded

product peaks were well resolved from the pure

drug peak with significant difference in their

retention time values. The proposed method was

validated and successfully applied to the

estimation of atorvastatin calcium and amlodipine

besylate in combined tablet dosage forms (Shah

D.A, 2008)

A reverse phase high performance liquid

chromatographic method was developed for the

simultaneous estimation of atorvastatin calcium

and fenofibrate in tablet formulation. The

separation was achieved by Luna C18 column

and methanol: acetate buffer pH 3.7 (82:18 v/v)

as mobile phase, at a flow rate of 1.5 ml/min.

Detection was carried out at 248 nm. Retention

time of atorvastatin calcium and fenofibrate was

found to be 3.02+0.1 and 9.05+0.2 min,



respectively. The method has been validated for

linearity, accuracy and precision. Linearity for

atorvastatin calcium and Fenofibrate were in the

range of 1-5 μg/ml and 16-80 μg/ml, respectively.

The mean recoveries obtained for Atorvastatin

calcium and fenofibrate were 101.76% and

100.06%, respectively. Developed method was

found to be accurate, precise, selective and rapid

for simultaneous estimation of atorvastatin

calcium and fenofibrate in tablets. (Jain N, 2008)

An isocratic RP-HPLC method was

developed and validated for the quantitation of

Atorvastatincalcium and Amlodipine besylate in

combined tablet dosage forms. Quantitation was

achieved using a reversed-phase Hypersil silica

BDS (250x4.6mm with 5+ particle size) column

at ambient temperature with mobile phase

consisting of 0.05M ammonium acetate buffer

(pH-4) and acetonitrilein the ratio (40 + 60, v/v).

The flow rate was 1.0 ml/min. Measurements

were made at a wavelength of 240.0nm. The

proposed method was validated for selectivity,

precision, linearity and accuracy. The assay

method was found to be linear from 30.0-

70.0µg/ml for Amlodipine besylate and 60.0-

140.0 µg/ml for Atorvastatin calcium. All

validation parameters were within the acceptable

range. The developed method was successfully

applied to estimate the amount of Atorvastatin

calcium and Amlodipine besylate in combined

dosage forms. (Mishra P, 2007)

A stability indicating UPLC method was

developed and validated for the simultaneous

determination of atorvastatin, fenofibrate and

their impurities in tablets. The chromatographic

separation was performed on acquity UPLC BEH

C18 column (1.7 microm, 2.1 mmx100 mm)

using gradient elution of acetonitrile and

ammonium acetate buffer (pH 4.7; 0.01 M) at

flow rate of 0.5 ml/min. UV detection was

performed at 247 nm. Total run time was 3 min

within which main compounds and six other

known and major unknown impurities were

separated. Stability indicating capability was

established by forced degradation experiments

and separation of known degradation products.

The method was validated for accuracy,

repeatability, reproducibility and robustness.

Linearity, loss of drying (LOD) and loss of

quality (LOQ) was established. (Kadav AA,

2008)

A simple, accurate, rapid and precise

isocratic reversed-phase high-performance liquid

chromatographic method has been developed and

validated for simultaneous determination of

aspirin, atorvastatin calcium and clopidogrel

bisulphate in capsules. The chromatographic

separation was carried out on an Inertsil ODS

analytical column (150×4.6 mm; 5 μm) with a

mixture of acetonitrile: phosphate buffer pH 3.0

adjusted with o-phosphoric acid (50:50, v/v) as

mobile phase; at a flow rate of 1.2 ml/min. UV

detection was performed at 235 nm. The retention

times were 1.89, 6.6 and 19.8 min. for aspirin,

atorvastatin calcium and clopidogrel bisulphate,

respectively. Calibration plots were linear (r 2

>0.998) over the concentration range 5-30 μg/ml

for atorvastatin calcium and 30-105 μg/ml for

aspirin and clopidogrel bisulphate. The method

was validated for accuracy, precision, specificity,

linearity, and sensitivity. The proposed method

was successfully used for quantitative analysis of

capsules. No interference from any component of

pharmaceutical dosage form was observed.

Validation studies revealed that method is

specific, rapid, reliable, and reproducible. The

high recovery and low relative standard deviation

confirm the suitability of the method for routine

determination of aspirin, atorvastatin calcium and

clopidogrel bisulphate in bulk drug and capsule

dosage form. (Londhe SV, 2011)

A UV spectrophotometric method was

developed for the estimation of atorvastatin

calcium & fenofibrate in table dosage form by

using simultaneous equation method. The drug

obeyed Beer’s law & showed good correlation

near to 0.999. Absorption maxima of atorvastatin

calcium & fenofibrate were found to be at 246

and 286nm respectively. Beer’s law was obeyed

in concentration rang of 1-10 μg/ml for

atorvastatin calcium & 2-20μg/ml for fenofibrate.

The method has been validated for linearity,

accuracy & precision. The recovery was more

than 99%. The developed method was found to be

accurate, simple, precise, economical, and

selective for simultaneous estimation of

http://www.ijpsonline.com/searchresult.asp?search=&author=SV+Londhe&journal=Y&but_search=Search&entries=10&pg=1&s=0



atorvastatin calcium &fenofibrate in tablet dosage

form. &fenofibrate in tablet dosage form. (Rupali

Hiravr, 2010)

A UV spectrophotometric method using

simultaneous equation was developed for the

simultaneous determination of Telmisartan and

Atorvastatin calcium in a binary mixture. In the

proposed method, the signals were measured at

296.0 nm and 247.0 nm corresponding to

absorbance maxima of Telmisartan and

Atorvastatin Calcium in methanol respectively.

Linearity range was observed in the concentration

range of 5-30 µg/ml for both the drugs.

Concentration of each drug was obtained by using

the absorptivity values calculated for both drugs

at two wavelengths, 296.0 nm and 247.0 nm and

solving the simultaneous equation. Developed

method was applied to laboratory mixture and its

pharmaceutical formulation. The method was

validated statistically and recovery study was

performed to confirm the accuracy of the method.

(Chaudhari KU, 2010)

Atorvastatin calcium(ATC) is the active

pharmaceutical ingredient (API) of the best

selling lipid-lowering formulation Lipitor.

Twelve ATC crystal forms are known and several

pharmaceutical companies are developing or have

developed generic drug formulations based on

different ATC polymorphs. The strong overlap of

the X-ray diffraction patterns (XRD) of the

polymorphs with the respective patterns of the

excipients, the presence of small API quantities in

the tablet and the similarity of the crystal phase

VIII XRD pattern used in the tablet examined in

this work to that of phases IV and IX made

identification difficult. Quantitative determination

of Atorvastatin was attempted using Raman

spectroscopy (RS), IR spectroscopy and X-ray

powder diffraction. It was found that RS

exhibited lower detection limit and a calibration

model was constructed. Its application on

commercial ATC tablets with 40mg strength

yielded an error of 1.25%. (Skoda D, 2008)

The aim of the proposed work was to

develop and validate a simple and sensitive assay

for the analysis of atorvastatin, ortho- and Para-

hydroxy-ATC, ATC lactone, and ortho- and Para-

hydroxy-ATC lactone in human plasma using

liquid chromatography tandem mass

spectrometry. All six analytes and corresponding

deuterium (d5)-labeled internal standards were

extracted from 50 μL of human plasma by protein

precipitation. The chromatographic separation of

analytes was achieved using a Zorbax-SB Phenyl

column (2.1 mm×100 mm, 3.5 μm). The mobile

phase consisted of a gradient mixture of 0.1% v/v

glacial acetic acid in10% v/v methanol in water

(solvent A) and 40% v/v methanol in acetonitrile

(solvent B). All analytes including ortho- and

Para-hydroxy metabolites were baseline separated

within 7.0 min using a flow rate of 0.35 ml/min.

Mass spectrometry detection was carried out in

positive electro spray ionization mode, with

multiple reactions monitoring scan. The

calibration curves for all analytes were linear

(R2≥0.9975, n=3) over the concentration range of

0.05–100 ng/ml and with lower limit of

quantitation of 0.05 ng/ml Mean extraction

recoveries ranged between 88.6–111%. Intra- and

inter-run mean percent accuracy was between 85–

115% and percent imprecision was≤15%.

Stability studies revealed that ATV acid and

lactone forms were stable in plasma during bench

top (6 h on ice-water slurry), at the end of three

successive freeze and thaw cycles and at −80 °C

for 3 months. The method was successfully

applied in a clinical study to determine

concentrations of ATV and its metabolites over12

h post-dose in patients receiving atorvastatin.

(Macwan JS, 2011)

A rapid, simple, sensitive and specific

LC-MS/MS method has been developed and

validated for the simultaneous estimation of

atorvastatin, amlodipine, ramipril and benazepril

using nevirapine as an internal standard. The

API-4000 LC-MS/MS was operated under the

multiple-reaction monitoring mode using electro

spray ionization. Analytes and IS were extracted

from plasma by simple liquid-liquid extraction

technique using ethyl acetate. The reconstituted

samples were chromatographed on C 18 column

by pumping 0.1% formic acid-acetonitrile (15:85,

v/v) at a flow rate of 1 ml/min. A detailed

validation of the method was performed as per

the FDA guidelines and the standard curves were

found to be linear in the range of 0.26-210 ng/ml

for ATO; 0.05-20.5 ng/ml for amlodipine( AML);



0.25-208 ng/ml for RAM and 0.74-607 ng/ml

mean correlation coefficient of ≥0.99 for each

analyte. The intra-day and inter-day precision and

accuracy results were well within the acceptable

limits. A run time of 2.5 min for each sample

made it possible to analyze more than 400 human

plasma samples per day. The developed assay

method was successfully applied to a

pharmacokinetic study in human male volunteers.

(Pilli NR, 2011)

CONCLUSION

This review is targeted at out lining the

various analytical methods and other related

aspects of atorvastatin it is however pertinent to

state that newer analytical methods are being

developed with respect to advancing technology

and this may necessitate a future review.

REFERENCES

Bisulphate in Capsules, Indian J Pharm Sci,

73(1), 2011, 23-9.

Chaudhari KU P.D. Gaikwad, V.H. Bankar and

S.P. Pawar, Development and validation of uv-

spectrophotometric method for simultaneous

estimation of telmisartan and atorvastatin calcium

in bulk and tablet dosage form,

Inj.Jour.PharmTech, 2(1), 2010, 255-264.

Jain N, Raghuwanshi R, Jain D.

Development and Validation of RP-

HPLC method for simultaneous

estimation of Atorvastatin Calcium and

Fenofibrate in tablet dosage forms,

Indian J Pharm Sci, 70, 2008, 263-5.

Joseph L, George M, Rao B VR, Simultaneous

estimation of atorvastatin and ramipril by RP-

HPLC and spectroscopy, Pak J Pharm Sci, 21(3),

2008, 282-4.

Kadav AA, Vora DN. Stability indicating UPLC

method for simultaneous determination of

atorvastatin, fenofibrate and their degradation

products in tablets, J Pharm Biomed Anal, 48(1),

2008, 120-6.

Londhe SV, Deshmukh RS, Mulgund SV, Jain

KS, Development and Validation of a Reversed-

phase HPLC Method for Simultaneous

Determination of Aspirin, Atorvastatin Calcium

and Clopidogrel

Macwan JS, Ionita IA, Dostalek M, Akhlaghi F.

Development and validation of a sensitive,

simple, and rapid method for simultaneous

quantitation of atorvastatin and its acid and

lactone metabolites by liquid chromatography-

tandem mass spectrometry (LC-MS/MS), Anal

Bioanal Chem, 400(2), 2011, 423-33.

Mishra P Alkagupta and K. Shah, Simultaneous


besylate from tablets, Indian journal of

pharmaceutical sciences, 69(6), 2007, 831-833.

Nováková L, Lopéz SA, Solichová D, Satínský

D, Kulichová B, Horna A, Solich P, Comparison

of UV and charged aerosol detection approach in

pharmaceutical analysis of statins, Talanta, 78(3),

2009, 834-9.

Panchal HJ, Suhagia BN, Simultaneous

determination of atorvastatin calcium and

ramipril in capsule dosage forms by high-

performance liquid chromatography and high-

performance thin layer chromatography, J AOAC

Int, 93(5), 2010, 1450-7.

Patil UP S. V. Gandhi M. R. Sengar, V. S.

Rajmane A, Validated densitometric method for

analysis of telmisartan and atorvastatin calcium in

fixed dose combination, J. Chil. Chem. Soc.,

55,2010,94-96.

Patole S, Khodke A, Potale L, Damle M, A

validated densitometric method for analysis of

atorvastatin calcium and Metoprolol Tartarate as

bulk drugs and in combined capsule dosage

forms, J Young Pharm, 3(1), 2011, 55-9.

Pilli NR, Inamadugu JK, Mullangi R, Karra VK,

Vaidya JR, Rao JV, Simultaneous determination

of atorvastatin, amlodipine, ramipril and

benazepril in human plasma by LC-MS/MS and

its application to a human pharmacokinetic study,

Biomed Chromatogr, 25(4), 2011, 439-49.

Rupali Hirave, Ravindra Bendagude, Manish

Kondawar, RP-HPLC method for simultaneous

estimation of Atorvastatin Calcium and

Fenofibrate in tablet dosage forms, Journal of

Pharmacy Research, 3(10), 2010, 2400-2401



Shah DA, K.K Bhatt, R.S Mehta, S.L Baldania

and T.R Gandhi, Stability indicating RP HPLC


besylate in pharmaceutical formulations. Indian

journal of pharmaceutical sciences, 70(6), 2008,

754-760.

Shah Y, Iqbal Z, Ahmad L, Khan A, Khan MI,

Nazir S, Nasir F, Simultaneous determination of

rosuvastatin and atorvastatin in human serum

using RP-HPLC/UV detection: method

development, validation and optimization of

various experimental parameters, J Chromatogr B

Analyt Technol Biomed Life Sci, 879(9-10),

2011, 557-63

Skoda D, Kontoyannis CG, Identification and

quantitative determination of atorvastatin calcium

polymorph in tablets using FT-Raman

spectroscopy, Talanta, 74(4), 2008, 1066-70.

Stanisz B, Kania L, Validation of HPLC method

for determination of atorvastatin in tablets and for

monitoring stability in solid phase, Acta Pol

Pharm, 63(6), 2006, 471-6.

Suresh Kumar GV, Rajendraprasad Y,

Chandrashekar SM, Development and validation

of reversed-phase HPLC method for simultaneous

estimation of Atorvastatin calcium and

Telmisartan in tablet dosage form, International

Journal of Pharma Tech Research, 2(1), 2010,

463-470.

Tripathi KD, Essentials of medical

pharmacology, sixth edition, Jaypee publication,

2008, 614-615.

Praveen and Ranadheer Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of

testicular cancer Praveen D*, Ranadheer Chowdary P

School of Pharmaceutical Sciences, Vels University

*Corresponding author: Email.id: [email protected], +919940510419

ABSTRACT

Combination chemotherapy with vinblastine plus bleomycin in disseminated testicular cancer was

pioneered by Samuels and represented a major therapeutic advance (Samuels ML, 1976). Another

milestone in the chemotherapy of testicular cancer was the discovery of the activity of cis-diammine

dichloro platinum (CDDP) in germinal neoplasm. Complete response rates between 60-80% have been

reported for patients with advanced disease and the vast majority of these patients are cured of their

disease as the relapse rates are less than 15% (Robert F, 1983). This discovery has led to a new and better

chemotherapeutic combination in the treatment of testicular cancer. For the first time, in a random

prospective cooperative group clinical trial evaluating the effectiveness of three Chemotherapy

combinations in the treatment of a solid tumor, in which the dose of one drug is the only treatment

variable, a clear-cut relationship has been shown for dose of therapy, not only with response and survival,

but with an increased potential for cure as well. Their plasma half-lives, pharmacokinetic parameters,

toxicities, adverse drug effects were also evaluated in various studies. This combination have been proved

better than Bleomycin-cisplatin-etoposide as the former combination masks the toxic effects of bleomycin

such as mucositis etc. Thus we conclude that this combination is a safer one with a good therapeutic

efficacy and reduced toxicity.

Key Words: Combination chemotherapy, bleomycin, cisplatin, testicular cancer

INTRODUCTION

Testicular cancer is a cancer that develops in

the testicles, a part of the male reproductive system.

Testicular cancer has one of the highest cure rates of

all cancers: a five-year survival rate in excess of 90 %

overall, and almost 100 % if it has not spread

(metastasized). Even for the relatively few cases in

which malignant cancer has spread widely,

modern chemotherapy offers a cure rate of at least

80%. One of the first signs of testicular cancer is often

a lump or swelling in the testes. The three basic types

of treatment are surgery, radiation therapy,

and chemotherapy. Surgery is performed

by urologists; radiation therapy is administered

by radiation oncologists; and chemotherapy is the

work of medical oncologists. In most patients with

testicular cancer, the disease is cured readily with

minimal long-term morbidity. While treatment

success depends on the stage, the average survival rate

after five years is around 95%, and stage 1 cancers

cases (if monitored properly) have essentially a 100%

survival rate (which is why prompt action, when

testicular cancer is a possibility, is extremely

important)

Testicular cancer: Testicular cancer is a disease in

which cells become malignant (cancerous) in one or

both testicles. The testicles (also called testes or

gonads) are a pair of male sex glands. They produce

and store sperm and are the main source of

testosterone (male hormones) in men. These hormones

control the development of the reproductive organs

and other male physical characteristics. The testicles

are located under the penis in a sac-like pouch called

the scrotum. Based on the characteristics of the cells

in the tumor, testicular cancers are classified as

seminomas or nonseminomas. Other types of cancer

that arise in the testicles are rare and are not described

here. Seminomas may be one of three types: classic,

anaplastic, or spermatocytic. Types of nonseminomas

include choriocarcinoma, embryonal carcinoma,

teratoma, and yolk sac tumors. Testicular tumors may

contain both seminoma and nonseminoma cells.

Epidemiology: Testicular cancer accounts for only

1% of all cancers in men in the United States. About

8,000 men are diagnosed with testicular cancer, and

about 390 men die of this disease each year. Testicular

cancer occurs most often in men between the ages of

20 and 39, and is the most common form of cancer in

men between the ages of 15 and 34. It is most

common in white men, especially those of

Scandinavian descent. The testicular cancer rate has

more than doubled among white men in the past 40

years, but has only recently begun to increase among

black men. The reason for the racial differences in

incidence is not known.

Risk Factors:

Undescended testicle (cryptorchidism): Normally,

the testicles descend from inside the abdomen into the


http://en.wikipedia.org/wiki/Cancer

http://en.wikipedia.org/wiki/Testicle

http://en.wikipedia.org/wiki/Male

http://en.wikipedia.org/wiki/Metastasis

http://en.wikipedia.org/wiki/Chemotherapy

http://en.wikipedia.org/wiki/Surgery

http://en.wikipedia.org/wiki/Radiation_therapy

http://en.wikipedia.org/wiki/Chemotherapy

http://en.wikipedia.org/wiki/Urologist

http://en.wikipedia.org/wiki/Radiation_oncologist

http://en.wikipedia.org/wiki/Oncologist

http://en.wikipedia.org/wiki/Morbidity



scrotum before birth. The risk of testicular cancer is

increased in males with a testicle that does not move

down into the scrotum. This risk does not change even

after surgery to move the testicle into the scrotum.

The increased risk applies to both testicles.

Congenital abnormalities: Men born with

abnormalities of the testicles, penis, or kidneys, as

well as those with inguinal hernia (hernia in the groin

area, where the thigh meets the abdomen), may be at

increased risk.

History of testicular cancer: Men who have had

testicular cancer are at increased risk of developing

cancer in the other testicle.

Family history of testicular cancer: The risk for

testicular cancer is greater in men whose brother or

father has had the disease.

Symptoms: Common symptoms are painless lump or

swelling in a testicle, pain or discomfort in a testicle

or in the scrotum, any enlargement of a testicle or

change in the way it feels, a feeling of heaviness in the

scrotum, a dull ache in the lower abdomen, back, or

groin, a sudden collection of fluid in the scrotum.

Diagnosis: Blood tests that measure the levels of

tumour markers. Tumour markers are substances often

found in higher-than-normal amounts when cancer is

present. Tumour markers such as alpha-fetoprotein

(AFP), Beta-human chorionic gonadotropin (HCG),

and lactate dehydrogenase (LDH) may suggest the

presence of a testicular tumor, even if it is too small to

be detected by physical exams or imaging tests.

Ultrasound: A test in which high-frequency sound

waves are bounced off internal organs and tissues.

Their echoes produce a picture called a sonogram.

Ultrasound of the scrotum can show the presence and

size of a mass in the testicle. It is also helpful in ruling

out other conditions, such as swelling due to infection

or a collection of fluid unrelated to cancer.

Biopsy: Biopsy (microscopic examination of

testicular tissue by a pathologist) to determine whether

cancer is present. In nearly all cases of suspected

cancer, the entire affected testicle is removed through

an incision in the groin. This procedure is called

radical inguinal orchiectomy.

Treatment: Chemotherapy is the use of anticancer

drugs to kill cancer cells. When chemotherapy is

given to testicular cancer patients, it is usually given

as adjuvant therapy (after surgery) to destroy

cancerous cells that may remain in the body.

Chemotherapy may also be the initial treatment if the

cancer is advanced; that is, if it has spread outside the

testicle at the time of the diagnosis. Most anticancer

drugs are given by injection into a vein.

Chemotherapy is a systemic therapy, meaning drugs

travel through the bloodstream and affect normal as

well as cancerous cells throughout the body. The side

effects depend largely on the specific drugs and the

doses. Common side effects include nausea, hair loss,

fatigue, diarrhea, vomiting, fever, chills,

coughing/shortness of breath, mouth sores, or skin

rash. Other side effects include dizziness, numbness,

loss of reflexes, or difficulty hearing. Some anticancer

drugs also interfere with sperm production. Although

the reduction in sperm count is permanent for some

patients, many others recover their fertility. Some men

with advanced or recurrent testicular cancer may

undergo treatment with very high doses of

chemotherapy. These high doses of chemotherapy kill

cancer cells, but they also destroy the bone marrow,

which makes and stores blood cells. Such treatment

can be given only if patients undergo a bone marrow

transplant. In a transplant, bone marrow stem cells are

removed from the patient before chemotherapy is

administered. These cells are frozen temporarily and

then thawed and returned to the patient through a

needle (like a blood transfusion) after the high-dose

chemotherapy has been administered.

Combination therapy: Bleomycin is a

glycopeptide antibiotic with a unique mechanism of

antitumor activity. The drug binds to guanosine-

cytosine-rich portions of DNA via association of the

"S" tripeptide and by partial intercalation of the

bithiazole rings. A group of five nitrogen atoms

arranged in a square-pyramidal conformation binds

divalent metals including iron, the active ligand, and

copper, an inactive ligand. Molecular oxygen, bound

by the iron, can produce highly reactive free radicals

and Fe(III). The free radicals produce DNA single-

strand breaks at 3'-4' bonds in deoxyribose. This

yields free base propenals, especially of thymine:

cytotoxicity is cell-cycle-phase specific for G2 phase.

In humans, bleomycin is rapidly eliminated primarily

by renal excretion. This accounts for approximately

half of a dose. In patients with renal compromise or

extensive prior cisplatin therapy, the drug half-life can

extend from 2 to 4 hours up to 21 hours. Thus, dose

adjustments are needed when creatinine clearance is

less than or equal to 3N mL/min (Dorr RT, 1992).

Platinum complexes are clinically used as adjuvant

therapy of cancers aiming to induce tumor cell death.

Depending on cell type and concentration, cisplatin

induces cytotoxicity, e.g., by interference with

transcription and/or DNA replication mechanisms.

Additionally, cisplatin damages tumors via induction



of apoptosis, mediated by the activation of various

signal transduction pathways, including calcium

signalling, death receptor signalling, and the

activation of mitochondrial pathways. Unfortunately,

neither cytotoxicity nor apoptosis are exclusively

induced in cancer cells, thus, cisplatin might also lead

to diverse side-effects such as neuro- and/or renal-

toxicity or bone marrow-suppression. Moreover, the

binding of cisplatin to proteins and enzymes may

modulate its biochemical mechanism of action ( Ana-

Maria Florea 2011).

There are two high affinity vinblastine-

binding sites per mole of embryonic chick brain

tubulin (KA = 3-5 X 10(5) l./mol). Binding to these

sites was rapid, and relatively independent of

temperature between 37 and 0degreeC. Vincristin

sulfate and desacetylvinblastine sulfate, two other

active vinca alkaloid derivatives, competitively

inhibited the binding of vinblastine. The inhibition

constant for vincristine was 1.7 X 10(-5) M; and for

desacetylvinblastine, 2 X 10(-5) M. The vinblastine

binding activity of tubulin decayed upon aging, but

this property was not studied in detail. Vinblastine did

not depolymerize stable sea urchin sperm tail outer

doublet microtubules, nor did it bind to these

microtubules (Wilson L , 1975). Since 1974, with the

introduction of platinum-based combination

chemotherapy, the complete response rate of patients

with metastatic germ cell neoplasms of the testis has

improved from 10%-30% to 50%-75%. Furthermore,

a significant proportion of patients entering complete

remission are relapse free after 2 years, and may be

considered cured of their disease. Important

prognostic factors predicting for complete response

include initial performance status, tumor histology,

and tumor burden at presentation.

Numerous in vivo studies of antitumor agents

exposed to a variety of transplantable experimental

tumors have indicated a steep dose-response and dose-

toxicity. These observations apply to both cell cycle

specific as well as non-cell-specific agents. In tumors

composed of a heterogenous cell population with both

drug-sensitive and drug-resistant subpopulations the

dose response curve is modified, depending on the

ratio of resistant to sensitive fraction. While there are

few prospective randomized clinical trials addressing

dose as a treatment variable, there appears to be a

confirmation of the fore mentioned concepts in

Hodgkin's and certain non-Hodgkin's lymphoma,

acute lymphocytic leukaemia, and oat cell carcinoma

of the lung, all regarded as chemotherapy-"sensitive"

turners (Michael K, 1984). Previous clinical trials in

testicular cancer incorporating cisplatin (DDP) have

employed either “high-dose’’ (100- 120 mg/m2) or

“low dose” (75 mg/m2) schedules without a clear

definition of dose response testicular cancer is

regarded as a “sensitive” tumor, the Southwest

Oncology Group (SWOG) initiated, in 1978, a

prospective randomized Phase III comparative trial in

which the primary objective was to determine whether

a high dose of DDP (cisplatin) when combined with

vinblastine and bleomycin resulted in a superior

response and survival experience than a lower dose of

DDP with the same combination of vinblastine and

bleomycin (Lawrence H Einhorn, 1980).

CONCLUSION

Platinum, vinblastine, bleomycin combination

chemotherapy consistently produces 70% complete

remissions, and a further 10% of patients will be

rendered disease free following surgical excision of

residual disease. For the first time, in a random

prospective cooperative group clinical trial evaluating

the effectiveness of two chemotherapy combinations

in the treatment of a solid tumour, in which the dose

of one drug is the only treatment variable, a clear-cut

relationship has been shown for dose of therapy, not

only with response and survival, but with an increased

potential for cure as well. Historically, testicular

cancer was one of the first malignancies of non-

hematologic origin in which long-term survival, and

cure, could be achieved with combination

chemotherapy (Lawrence H Einhorn, 1980; Robert F

Ozols, 1983; Michael K. Samson, 1984).

REFERENCES

Ana-Maria Florea and Dietrich Büsselberg, Cisplatin

as an Anti-Tumor Drug: Cellular Mechanisms of

Activity, Drug Resistance and Induced Side Effects,

Cancers, 2011, 3, 1351-1371

Dorr RT, Bleomycin pharmacology: mechanism of

action and resistance, and clinical pharmacokinetics.

Semin Oncology, 1992, 19 (2 Suppl 5), 3-8.

Lawrence H Einhorn, and Stephen D, Chemotherapy

of disseminated testicular cancer -a random

prospective study, Cancer, 46, 1980, 1339- 1344.

Michael K Samson, Dose-response and dose-survival

advantage for high versus low-dose cisplatin

combined with vinblastine and bleomycin in

disseminated testicular cancer, Cancer, 53, 1029-1035,

1984.

Robert F Ozols, Treatment of poor prognosis

nonseminomatous testicular cancer with a "high-dose"

platinum combination chemotherapy regimen, Cancer,

51, 1983, 1803-1807.

http://www.ncbi.nlm.nih.gov/pubmed/1384141



Samuels ML, Lanzotti VJ, Holoye PY, Boyle LE,

Smith TL, Johnson DE, Combination chemotherapy in

germinal cell tumors, Cancer Treat Rev, 3, 1976, 185-

204.

Wilson L, Creswell KM, Chin D, The mechanism of

action of vinblastine, Biochemistry, 30;14(26), 1975,

5586-92.

Wozniak AJ, A randomized trial of cisplatin,

vinblastine, and bleomycin versus vinblastine,

cisplatin, and etoposide in the treatment of advanced

germ cell tumors of the testis: a Southwest Oncology

Group study, Journal of clinical oncology, 1991, 9(1),

70-76.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilson%20L%5BAuthor%5D&cauthor=true&cauthor_uid=1203244

http://www.ncbi.nlm.nih.gov/pubmed?term=Creswell%20KM%5BAuthor%5D&cauthor=true&cauthor_uid=1203244

http://www.ncbi.nlm.nih.gov/pubmed?term=Chin%20D%5BAuthor%5D&cauthor=true&cauthor_uid=1203244


Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Method development and validation for the simultaneous estimation of Ofloxacin

and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC

method Y.Bhargav*, K Haritha Pavani, S Amareswari

Nimra College of Pharmacy, Vijayawada, A.P, India

*Corresponding author: Email: [email protected]; Phone no: 8466941272

ABSTRACT

A new, simple, accurate, rapid, precise RP-HPLC method was developed for the simultaneous

estimation of ofloxacin and tinidazole in bulk and pharmaceutical dosage form. A good chromatographic

separation was achieved with Intersil ODS C18 (250×4.6mm.5µ) column and ammonium acetate buffer

pH 4.0, acetonitrile, and tetrahydrofuran 60:30:10 was used as mobile phase at a flow rate of 1.0ml/min

and the detection was carried out at a wavelength of 304 nm. The retention times was found to be 2.350

min for ofloxacin and 3.613 min for tinidazole. The linearity of the method was in the concentration range

of 15-35µg/mL for ofloxacin and 45-105µg/mL for tinidazole. The developed method was validated for

system suitability, specificity, precision, recovery and linearity according to ICH guidelines. The method

was successfully applied for routine analysis for the determination of oflaxacin and tinidazole in bulk and

dosage forms.

Key Words: Oflaxacin, Tinidazole, RP-HPLC, Validation.

INTRODUCTION

Ofloxacin was chemically (RS) 9-fluoro-2,

3dihydro-3-methyl-10-(4methl-1-piperazinyl)-7- oxo-

7H-prido [1, 2, 3-de]-1, 4benzoxazine-6-carboxylic

acid. Ofloxacin belongs to class of drugs called

quinolone antibiotics. Ofloxacin is a broad spectum

antibiotic that is active against both Gram-positive and

Gram-negitive. It inhibition of topoisomrase enzymes,

which inhibits relaxation of supercoild DNA and

promotes breakage of double stranded DNA. It is

used to treat a variety of bacterial infections.

Tinidazole was chemically 1-[ethanesulfonyl)

ethyl]-2-methyl-5-nitro-1H-imidazole. Tinidazole is

Antiprotozoal, Antibacterial agent. The nitro-group of

tinidazole is reduced by cell extracts of trichomonas.

The free nitro-radical generated as a result of this

reduction may be responsible for antiprotozoal

activiiaty. Chemically reduced Tinidazole was shown

to release nitrites and cause damage to purified

bacterial DNA in vitro.

Literature survey revealed that very few

methods have been reported for the analysis of

Ofloxacin and Tinidazole combinational dosage forms

which include UV spectroscopy, Reverse Phase High

performance Liquid Chromatography, HPTLC

methods. The present study illustrate development and

validation of simple, economical, selective, accurate,

precise RP-HPLC method for the determination of

Ofloxacin and Tinidazole in bulk and Pharmaceutical

dosage forms as per ICH guidelines.


Shimadzu HPLC equipped with spinchrome

software, Elico UV-Spectrophotometer, Intersil ODS

C18 column (250×4.6mm.5µ), polmon pH Meter,

Weighing Balance Ax200 Shimadzu, LAB INDIA

Sonicator, rheodyne injector.

Preparation of mobile phase: 1.925g of Ammonium

acetate was accurately weighed and dissolved in

500ml of distilled water. The pH of the buffer was

adjusted to 4.0 with ortho phosphoric acid. A suitable

quantity of degassed mixture of pH4.0 Ammonium

acetate buffer, Acetonitrile, Tetra hydro furan in the

ratio of 60:30:10 was prepared and filtered through

0.45µ filter under vacuum filtration.

Preparation of standard stock solution: Accurately

weighed 10mg of Ofloxacin and 10mg of Tinidazole

into a 10ml volumetric flasks and 10ml of diluents

Ammonium acetate Buffer

pH4.0:ACN:THF(60:30:10) was added and sonicated

for 5min and make up to the volume with diluent.

From the stock 1ml of the solution was taken and

diluted to 10ml to get a concentration of 100µg/ml

solution from the above solution 2ml of Ofloxacin and

6ml of Tinidazole and mixed and injected.

Preparation of sample: Twenty tablets were weighed

and powdered the powder equivalent to 25mg of

Ofloxacin and 75mg of Tinidazole were weighed and

taken into a 200ml volumetric flask. To this 50ml of

diluents was added and sonicated for 15min to

dissolve the drugs then made up the volume to

required volume with the diluents. From this solution

5ml was taken into a 50ml flask and made up to final

volume with diluents to get a concentration of

100ppm filtered through 0.45µ filter under vacuum

filtration. From this stock solution further dilutions

were made for the validation of the method developed.





Optimized method development: Various

experimental conditions were carried out to achieve

the best chromatographic conditions for the

simultaneous determination of the drug substances.

Several column types and lengths were tried for better

elution and for chromatographic parameters. A good

chromatographic separation was achieved with Intersil

ODS C18 (250×4.6mm.5µ) column and ammonium

acetate buffer pH 4.0, acetonitrile and tetrahydrofuran

60:30:10 was used as mobile phase at a flow rate of

1.0ml/min and the detection was carried out at a

wavelength of 304nm. The retention times was found

to be 2.350min for oflaxacin and 3.613min for

tinidazole.

System suitability: From the system suitability

studies it was observed that theoretical plates were

found to be more than 2125 for Ofloxacin and 3873

for Tinidazole. USP tailing factor was found to be

1.76 for Ofloxacin and 1.72 for Tinidazole. All the

parameters were within the limit. The results of

system suitability studies were given in Table.1 and

the standard Chromatograms can be were shown in

the Figure.1.

Specificity: The Chromatograms of Standard and

Sample are identical with nearly same Retention time.

There is no interference with blank and placebo to the

drugs. The results were tabulated in the Table.2. The

chromatograms were shown in the Figures 2,3,4 for

standard, sample, blank and placebo.

Linearity: From the Linearity data it was observed

that the method was showing linearity in the

concentration range of 15-35μg/ml for Ofloxacin and

45-105μg/ml for Tinidazole. Correlation coefficient

was found to be 0.999 and 0.998 for both the

compounds. The linearity data was tabulated in

Table.3. The Chromatograms for the linearity data

were shown in the fig no: and the linearity curve was

plotted and given in the Figures 5,6.

Accuracy: The recoveries of pure drug from the

analyzed solution of formulation were 100.81 % for

Ofloxacin and 99.15 % for Tinidazole, which shows

that the method was accurate. The results were

tabulated in the Table.4.

The chromatograms were shown in the Figure.7.

Precision: The %RSD for the sample chromatograms

of method precision were found to be 0.52 & 0.73 for

Ofloxacin and 0.41 &0.35 for Tinidazole. Hence it

passes method precision. The results were tabulated in

the Table.5. The chromatograms were shown in the

Figure.8.

Assay: The %assay of the Ofloxacin was found to be

99.87% and for Tinidazole 99.23%. The results were

tabulated in the Table.6. The chromatograms were

shown in the Figures 9,10.

Ruggedness: Comparison of both the results obtained

for two different Analysts shows that the method was

rugged for Analyst-Analyst variability. The system

suitability parameters of Ruggedness were found to be

within the limits and were tabulated in Table.7. The

Chromatograms for ruggedness were shown in

Figures 11,12.

Robustness: All the system suitability parameters are

within limits for variation in flow rate (±0.2 ml) and

for variation in the wavelength (±2nm).

Forced degradation studies: A forced degradation

study is an important step in drug development

process to observe the drug products stability. An

attempt has been made to stress the drug products to

acid hydrolysis by using 0.1N HCl, base hydrolysis by

using 0.1N NaoH, oxidative degradation by using 1%

H2O2, thermal treatment heated at 800c, photolytic

degradation for 4hrs to evaluate the stability of the

propose method to separate the drugs and its

degradation products. The results were tabulated in

the Table: 8 The chromatograms were shown in the

Figures 13,14,15,16,17.

Chemical structure of ofloxacin Chemical structure of tinidazole

Table.1.System suitability data for Ofloxacin and Tinidazole

Parameters Ofloxacin Tinidazole Acceptance Criteria

Retention Time 2.350 3.613 -

Theoretical plates 2125 3873 >2000

Asymmetry 1.769 1.724 <2

Resolution 5.793 -



Table.2. Specificity Data for Ofloxacin and Tinidazole

Ofloxacin Tinidazole

Standard

Retention

time

Area Theoretical

Plates

Retention

time

Area Theoretical

Plates

2.88 314.464 4039 4.140 884.734 5918

2.80 295.781 3817 4.040 850.497 5636

2.88 326.538 4039 4.140 891.542 5918

Sample

2.80 298.113 3817 4.040 863.317 5636

2.88 328.148 4039 4.140 887.046 5918

2.78 303.004 3763 4.003 851.318 5534

Blank - - - - - -

Table.3. Linearity data for Ofloxacin and Tinidazole:


Mcg/ml Area Rt Mcg/ml Area Rt

15 160.368 2.750 45 473.440 3.953

20 212.082 2.740 60 589.513 3.940

25 281.411 2.800 75 776.017 4.140

30 350.32 2.733 90 928.174 3.933

35 319.149 2.727 105 1065.057 3.920

Table.4. Accuracy Data For Ofloxacin and Tinidazole

Drug %level Amount

added (mcg)

Amount found

(mcg)

Avg

% reecovery

Mean

%recovery

Ofloxacin

80 25 25.43 101.73

100.81 100 30 30.50 101.67

120 35 34.67 99.05

Tinidazole

80 75 74.03 98.71

99.15 100 90 89.39 99.32

120 105 104.39 99.42

Table.5. Precision data for Ofloxacin and Tinidazole

Ofloxacin Tinidazole Rt Area Rt Area

2.83 300.079 4.014 857.704

2.833 298.969 4.012 851.606

2.800 302.438 4.040 857.331

2.812 296.614 4.003 858.53

2.823 297.816 4.008 852.506

2.800 301.438 4.040 857.331

Table.6.Assay data for Ofloxacin and Tinidazole

Ofloxacin Tinidazole Standard Area Sample area Standard Area Sample area

301.472 290.755 831.425 831.363 300.928 302.911 835.201 827.911 301.613 303.766 827.911 828.218 301.472 308.66 831.845 834.333 306.062 303.37 842.884 828.432 %Assay 99.87% 99.23%



Table.7.Ruggedness data of Ofloxacine and Tinidazole


Area Retention time Area Retention time

Actual 3532.65 2350 4312.863 3.613

Analyst 1

Analyst 2 312.858 2.780 833.419 4.003 306.953 2.717 836.314 3.930

Analyst 1

Analyst 2 308.838 2.717 841.567 3.930 305.234 2.780 852.013 4.003

Table No: 8 Forced degradation data for Ofloxacin and Tinidazole

Stress Conditions Time (hrs) Retention Time

(hrs)

Time

(hrs)

Retention Time (hrs)

As such 4hrs 2.350 4hrs 3.613

Acid Hydrolysis (0.1 N, at RT) 4hrs 2.703 4hrs 3.907

Base Hydrolysis (0.1 N, at RT) 4hrs 2.663 4hrs 3.873

Oxidation (1% H2O2 at RT) 4hrs 2.703 4hrs 3.907

Photolysis (UV light at 254nm at RT) 4hrs 2.663 4hrs 3.873

Thermal (at 800C) 4hrs 2.663 4hrs 3.873

Table.9. Summary of validated parameters of Ofloxacin and Tinidazole

Parameters Ofloxacin Tinidzole

Linearity 15-35µg/ml 45-105 µg/ml

Correlation Coefficient(r2) 0.999 0.998

Slope(m) 11.3 11.234

Intercept(c) 11.0793 68.5073

Precision (%RSD) 0.52,0.73 0.41,0.35

Accuracy 100.81% 99.15%

LOD 2.31 7.06

LOQ 6.99 21.41

Assay % 99.87% 99.23%

Figure.1.Data for System suitability Figure.2.Chromatogram for blank

Figure.3.Data for Specificity standard Figure.4.Data for Specificity sample



Figure.5.Linearity plot for Ofloxcin Figure.6.Linearity plot for Tinidazole

Figure.7.Data for Recovery Figure.8.Data for Precision

Figure.9.Data for Assay (standard) Figure.10. Data for Assay (sample)

Fig No:11 Data for Ruggedness (standard) Fig No:12 Data for Ruggedness (sample)

y = 11.3x + 11.234 r² = 0.999

0

50

100

150

200

250

300

350

400

450

0 1 2 3 4 5 6

Are

a

Conc

Linearity of Ofloxacin y = 11.0793x + 68.5073

r² = 0.998

0

200

400

600

800

1000

1200

0 1 2 3 4 5 6

Are

a

Conc

Linearity of Tinidazole



Fig No:13 Acid Degradation Fig No:14 Base Degradation

FigNo:15 Peroxide Degradation FigNo:16 Thermal Degradation

Fig No: 17 Photolysis Degradation

CONCLUSION

Finally it concludes that all the parameters are

within the limits and meet the acceptance criteria of

ich guidelines for method validation. The proposed

method was simple, accurate, specific, precise, robust,

rugged and economical. Hence this method is

validated and can be used for routine and stability

sample analysis.

ACKNOWLEDGMENT

The authors would like to thank all the staff of

nimra college of pharmacy, beloved parents and all

my well wishers, one and all who have helped me

directly and indirectly in completing this project work.

REFERENCES

B Dhandapani, Method development and validation

for the simultaneous estimation of Ofloxacin and

Ornidazle tablet dosage form, Indian journal of

pharmaceutical sciences and research, 1(1), 2010, 78-

83.

M Rama Kotaiah, Shaik Harun Rasheed, Y Narasimha

Rao, Y Venkateswarlu, Konda Ravi Kumar,

Simultaneous estimation of Ofloxacin and Tinidazole

in tablet dosage form by RP-HPLC, Research journal

of pharmaceutical, biological and chemical sciences,

1(4), 2010, 460-466.

Maduri D Game and D.M Sakarkar, Simultaneous

spectrophotometric estimation of Nitazoxinide and

Ofloxcin in tablets, Indian Pharma Sciences, 73(1),

2011, 70-74.

Manisha Puranik, DV Bhawsar Prachi Rathi, PG

Yeole, Simultaneous determination of Ofloxacin and

Ornidazole in solid dosage form by RP-HPLC and

HPTLC techniques, Indian journal of pharmaceutical

sciences, 2(4), 2010, 513-517.

Nargesh Keshar, Kareti Srinivasa Rao, Arijit

Banerjee, Spectrophotometric methods for

simultaneous estimation of Ofloxacin and Tinidazole

in bulk and pharmaceutical dosage forms, Chronicle

of young scientists, 2(2), 2011, 98-102.

Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Evaluation of nephro protective activity of methanolic extract of seeds of Vitis

vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in

wistar rats Kalluru Bhargavi*,

N Deepa Ramani, Janarthan M, Duraivel S

Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India.

*Corresponding author: [email protected]

ABSTRACT

The Objective of the study was to investigate the nephroprotective activity of methanolic extract of

seeds of Vitisvinifera (family:vitaceae) against rifampicin induced and carbontetrachloride induced kidney

damage in rats.Male albino wistar rats (150-250gm) were selected and divided in to six groups of six

animals each. Group 1 served as normal control, group 2 served as positive control, group 3 served as

standard, group 4 was treated with MEVV (low dose) and group 5 was treated with MEVV (high dose).

The same grouping was followed for both models (rifampicin and carbon tetra chloride). Inducing agents

are given 3 days once for two weeks to induce nephrotoxicity. The results are evidenced on the basis of

physical, biochemical and histological parameters. One-way analysis of variance followed by tukey’s

multiple comparison tests were used for statistical analysis.Rifampicin and carbontetrachloride produced

significant changes in physical (decreased liver and body weight), biochemical (increased levels of total

protein, uric acid, urea, and creatinine), and histological parameters in rats. Pretreatment with MEVV and

standard drug cystone significantly prevented the physical, biochemical and histological changes

produced by rifampicin and carbon tetrachloride toxicity. Results of the present study suggest that MEVV

has a significant nephroprotective activity probably by acting against free radicals.

Key words: Vitis vinifera, nephrotoxicity, rifampicin, carbontetrachloride, biochemical parameters etc.

INTRODUCTION

Nephrotoxicity is one of the most common

kidney problems and occurs when body is exposed to

a drug or toxin. When kidney damage occurs, body

unable to rid of excess urine and wastes from the body

and blood electrolytes (such as potassium and

magnesium) will all become elevated (Ramyapydi,

2011).A number of therapeutic agents can adversely

affect the kidney resulting in acute renal failure,

chronic interstitial nephritis and nephritic syndrome.

Because of the increasing number of potent

therapeutic drugs like aminoglycoside antibiotics,

chemotherapeutic agents and NSAIDS have been

added to the therapeutic arsenal in recent years.

Exposure to chemical reagents like ethylene glycol,

carbon tetrachloride, sodium oxalate and heavy metals

like lead, mercury, arsenic and cadmium also induces

nephrotoxicity which leads to acute kidney injury

(AKI).

MATERIALS AND METHODS:

Materials: All chemicals were of analytical grade and

obtained locally. Creatinine,totalprotein,urea and uric

acid kit were procured from Robonik diagnostics,

Hyderabad, India.

Plant material: The fresh seeds Vitisvinifera were

collected from Kadapa District; A.P. Identification of

the plant was done by Dr. SreedharMurty, Assistant

Professor, Department of Botany, Government

College of Arts, Kadapa, A.P, India.

Animals: Healthy adult male wistar rats weighing

between 150-250gm were used for the present study.

The animals were housed in groups of six and

maintained under standard conditions (27±2ºC,

relative humidity 44 - 56% and light and dark cycles

of 10 and 14 hours respectively) and fed with standard

rat diet and purified drinking water ad libitum for 1

week before and during the experiments.

Preparation of the extract: The dried flowers of V.

viniferawas collected, cleaned, dried and powdered in

a grinder - mixer to obtain a coarse powder and then

passed through 40 mesh sieve. About 1000 gm of

powdered drug was extracted with aqueous methanol

by soxhlet apparatus. The extraction was carried out

until the drug becomes exhausted. The solvent was

recovered from their extract by distillation under

reduced pressure. The dried extract thus obtained was

kept in a desicator and was used for further

experiments.

Induction of nephrotoxicity in rats: Rifampicin

(1000mg/kg) was dissolved in distilled water and

administered orally to rats for 14 consecutive days at

an interval of 72 hrs to induce experimental nephro

toxicity in rats.

CCl4 (1ml/kg) was dissolved in olive oil and

injected intraperitoneally to rats for 14 consecutive

days at an interval of 24 hrs to induce experimental

nephro toxicity in rats.




Rifampicin induced nephrotoxicity: The

experimental animals were randomly divided in to 5

groups (n= 6) and treated for duration of 14 days as

per the treatment schedule given in table no: 3.

Nephrotoxicity was induced by administration of

Rifampicin (1000 mg/kg oral) three days once for two

weeks. Methanolic extract of V. vinifera was freshly

suspended in distilled water and administered to

animals by oral feeding needle.

Carbon tetra chloride induced nephrotoxicity: The

experimental animals were randomly divided in to 5

groups (n= 6) and treated for duration of 15 days as

per the treatment schedule given in table no: 4.

Nephrotoxicity was induced by injected

intraperitoneally of ccl4 (1ml/kg i.p) with olive oil

every day for two weeks. Methanolic extract of V.

viniferawas freshly suspended in distilled water and

administered to animals by oral feeding needle.

Treatment schedule Evaluation of

nephroprotective activity of V.vinifera against

Rifapmicin induced nephrotoxicity in wistar Rats:

Groups Treatment (14 days)

Normal Vehicle (1% CMC)

Control Rifampicin (1000mg/kg,p.o.)

Standard Rifampicin (1000mg/kg,p.o.) + Cystone

(500 mg/kg, p.o.)

Low

dose

Rifampicin (1000 mg/kg, p.o.) + VVFE

(100 mg/kg, p.o.)

High

dose

Rifampicin (1000 mg/kg, p.o.) + VVFE

(200 mg/kg, p.o.)

Treatment schedule –Evaluation of

nephroprotective activity of V.vinifera against

carbon tetrachoride induced nephrotoxicity in

wistar Rats:

Groups Treatment (15 days)

Normal Olive oil (5ml/kg.p.o.)

Control CCl4 (1ml/kg,i.p.)

Standard CCl4 (1ml/kg,i.p.) + Cystone (500 mg/kg,

p.o.)

Low

dose

CCl4 (1ml/kg,i.p.) + VVFE (100 mg/kg,

p.o.)

High

dose

CCl4 (1ml/kg,i.p.) + VVFE (200 mg/kg,

p.o.)

I.P = Intra peritoneal, P.O = Per oral.

Parameters measured:

Physical Parameters: The body weight was recorded

on the first day and then last day of the study period in

each group.

Blood Estimations: Levels of creatinine, total

protein, urea, uric acid in blood were determined by

using commercial glucometer kit on final day of the

experiment by collecting blood.

Urine Estimations: Levels of creatinine, total protein,

urea, uric acid in urine were determined by using

commercial glucometer kit on final day of the

experiment by collecting urine.

Histopathological studies: For histopathological

studies, tissue obtained from the excised kidney was

immediately fixed in 10% buffered neutral formalin

solution. The fixed tissues were embedded in paraffin

and serial sections were cut. Each section was stained

with hematoxylin and eosin (H & E stain). The

sections were examined under light microscope and

photomicrographs were taken.

Statistical analysis: All the data was expressed as

mean ± S.E.M. Statistical significance between more

than two groups was tested using one way ANOVA

followed by the Tukey’s multiple comparison test

using computer based fitting program (Prism graph

pad 5.0). Statistical significance was set accordingly.

RESULTS

Effect of plant extract on body and kidney weight:

Carbon tetra chloride treated rats showed significant

(p<0.05) decrease in body and kidney weight

compared to control rats. Pretreatment with test-1,

test-2 and standard significantly (p<0.05) increased

body and kidney weights as compared to carbon tetra

chloride treated rats (table 1)

Rifampicin treated rats showed significant (p<0.05)

decrease in body and kidney weight compared to

control rats. Pretreatment with test-1, test-2 and

standard significantly (p<0.05) increased body and

kidney weights as compared to rifampicin treated rats

(table 2)

Effect of Plant extract on Blood and urine

estimations: Carbon tetra chloride (CCl4) treated rats

showed significant (p<0.05) increase in levels of Total

Protein, urea, uric acid and Creatinine in blood and

urine as compared to control rats. Pretreatment with

test-1, test-2 and Standard significantly (p<0.05)

decreased the elevated levels of these parameters as

compared to CCl4 treated rats (table 3). Rifampicin

treated rats showed significant (p<0.05) increase in

levels of Total Protein, urea, uric acid and Creatinine

in blood and urine as compared to control rats.

Pretreatment with test-1, test-2 and Standard

significantly (p<0.05) decreased the elevated levels of

these parameters as compared to Rifampicin treated

rats (table 4).

Table.1.Effect of extract on Body and kidney weight (CCl4 induced)



All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison

test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no

significance Table 2: Effect of plant extract on body and kidney weights (Rifampicin induced)

Groups Initial body weight

(gm)

Final body weight

(gm)

Change in body

weight (gm)

Kidney weight

(gm)

Normal 180 200 20±0.62 0.815±0.021

Positive Control 210 180 -30±1.02 0.59±0.024

Standard 250 230 -20±1.21 0.86±0.027

Test-1 190 185 -5±0.39 0.62±0.021

Test-2 200 180 -20±0.66 0.75±0.028

All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison

test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no

significance

Table 4: Effect of Plant extract on blood and urine estimations in carbon tetra chloride induced

nephrotoxic rats

Group

Blood Parameters Urine Parameters

Total

Protein

Urea Uric acid Creatinine Total

Protein

Urea Uric acid Creatinine

Control 7.355+0.119 22.89+0.8 2.561+0.133 0.603+0.037 41.8+1 25.253+1.302 3.468+0.052 51.95+0.16

Positive

control

19.5+0.086* 52.626+0.958* 7.49+0.109 1.85+0.036* 88.93+1.024* 56.75+2* 10.63+0.089* 2.628+0.045*

Standard 7.74+0.084# 41.5+0.081# 3.12+0.173# 0.3+8.975# 43.51+0.097# 35.611+0.112# 8.34+0.043# 0.675+0.029#

Test 1 9.59+0.082# 34.67+0.89# 50.35+0.038# 0.218+0.011# 62.26+0.099# 40.363+2.127# 4.708+0.035# 0.458+0.108#

Test 2 9.05+0.103# 26.21+1.199# 4.26+0.01# 0.413+0.01# 51.95+0.16# 28.9+2.438# 0.458+0.108# 0.348+0.032# All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where n=6; *-when compared with

Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance

Table 5: Effect of Plant extract on blood and urine estimations in rifampicin induced nephrotoxic rats

Group

Blood Parameters Urine Parameters

Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine

Control 7.458+0.076 23.96+1.028 2.302+0.06 0.068+0.038 39.46+1.29 26.132+1.507 3.368+0.541 0.822+0.023

Positive

control

18.594+0.180* 51.562+1.18* 7.66+0.076* 1.84+0.043* 90.76+1.196* 62.43+1.467* 10.502+0.12*

2.59+0.056*

Standard 7.22+0.079# 40.23+0.049# 3.007+0.168# 0.284+0.0082# 44.346+0.01# 36.6+0.032# 8.274+0.393# 0.644+0.028#

Test 1 9.93+0.177# 33.4+0.079# 5.32+0.023# 0.504+0.273# 61.63+0.007# 35.54+1.546 4.72+0.027# 0.0386+0.123#

Test 2 8.85+0.032# 25.48+1.468# 4.242+0.003# 0.408+0.127# 51.402+0.008# 26.2+0.222# 4.68+0.02# 0.324+0.029# All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where n=6;

*-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance

Histopathological studies: Histological changes such

as cortical glomerular, peritubular blood vessels

congestion, and interstitial inflammation etc. were

observed in the CCl4 and rifampicin administered

group. Pretreatment with standard (cystone), low and

high dose of VVFE significantly prevented

histopathological changes towards normal (fig A-E

and F-J respectively)

Normal Group Positive Control (CCl4)

Groups Initial body weight

(gm)

Final body weight

(gm)

Change in body

weight (gm)

Kidney weight

(gm)

Normal 200 230 +30±1.065 0.95±0.033

Positive Control 210 180 -30±0.866* 0.61±0.029*

Standard 190 180 -10±0.578# 0.72±0.016

#

Test-1 240 210 -30±0.87# 0.82±0.012

#

Test-2 200 190 -10±0.613# 0.79±0.025

#



Standard Group Low dose Extract

High dose extract F. Control

Positive Control (Rifampicin) Standard

Low dose extract High dose extract

DISCUSSION

Percentage change in body weight and

increased the levels of serum and urine markers such

as Creatinine, urea, uric acid, and total protein when

compared with control rats. Pretreatment with VVFE

in CCl4 administered rats significantly reduced the

elevated levels of serum and urine markers when

compared to positive control group. It indicates

protective effect of VVFE against rifampicin induced

nephrotoxicity in rats.

Histological changes such as cortical

glomerular, peritubular blood vessels congestion, and

interstitial inflammation were observed in the CCl4

and rifampicin administered group. The VVFE

pretreated rats significantly prevented these

histological changes, further indicating their

nephroprotective activity. All the histological changes

observed were in correlation with the physical and

biological parameters of the kidney.

From the present study results, it indicates

that VVFE has protective effect against rifampicin and

carbon tetrachloride induced nephrotoxicity in rats

individually.

CONCLUSION

In conclusion, Results of the present study suggest

that VVFE provides adequate protection against

rifampicin induced and carbon tetra chloride induced

nephrotoxicity on albino wistar rats as evidenced by

physical, biochemical and histological parameters.

The protective effect of VVFE may be due to its

antioxidant potential. However, further studies are

needed to confirm its clear mechanism of action in

nephroprotection and to characterize the chemical

constituents responsible for it.



REFERENCES

Hoitsma AJ, Wetzels JF and Koene RA, Drug induced

nephrotoxicity, Aetiology, clinical features and

management, Drug Saf, 6 (2), 1991, 131-147.

Paller MS, Drug induced nephropathies, Med Clin

North Am, 74 (4), 1990, 909-917.

Porter G. A, Bennett W.M, Nephrotoxic acute renal

failure due to common drugs. American journal of

Physiology, 241(7), 1981, 252-256.

RamyaPydi, IRajalakshmi, S Indumathy, S Kavimani,

Nephroprotective Medicinal Plants - A Review,

International Journal of Universal Pharmacy and Life

Sciences, (2), 2011, 266-281.

Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Method development and validation for the simultaneous estimation of Atazanavir

and Ritonavir in tablet dosage form by RP-HPLC

Nuli Vasavi*, Afroz Patan

Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India

*Corresponding author: Email: [email protected], Phone +91-9966136060

ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise reverse

phase high performance liquid chromatographic method for the simultaneous estimation of Atazanavir

and Ritonavir in pure and pharmaceutical dosage forms of Atazanavir and Ritonavir were well separated

using a X-Tera C18 (100 x 4.6mm, 3.5m) and Mobile phase consisting of Buffer(pH-2.5): Acetonitrile

(40:60) adjusted to pH- 2.5 at the flow rate 1.2 ml/min and the detection was carried out at 247nm with

PDA detector. The Retention time for Atazanavir and Ritonavir were found to be 1.982 & 2.576

respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity

according to ICH guidelines. The method was successfully applied to Metronidazole and Norfloxacin

combination pharmaceutical dosage form.

Key Words: RP-HPLC, Atazanavir and Ritonavir Accuracy, Precision.

1. INTRODUCTION

Atazanavir Sulphate Methyl is a Antiretroviral

drug N- [(1S)-1-{ [(2S,3S) - 3 - hydroxy-4- [(2S)-2-

[(methoxycarbonyl) amino] - 3, 3 – dimethyl - N' -

{[4-(pyridin-2-yl)phenyl]methyl} butanehydrazido]-1-

phenylbutan-2-yl] carbamoyl}-2, 2 - dimethylpropyl]

carbamate sulphate is a azapeptide HIV-1 protease

inhibitor The compound selectively inhibits the virus-

specific processing of viral Gag and Gag-Pol

polyproteins in HIV-1 infected cells, thus preventing

formation of mature virions.

Ritonavir is a Antiretroviral drug 1,3-thiazol-

5-ylmethyl N-[(2S,3S,5S)-3-hydroxy-5-[(2S)-3-

methyl-2 {[methyl({[2-(propan-2-yl)-1,3-tiazole-4-

yl]methyl})carbamoyl]amino} butanamido]-1,6-

diphenylhexan-2-yl] carbamate. Ritonavir inhibits the

HIV viral protease enzyme. This prevents cleavage of

the gag-pol polyprotein and, therefore, improper viral

assembly results. This subsequently results in non-

infectious, immature viral particles.



Atazanavir and Ritonavir combinational dosage forms

which include UV spectroscopy, Reverse Phase High

performance Liquid Chromatography, Densitometric

method, HPTLC methods. The present study illustrate

development and validation of simple, economical,

selective, accurate, precise RP-HPLC method for the

determination of Atazanavir and Ritonavir in bulk and

Pharmaceutical dosage forms as per ICH guidelines.

The goal of this study is to develop rapid,

economical HPLC method for the analysis of

Atazanavir and Ritonavir in combined dosage form

using most commonly employed column (C18) and

simple mobile phase preparation. In the present

proposed work a successful attempt had been made to

develop a method for the simultaneous estimation of

Atazanavir and Ritonavir pharmaceutical dosage form

and validate it. From the economical point of view

and for the purpose of routine analysis, it was decided

to develop a more economical RP-HPLC method with

simple mobile phase preparation for the estimation of

Atazanavir and Ritonavir combinational dosage form.

The method would help in estimate of drugs in single

run which reduces the time of analysis and does not

require separate method for each drug. Thus, the paper

reports an economical, simple and accurate RP-HPLC

method for the above said pharmaceutical dosage

forms.

2. MATERIALS AND METHODS

Quantitative HPLC was performed on a high

performance liquid chromatograph -Waters

e2695Alliance HPLC system connected with PDA

Detector 2487 and Empower2 Software. The drug

analysis data were acquired and processed using

Empower2 software running under Windows XP X-

Tera C18 (100 x 4.6mm, 3.5m) particle size. In

addition an analytical balance (AFCOSET Model

ER200A), digital pH meter (ADWA Model

AD102U), a sonicator (ENERTECH Model SE60US)

were used in this study. Standards and chemicals used:

The reference samples of Atazanavir and Ritonavir

standards were kindly supplied as gift samples by

Hetero Drugs Ltd., Hyderabad, Andhra Pradesh, India.

All the chemicals were analytical grade. Potassium

dihydrogen orthophosphate and phosphoric acid from

Merck Ltd., Mumbai, India, while acetonitrile (HPLC



grade) and triethylamine (HPLC grade) from Merck

Pharmaceuticals Private Ltd., Mumbai, India. Ortho

phosphoric acid used was of HPLC grade and

purchased from Merck Specialties Private

Ltd.,Mumbai,India

Preparation of mobile phase: A mixture of above

prepared buffer 400 ml (40%) and 600 ml of HPLC

grade Acetonitrile (60%) were mixed and degassed in

ultrasonic water bath for 5 minutes. The mobile phase

was filtered through 0.45 µ filter under vacuum.

Preparation of calibration standards: Accurately

weighed and transferred 30mg of Atazanavir and

10mg of Ritonavir working standard into a 10ml clean

dry volumetric flask and added about 7ml of diluent.

It was sonicated to dissolve completely and made

volume up to the mark with the same diluent. (Stock

solution)(3000, 1000 µg/ml). From the above stock

solution, 1ml of the solution was pipetted into a 10ml

volumetric flask and diluted up to the mark with

diluent. (300, 100µg/ml). From this, 4ml of the

solution was pipetted into another 10ml volumetric

flask and diluted up to the mark with diluent.

System suitability: System suitability is an integral

part of chromatographic system. To ascertain its

effectiveness, certain system suitability test

parameters were checked by repetitively injecting the

drug solutions at 100% concentration level for

Atazanavir and Ritonavir to check the reproducibility

of the system. At first the HPLC system was stabilized

for 40 min. One blank followed by six replicate

analysis of solution containing 100% target

concentration of Atazanavir and Ritonavir were

injected to check the system suitability. To ascertain

the system suitability for the proposed method, a

number of parameters such as theoretical plates, peak

asymmetry, and retention time were taken and results

were presented in Table 2.

Calibration curves for Atazanavir and Ritonavir: Replicate analysis of solution containing 60-180

µg/ml for Atazanavir and 20-60 µg/ml for Ritonavir

sample solutions respectively were injected into

HPLC according to the procedure in a sequence and

chromatograms were recorded. Calibration curves

were constructed by plotting by taking concentrations

on X-axis and ratio of peak areas of standards on Y-

axis and regression equation were computed for both

drugs and represented in fig:5&6

Analysis of marketed formulation: Accurately

weighed and transferred 49.8mg of Atazanavir and

Ritonavir tablet powder into a 10ml clean dry

volumetric flask and added about 7ml of diluent. It

was sonicated to dissolve it completely and made

volume up to the mark with the same diluent. (Stock

solution).

From the above stock solution, 1ml of the solution

was pipetted into a 10ml volumetric flask and diluted

up to the mark with diluent. From this, 4ml of the

solution was pipetted into another 10ml volumetric

flask and diluted up to the mark with diluent. 20 µL of

the standard and sample solutions were injected into

the chromatographic system and areas for the

Atazanavir and Ritonavir peaks were measured.

Validation study of Metronidazole and

Norfloxacin: An integral part of analytical method

development is validation. Method validation is the

process to confirm that the analytical procedure

employed for a specific test is suitable for its intended

use. The newly developed RP-HPLC method was

validated as per International Conference on

Harmonization (ICH) guidelines for parameters like

system suitability, accuracy, linearity, precision

(repeatability), Intermediate Precision limit of

detection (LOD), limit of Quantification (LOQ) and

robustness.

Precision: precision study of sample (Atazanavir and

Ritonavir) was carried out by estimating

corresponding responses 5 times on the same day for

the 100% target concentration. The percent relative

standard deviation (%RSD) is calculated which is

within the acceptable criteria of not more than 2%.

The results were presented in Table 3.

Linearity: The linearity graphs for the proposed assay

methods were obtained over the concentration range

of 30mg of Atazanavir and 10mg of Ritonavir.

Method of least square analysis is carried out for

getting the slope, intercept and correlation coefficient,

regression data values and the results were presented

in Table 5. The representative chromatograms

indicating the sample were shown in fig.2&3. A

calibration curve was plotted between concentration

and area response and statistical analysis of the

calibration curves were shown in fig. 5&6.

Accuracy (Recovery studies): The Amount found

and Amount added for Atazanavir & Ritonavir and

the individual recovery and mean recovery values

were calculated. Known amount of Atazanavir and

Ritonavir at 50%, 100%, 150% is added to a pre

quantified sample solution. The recovery studies were

carried out in the tablet in triplicate each in the

presence of placebo. The mean percentage recovery of

Atazanavir and Ritonavir at each level is not less than

98% and not more than 102%.



Robustness: The robustness is evaluated by the

analysis of Atazanavir and Ritonavir under different

experimental conditions such as making small

changes in flow rate (±0.2 ml/min), λmax (±5),

column temperature (±5), mobile phase composition

(±5%), and pH of the buffer solution. The results were

presented in Table 4.

LOD and LOQ: Limit of detection is the lowest

concentration in a sample that can be detected but not

necessarily quantified. Under the stated experimental

conditions, the limit of quantification is the lowest

concentration of analyte in a sample that can be

determined with acceptable precision and accuracy.

Limit of detection and limit of quantification were

calculated using following formula LOD=3.3(SD)/S

and LOQ=10(SD)/S, where SD= standard deviation of

response (peak area) and S= average of the slope of

the calibration curve.

3. RESULTS AND DISCUSSION

Reverse phase HPLC method was preferred

for the determination of Atazanavir and Ritonavir.

Preliminary experiments were carried out to achieve



Several column types and lengths were tried

considering other chromatographic parameters. C18

column with a 4.6 mm inner diameter and 3.5µm

particle size was chosen. The detection wave length

was selected as 247nm with 2487 detector.

Chromatographic conditions were optimized by

changing the mobile phase composition and buffers

used in mobile phase. Different experiments were

performed to optimize the mobile phase but adequate

separation of the drugs could not be achieved. By

altering the pH of buffer results a good separation.

Different proportions of solvents were tested.

Eventually the best separation was obtained by the

isocratic elution system using a mixture of

Acetonitrile (40:60) adjusted to Buffer (pH-2.5) at a

flow rate of 1.2 ml/min. A typical chromatogram for

simultaneous estimation of the two drugs obtained by

using a above mentioned mobile phase. Under these

conditions Atazanavir and Ritonavir were eluted at

1.982 & 2.567 minutes respectively with a run time of

5 minutes. The representative chromatogram of this

simultaneous estimation shown in fig. 3 & 4 and

results were summarized in Table 1.

The Buffer (pH-2.5): Acetonitrile (40:60) was

chosen as the mobile phase. The run time of the HPLC

procedure was 5 minutes at flow rate of 1.2ml/min

was optimized which gave sharp peak, minimum

tailing factor. The system suitability parameters were

shown in Table 1 were in within limit, hence it was

concluded that the system was suitable to perform the

assay. The method shows linearity between the

concentration range 30mg of Atazanavir and 10mg of

Ritonavir. The experimental results were shown in

table 5 and fig.5&6. The % recovery of Atazanavir

and Ritonavir was found to be in the range of 98.96 to

101.84 % and 98.29 to 100.54% respectively. As there

was no interference due to excipients and mobile

phase, the method was found to be specific. As both

compounds pass the peak purity, the method was

found to be specific. The method was robust and

rugged as observed from insignificant variation in the

results of analysis by changes in Flow rate, column

oven temperature, mobile phase composition and

wave length separately and analysis being performed

by different analysts. The results were shown in Table

4. The LOD and LOQ values were calculated based

on the standard deviation of the response and the slope

of the calibration curve at levels approximately the

LOD and LOQ. The limit of detection was obtained

for Atazanavir and Ritonavir found to be 0.999 and

0.999. The results were shown in Table-6.

Table.1 optimized chromatographic conditions and system suitability parameters for proposed method

Parameter Chromatographic conditions

Instrument Waters e2695 Alliance HPLC with Empower2 software

Column X-Tera C18 (100 x 4.6mm, 3.5m)

Detector Detector 2487

Mobile phase Phosphate Buffer ( pH2.5): Acetonitrile (40:60)

Flow rate 1.2ml/min

Detection wavelength 247nm

Temperature Ambient

Injection volume 20µl

Retention time Atazanavir: 1.982; Ritonavir: 2.576

Theoretical plate count Atazanavir: 4092.8 ; Ritonavir: 4900.4

Tailing factor Atazanavir: 1.3; Ritonavir: 1.2

Resolution factor 4.2



Fig. 1: Structure of Atazanavir Sulphate Fig. 2: Structure of Ritonavir

Table.2.System suitability:Flow change observation of atazanavir and ritonavir Flow rate (ml/min) System suitability results

Usp plate count Usp tailing

Atazanavir 1.0 4028.2 1.3

1.2 4092.8 1.3

1.4 4010.7 1.3

Ritonavir 1.0 4727.0 1.2

1.2 4900.4 1.2

1.4 4712.2 1.2

Table.3.Results of Precision study

Sample Injection number Precision

RT Peak area

Atazanavir 1 1.978 1647681

2 1.976 1647899

3 1.979 1642958

4 1.982 1649928

5 1.974 1649877

Mean 1.977 1633919

%RSD(NMT 2.0) 0.10

Ritonavir 1 2.576 595172

2 2.572 596877

3 2.573 596609

4 2.578 597459

5 2.573 596311

Mean 2.574 596485.6

%RSD(NMT 2.0) 0.14

Table 4: Robustness studies Atazanavir and Ritonavir

Sample Paraameters Optimized Used RT USP Tailing Plate count

Atazanavir Flow

rate(±0.2)

1ml/min 1.0 2.541 1.3 4028.2

1.2 1.982 1.3 4.92.8

1.4 1.786 1.3 4010.7

Mobile

phase

variation

0% Less 2.432 1.3 4131.8

Actual 1.982 1.3 4092.8

More 1.785 1.3 4013.1

Ritonavir Flow

rate(±0.2)

1ml/min 1.0 2.956 1.2 4727.0

1.2 2.576 1.2 4900.4

1.4 2.291 1.2 4712.2

Mobile

phase

variation

0% Less 2.952 1.2 4918.2

Actual 2.576 1.2 4900.4

More 2.290 1.2 4878.1



Table.5.Linearity data of the Atazanavir and Ritonavir Observation of Atazanavir

Linearity Level Concentration Area

I 60ppm 899573

II 90ppm 1254637

III 120ppm 1648501

IV 150ppm 2027034

V 180ppm 2469227

Correlation Coefficient 0.999

Observation Of Ritonavir

I 20ppm 328807

II 30ppm 457715

III 40ppm 602795

IV 50ppm 744367

V 60ppm 904976

Correlation Coefficient 0.999

Table.6.Limit of Detection and Limit of Quantification

Atazanavir Ritonavir mcg Area mcg Area

LOD 1.979 580 2.578 687

LOQ 1.978 1962 2.577 2322

Figure.3.Typical Chromatogram of standard Atazanavir and Ritonavir

Figure.4.Typical chromatogram of Metronidazole and Norfloxacin tablets in marketed formulation



Figure.5.Linearity for Atazanavir

Figure.6.Linearity for Ritonavir

4. CONCLUSION

The proposed RP-HPLC method was found to

be specific, precise, accurate, rapid and economical

for simultaneous estimation of Atazanavir and

Ritonavir in Tablet dosage form. The developed

method was validated in terms of accuracy, precision,

linearity, robustness and ruggedness and results will

be validated statistically according to ICH guidelines.

The sample recoveries in all formulations were in

good agreement with their respective Label Claims

and this method can be used for routine Analysis.

ACKNOWLEDGEMENT

The authors would like to thank beloved

parents and all my well wishers, one and all who have

helped me directly and indirectly in completing this

project work.

REFERENCES

Adrienne C. Muller, An efficient HPLC method for

the quantitative determination of Atazanavir in

Human Plasma suitable for Bioequivalence and

Pharmacokinetic studies in healthy Human Subjects.

Journal of Pharmaceutical and Biomedical Analysis,

53(1), 2010, 113–118.

J. Venkateswara Rao, K. Srinivasu, N. Appala Raju

and K. Mukkanti, A Validated RP-HPLC method for

the determination of Atazanavir in Pharmaceutical

dosage form, E-Journal of Chemistry, 8(1), 2011, 453-

456.

M. Padmalatha, K.Vanitha Prakash and Eranna

Dopadally, Validated Reversed Phase High

Performance Liquid Chromatography method for the

estimation of Atazanavir Sulphate in Pharmaceutical

formulations. Oriental Journal of Chemistry, 26(1),

2010, 123-127.

R. K. Nanda, A.A. Kulkarni and P.B.Yadav,

Simultaneous Spectrophotometric estimation of

Atazanavir Sulphate and Ritonavir in tablets, Scholars

Research Library Der Pharma Chemica, 3(3), 2011,

84-88.

Ravindra Reddy Y. and A. Swetha Mallesh, Method

development and validation of Atazanavir and

Ritonavir in a combined dosage form by RP-HPLC



Method, International Journal of Pharmacy &

Technology, 3(3), 2011, 3316-3334.

S. Colombo, N. Guignard, C. Marzolini, A. Telenti, J.

Biollaz and L.A. Decosterd, Determination of the

new HIV-Protease Inhibitor Atazanavir by Liquid

Chromatography after Solid-Phase Extraction. Journal

of Chromatography B Analytical Technologies in the

Biomedical and Life Sciences, 810 (1), 2004, 25-34.

S.G. Khanage, V.K. Deshmukh, P.B. Mohite, V.M.

Dhamak and S. Appala Raju, Development of

Derivative Spectrophotometric estimation of

Atazanavir Sulphate in bulk drug and Pharmaceutical

dosage forms. Int.J.Pharm.& Health Sci., 1(3),

2010, 49-154.

Sreenivasa Rao Chitturia, Yallappa Somappa

Somannavara, Badrinath Gupta Peruria, Srinivas

Nallapatia, and Hemant Kumar Sharmaa, Gradient

RP-HPLC method for the determination of Potential

Impurities in Atazanavir Sulfate, Journal of

Pharmaceutical and Biomedical Analysis, 55(1), 2011,

31-47.

Vishnu P. Choudhari, Nilesh A. Bari, Shailendra P.

Kela, Shailesh N. Sharma and Saroj V. Shirse,

Spectrophotometric simultaneous determination of

Atazanavir and Ritonavir in combined tablet dosage

form by Ratio Derivative and Area Under Curve

Method, Scholars Research Library Der Pharma

Chemica, 4(1),2012, 208-213.

Praveen and Janarthan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Evaluation of anti arthritic activity of aqueous extract of

Hibiscus Platinifolius in albino rats Marri Praveen*, M.Janarthan

Nimra College of Pharmacy, Vijayawada, India

*Corresponding author E.Mail:[email protected]

ABSTRACT

Rheumatoid arthritis is a chronic, inflammatory disorder that may affect many tissues and organs, but

principally attacks flexible (synovial) joints. The process produces an inflammatory responses of the

capsule around the joints, secondary swelling of the synovial cells. The aim of the present study was to

investigate anti-arthritic activity of leaves of Hibiscus platinifolius linn on male Wister rats and estimation

of paw edema, body weight measurement and measurement of activity of marker enzymes like alanine

trans aminases(SGPT)and serum glutamate oxalo acetate transferases (SGOT) in serum by using Aqueous

extract of hibiscus platinifolius line. The study of anti-arthritic activity involves induction of arthritis to

rats of all groups using FCA and turpentine oil induced in i.p route, followed by subsequent treatment

with aqueous extraction at two different doses. i.e AEHP 200mg/kg and AEHP400mg/kg respectively.

Diclofenac sodium is used as a reference standard. paw edemas, paw height, paw volume were estimated

from the serum by using Freund’s complete adjuvant(FCA) and turpentine oil induced arthritis .The bio

chemical parameters were increased in all arthritic rats, there parameters were decreased by the

administration of aqueous extraction of Hibiscus platinifolius at dose of 200mg and 400 mg respectively.

From this study it has been concluded that the aqueous extract of leaves of Hibiscus platinifonlius having

good anti-arthritic activity, which is comparable to Diclofenac sodium.

Key words: Hibiscus platinifolius linn, Anti-Arthritic, Rats, Paw volume, Paw width, and Paw height.

INTRODUCTION

Hibiscus platanifolius Linn (Malvaceae)

known as Mapleleaved mallow is an important

medicinal plant. It is an evergreen tree, growing up to

10 m tall. Leaves are alternate, simple, stipulate,

petiolate and ovate to lanceolate, often with a toothed

or lobed margin. Leaves are usually 3-5 lobed, 6-12 ×

5-12 cm. Leaf are palmetely veined, entire or various

lobed. Flowers are pale pink, with each petal having a

deep pink base. Flowers are about 3-5 inches across.

Sepals are leathery, hairy. Stamen-column is 2-2.5cm

long, pale pink. Maple leaved mallow is native to

India.


Preparation of extraction: The Hibiscus platinifolius

plant was collected during the march 2013 from Sri

Venkateshwara University, Tirupati, India. The plant

was authenticated by Dr. Madhava Chetty, Deparment

of Botany and voucher specimen of the plant were

preserved at institute herbarium library. Plant was

separately washed, wiped-dry, and subsequently

reduced to a coarse powder. About 100 g of the plant

material were separately extracted for 24 h aqueous

with intermittent vigorous shaking. The extracts were

filtered, concentrated with a rotary evaporator and

dried over a water bath at 45°Cshaking. The extracts

were filtered, concentrated with a rotary evaporator

and dried over a water bath at 45°C. The residue from

the plant parts were used for experimental analysis.

Acute toxicity: The acute toxicity of the Aqueous

extract of Hibiscus platinifolius was determined as per

the OECD guideline no. 423 (Organization for

Economic Cooperation and Development). It was

observed that the test extract was not mortal even at a

dose of 2000 mg/kg body weight. Hence, 200 mg/kg

and 400 mg/kg doses were selected for further study.

Ist Model:

Experimental protocol design:

Assessment of the parameters:

A) Effect of Aqueous extract Hibiscus platinifolius

paw oedema against FCA induced chronic arthritis

in rats: The FCA induced chronic anti-arthritic

activity of Aqueous extract of Hibiscus platinifolius

200mg/kg and 400mg/kg was carried out and Wistar

albino rats (150-200g) were divided into 4 groups,

contains 6 animals in each group.

Group I. Control group received vehicle (10 % v/v

tween 80; p.o.) + FCA induced changes in rat paw

oedema

Group II. Effect of Diclofenac (10 mg/kg; p.o.) on

FCA induced changes in rat paw oedema

Group III. AEHP (200 mg/kg; p.o.) on FCA induced

changes in rat paw oedema

Group IV. AEHP (400 mg/kg; p.o.) on FCA induced

changes in rat paw oedema.

Adjuvant arthritis was induced by the sub-

plantar injection of 0.1ml of Freund’s complete

adjuvant (FCA) on day zero (kalia et al). Everyday

animals were carefully and thoroughly inspected, by

http://en.wikipedia.org/w/index.php?title=Hibiscus_platanifolius&action=edit&redlink=1





examining the affected paw and the animals general

status. In FCA induced animals, the sub-plantar

injection of FCA produces local oedema after few

hours with a progressive increase reaching its

maximum upto 21st thday. On 0th, 7th, 14th, and 21

st

day the paw-oedema volume of each rat was measured

thoroughly in all groups. Inflammation in the paw

oedema was measured by using Digital

Plethysmometer (7140 UGO Basile). The change in

the paw-oedema volume for the Aqueous extract of

Hibiscus Platini folius was summarized in the Table1.

The percentage inhibition of paw oedema volume of

each treated groups is calculated by using the

following equation,Percentage inhibition,

% = (Vc – Vt / Vc) 100

Where, Vt = Mean paw volume of each treated group

Vc= Mean paw volume of control group

The width and height of the right paw of each rat was

measured with a digital Vernier caliper ruler before

and on subsequent testing days, after the induction of

arthritis according to Andersen et al.

Table 1: Effect of Aqueous extract of Hibiscus platinifolius on Body weight against FCA induced chronic arthritis in

rats

Groups Body weight

0 day 7th

day 14th

day 21st day

Control (10% tween80) 163.2±1.138 154.5± 2.405 141.7± 0.918 137.7± 0.988

Diclofenac (10 mg/kg) 154.7±1.647 168.2±1.493** 180.5±1.544*** 179.3±1.764***

AEHP 200mg/kg 163.3±1.054 177.7±1.054* 189.3±2.333** 183.5±1.765***

AEHP 400mg/kg 159.5±1.708 181.5±1.708** 188.3±1.764** 183.5±2.604***

All values are expressed as mean ± SEM, n=6, One way Analysis Variance (ANOVA) followed by Dunnett’s multiple

comparison test; ***p<0.001 as compared to control group; AEHP200mg/kg, AEHP 400mg/kg.

Table 2: Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic

arthritis in rats

2nd

model: (turpentine oil): turpentine oil induced

granuloma pouch in rat: Subcutaneous dorsal granuloma

pouch was made in ether anaesthetized rats by injecting 2

ml of air, followed by injection of 0.5 ml of turpentine oil

into it. All drugs were administered orally one hour prior to

turpentine oil injection and continued for seven consecutive

days. On day 7, the pouch was opened under anesthesia, the

amount of exudate was taken out with a syringe, and later

on the volume was measured and compared with those of

the control and standard group.

The Turpentine induced Acute anti-arthritic activity of

Aqueous extract Hibiscus platanifolius 200mg/kg and

400mg/kg was carried out on Wistar albino rats (150-200g)

were divided into 4 groups, contains 6 animals in each

group.

Group I. Control group received vehicle (10 % v/v tween

80; p.o.) + Turpentine induced changes in rat paw oedema

Group II. Effect of Diclofenac (10 mg/kg; p.o.) on

Turpentine induced changes in rat paw oedema

Group III. AEHP (200 mg/kg; p.o.) on Turpentine induced


Group IV. AEHP (400 mg/kg; p.o.) on Turpentine induced


Figure.1.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats

Groups Paw oedema volume (ml) (%EI) %inhibition of Oedema

1st day 7

th day 14

st day 21

st day

Control 10% tween80) 0.74±0.01 0.87±0.05 0.92±0.01 1.02±0.03 -----

Diclofenac(10 mg/kg) 0.64±0.01ns 0.48±0.02** 0.37±0.01*** 0.31±0.01*** 69.55

AEHP 200 mg/kg 0.75±0.01ns 0.78±0.03* 0.71±0.02**

0.69±0.01*** 45.58

AEHP 400 mg/kg 0.71±0.00ns 0.74±0.01* 0.68±0.01*** 0.64±0.03*** 32.58





Figure.2.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic

arthritis in rats

All values are expressed as mean ± SEM, n=6, One way Analysis of Variance (ANOVA) followed by Dunnett’s multiple

comparison, *p<0.05, **p<0.01 as compared to control group; AEHP 200mg/kg, AEHP 400mg/kg.

Statistical analysis: The data are expressed as mean ±

SEM. Statistical comparisons were performed by one-

way analysis of variance (ANOVA), followed by

Dunnett’s Multiple comparison test (DMCT). The results

were considered statistically significant if the p values


FCA Model:

A. EEffect of Aqueousextract of Hibiscus platinifolius

on Body weight against FCA induced chronic

arthritis in rats: Body weight is one of the parameter in

arthritis there is significant difference between body

weights of each groups immediately after induction of

arthritis in animals. Thereafter control group showed

significant decrease in body weight after 3rd week

(p<0.001) as compared to standard and extract treated

groups. However there is significant increase body

weight in treated groups after 3rd week. standard group

(p<0.001), AEHP [200mg/kg (p<0.001)] and AEHP

[400mg/kg (p<0.001)] as compared to control group.

B. Effect of Aqueous extract of Hibiscus platinifolius

on paw oedema volume against FCA induced chronic

arthritis in rats: In FCA induced chronic arthritis model,

control group animals showed increased paw oedema

gradually upto 21st day. The test extract AEHP 200mg/kg

and AEHP 400mg/kg and Diclofenac showed significant

reduced right paw oedema (p<0.001), as compared to

control group.

C.Effect of Aqueous extract of Hibiscus platinifolius

on FCA induced rat chronic arthritis serum

biochemical parameters: The biochemical marker ALT,

AST and ALP was increased significantly in Control

(FCA) group. Diclofenac and test extract AEHP

200mg/kg and AEHP 400mg/kg was showed

significantly (p<0.001) decreased in ALT, AST ansd

ALP level as compared to control group.

Turpentine oil model:

Effect of Aqueous extract of Hibiscus platinifolius on

paw oedema volume against Turpentine induced

granuloma pouch in rats: The treatment of AEHP (200

and 400 mg/kg) significantly reduced the volume of

exudates (P<0.001) in turpentine oil‐induced granuloma

pouch dose dependently, which was comparable with the

effect of diclofenac (P <0.001).

NSAID’s are widely used clinically for RA.

However, despite their great number, their therapeutic

efficacy seems to be hampered by the presence of a

number of undesired and often serious side effects.

Selective COX-2 inhibitors make alternative approach to

arthritic treatment with reduced GI side effects, but on

long term treatment leads to serious cardiovascular and

thrombotic side effects. However, a series of new

biological monoclonal antibodies (anti-TNF, anti IL-1Ra

anti-CD 20, anti-IL-2, IL-4) were preferred for RA but

these are highly expensive.

The author has immensely fascinated by these aspects of

drug research and looked for some new safer anti-

inflammatory and anti-rheumatic drugs represents a new

challenging goal for acute and chronic inflammatory

conditions. This is the dissertation work consists of four

chapters with title of “Evaluation of AEHP as potential

anti-inflammatory and antiarthritic agents”.

The chronic inflammation involves the release of

various inflammatory mediators like cytokines (IL-1α

and TNF-α), granulocyte monocytes colony stimulating

factor (GM-CSF), platelet derived growth factor (PGDF)

and others. These mediators are responsible for the pain,

destruction of cartilage and leads to severe disability.

Paw swelling is one of the major factors in assessing the

degree of inflammation and efficacy of the drugs.

Adjuvant induced arthritis is non-specific immune

response within the joint can also result in inflammatory

and erosive disease. Paw swelling is an index of



measuring the anti-arthritic activity of various drugs and

it is employed here to determine the activity of AEHP

200mg/kg and AEHP 400mg/kg. Reference standard

Diclofenac sodium, AEHP 200mg/kg and AEHP

400mg/kg administered groups showed marked reduction

in paw volume when compared with the arthritic control

group by inhibiting the release of inflammatory

mediators.

The cytoplasmic enzymes like AST and ALT

serves as indicators and suggestive for disturbances of the

cellular integrity induced by pathological conditions.

These enzymes are used as sensitive markers for

evaluation of protective activity, these markers attribute

towards persistent inflammation. The increased enzyme

activity may result from one of the several mechanisms

which include the release of various enzymes from

leukocytes, from necrotic or inflammed synovial tissue

and production and release of an increased amount of

enzymes due to altered synovial tissue. A positive

correlation observed between the leukocytes in the field

and the enzyme levels is considered as evidence for the

release of enzymes from the leukocytes. A loss of semi-

permeability of the synovial membrane has also been

correlated with the significant elevation of enzyme levels.

In present study, the decreased level of cytoplasmic

enzymes ALT s upports the protective role of the AEHP

200mg/kg, 400mg/kg and Diclofenac sodium. Granuloma

pouch technique was modified using turpentine oil as

irritant. An aseptic inflammationresulting in large volume

of haemorrhage exudate is elicited which resembles the

sub‐acute type of inflammation. Turpentine oil‐induced

granuloma pouch offer a model for exudative type of

inflammation. Though, the chemical mediators of this

type of response are unknown, protein synthesis is

necessary for the formation of granuloma. AEHP has

show potential inhibitory action on exudates formation.

Kinin is said to be the main mediator of granuloma, as it

not only vasodilate but also increase the vascular

permeability in the early stages of inflammation. Thus,

AEHP may possess anti‐kinin like activity.

CONCLUSION

Therefore drugs appear to be effective against

FCA induced arthritis and Turpentine induced

Inflammation. This finding justifies the usefulness of

AEHP in the treatment of inflammatory diseases

associated like arthritis. It is concluded that Aqueous

extract of Habiscus platinifolius possess significant anti-

arthritic activity, which is comparable to diclofenac

sodium.

REFERENCES

Anderson M.L, Eduardo H.R.S, Maria de Lourdes V.S,

Ana A.B.S, Seirgo T, Evaluation of acute and chronic

treatments with Harpagophytum procumbens on Freund’s

adjuvant induced arthritis in rats, J Ethno pharmacol,

2004; 91, 2004, 325-330.

Bradley D.W., Maynard J.E., Emery G., Webster H,

Transaminase activities in serum of long-term

hemodialysis patients, Clinchem, 11 (18), 1972, 1442.

Narendhirakannan R.T, Subramanain S, Kandaswamy M,

Antiinflammatory and lysosomal stability actions of

Cleome gynandra L studied in adjuvant induced arthritic

rats, Food ChemToxicol, 45, 2007, 1001-1012.

Paul H.W, What animal models are best to test novel

rheumatoid arthritis therapies? Current Rheum Review,

4, 2008, 277-288.

Robert A and Nezamis JE, The granuloma pouch as a

routine assay for anti‐phlogistic compounds, Acta

Endocr, 25, 1957, 105‐7.

Sarkar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Some H.R. methodology/ techniques for costs reduction in companies to improve

profit M. Sarkar*

1, B. K. Sarkar

2, M. D. Gora

3, S. C. Verma

4

1.Sri Balaji College of Engineering & Technology, Dept of Pharmaceutical Management, Jaipur, Rajasthan.

2. National Research Institute for Panchakarma Central Council for Research in Ayurvedic Sciences

Cheruthuruthy, Trissur, Kerala.

3. Lohia College, Churu, Rajasthan, India.

4. Central Council for Research in Ayurvedic Sciences, New Delhi.

*Corresponding author: [email protected]

ABSTRACT

It is not easy to compete in the market today. Rising prices, shifting fuel rates, global competition,

varying labor rates around the world, and spiraling health insurance costs have made cost control a

moving target. Sometimes it seems that a company gets one set of expenses under control, and in the

meantime, another area of the company begins experiencing cost overruns. It is a never ending battle to

maintain company profitability. Controlling cost means monitoring and controlling updates and changes

to costs, budget, and the cost baseline of the project. Monitoring and controlling costs has two dimensions

to it: expenditure of project funds and the work performed as a result of those expenditures. One major

aspect of cost monitoring and controlling is to determine the relationship between the expenditures and

the accomplishments. Departments are under increasing pressure to reduce costs. The scale of cost

reduction required means that they will have to look beyond immediate short term savings and think more

radically about how to take cost out of the business and how to sustain this longer term. This will require

strong leadership, disciplined financial management and a corresponding change in organizational

culture.

Key words: Human resources, H R Methodology, Recruitment

INTRODUCTION

Human Resources (HR) is an indispensable

part of every business and HR services ensure the

development of a mutually satisfactory and productive

employer-employee relationship. Small business also

manages to have HR at their office. HR personnel are

responsible for forming employee policies, recruiting

and shortlisting candidates, managing payroll and

employee benefits. Many small businesses appoint a

staff member to manage HR related tasks. HR services

have the expertise to manage tasks efficiently,

protecting business from possible litigations. Now

days HR have shifted its focus from administration to

strategy development, an accurate assessment of HR-

related costs has become more crucial now.

Organizations need to be realistic in their hiring and

prioritize on the areas to focus on in order to find the

right candidates. Ultimate goal of HR should be

maximum utilization of resources to have desired

profit with in confined cost investment; this all

encourages HR to focus on cost reduction and now a

day’s HR practicing many policies as a tool of cost

reduction. (Risser R, 1993; Thomas K and Schmidt

W, 1976)

Methodology/techniques for cost reductions:

(McClure L, 2000; Cox T, 1994; Decker B, 1998)

Cost reduction through appropriate recruitment

Manufacturing cost reduction and process

optimization

Selection of proper business model

Cost reduction through supply chain

Debit/Credit cost reduction

Cost reduction through concession

Reduction in transportation charges

Utilization of resources

Utilization of IT/communication techniques

Outsourcing to reduce cost

Cost reduction through appropriate recruitment:

The hiring process needs to be designed to provide

both parties with information, data and clues, on what

the job will entail, much deeper than what is visible at

the tip of the iceberg. It must provide information on

aspects like information on the informal culture of the

team, how decisions are taken, relationship dynamics

etc. For some roles, job simulation can be a great aid

where the person experiences some challenging aspect

of the job to see how he/she perform and feel. This

gives the candidate a chance to experience the job

even before he/she is actually put on the job. These

assessments are also useful for vertical movements in

the organization, especially when moving from an

operational job, to a managerial role. There are many

situations where managers are not ready to handle a

role as they have never been put in those situations,

such as, giving feedback to an underperformer or



handling delicate issues like complaints and conflicts.

Organizations need to focus on accelerating

development on the first days and weeks from joining

so that the new employee can become productive

faster. In reality, not many organizations focus on

setting expectations, creating net worth for people,

especially in a complex work environment. Early

development has immense benefits: from fewer

mistakes and faster productiveness, to early success.

Developing a cost-reduction strategy that maximizes

efficiency without compromising growth potential is a

tricky proposition. This requires identification of core

competencies where efficiency can be improved, trim

and consolidate non-core functions, and reinvest the

savings in critical business assets.

Manufacturing cost reduction and process

optimization: Challenging economic conditions and

tough competition make production errors and waste

unacceptable. Machine vision technology can help to

reduce manufacturing costs and optimize processes.

By networking vision systems throughout production

to catch defects at the source and potentially prevent

errors altogether, manufacturers can minimize scrap

and costly rework. If profit margins are narrow,

reduced manufacturing and supply chain costs can

often be the difference between profit and loss. This

can be optimized by Improving management of work

in process, reducing inventory, optimizing availability

and use of production tools and minimizing

distribution of non-conforming products.

Selection of proper business model

Organization facing severe margin pressure

has a greater imperative to reduce their costs through a

wide range of cost levers. On the other hand, healthy

companies can continue to focus on incremental

process improvement. The most immediate cost

savings may be achieved in streamlining General and

Administrative functions (G&A) and cutting external

spending on materials and services. Improvements in

these areas can deliver significant savings almost

immediately, with little or no adverse effect on the

operations. Company should also look beyond

organizational silos to include cost reduction

opportunities across the entire enterprise. A quick but

comprehensive analysis of actionable spending (i.e.

costs that are within the company’s control over the

next 12 months) can help identify the biggest

opportunities and set priorities. The selection of right

business model in some cases may be the most

effective way for a company to achieve the required

savings through a transformation of its business

model.

Cost reduction through supply chain: Reduce

supply costs by shopping around to find the best deal

on office supplies, production equipment, and raw

materials. Consider hiring a procurement officer to

monitor and maintain supply levels, as their training

and knowledge are invaluable assets to organization.

Ensure that the decision makers within the company

know how to find the best prices by using a variety of

tools and resources. Internal inventory management is

cost efficient, however; larger companies may find

external inventory management a viable option.

Create an automated system to automatically order

new supplies, which reduces back office labor

expenses. Improve efficiency and maximize space by

organizing inventory supplies and modifying the

layout of the room or warehouse. Keep the aisles free

of debris and narrow, with enough room for handcarts,

forklifts, or other equipment. Consider liquidating

products that are expiring soon or have a history of

poor sales. Consider a variety of programs, such as

vendor managed inventory systems (VIM), vendor

stocking programs (VSP), and common supplier joint

procurement policies. Choosing a VSP reduces

inventory costs for less popular items and increases

supplier reliability and dependency. Alleviate the

nightmare of managing inventory by giving the

responsibility to the vendor, which reduces inventory

and related expenses.

Debit/Credit cost reduction: Encourage cash-based

transactions such as check, money order, and cash.

Form partnerships with processing authorities and

choose a plan that is cost effective for organization.

Streamline the purchasing process by using auto-

generated purchase orders and advanced notification

systems. Additionally automate the shipping and

receiving procedure by using electronic metered

postage and bulk discounts when applicable. Review

PO history as part of cost reduction strategy at the end

of the year.

Cost reduction through concession: Every company

orders certain supplies more than other products.

Consider purchasing non-perishable items with long

shelf lives in bulk to reduce supply and labor costs.

Ordering items less frequently reduces the costs

associated with placing orders and saves money by

lowering the cost per unit. Before placing the order,

ensure the savings per unit are worth the risk, given

current market demands.

Reduction in transportation charges: Attempt to

purchase items in large groups based on the

manufacturer or vendor to save on freight charges,

utilizing merge-in-transit techniques to reduce transit



times. When shipping to consumers, utilize bulk

discounts by shipping multiple quantities of the same

item. Choose carriers and form partnerships with them

to reduce shipping charges. Order inventory early to

avoid rush-processing charges and expedited delivery

fees, which add up quickly for bulk orders.

Maximum utilization of resources

Do comparison shopping and ask current service

providers to match the lowest price.

Reduce maintenance frequency for building,

equipment, etc.

Share office or building space with another

business

Review and refine receiving protocols to ensure

products hit the shelves with minimal delay by

maintaining adequate order supply rates and

throughput levels. Maintain optimal levels by

reducing safety stock inventory and increasing

order fill rates.

Utilization of IT/communication techniques

Computer to computer phone calls are free and

other rates are much lower than traditional

business phone lines.

Establish presence on social media sites for

marketing instead of spending money on

traditional media (newspaper, magazine, mail).

Allow employees to telecommute, where

possible, instead of leasing an office space.

Cut down on printing and paper based

communication. Use electronic communication,

including emails and text messaging.

Use video conferencing services with clients and

employees instead of spending money on travel.

Another great way to improve productivity while

lowering costs is to eliminate paper flow. The best

approach is to place all documents online for

employees to download, read, and make changes to.

Also, instruct all employees not to print e-mails and

other unnecessary documents that will usually end

up in the trash upon a few quick glances.

Outsourcing to reduce cost

Hire temporary workers on as needed basis

instead of permanent ones.

Lease equipments as opposed to buying them.

Outsource computer maintenance for a flat

monthly fee rather than hiring a full-time

employee.

SUMMARY

Companies that are losing money, need to

increase profits, or must become more competitive

need to cut expenses in order to succeed. Knowing

how to implement effective cost reduction strategies

can be the determining factor in the survival of a

business. A good manager understands the importance

of cost reduction to the health of a company. Bloated

expense accounts can eat up profits quickly. A cost

reduction plan is one that focuses on lowering costs in

every business activity. The activities vary by type of

business. The Cost reduction essential for increasing

profits, improving competitive standing and to reduce

waste; which all ultimately improve productivity.

References

Cox T, Cultural diversity in organizations: theory,

research & practice. San Francisco: Berrett-Koehler

Publishers; 1994.

Decker B, The art of communicating: achieving

interpersonal impact in business, Los Altos, CA: Crisp

Publications: 1988.

McClure L, Anger and conflict in the workplace: spot

the signs, avoid the trauma, Manassas Park VA:

Impact Publications; 2000.

Risser R. Stay out of court: the manager’s guide to

preventing employee lawsuits, Englewood Cliffs, New

Jersey: Prentice Hall; 1993.

Thomas K. and Schmidt W, A survey of managerial

interests with respect to conflict, Academy of

Management Journal, 1976.

Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Analytical method development and validation of Artesunate and Amodiaquine

hydrochloride in tablet dosage form by RP-HPLC P RajaRao*, Nanda Kishore Agarwal

Department of pharmaceutical analysis, Nimra College of Pharmacy, Jupudi, Vijayawada.

*Corresponding author: [email protected]@gmail.com, phone no: 9652598593.

ABSTRACT

A simple, specific and accurate reverse phase high performance liquid chromatographic method was

developed for the simultaneous determination of Artesunate (ART) and Amodiaquine hydrochloride

(AMO) in pharmaceutical dosage form. The column used was inertsil ODS C18 (250*4.6mm,5µ) in

isocratic mode, with mobile phase containing phosphate buffer- acetonitrile-methanol (50:30:20) adjusted

to pH 5.8 using ortho phosphoric acid was used and injection volume of 20µL, with a flow rate of

1.0ml/min. and effluents were monitored at 208 nm. The retention times of artesunate and amodiaquine

hydrochloride were 5.03 min and 2.77 min, respectively. The linearity for Artesunate and Amodiaquine

hydrochloride were in the range of 15-35 mcg/ml and 45.9-107.1 mcg/ml respectively with correlation

coefficient of r2=0.999 for both.The assay of the proposed method was found to be 98.56% and 99.08%.

The recoveries of artesunate and amodiaquine hydrochloride were found to be 99.81% and 99.3%,

respectively. The % RSD from reproducibility was found to be <2%. The proposed method was

statistically evaluated and can be applied for routine quality control analysis of artesunate and

amodiaquine hydrochloride in bulk and in Pharmaceutical dosage form.

Key Words:, Artesunate & Amodiaquinehydrochloride RP-HPLC, Inertsil ODS, Validation, Forced

degradation studies.

INTRODUCTION

Artesunate belongs to artemesinin group

effective in the treatment of malarial patients.

Amodiaquinehydrochloride is an antimalarial

agent similar to chloroquine in structure and

activity which belongs to the class of 4-

aminoquinoline widely used in both antimalarial

and anti-inflammatory pharmaceutical

formulations, alone or combination with other

drugs. Artesunate is chemically

(3R,5aS,6R,8aS,9R,10S,12R,12aR) - Decahydro -

3,6,9 - trimethyl-3, 12epoxy - 12H - pyrano [4,3-

j] -1,2-benzodioxepin-10-ol,hydrogensuccinate,

and amodiaquine hydrochloride is 4-[(7-chloro-

4-quinolyl)amino]-2-[(diethylamino)methyl]

phenol dihydro chloride dihydrate was

successfully used as one content in association

with other drugs in the treatment of malaria.

Literature survey revealed that a various

analytical methods have been reported for the

determination of Artesunate and Amodiaquine

hydrochloride in pure drug, pharmaceutical

dosage forms and in biological samples using

liquid chromatography either in single or in

combined forms. Confirmation of the

applicability of the developed method was

validated according to the International

Conference on Harmonization (ICH) for the

simultaneous determination of Artesunate and

Amodiaquine hydrochloride in bulk and in tablet

dosage form.


UV-3000 LABINDIA double beam with UV

win 5software UV-VISIBLE spectrophotometer with

1cm matched quartz cells. Schimadzu HPLC equipped

with SPD 20A UV-VIS detector and the column used

was INERTSIL ODS C18 (250*4.6mm, 5µ). The data

acquisition was performed by using LC solutions

software. In addition an analytical balance (DENVER

0.1mg sensitivity), digital pH meter (Eutech pH 510),

a sonicator (Unichrome associates UCA 701) were

used in this study.

Figure.1.Structure of Artesunate Figure.2. Structure of Amodiaquine hydrochloride

mailto:[email protected]@gmail.com

http://en.wikipedia.org/wiki/File:Amodiaquine.svg



Chemicals and reagents: Artesunate and

Amodiaquinehydrochloride pure sample was taken as

a gift sample from local labs and dosage form

“falcinil” manufactured by zuventus was purchased

from local pharmacy. Other chemicals all are of

HPLC grade.

Preparation of mobile phase: Potassium dihydrogen

phosphate was weighed (2g) and dissolved in 1000 ml

of water. Finally the pH was adjusted to 5.8 with ortho

phosphoric acid (0.1 M). The solution was sonicated

for 10 minutes and filtered using Whatman filter paper

(No.1) and used. Then mix the buffer, acetonitrile and

methanol in 50:30:20 compositions respectively.

Preparation of stock solutions:

Artesunate standard stock solution: An accurately

weighed quantity of artesunate 25 mg was transferred

to the 100ml volumetric flask add 30ml of diluents

(buffer:ACN:methanol 50:30:20), sonicate to dissolve,

dilute upto the mark with diluent and mix

well.(Concentration of artesunate is about 250 g/ml).

Amodiaquine hydrochloride standard stock

solution: An accurately weighed quantity of

Amodiaquine hydrochloride 76.5 mg was transfer to

the 100ml volumetric flask add 30ml of diluent,

sonicate to dissolve, dilute up to the mark with diluent

and mix well. (Concentration of

Amodiaquinehydrochloride is about 765 g/ml).

Preparation of standard: Take 10 ml solution from

standard stock solution of Artesunate and 10ml

solution from standard stock solution of Amodiaquine

hydrochloride in 100 ml volumetric flask and make up

the volume upto the mark with diluents.

(Concentration of Artesunate is about 250 g/ml).

(Concentration of Amodiaquine hydrochloride is

about 765g/ml).

Preparation of the sample solution:

The powder equivalent to 25 mg of Artesunate and

76.5mg of Amodiaquine hydrochloride were weighed

and taken into a 100mL volumetric flask. To this

25mL of diluents was added and sonicated for 15min

to dissolve the drugs then made up the volume to

required volume with the diluents. From this solution

10ml was taken into a 100mL flask and made up to

final volume with diluents to get concentration of

Artesunate is about 250g/ml, concentration of

Amodiaquine hydrochloride is about 765g/ml and

filtered through 0.45µ filter under vacuum filtration.

From this stock solution further dilutions were made

for the validation of the method developed.


Method Validation:

Specificity: Specificity is the ability of analytical

method to measure accurately and specifically the

analyte in the presence of components that may be

expected to be present in the sample. The specificity

of method was determined by spiking possible

impurities at specific level to standard drug solution

(100ppm). The diluent and placebo solutions were

also injected to observe any interference with the drug

peak. The results are tabulated in the table no-2 and

the chromatogram was shown in the figure no- 2, 3.

Linearity: Linearity is the ability of the method to

produce results that is directly proportional to the

concentration of the analyte in samples with given

range. The linearity of ARTESUNATE was in the

concentration range of 15- 35 %, for

AMODIAQUINEHYDROCHLORIDE 45.9-107.1%.

From the linearity studies calibration curve was

plotted and concentrations were subjected to least

square regression analysis to calculate regression

equation. The regression coefficient was found to be

0.999 and shows good linearity for both the drugs.

The results are tabulated in the table no-3 and the

chromatogram was shown in the figure no-.4, 5.

Precision: Precision is the degree of closeness of

agreement among individual test results when the

method is applied to multiple sampling of a

homogeneous sample. Study was carried out by

injecting six replicates of the same sample

preparations at a concentration of Artesunate 25

ppm/ml & Amodiaquinehydrochloride 76.5 ppm/ml.

The results are tabulated in the table no-5.

Accuracy: Accuracy is the closeness of results

obtained by a method to the true value. It is the

measure of exactness of the method. Accuracy of the

method was evaluated by standard addition method.

Recovery of the method was determined by spiking an

amount of the pure drug (80%,100% ,120%) at three

different concentration levels in its solution has been

added to the pre analyzed working standard solution

of the drug. The results are tabulated in the table n-5.

LOD & LOQ: LOD is the lowest concentration of

analyte in a sample that can be detected but not

quantified under experimental conditions. The LOD

values were determined by the formulae LOD=3.3σ/s

(where σ is the standard deviation of the responses

and s is the mean of the slopes of the calibration

curves).



LOQ is the lowest concentration of analyte in a

sample that can be determined with acceptable

precision and accuracy under experimental conditions.

It is a parameter of the quantitative determination of

compounds in the mixtures. The LOQ values were

determined by the formulae LOD=10σ/s. The results

are tabulated in the table no-5

Forced degradation of Artesunate and

Amodiaquine hydrochloride Acid degradation: Acid degradation was determined

by taking 5ml of stock solution in 10ml volumetric

flask and to this 2ml of 0.1N HCl was added and

sonicate for 5min, kept aside for 12hrs at room

temperature. After 12hrs the solution was neutralized

with 2ml of 0.1N NaoH then diluted with diluents to

get a concentration of 10µg/ml solution and analysed

to recorded chromatogram.

Base Degradation: Base degradation was determined

by taking 5ml of stock solution in 10ml volumetric

flask and to this 2ml of 0.1N NaoH was added and

sonicate for 5min, kept aside for 12hrs at room

temperature. After 12hrs the solution was neutralized

with 0.1N HCl then diluted with diluents to get a

concentration of 10µg/ml solution and analysed to

recorded chromatogram.

Oxidative degradation: Oxidative degradation was

determined by taking 5ml of stock solution in 10ml

volumetric flask and diluted up to the mark with 5%

H2O2 and kept aside for 12hrs. After 12hrs the

solution was diluted with diluents to get a



Thermal degradation: Sample powder equivalent to

100mg of Artesunate and 12.5mg of Amodiaquine

hydrochloride was taken and kept in a controlled

temperature oven at 800

c for 12hrs. After 12hrs the

powder was diluted with diluents to get a



Photolytic degradation: The Artesunate and

Amodiaquine hydrochloride powder and solutions of

both were prepared and exposed to light to determine

the irradiation of light on the stability of solution and

powder form of drugs. Approximately 100mg of drug

powder and 1mg/ml solution were spread on a glass

dish in a layer that was less than 2mm thickness and

were placed in a light cabinet and exposed to UV light

at 300-400nm for 12hrs. After 12hrs the samples are

removed and diluted with diluents to get a



Several trials has made until getting good

peak resolution, acceptable plate count and tailing

factor. Method was optimized and the retention times

of Artesunate and Amodiaquine hydrochloride was

reported as 5.03 &2.77




drugs. Hence the proposed method was found to be

specific.



concentration range of 15-35μg/ml for Artesunate and

45.9-107.1 μg/ml for Amodiaquinehydrochloride

Correlation coefficient was found to be 0.999 for both

the compounds.


analyzed solution of formulation were 99.81% for

Artesunate and 99.30% for

Amodiaquinehydrochloride, which shows that the

method was accurate.

Precision: The %RSD for the sample chromatograms

of method precision were found to be 0.21 &1.48 (Rt

& Area) for Artesunate and 0.24 &0.73 (Rt & Area)

for Amodiaquinehydrochloride. Hence it passes

method precision.

Robustness: All the system suitability parameters are

within limits for variation in flow rate (±0.2 ml).

Hence the allowable flow rate should be within 0.8 ml

to 1.2 ml. All the system suitability parameters are

within limits for variation (±2nm) in wavelength.

Hence the allowable variation in wavelength is ± 2nm

LOD & LOQ: LOD and LOQ of Artesunate was

found to be 2.07, 6.27 and for Amodiaquine

hydrochloride was found to be 1.58, 4.78 respectively.

All the system suitability parameters are within in the

limits when the drugs are subjected to stress

conditions like acid, base peroxide, thermal and

photolysis. The results obtained were satisfactory and

good agreement as per the ICH guidelines.

Table.1.Details of marketed Formulation

Brand name Content Mfg.Company

FALCINIL AQ ART & AMO (100mg & 306mg Respectively)

Zuventus

824



Table.2.Optimized chromatogram conditions for Artesunate and Amodiaquine hydrochloride

Table.3.Specificity Data for Artesunate and Amodiaquine hydrochloride

Table.4.Linearity data for Artesunate and Amodiaquine hydrochloride

Table.5.Summary of validation parameters Parameter Artesunate Amodiaquine hydrochloride

Linearity 15-35µg/ml 45.9-107.1µg/ml

Precision(% RSD) 0.21 (Rt) 1.48(Area) 0.24 (Rt) 0.73(Area)

Accuracy 99.81% 99.3%

LOD & LOQ 2.07,6.27 1.58, 4.78

Assay 98.56% 99.08%

Table.6.Summary of Forced degradation data for Artesunate and Amodiaquinehydrochloride

Stress Condition Time(hrs) Retention

Time

Time(hrs) Retention Time

As such 12hrs 5.033 12hrs 2.777

Acid Hydrolysis (0.1 N, at RT) 12hrs 5.033 12hrs 2.777

Base Hydrolysis (0.1N at RT) 12hrs 5.033 12hrs 2.777

Oxidation (5% H2O2 at RT) 12hrs 5.053 12hrs 2.783

Photolysis(UV Light and sunlight) 12hrs 5.053 12hrs 2.783

Thermal (at 800c) 12hrs 5.040 12hrs 2.780

Column Inertsil ODS C18 (250*4.6mm,5µ)

Mobile phase Phosphate Buffer pH 5.8:ACN:Methanol(50:30:20)

Flow rate 1.0 ml/ min

Wavelength 208 nm

Injection volume 20 l

Column temperature Ambient

Run time 8 min

Artesunate Amodiaquine hydrochloride

Standard

Injection

Retention

time

Area Theoretical

Plates

Retention

time

Area Theoretical

Plates

5.03 315.58 4028 2.777 4586.64 2808

5.04 324.64 4039 2.780 4549.66 2973

5.05 298.92 3919 2.783 4538.27 2821

Sample

Injection

5.05 319.49 4060 2.783 4587.39 2980

5.03 304.96 4338 2.770 4512.74 2952

5.06 309.21 4220 2.790 4564.21 2995

Blank injection - - - - - -

For Artesunate For Amodiaquine hydrochloride


15 214.518 5.060 45.9 2981.917 2.787

20 277.385 5.023 61.2 3680.566 2.740

25 337.549 5.053 76.5 4650.723 2.777

30 409.413 5.063 91.8 5266.344 2.790

35 463.805 5.060 107.1 6014.413 2.787

Slope 12.61 Slope 50.66

Correlation

coefficient

0.9987 Correlation

Coefficient

0.9954

Intercept 25.233 Intercept 663.41

825



Figure.1.Chromatogram of standard drug

Figure.2.Chromatogram for specificity sample

Figure.3.Chromatogrphy for blank

Figure.4. Linearity plot for Artesunate Figure.5.Linearity plot for Amodiaquine

hydrochloride

y = 12.612x + 25.233 r² = 0.9987

0

50

100

150

200

250

300

350

400

450

500

0 10 20 30 40

Are

a

Conc

Linearity of Artesunate

y = 50.659x + 663.41 r2= 0.9954

0

1000

2000

3000

4000

5000

6000

7000

0 20 40 60 80 100 120

Are

a

Conc

Linearity of Amodiaquine Hcl

826



Figure.6. Acid degradation Figure.7. Base degradation

Figure.8.Thermal Degradation Figure.9.Photolytic Degradation

Figure.10.Peroxide degradation CONCLUSION



ICH guidelines for method validation. The proposed


rugged and economical. Hence this method is validated

and can be used for routine and stability sample analysis

REFERENCES

Catherine Orrell, Francesca Little, Peter Smith,

Peter Folb, Walter Taylor, Piero Olliaro, Karen I.

Barnes, Pharmacokinetics and tolerability of

Artesunate and Amodiaquine alone and in

combination in healthy volunteers, Eur J Clin

Pharmacol, 64, 2008, 683–690.

Odedara MH, Faldu SD, Dadhania KP, RP-

HPLC Method for Simultaneous Estimation of

Artesunate and Amodiaquine HCL in their

combined pharmaceutical dosage form, JPSBR,

2(3), 2012, 114-117.

P.S.Jain, A.J.Chaudhari, and S.J.Surana, Selective

high performance liquid chromatographic

determination of amodiaquine and artesunate in

bulk and pharmaceutical formulation, Journal of

applied pharmaceutical science, 3(3), 2013, 066-

070.

Santosh Gandhi, Padmanabh Deshpande, Pankaj

Jagdale, Godbole Varun, A simple and sensitive

RP-HPLC method for simultaneous estimation of

Artesunate and Amodiaquine in combined tablet

dosage form, Journal of Chemical and

Pharmaceutical Research, 2(6), 2010, 429-434

429.

827

Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Analytical method development and validation for the simultaneous estimation of

Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage

forms by RP-HPLC Syed Shaheda*, Nanda Kishore Agarwal,

Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India


ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise reverse

phase high performance liquid chromatographic method for the simultaneous estimation of Rabeprazole

sodium and Itopride hydrochloride in pure and pharmaceutical dosage forms. Rabeprazole and Itopride

were well separated using a Thermohypersil ODS C18 column of dimension 250 × 4.6, 5µm and Mobile

phase consisting of Sodium dihydrogen orthophosphate:Acetonitrile ( pH-5.8) in the ratio of 60:40v/v at

the flow rate 1 ml/min and the detection was carried out at 209nm. The Retention time for Rabeprazole

and Itopride were found to be 1.950, 5.027 respectively. The developed method was validated for

recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was

successfully applied to Rabeprazole sodium and Itopride hydrochloride combination pharmaceutical

dosage form.

Key Words: RP-HPLC, Rabeprazole sodium, Itopride hydrochloride.

INTRODUCTION

Rabeprazole is chemically 2- [[[4-(3-

Methoxypropoxy) – 3 – Methyl – 2 - Pyridinyl] -

Methyl]Sulfinyl]-1H-Benzimidazole Sodium salt,

belongs to a class of antisecretory compounds

(substituted benzimidazole proton-pump inhibitors)

that do not exhibit anticholinergic or histamine H2-

receptor antagonist properties, but suppress gastric

acid secretion by inhibiting the gastric H+/K

+ATPase

(hydrogen-potassium adenosine triphosphatase) at the

secretory surface of the gastric parietal cell. Because

this enzyme is regarded as the acid (proton) pump

within the parietal cell, rabeprazole has been

characterized as a gastric proton-pump inhibitor.

Rabeprazole blocks the final step of gastric acid

secretion.

Itopride hydrochloride, N - [[4 - (2 -

Dimethylaminoethoxy) phenyl] methyl] - 3, 4-

dimethoxybenzamide is a synthesized gastroprokinetic

agent. It has been shown to involve an amplification

of the prokinetic action of acetylcholine in the

gastrointestinal tract by increasing the release of

acetylcholine through the inhibition of the D2

receptors, as well as decreasing the metabolism of this

transmitter by inhibiting acetylcholinesterase enzyme.

Itopride increases acetylcholine concentrations by

inhibiting dopamine D2 receptors and

acetylcholinesterase. Higher acetylcholine increases

GI peristalsis, increases the lower esophageal

sphincter pressure, stimulates gastric motility,

accelerates gastric emptying, and improves gastro-

duodenal coordination. Literature survey revealed that

very few methods have been reported for the analysis

of Rabeprazole and Itopride combinational dosage

forms which include UV spectroscopy, Reverse Phase

High performance Liquid Chromatography, HPTLC

methods. The present study illustrate development and

validation of simple, economical, selective, accurate,

precise RP-HPLC method for the determination of

Rabeprazole sodium and Itopride hydrochloride in

bulk and Pharmaceutical dosage forms as per ICH

guidelines.

The goal of this study is to develop rapid,

economical HPLC method for the analysis of

Rabeprazole sodium and Itopride hydrochloride in

combined dosage form using most commonly

employed column (C18) and simple mobile phase

preparation. In the present proposed work a successful

attempt had been made to develop a method for the

simultaneous estimation of pharmaceutical dosage

form a Rabeprazole sodium and Itopride

hydrochloride and validate it. From the economical

point of view and for the purpose of routine analysis,

it was decided to develop a more economical RP-

HPLC method with simple mobile phase preparation

for the estimation of Rabeprazole sodium and Itopride

hydrochloride combinational dosage form. The

method would help in estimate of drugs in single run

which reduces the time of analysis and does not




forms.



performance liquid chromatograph –Shimadzu

prominance HPLC system connected with

http://en.wikipedia.org/wiki/Acetylcholine

http://en.wikipedia.org/wiki/Dopamine_receptor_D2

http://en.wikipedia.org/wiki/Acetylcholinesterase

http://en.wikipedia.org/wiki/Peristalsis



Spinchrome-CFR Software. The drug analysis data

were acquired and processed using Spinchrome-CFR

software running under Windows XP on a Pentium

PC and Thermohypersil ODS C18 column of

dimension 250 × 4.6, 5µm particle size. In addition an

analytical balance (SHIMADZU 0.1mg sensitivity),

digital pH meter (Polmon Lp-137), a sonicator (Lab

india) were used in this study.

Standards and chemicals used: Pharmaceutical

grade Rabeprazole sodium and Itopride hydrochloride

were kindly supplied as a gift sample by Chandra

Labs, Hyderabad,Andhra Pradesh, India. Acetonitrile

was of HPLC grade and Purchased from E. Merck,

Darmstadt, Germany. Water HPLC grade was

obtained from a Milli-QRO water purification system.

Rabeprazole sodium and Itopride hydrochloride

Capsules available in the market as Rablet-IT (Hetero

labs limited, Himachalpradesh, India.) in composition

of Rabeprazole sodium (20mg), Itopride

hydrochloride (150mg).

Preparation of mobile phase: Transfer 0.4825gm of

Sodium Dihydrogen Orthophosphate into 100ml of

beaker, dissolve and dilute up to the volume with

water. Then adjust its pH to 5.8. Now,The buffer

adjusted pH to 5.8:Acetonitrile were mixed to the ratio

(60:40 v/v) and filtered through 0.45µ membrane filter

and degassed by sonication.

Preparation of calibration standards: 75mg Itopride

and 10mg Rabeprazole was taken into a 100 ml of

volumetric flask, diluted to 50ml with mobile phase

and sonicated for 10 minutes and made up with

mobile phase. This is taken as a 100% concentration.

From the above, pipette out 0.6,0.8,1.0,1.2 and 1.4 ml

of solution and transfer each of them in to a 10ml

volumetric flask. Dilute with mobile phase to get

concentrations of 60,80,100,120 and 140 µg/mL

respectively. Linearity of the method was determined

by mean of calibration graph using an increasing

amount of each analyst. Linearity was evaluated by

visual inspection of a calibration graph.The calibration

curves were plotted over a concentration range of 6-14

µg/ml for Rabeprazole sodium and 25-125 µg/ml

Itopride. calibration curves were constructed by

plotting absorbance versus concentration and the

regression equations were calculated.

System suitability: System suitability are an integral





Rabeprazole sodium and Itopride hydrochloride to

check the reproducibility of the system. At first the

HPLC system was stabilized for 40 min. One blank

followed by six replicate analysis of solution

containing 100% target concentration of Rabeprazole

sodium and Itopride hydrochloride were injected to

check the system suitability. To ascertain the system

suitability for the proposed method, a number of

parameters such as theoretical plates, peak

asymmetry, and retention time were taken and results

were presented in Table 1.

Recommended procedure:

Calibration curves for Rabeprazole sodium and

Itopride hydrochloride: Replicate analysis of

solution containing 6-14µg/mL, 25-125µg/mL of

Rabeprazole sodium and Itopride hydrochloride

sample solutions respectively were injected into

HPLC according to the procedure in a sequence and





drugs and represented in Table .6

Analysis of marketed formulation: The content of

ten capsules were weighed accurately. Their average

weights were determined. Powder of capsules

equivalent to 75mg of Itopride and 10mg of

Rabeprazole sodium were weighed and taken in a 50

ml volumetric flask, dissolved in Mobile phase,

shaken and sonicated for about 20 minutes then

filtered through 0.45µ membrane filter. The filtered

solution was further diluted (5 to 50ml) in the mobile

phase to make the final concentration of working

sample equivalent to 100% of target concentration.

The prepared sample and standard solutions were

injected into HPLC system according to the

procedure. from the peak areas of Rabeprazole sodium

and Itopride hydrochloride the amount of the drugs in

the sample were computed. The contents were

calculated as an average of six determinations and

experimental results were presented in Table 4. The

representive standard and sample chromatograms

were shown in fig.4 and fig.5.

Validation study of Rabeprazole sodium and

Itopride hydrochloride: An integral part of

analytical method development is validation. Method

validation is the process to confirm that the analytical

procedure employed for a specific test is suitable for

its intended use. The newly developed RP-HPLC

method was validated as per International Conference

on Harmonization (ICH) guidelines for parameters

like specificity, system suitability, accuracy, linearity,

precision (repeatability), limit of detection (LOD),

limit of Quantification (LOQ) and robustness.

Specificity: The effect of wide range of excipients

and other additives usually present in the formulation



of Rabeprazole sodium and Itopride hydrochloride in

the determination under optimum conditions were

investigated. The specificity of the RP-HPLC method

was established by injecting the mobile phase and

placebo solution in triplicate and recording the

chromatograms. The common excipients such as

lactose anhydrous, microcrystalline cellulose and

magnesium stearate have been added to the sample

solution injected and tested.

Precision: precision study of sample (Rabeprazole

and Itopride) was carried out by estimating




within the acceptable criteria of not more than 2.0.



of 6-14µg/ml and 25-125µg/mL Rabeprazole sodium

and Itopride hydrochloride respectively. Method of

least square analysis is carried out for getting the

slope, intercept and correlation coefficient, regression

data values and the results were presented in Table 6.

The representative chromatograms indicating the

sample were shown in fig.5. A calibration curve was

plotted between concentration and area response and

statistical analysis of the calibration curves were

shown in fig. 6&7.

Accuracy (Recovery studies): The accuracy of the

method is determined by calculating recovery of

Rabeprazole sodium and Itopride hydrochloride by the

method of addition. Known amount of Rabeprazole

sodium and Itopride hydrochloride at 50%, 100%,

150% is added to a pre quantified sample solution.

The recovery studies were carried out in the tablet in

triplicate each in the presence of placebo. The mean

percentage recovery of Rabeprazole sodium and

Itopride hydrochloride at each level is not less than

99% and not more than 101%.


analysis of Rabeprazole sodium and Itopride

hydrochloride under different experimental conditions

such as making small changes in flow rate (±0.2

ml/min), λmax (±5), column temperature (±5), mobile

phase composition (±5%), and pH of the buffer

solution.




conditions the limit of quantification is the lowest










for the determination of Rabeprazole sodium and

Itopride hydrochloride. Preliminary experiments were

carried out to achieve the best chromatographic

conditions for the simultaneous determination of the

drug substances. Several column types and lengths

were tried considering other chromatographic

parameters. C18 column with a 4.6 mm inner diameter

and 5µm particle size was chosen. The detection wave

length was selected as 209nm with UV detector.









isocratic elution system using a mixture of Sodium

dihydrogen orthophosphate buffer (adjusted the pH to

2): Acetonitrile (60:40, v/v) at a flow rate of 1 ml/min.

a typical chromatogram for simultaneous estimation

of the two drugs obtained by using a above mentioned

mobile phase.Under these conditions Rabeprazole

sodium and Itopride hydrochloride were eluted at

5.027min and 1.950minutes respectively. The

representative chromatogram of this simultaneous

estimation shown in fig. 3, 4 & 5 and results were

summarized in Table 1.

The Sodium dihydrogen orthophosphate

buffer (NaH2PO4): ACN (60:40, v/v) was chosen as

the mobile phase. The run time of the HPLC

procedure was 6 minutes at flow rate of 1ml/min was

optimized which gave sharp peak, minimum tailing

factor. The system suitability parameters were shown

in Table 1 were in within limit, hence it was

concluded that the system was suitable to perform the

assay. The method shows linearity between the

concentration range of 6-14µg/ml for Rabeprazole and

25-125µg/ml for Itopride. The experimental results

were shown table 6 and fig.6&7. The % recovery of

Rabeprazole and Itopride was found to be in the range

of 100.99 to 101.87% & 98.10 to 101.35%

respectively. As there was no interference due to

excipients and mobile phase, the method was found to

be specific. As both compounds pass the peak purity,

the method was found to be specific. The method was

robust and rugged as observed from insignificant

variation in the results of analysis by changes in Flow



rate, column oven temperature, mobile phase

composition and wave length separately and analysis

being performed by different analysts. The results

were shown in Table 5. The LOD and LOQ values

were calculated based on the standard deviation of the

response and the slope of the calibration curve at

levels approximately the LOD and LOQ. The limit of

detection was obtained as 0.17µg/mL for Rabeprazole

and 4.74µg/mL for Itopride. The limit of quantitation

was obtained as 0.50µg/mL for Rabeprazole and

14.36µg/mL for Itopride which shows that the method

is very sensitive. The results were shown in Table. 7.

Table.1.Optimized chromatographic conditions and system suitability parameters for proposed

method

Parameter Chromatographic conditions

Instrument Schimadzu HPLC with Spinchrome software

Column thermohypersil C18, (5μ, 250 x 4.6mm)

Detector UV Detector

Diluent Methanol

Mobile phase Sodium dihydrogen orthophosphate (adjusted pH 5.8): methanol

(60:40 v/v)

Flow rate 1ml/min


Temperature 25°c


Retention time Itopride hydrochloride:1.950; Rabeprazole sodium:5.027

Theoretical plate count Itopride hydrochloride:2810; Rabeprazole sodium:4659

Tailing factor Itopride hydrochloride:1.33; Rabeprazole sodium1.50

Table.2.Specificity study

Name of the solution Retention time in min

Blank No peaks

Itopride hydrochloride 1.950

Rabeprazole sodium 5.027

Table.3.Results of precision study


RT Peak area

Itopride

hydrochloride

1 2.01 3652.679

2 1.99 3623.413

3 2.007 3604.924

4 1.950 3560.842

5 1.973 3582.141

6 1.950 3562.597

Mean 3597.766

%RSD(NMT 2.0) 1.35

Rabeprazole sodium 1 5.157 592.427

2 5.123 605.424

3 5.140 602.195

4 5.027 599.185

5 5.107 620.111

6 5.027 611.206

Mean 605.091

%RSD(NMT 2.0) 1.11



Table.4.Recovery data of the proposed Itopride hydrochloride and Rabeprazole sodium

Sample Spiked Amount

(µg/ml)

Recovered Amount

(µg/ml)

%Recovered %Average

recovery

Itopride

hydrochloride

75 73.98 98.64

99.36% 100 98.10 98.10

125 126.69 101.35

Rabeprazole

sodium

10 10.14 101.43

101.43% 12 12.22 101.87

14 14.14 100.99

Table.5.Robustness results of Itopride hydrochloride and Rabeprazole sodium

Sample Parameters Optimized Used Rt Tailing Plate count Itopride

hydrochloride

Flow rate

(±0.2)

1ml/min 0.8 2.583 1.62 2477

1 1.950 1.33 4659

1.2 1.683 2.65 1470

Wavelength

(±2 nm)

209 nm 207 2.050 2.07 2396

209 5.027 1.50 2560

211 2.047 2.32 2378

0.8 6.637 1.61 3802

Rabeprazole

sodium

Flow rate

(±0.2)

1ml/min 1 5.027 1.50 4659

1.2 4.323 1.60 1447

207 5.237 1.56 3557

Wavelength

(±2 nm)

209 nm 209 5.027 1.50 4659

211 5.220 2.57 3534

Table.6.Linearity data of the Itopride hydrochloride and Rabeprazole sodium sample Linearity level

(µg/ml)

Peak area Slope Y-intercept r²

Itopride

hydrochloride

25 2056.371 27.5 1336 0.995

50 2605.348

75 3483.719

100 4120.135

125 4739.482

Rabeprazole

sodium

6 394.802 62.71 16.84 0.999

8 512.594

10 647.862

12 772.627

14 891.9


Parameter Itopride hydrochloride Rabeprazole sodium

Limit of detection(LOD) 4.74µg/mL 0.17µg/mL

Limit of Quantification(LOQ) 14.36µg/mL 0.50µg/mL

Figure.1.Structure of Itopride hydrochloride Figure.2. Structure of Rabeprazole sodium

http://www.lookchem.com/300w/2010/0625/117976-89-3.jpg



Figure.3.Typical chromatogram of blank solution

Figure.4.Typical chromatogram of standard Itopride and Rabeprazole

Figure.5.Typical chromatogram of Itopride hydrochloride and Rabeprazole sodium in marketed formulation

Figure.6.Linearity of Itopride hydrochloride

y = 62.711x + 16.843 R² = 0.9995

0

100

200

300

400

500

600

700

800

900

1000

0 2 4 6 8 10 12 14 16

Are

a

Conc

Linearity of Rabeprazole



Figure.7.Linearity of Rabeprazole sodium

CONCLUSION

A new validated RP-HPLC method has been

developed for the quantitative and Qualitative

determination of Rabeprazole sodium and Itopride

hydrochloride in capsule dosage forms in bulk and

pharmaceutical dosage forms was established. The

method was completely validated shows satisfactory

results for all the method validation parameters tested

and method was free from interferences of the other

active ingredients and additives used in the

formulation. Infact results of the study indicate that

the developed method was found to be simple,

reliable, accurate, linear, sensitive, economical and

reproducible and have short run time which makes the

method rapid. Hence it can be concluded that the

proposed method was a good approach for obtaining

reliable results and found to be suitable for the routine

analysis of Rabeprazole hydrochloride and Itopride

hydrochloride in Bulk drug and Pharmaceutical

formulations.

ACKNOWLEDGEMENT

The authors would like to thank beloved

parents and all my well wishers, one and all who have

helped me directly and indirectly in completing this

project work.

REFERENCES

Akkamma H, Sai Kumar S, Sreedhar C, Rao S,

Kanagala S, Manogna K, Development and

Validation of New Analytical Method for

Simultaneous Estimation of Domperidone and

Rabeprazole in Pharmaceutical Dosage Forms,

Research Journal of Pharmaceutical, Biological and

Chemical Science, 3(3), 2010, 705.

Padmalatha M, Snehalatha T, Ramya S, Kanakadurga

M, A simple and validated RP-HPLC method for the

simultaneous estimation of Rabeprazole and

Levosulpiride in bulk and pharmaceutical dosage

forms, International Research Journal of

Pharmaceutical and Applied Sciences, Int. Res J

Pharm. App Sci, 2(2), 2010, 99-106

Patel AH, Patel JK, Patel KN, Rajput GC, Rajgor NB,

Development and Validation of derivative

Spectrophotometric method for Simultaneous

estimation Domperidone and Rabeprazole Sodium in

bulk and dosage forms, International Journal on

Pharmaceutical and Biological Research, 1(1),

2010:1-5.

Reddy M, Bodepudi C, Shanmugasundaram P,

Method Development and Validation of Rabeprazole

in Bulk and Tablet dosage form by RP-HPLC Method,

International Journal of ChemTech Research, 3(3),

2011, 1580-1588.

y = 62.711x + 16.843 R² = 0.9995

0

100

200

300

400

500

600

700

800

900

1000

0 2 4 6 8 10 12 14 16

Are

a

Conc

Linearity of Rabeprazole

Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Formulation and evaluation of herbal anti-dandruff shampoo Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel

Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India

*Corresponding author: Email:[email protected]

ABSTRACT

Dandruff is a common disorder affecting the scalp condition caused by yeast Pityrosporum.

Dandruff cannot be completely eliminated but can only be managed and effectively controlled. A

shampoo is a preparation containing surfactant (i.e. surface active material) in a suitable form – liquid,

solid or powder – which when used under the specified conditions will remove surface grease, dirt, and

skin debris from the hair shaft and scalp without adversely affecting the user. Various anti-fungal agents

are employed in hair care preparations for the treatment dandruff. These products show many side effects

like loss of hair, increased scaling, itching, irritation, nausea, and headache. Hence an attempt was made

to formulate herbal anti-dandruff shampoo which is effective in terms of safety and treating the dandruff

condition better than the chemical based anti-dandruff shampoo. Herbal anti-dandruff shampoos were

formulated using herbal based ingredients like Lemon Grass Oil, Neem oil, Henna, Aloe Vera gel and

other ingredients for preparing base shampoo. The formulated shampoos were subjected to evaluation

parameters like visual inspection, pH, viscosity, Percentage of solids contents, Dirt dispersion, Surface

tension, Foaming ability and foam stability, anti-fungal activity test using Pityrosporum Ovale strain.

Formulation (F8) exhibited good antifungal activity i.e., maximum zone of inhibition. Hence it was

subjected to safety studies on animals, such as eye irritation test and skin sensitivity test. The (F8)

exhibited good safety without any irritation and sensitivity. Stability studies for a period of three months

were conducted for F8 formulation and showed negligible changes in their physicochemical properties.

Key words: Dandruff, herbal anti-dandruff shampoo, Pityrosporum ovale.

INTRODUCTION

Dandruff represents one of the most common

dermatological skin conditions and is a chronic, non

inflammatory condition of the scalp that is

characterized by excessive scaling of scalp tissue.

Dandruff is apparently caused by a fungus called

Malassezia restricta and M. globosa. Malassezia

formerly called Pityrosporum is a yeast causing

infection of skin and scalp. It often causes itching.

Warm and humid atmosphere, overcrowding and poor

personal hygiene are ideally suited for the growth of

Malassezia. Dandruff affects 5% of the population

and mostly occurs after puberty, between 20-30 years

and dandruff affects males more than females.

Dandruff occurs exclusively on skin in areas with high

levels of sebum. Symptoms of dandruff mainly

include itching, flakes; redness of scalp. Dandruff can

be treated in two ways, by using herbal based anti-

dandruff shampoo and by using chemical based anti-

dandruff shampoo. A shampoo is a preparation

containing surfactant (i.e. surface active material) in a

suitable form – liquid, solid or powder – which when

used under the specified conditions will remove

surface grease, dirt, and skin debris from the hair shaft

and scalp without adversely affecting the user. Most

shampoos contain water, a detergent (cleaning agent),

surfactant (lather making agent), salt, fragrance

(natural and artificial), preservative and food

coloring. With the exception of water and salt (sodium

chloride), different chemical compounds are used

depending on the desired result of the shampoo. Many

shampoos also contain vitamins and moisturizing

alcohols to prevent too much of the hair and scalp's

natural oils from being stripped away during

cleansing. Herbal Cosmetics, here in after referred as

Products, and are formulated, using various

permissible cosmetic ingredients to form the base in

which one or more herbal ingredients are used to

provide defined cosmetic benefits only, shall be called

as “Herbal Cosmetics”. Herbal drugs or their

formulations are viable alternative to synthetic drugs.

During the past few decades, there has been a

dramatic increase in the use of natural products in

cosmetics. Now-a-days, many herbal shampoos are

available in the market which contains herbal

ingredients such as plant extracts and essential oils.

There are large number of plants which are reported to

have beneficial effects on hair and are commonly used

in shampoos.many herbas such as Hibiscus rosa-

sinensis, Lawsonia inermis, Citrus aurantifolia,

Phyllanthus emblica, Ocimum sanctum, Zingiber

officinalis, Azadirecta indica, aloe vera have been

used as an anti dandruff agents in many shampoo

formulations.


Lemon Grass Oil, Neem Oil, Aloe Vera Gel,

Henna was obtained as a gift samples from cavin care

pvt lmtd, Chennai, sodium lauryl sulfate was obtained



from Cipla Ltd., Daund, glycerine was procured form

Signet, Mumbai and EDTA was obtained from Syned

Labs Limited, Medak, AP.

Preparation of anti-dandruff shampoo: Shampoo

was formulated using simple mixing process. Herbal

anti-dandruff shampoo was formulated by adding the

required amounts of herbal ingredients as given in the

formulation table no 1

Evaluation of prepared herbal shampoo: The

prepared herbal shampoo formulation should be

evaluated for its appearance, pH, viscosity, foaming

ability, surface tension, percentage solid content,

detergency ability, rheology, dirt dispersion and anti-

fungal activity against pityrosporum ovale.

Antifungal activity against Pityrosporum ovale: The

herbal anti-dandruff shampoo formulations (F5-F8)

were subjected to anti-fungal activity by adopting

disc-diffusion method. Potato Dextrose Agar (PDA)

medium was used for growing fungus. PDA was

prepared with addition of Butter. Dandruff was

dissolved in Potato dextrose broth for its further use as

inoculum. The inoculum obtained was serially diluted

to 10-6 and 10-7 dilutions and 100μl of inoculum was

inoculated onto the PDA plate which was spread using

an L-Shaped spreader. The Petri plates were then

sealed using a parafilm and incubated at 30 degree

Celsius for 48 hours to get plates with uniform growth

of fungus. Then different dilutions of shampoo as

prepared and poured into petriplates and incubated,

the growth of fungus were checked at regular

intervals. Disk diffusion method was used to check the

zone of inhibition for all the dilutions of shampoo.

Safety evaluation: Safety is an important aspect of a

shampoo; it should be tested by conducting animal

studies like eye irritation test and skin sensitization

test, using albino rabbits.

Stability studies: Stability studies were carried out by

placing glass tubes and in humidity chamber at

45°Cand 75% relative humidity. And their

appearance, physical stability were inspected for a

period of 3 months at interval of one month.


Table.1.Formulation of herbal anti-dandruff shampoo Ingredients F1 F2 F3 F4 F5 F6 F7 F8

Neem oil(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0

Lemon Grass Oil (ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0

Aloe Vera gel(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0

Henna oil(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0

Sodium lauryl

sulfate(gm)

6 3.0 1.5 0.75 15 10 5 -

Carbopol(gm) 2.0 1.0 1.0 1.0 - - - -

Glycerin(ml) - - - - 1 1 1 1

Guar gum(gm) 1.2 0.60 0.30 0.15 - - - -

Methyl paraben(gm) 0.180 0.180 0.180 0.180 - - - -

Propyl paraben(gm) 0.120 0.120 0.120 0.120 - - - -

EDTA(gm) - - - - 0.15 0.15 0.15 0.15

Sodium hydroxide To adjust

pH

To adjust

pH

To adjust

pH

To adjust

pH

To adjust

pH

To adjust

pH

To adjust

pH

To adjust

pH

Water q.s q.s q.s q.s q.s q.s q.s q.s

Perfume q.s q.s q.s q.s q.s q.s q.s q.s

Total 100ml 100ml 100ml 100ml 100ml 100ml 100ml 100ml

Table 2: Evaluation of Formulations for physical appearance, pH and %Solids Formulation Appearance pH %solids Surface tension

(dy/cm)

Cleansing action

(%)

Dirt dispersion

F5 Off white, good

foaming

4.9+0.02 21.10+0.01 30.12+0.02 22.12+0.05 Moderate

F6 Off white, good

foaming

5.1+0.07 23.01+0.05 31.25+0.01 25.02+0.01 Light

F7 Off white, good

foaming

5.2+0.02 26.02+0.02 33.17+0.01 27.52+0.03 Light

F8 Off white, good

foaming

5.5+0.01 28.05+0.04 34.20+0.01 32.06+0.04 None



Table.3.Evaluation of formulations for viscosity

RPM Viscosity(cp

F5 F6 F7 F8

0.5 82150.00 60765.00 51516.67 17533.33

1.0 54150.00 42666.66 40450.00 14916.67

2.5 50916.67 33350.00 28851.66 11478.33

5 25425.00 14645.33 13651.66 9158.33

10 15775.00 8541.00 8041.66 7766.66

Table.4.Evaluation of Foam Stability of Herbal Shampoo formulations

Time in min Foam volume(ml)

F5 F6 F7 F8

1min 176 170 168 156

2min 173 168 166 152

3min 170 167 165 148

4min 169 166 164 142

5min 168 165 163 136

Table.5.Evaluation of Antifungal activity of Herbal Shampoos formulations

Zone of inhibition

Marketed product Formulation code

F5 F6 F7 F8

26.06mm 10.26mm 18.52mm 25.04mm 27.06mm

Table.6.Evaluation of Stability of Herbal Shampoo formulations

Evaluation parameter Stability

After 1month After 2 months after 3months

Appearance Off white, good foaming Off white, good foaming Off white, good foaming

pH 5.5+0.01 5.5+0.24 5.5+0.85

Viscosity(cp) 17533.33 17450.02 16477.36

% Solids 28.05+0.04 28.54+0.56 29.35+0.11

Surface tension

(dy/cm)

30.45+0.02 31.22+0.78 31.85+0.056

Dirt dispersion None None None

Foaming volume(ml) 136 134 130

Figure.1.Foam Stability of Herbal Shampoo Formulations (F5-F8)

0

50

100

150

200

1min 2min 3min 4min 5min

foam

vo

lum

e(m

l)

time (min)

Foam volume(ml) F5

Foam volume(ml) F6

Foam volume(ml) F7

Foam volume(ml) F8

837



Figure.2.Initial Skin Condition of

Albino Rabbit

Figure.3.Skin Sensitivity for F8 after

1hr

Figure.4.Skin Sensitivity for F8 after

2hrs

Figure.5. Skin sensitivity for F8 after

3hrs

Figure.6. Skin sensitivity for F8 after

4hrs

Fig no 7 Initial Eye Condition of

Rabbit without Applying Shampoo

Figure.8.Eye Irritation after

30seconds for Formulation F5


30seconds for Formulation F6


30seconds

Figure.11. Eye Irritation after 30seconds for Formulation F8

Figure.12.Antifungal activity of marketed herbal anti-

dandruff shampoo (NIZORAL) against Pityrosporum

ovale

Figure.13.Antifungal activity of prepared herbal anti-

dandruff shampoo formulation F8 against Pityrosporum

ovale

838



Total 8 formulations were made. Out of 8

formulations F1, F2 F3, F4 showed consistency,

foaming and stability problems. Formulations F5,

F6, F7, F8 showed good consistency, foaming.

Hence the formulations F5, F6, F7, and F8 were

used for further study. The results of visual

inspection of formulations are listed in Table 2.

All formulations had the good characteristics with

respect to foaming. The pH of shampoos has been

shown to be important for improving and

enhancing the qualities of hair, minimizing

irritation to the eyes and stabilizing the ecological

balance of the scalp. As seen from Table 2, all the

shampoos were acid balanced and were

ranged4.9-5.5, which is near to the skin pH. If the

shampoo has too many solids it will be hard to

work into the hair or too hard to wash out. The

result of percent of solids contents is tabulated in

table 2, and was found between 21-28%. As a

result, they were easy to wash out. It has been

mentioned that a proper shampoo should be able

to decrease the surface tension of pure water to

about 40 dynes/cm12.

The reduction in surface tension of water

from 72.8 dynes/cm to 34.2 dynes/ cm by the

herbal shampoos is an indication of their good

detergent action. The results are shown in Table

2. Cleaning action was tested on wool yarn in

grease. As seen from the results, there is a

significant difference in the amount of sebum

removed by the different shampoos. The foam

stability of herbal shampoos is listed in table 4.

The results of antifungal activity are described in

table no 5 and zone of inhibition was shown in fig

no 12 and 13. The formulation F8 showed

maximum zone of inhibition. Therefore it is

concluded that as the concentration of the herbs

increased, the zone of inhibition was also

increased, hence the formulation F8 was the best

formulation for treating dandruff. The same was

compared with marketed product, Nizoral

antidandruff shampoo containing ketaconazole as

an active ingredient and found that the formulated

product shows better control over dandruff than

the marketed product. Eye irritation for F5

formulation is more compared to other

formulation and it is less for F6 and F7. F8

formulation was without any eye irritation. Hence

it is safe for use without any side effects. Hence

the formulation F8 was found to be best for

formulation for treating the dandruff as it exhibit

maximum zone of inhibition, and without any eye

irritation.

CONCLUSION

The formulation of Anti-dandruff hair

shampoo provides a method for treating a scalp

dandruff or seborrheic dermatitis. Herbal anti-

dandruff hair shampoo containing 2ml (F8) of

herbs concentration of neem oil, lemon grass oil,

henna, aloe vera gel with sodium lauryl sulfate

base could be used as an effective in treatment of

Dandruff on scalp. The formulated shampoos

were not only safer than the chemical dandruff

agents, but may also greatly reduce the hair loss

during combing as well as strengthen the hair

growth. The pH of the shampoos was adjusted to

5.5, to retain the acidic mantle of scalp. However,

the aesthetic attributes, such as lather and clarity,

of the laboratory shampoo are not comparable

with the marketed shampoos.

REFERENCES

Chandrani D, Lubaina SZ and Soosamma M, A

review of antifungal effect of plant extract vs.

chemical substances against malassezia spp., Int J

Pharm Bio Sci, 3(3), 2012, 773 – 780.

Mansuang Wuthi-udomlert, Ployphand

Chotipatoomwan, Sasikan Panyadee and Wandee

Gritsanapan, Inhibitory effect of formulated

lemongrass shampoo on Malassezia furfur: a

yeast Associated with dandruff, Southeast asian j

trop med public health, 42(2), 2011, 363-369.

Naveen S, Karthika S, Sentila R, Mahenthiran R,

Michael A, In-vitro evaluation of herbal and

chemical agents in the management of Dandruff,

J. Microbiol. Biotech. Res., 2 (6), 2012, 916-921.

Richa Madhu Sharma, Kinjal Shah, Janki Patel,

Evaluation of Prepared Herbal Shampoo

Formulations and To Compare Formulated

Shampoo with Marketed Shampoos, Int J Pharm

Pharm Sci, 3(4), 2011, 402-405.

Singla chhavi, Drabu sushma, Ali mohammed,

Potential of herbals as an antidandruff agents,

2(3), 2011, 16-18.

839

Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)



Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage

forms V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy.


*Corresponding author: [email protected]; Phone no: 8985549686.

ABSTRACT

A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was

developed for the determination of Paracetamol and Tapentadol in bulk and pharmaceutical dosage forms.

The quantification was carried out using Thermo hypersil BDS C18 (100 X 4.6 mm, 5 µm) column run in

isocratic way using mobile phase comprising of Ammonium acetate buffer and methanol in the ratio of

50:50 w/v by adjusting the pH to 6.5(±0.5) with orthophosphoric acid and a detection wavelength of

280nm, and injection volume of 10µL, with a flow rate of 1.0ml/min. The retention times of Paracetamol

and Tapentadol was found to be 1.362 and 2.273. The linearity ranges of the proposed method lies

between 0.50 mg/mL to 0.150 mg/mL, which is equivalent to 50% to 150% and with correlation

coefficient of r2=1.0 and 0.999 for Paracetamol and Tapentadol . The assay of the proposed method was

found to be 101.0% and 98.0%. The recovery studies were also carried out and mean % Recovery was

and found to be 99.0% to 99.0%. LOD values for Paracetamol and Tapentadol was found to be 0.22 and

0.64 respectively and LOQ were found to be 0.68 and 1.96 respectively. The % RSD from

reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied

for routine quality control analysis of Paracetamol and Tapentadol in bulk and in Pharmaceutical dosage

form.

Key Words: Paracetamol,Tapentadol, RP-HPLC, Thermo hypersil BDS C18 (100 X 4.6 mm, 5 µm),

tablets, validation.

INTRODUCTION

Paracetamol is (4) N-(4-Hydroxyphenyl)

ethanamide /Para-acetylaminophenyl. The molecular

weight is 151.169, molecular formula is C8H9NO2. It

is used as Anti-pyretic and Analgesic.Tapentadol is 3-

[(1R, 2R)-3-(dimethylamino)1- ethyl-2-

methylpropyl]HCL. The molecular weight is221.339,

molecular formula is C14H23NO. Tapentadol is a

synthetic, centrally-acting analgesic that is effective

for the treatment of moderate to severe acute or

chronic pain. It has a unique dual mode of action as an

agonist at the µ-opioid receptor and as a

norepinephrine reuptake inhibitor. As a mu-opioid

agonist, it binds to and activates µ-opioid receptors in

the central nervous system. It modifies sensory and

affective aspects of pain, inhibits the transmission of

pain at the spinal cord and affects activity at parts of

the brain that control pain perception.

Literature review reveals very few methods

are reported for the assay of Paracetamol and

Tapentadol in Tablet dosage forms using RP-HPLC

method. The reported HPLC methods were having

disadvantages like high flow rate, more organic phase

and use of costly solvents. The proposed RP-HPLC

method utilizes economical solvent system and having

advantages like better retention time, less flow rate,

very sharp and symmetrical peak shapes. The aim of

the study was to develop a simple, precise, economic

and accurate RP-HPLC method for the estimation of

Paracetamol and Tapentadol in Tablet dosage forms.



win 5software UV-VISIBLE spectrophotometer with

1cm matched quartz cells. Schimadzu HPLC equipped

with SPD 20A UV-VIS detector and the column used

was THERMO HYPERSIL BDS C18

(100*4.6mm,5µ).The data acquisition was performed

by using LC solutions software.

Chemicals and reagents: Paracetamol and

Tapentadol pure samples were obtained from Laurus

laboratories, Hyderabad, India and dosage form

“Lazid-E” marketed by EMCURE was purchased

from local pharmacy. Other chemicals all are of

HPLC grade.




Figure.1.Structure of Paracetamol Figure.2.Structure of Tapentadol

Preparation of mobile phase: A suitable quantity of

degassed mixture of methanol and water in the ratio of

65:35 v/v was prepared and filtered through 0.45µ

filter under vacuum filtration.

Preparation of standard solution: Accurately

weighed and transfer about 32.50 mg of Paracetamol

and 5 mg of Tapentadol in 100 ml volumetric flask,

add to it about 50 ml of diluents and sonicate to

dissolve, dilute up to the mark with diluents and mix

well. Transfer above solution in to 5ml in to 50 ml of

volumetric flask dilute to volume with diluent.Filter

the solution through Nylon filter 0.45µ, The final

concentrations will be0.0325 mg/ml for Paracetamol,

0.005 mg/ml for Tapentadol.

Preparation of sample solution: A powder quantity

equivalent to 610mg was accurately weighed and

transferred to a 100ml volumetric flask and 50ml of

diluent was added to the same. The flask was

sonicated for 30 min and volume was made up to the

mark with diluent. Transferred 5ml of solution into a

50ml volumetric flask and dilute up to the mark with

diluent so as to obtain a concentration of 610 μg/mL

mixed well and injected. The amount present in each

tablet was calculated by comparing the area of

standard Paracetamol ,Tapentadol and tablet sample.

Method development:

Method optimization: The chromatographic

separation was performed using column Thermo

hypersil BDS C18 (100*4.6mm, 5µ). For selection of

mobile phase, various mobile phase compositions

were observed for efficient elution and good

resolution. The mobile phase consisting of

Ammonium acetate buffer:Methanol (50:50) by

adjusting the pH to 6.5(±0.5) with ortho phosporic

acid was found to be the optimum composition for

efficient elution of analyte. The mobile phase was

injected to the column at a flow rate of 1.0 ml/min for

4min. The column temperature was maintained at

35oC. The analyte was monitored at 280 nm using

UV-detector. The retention time of the drugs was

found to be 1.362 and 2.76. Mobile phase was used as

diluent during the standard and test samples

preparation.

RESULTS

Method validation:

System suitability: System suitability tests are an

integral part of method validation and are used to

ensure adequate performance of the chromatographic

system. Retention time (RT), number of theoretical

plates (N) or column efficiency and tailing factor (T)

were evaluated for five injections of standard solution

at a solution of 100µg/ml of paracetamol and

Tapentadol.







(100ppm). The diluent and placebo solutions were

also injected to observe any interference with the drug

peak.




range. The linearity of Paracetamol and Tapentadol

was in the concentration range of 50-150%.From the

linearity studies calibration curve was plotted and

concentrations were subjected to least square

regression analysis to calculate regression equation.

The regression coefficient was found to be 1for

Paracetamol and 0.999 for Tapentadol shows good

linearity for three drugs.









of the drug.

Precision: The precision of the analytical method was

studied by analysis of multiple sampling of

homogeneous sample. It is expressed as standard

deviation or relative standard deviation. Precision was

measured in terms of repeatability of application and

http://en.wikipedia.org/wiki/File:Tapentadol.svg



measurement. Study was carried out by injecting six

replicates of the same sample preparations at a

concentration of 0. 61mg/mL.

Method precision: Method precision was performed

by analyzing a sample solution of Paracetamol and

Tapentadol at working concentrations six times (Six

individual sample preparations).

Robustness: Robustness shows the reliability of an

analysis with respect to deliberate variations in

method parameters. If measurements are susceptible

to variations in analytical conditions, the analytical

conditions should be suitably controlled or a

precautionary statement should be included in the

procedure.


studies it was observed that retention time of

Paracetamol and Tapentadol was found to be 1.362

and 2.273min. % RSD of peak area was found to be

0.7 and 1.0. Theoretical plates were found to be more

than 4000. USP tailing factor was found to be 1.334

and 1.129 for Paracetamol and Tapentadol. All the

parameters were within the limit.





specific.



concentration range of 50-150μg/ml for Paracetamol

and Tapentadol. Correlation coefficient was found to

be 1 and 0.999 for two compounds.


analyzed solution of formulation were in the range of

99.3%-101.6%, which shows that the method was

accurate.

Precision: The percentage relative standard deviation

(RSD) for the peak area of paracetamol and tapentadol

were 0.4 and 1.3.

Robustness: As the % RSD of retention time and

asymmetry were within limits for variation in flow

rate (± 0.1 ml). Hence the allowable flow rate should

be within 0.9 ml to 1.1 ml. As the % RSD of retention

time and asymmetry was within limits for variation (+

20C) in column oven temperature. Hence the

allowable variation in column oven temperature is +

20C. The results obtained were satisfactory and are in

good agreement as per the ICH guidelines.

Table.1.Optimized chromatogram conditions for Paracetamol and Tapentadol Column Thermo hypersil BDS C18 (100*4.6mm,5µ)

Mobile phase Ammonium acetate buffer: Methanol (50:50)

Flow rate 1 ml/ min

Wavelength 280 nm

Injection volume 10 l

Column temperature 35o C

Run time 4 min

Sample cooler 25o C

Table.2.System suitability Data for Paracetamol and Tapentadol S.No Paracetamol Peak area Tapentadol Peak area

1 2369806 206088

2 2352610 200880

3 2364950 204747

4 2396542 204226

5 2369554 205778

Average 2370692 204344

SD 16049 2078

%RSD 0.7 1.0

Theoretical plates 4428 4194

Tailing factor 1.334 1.129

Retention time 1.362 2.276

Table.3. Specificity Data for Paracetamol and Tapentadol Name of the solution Retention time in min

Blank No peaks

Paracetamol 1.36

Tapentadol 2.27



Table.4. Linearity Data for Paracetamol and Tapentadol

Paracetamol Tapentadol

Level Con. (mg/ml) Peak area Con. (mg/ml) Peak area

50% 16.25 1199804 2.5 106313

75% 24.37 1787490 3.75 153382

100% 32.5 2383485 5.0 201678

125% 40.62 2985724 6.25 251788

150% 48.75 3575403 7.5 302257

Slope 60155 55995

Intercept 23856 2023

Correlation coefficient 1.0 0.999

Table.5.Accuracy Data for Paracetamol and Tapentadol % Level Amount Added

( µg/ml) Area Amount Founded

( µg/ml) % recovery % Mean

50% 162.500 1197918 162.58 100 100

160.902 1191018 161.64 100

161.967 1195828 162.30 100

163.033 1191389 161.70 99

160.902 1196479 162.39 101

163.033 1198386 162.64 100

100 325.000 2395924 325.17 100 99

325.533 2353829 319.45 98

325.000 2364429 320.90 99

150 479.508 3572403 484.85 101 101

480.574 3579690 485.84 101

482.705 3574256 485.10 100

481.639 3573376 484.98 101

479.308 3564202 483.73 101

480.574 3573106 484.94 101

Table.6.Precision Data for Paracetamol and Tapentadol S.No Paracetamol Assay (%) RT Tapentadol Assay (%) RT

1 101.0 1.359 98.0 2.259

2 100.0 1.360 101.0 2.260

3 101.0 1.360 98.0 2.260

4 100.0 1.360 98.0 2.263

5 100.0 1.361 100.0 2.261

6 100.0 1.361 98.0 2.262

Average 100.0 - 99.0 -

SD 9409 - 2707 -

% RSD 0.54 - 1.36 -

Table.7.Variation in flow rate and temperature of Paracetamol Parameter Rt (Min) Peak Area Column Efficiency Tailing Factor

Increased flow rate 1.137 2029076 4255 1.268

Actual flow 1.362 2395429 4364 1.331

Decreased flow rate 1.693 3094749 4737 1.325

Increased temperature 1.361 2454401 4420 1.274

Actual temperature 1.359 2369554 4466 1.303

Decreased temperature 1.362 2424044 4384 1.291



Table.8.Variation in flow rate and temperature of Tapentadol Parameter Rt (Min) Peak Area Column Efficiency Tailing Factor

Increased flow rate 1.884 176068 4028 1.184

Actual flow 2.267 200880 4716 1.245

Decreased flow rate 2.806 270335 5302 1.143

Increased temperature 2.243 220414 4681 1.117

Actual temperature 2.273 206088 4194 1.129

Decreased temperature 2.255 209903 4721 1.127

Figure.3.Standard chromatogram Figure.4.Sample chromatogram

Figure.5.Chromatogram for Specificity Figure.6.Chromatogram for Systemsuitability

Figure.7.Linearity plot for Paracetamol Figure.8.Linearity plot for Tapentadol

CONCLUSION





rugged and economical. Hence this method is validated

and can be used for routine sample analysis.

ACKNOWLEDGEMENT

The authors thankful to Mr. Satyanarayana

Goud (Research scientist-II), Mr. Murthy (G.M),

Laurus Laboratories for providing necessary facilities to

carry out the research work.

REFERENCES

Bhupendrasinh M Rao, Patel Bimal, Nurrudin Jivani,

Kumar Digbijay, Solanki Nitin, RP-HPLC method for

the simultaneous estimation of Paracetamol and

Tapentadol in tablet dosage form, Pharm Analysis &

Quality Assurance, 15(15), 2013, 1756-1763.

Dharmishtha N Bhakhar, Ashok R Parmar, Hitesh J

Vekaria, Chetana D Ribadiya, Chandani, RP-HPLC

method for the simultaneous estimation of

Paracetamol and Tapentadol in tablet dosage forms,

Pharm Analysis & Quality Assurance, 2(15), 2013,

353-362.



Samil D Desai, Bhavna A.Patel, Shraddha J Parmar,

Naitik N, Champaneri, Spectrophotometric method for

Simultaneous estimation of Paracetamol and

Tapentadol Hydrochloride by employing first order

derivative zero crossing method in 0.1 N Sodium

Hydroxide, International Journal of Pharmaceutical

sciences and Research, 5(4), 2013, 1777-1781.

Shailesh V. Malaviya, Dharmishtha N. Bhakhar,

Kavita N. Golakiya, Nehal H. Kothadiya, Hitesh J.

Vekaria, Ashok R. Parmar, Gunjan N. Pandya, Shruti

D. Dobariya, High performance thin layer

chromatographic method has been developed for the

simultaneous determination of Tapentadol

Hydrochloride (TAPE) and Paracetamol (PCM) in

pharmaceutical dosage form, Indo American Journal

of Pharmaceutical Research, 4(3), 2013, 117-122.

Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin

and Gentamycin induced nephrotoxicity in Albino rats Radha.B,

* Janarthan M, Durraivel S

Nimra College of Pharmacy,Vijayawada, Andhra Pradesh, India

*Corresponding author: [email protected], 9160508071

ABSTRACT The nephroprotectic effect of Methanolic extract of Polygonum glabrum willd was studied in

Cisplatin,Gentamycin induced Albino Rats. Oral administration of extract to albino rats [200mg/kg and

400mg/kg for 14, 8 days] produced significant (p<0.01) in animals treated with extract dependent manner,

when compared to control drugs(cis platin 12mg/kg andgentamycin 80mg/kg). Treatment with extract

200mg/kg and 400mg/kg showed significant (P<0.01) improvement in body weight and serum and urine

urea,uric acid,total protein,creatinine, when compared to nephroprotective control. Histopathological

studies also confirmed biochemical findings. Thus our study shows that Methanolic extract of polygonum

glabrum willd (200mg/kg and 400mg/kg) significantly improves the nephroprotectic activity

Key words: Polygonum glabrum willd, Methanolic extract, Cisplatin, Gentamycin.

INTRODUCTION

Nephrotoxicity is a poisonous effect of some

substances, both toxic chemicals and medication, on

the kidney. There are various forms of toxicity.

Nephrotoxicity should not be confused with the fact

that some medications have a predominantly renal

excretion and need their dose adjusted for the

decreased renal function (e.g. heparin). Several drugs

are nephrotoxic. Reactions to drugs and other

compounds are relatively common and have been

described for many substances. They are commonly

associated with renal dysfunction although the actual

incidence of drug-induced renal failure has not been

reported, since incidence is complicated by the

complexity of the causes of ARF in seriously ill

patients. Nephrotoxicity arises through several

mechanisms, including general and local vascular

effects, direct effects on renal tubules, tubular

obstruction and acute interstitial nephritis. Acute

glomerulonephritis can also occur although this less

common


Materials: All chemicals were of analytical grade and

obtained locally. Serum urea,uric acid,creatinine,total

protein kit were procured from Robonik diagnostics,

Hyderabad, India.

Plant material: The fresh plant polygonum glabrum

willd was collected from Kolli hills and foot hill of

Yercaud, Tamilnadu, India. Identification of the plant

was done by Dr. K.Madhava Chetty assistant

professor, department of botany, Sri Venkateswara

University, Tirupati, A.P, India.

Animals: Albino rats weighing 180-250g were

selected and housed in polypropylene cages in a room

where the congenial temperature was 27°C ±1°C and

12 hrs light and dark cycles were maintained. Each of

these treatment groups consisted of six animals/group.

The protocol of this study was approved by the

Institutional Animal Ethics Committee (IAEC)

constituted under Committee for Purpose of Control

and Supervision of Experiments on Animals

(CPCSEA).

Preparation of the extract: The whole plant were

isolated, chopped into small pieces and dried under

shade at room temperature for seven days. The dried

plant were powdered and passed through the sieve

(coarse 10/44). This powder was used for the

preparation of methanolic extract.

Methanolic extract: Methanolic extract was prepared

by Heat Soxhlet extractor. The dried coarse

powdered of plant (250 gm) were transferred to a

round bottom flask, 75% of methanol was added to

the flask and soaked for 2 hours. This was then boiled

for 4 hours. The extract so obtained was decanted in a

beaker and then concentrated to 1/6th of the total

volume on a water bath. This was preserved by adding

a few drops of chloroform and kept in the refrigerator.

This extract was administered to the animals by

making the concentration required. By weighing the

water-evaporated extract (24.5% yield). The extract

was assigned a code name MEPG (methanolic extract

of polygonum glabrum)

Experimental protocol: In order to induce at

nephrotoxicity, the method was followed. The animals

were divided into four groups of six rats each

Group I: Normal animals

Group II: control animals (Cisplatin, Gentamycin)

Group III: control drugs+ extract (200mg/kg/day)

Group IV: control drugs+ extract (400 mg/kg/day).

At the end of the treatment the rats were sacrificed on



15 and 9 day. Serum was separated and stored in

refrigerator until assay

Experimental protocol: In order to induce at

nephrotoxicity, the method was followed. The animals

were divided into four groups of six rats each

Group I: Normal animals

Group II: control animals (Cisplatin, Gentamycin)

Group III: control drugs+ extract (200mg/kg/day)

Group IV: control drugs+ extract (400 mg/kg/day).

At the end of the treatment the rats were sacrificed on

15 and 9 day. Serum was separated and stored in

refrigerator until assay

Measurement of various Parameters:

Physical Parameters: The body weight was recorded

on the first day and then last day of the study period in

each group.

Biochemical Estimations: Serum urea, uric acid,

creatinine, total protein kit were procured from

Robonik diagnostics, animals were taken and blood

was collected from retro orbital plexus under light

ether anesthesia, centrifuged at 2500 rpm for 20

minutes. The serum obtained will be kept at 4oC until

used then sacrificed the rats and remove the kidneys

for histopatological evaluation.

RESULTS AND DISCUSSION Table.1. Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on serum creatinine, blood

urea and serum uric acid,total protien in treated rats for 14 days (serum parameters) Treatment groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl

Normal 0.333+0.309 7.313+3.118 3.223+1.469 40.52+16.69

Control 26.70+11.23a

3.495+1.590a

8.43+3.556a

65.06+26.86a

T1 2.09+0.878*** 5.316+2.27*** 5.58+2.496*** 28.58+12.04***

T2 1.205+0.509*** 4.065+1.750** 4.075+1.689*** 24.59+10.27***

All the values are mean+SEM,n=6,ns=not significant (ANOVA) one way analysis of variance followed by the multiple comparision

of the Dunnett’s test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group

Table.2.Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on urine creatinine; urine

urea and urine uric acid,total protien in treated rats for 14 days (Urine parameters) Treatement groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl

Normal 0.886+0.395 8.85+3.73 22.285+9.21 25.18+10.38


18.23+7.47a

55.03+26.58a

61.21+25.07a

T1 1.383+0.594*** 11.228+4.605*** 32.23+13.32*** 35.05+14.43***

T2 1.088+0.454*** 9.2233+.789*** 29.23+11.95*** 30.07+12.47***

All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision


Table.3.Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on serum creatinine; blood

urea and serum uric acid,total protien in treated rats for 8 days (Blood parameters) Treatment Groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl

Normal 0.205+0.0093 6.44+0.224 3.77+0.168 45.305+0.130

Control 11.35+0.0981a

4.15+0.163a

7.5+0.116a

63.29+0.126a

Polygonum glabrum(T1) 0.215+0.0043*** 6.7+0.268*** 3.166+0.339*** 45.07+0.202***

Polygonum glabrum(T2) 3.23+0.2460*** 5.35+0.151* 5.19+0.278*** 57.12+1.458***

All the values aree mean+ SEM,n=6,ns=not significant,(ANOVA) one way analysis of variance followed by the multiple

comparision of the Dunnett’s test, p<0.005, p<0.001, and p<0.001 v/s control and ap<0.001,bp<0.001 and cp<0.05 v/s normal group

Table.4. Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on urine creatinine; urine

urea and urine uric acid,total protien in treated rats for 8days (Urine parameters (gentamycin)) Treatment groups Creatinine mg/dl Total protein mg/dl Urea mg/dl Uric acid md/dl

Normal 6.496+0.188 3.36+1.53 59.85+2.507 0.565+0.052


10.48+4.45a

95.06+38.85a

2.666+0.159a

T1 6.455+0.188*** 7.88+3.35*** 78.03+31.92*** 1.153+0.1485***

T2 7.243+0.2406*** 4.08+1.960*** 65.05+26.62*** 0.761+0.0576***

All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision




Effect of administration of Methanolic extract of

polygonum glabrum willd (200 and 400mg / kg

once daily for 14, 8days)/ Cisplatin (12mg /kg/day)

Gentamycin (80mg/kg/day) on Histopathological

changes in aorta of rats 14, 8 days:

Group1: Section studied shows renal parenchyma

with intact normal architecture. The glomerular and

tubular changes appear unremarkable. Some of the

blood vessels are dilated and congested within the

interstitium. Also few scattered mononuclear

inflammatory infiltration is seen within the

interstitium.

Important Highlights: Some blood vessels show

congestion


with intact architecture. There are seen diffuse

glomerular congestion, focal hydropic degeneration of

the tubular epithelial cells and peritubular congestion.

Some of the tubules show partial desquamation of the

epithelial cells. Also seen are blood vessel congestion

and scattered mononuclear inflammatory cell

infiltrations within the interstitium.

Important Highlights: Diffuse glomerular

congestion, Tubular casts.


with intact architecture. There is seen focal glomerular

congestion. Few the tubular epithelial cells show

hydropic degeneration and peritubular congestion.

Also seen are few scattered mononuclear

inflammatory cell infiltrations within the interstitium.

Important Highlights: Focal glomerular congestion,

Peritubular congestion

Group 4: High fatty die Section studied shows renal

parenchyma with intact architecture. The glomerular

and tubular changes appear unremarkable. Some of

the blood vessels are dilated and congested. Within

the interstitium, also seen are few scattered

mononuclear inflammatory infiltration is seen within

the interstitium.

Due to cisplatin administration,

platinumsulphydryl group complexes formed are

taken up by renal cells and stabilized by intracellular

GSH for several hours. In case of intracellular GSH

depletion, the complexes undergo rapid

transformation to reactive metabolites28. Thus GSH

depletion results in increased toxicity of cisplatin.The

use of gentamicin, an aminoglycoside antibiotic with a

wide spectrum of activities against Gram-positive and

Gram-negative bacterial infections but with high

preference for latter is equally associate with

nephrotoxicity as its side effect. Thus gentamicin

induced nephrotoxicity is well established

experimental model of drug induced renal injury.

Many animal experiments have demonstrated

overwhelmingly, the positive correlation between

oxidative stress and nephrotoxicity. Gentamicin

induced nephrotoxicity by causing renal

phospholipidosis through inhibition of lysosomal

hydrolases such as sphingomylinase and

phospholipases in addition to causing oxidative stess.

Nephrotoxic activity can be lowered significantly with

extract of polygonum glabrum.

CONCLUSION

In case of cis platin treated group there will be

rise in serum marker such as urea, uric acid and

creatinine and decrease in the level of protein. The

same is observed in kidney diseases in clinical

practice and hence are having diagnostic importance

in the assessment of kidney function. In the present

study, the stem extract of polygonum glabrum

significantly reduced the toxicant elevated levels of

above mentioned serum markers and increase in the

levels of protein. Hence, at this point it is concluded

that the extract of polygonum glabrum offers

nephroprotection.

In gentamicin treated animals there will be

found glomerular, peritubular and blood vessel

congestion and result in presence of inflammatory

cells in kidney sections. The same is observed in case

of humans who are suffering from major kidney

disorders. In the present study, the extract of

polygonum glabrum treated group animals were found

to reduce such changes in kidney histology induced by

gentamicin, indicating nephroprotection. Further

documented reports reveal that, plant material

containing phenols, flavonoids, alkaloids and saponins

offers organ protection by virtue of their free radical

scavenging activity

ACKNOWLEDGEMENT

Authors are grateful to Dr. Durivel, head of

the institution, Dr. Janardhan, head of the department,

Nimra College of pharmacy.

REFERENCES

George JK, Enrique PM, Aminoglycoside

nephrotoxicity, Kidney Int, 8, 1980, 571 -582.

Jones S and Janardhanan KK, Antioxidant and

antitumor activity of Ganoderma lucidum (Curt. Fr.)

P. Karst-Reishi (Aphyllophoromycetideae) from

South India, Int. J. Med. Mushr, 2000, 195–200.



Leelavathy, K. M. and Ganesh, P. N., Polypores of

Kerala, Daya Publishing House, Delhi, 2000, 166.

Shiao M, Lee K R, Lin L J and Wang C T, Natural

productsand biological activities of the Chinese

medicinal fungus Ganoderma lucidum in Food

Phytochemicals II. Teas, Spices and Herbs, American

Chemical Society, Washington DC, 1994, 342–354.

Vijay KK, Naidu MUR, Shifow AA, Ratnakar KS,

Nephroprotective and antioxidant activity of ehanolic

extract of the bark of Madhuca longifolia (koenig),

Indian J Pharmacol, 32, 2000, 108.




Rosuvastatin and Finofibate in tablet dosage form by reverse phase high

performance liquid chromatography M. Sumalatha, K.Haritha Pavani

Nimra College of Pharmacy, Vijayawada, A.P, India


ABSTRACT

A new, simple, precise, accurate and reproducible RP-HPLC method for Simultaneous estimation of

Rosuvastatin (ROS) and Fenofibrate (FEN) in bulk and pharmaceutical formulations was developed.

Separation of ROS and FEN was successfully achieved on a Hypersil C18 (4.6 x 250mm, 6.5 m,

Make: Waters) or equivalent in an isocratic mode utilizing OPA buffer (pH 3.0): Methanol (65:35%v/v)

at a flow rate of 1.2 mL/min and eluate was monitored at 238 nm, with a retention time of 1.950 and

3.858 minutes for ROS and FEN. The method was validated and the response was found to be linear

in the drug concentration range of 50 µg/mL to 150 µg/mL for ROS and 50 µg/mL to 150 µg/mL for

FEN. The values of the slope, intercept and the correlation coefficient were found to be 2 2 507,

7467 and 0.999 for ROS and 21157, 16980 and 0.999 for FEN respectively. The LOD and LOQ for

Rosuvastatine were found to be 0.0053, 0.017 respectivly. The LOD and LOQ for Fenofibrate were

found to be 0.00019, 0.00063 respectively. This method was found to be good percentage recovery for

Rosuvastatine and Fenofibrate were found to be 99.00 and 99.00 respectively indicates that the proposed

method is highly accurate. The specificity of the method shows good correlation between retention times

of standard with the sample so, the method specifically determines the analyte in the sample without

interference from excipients of tablet dosage forms. The method was extensively validated according to

ICH guidelines for Linearity, Range, Accuacy, Precesion, Specificity and Robustness.

Key words: Rosuvastatin, Fenofibrate, High performance liquid chromatography.

INTRODUCTION

Rosuvastatin (3R, 5S, 6E) – 7 - [4 - ( 4 –

fluorophenyl ) – 2 ( N - methylmethanesulfonamido )

– 6 - (proan-2-yl) pyrimidine-5-yl ] - 3, 5-

dihydoxyhept-6-enoic acid. Rosuvastatin is an

antilipidemic agent that competitively inhibits

hydroxymethylglutaryl-coenzyme A (HMG-CoA)

reductase.HMG-CoA reducuase catalyzes the

conversion of HMG-CoA to mevalonic acid, the rate-

limiting step in cholesterol biosynthesis. Rosuvastatin

belongs to a class of medications called Statins and is

used to reduce plasma cholesterol levels and prevent

cardiovascular disease.

Fenofibrate propan - 2 - yl2 - {4 - [(4-

chlorophenyl) carbonyl] phenoxy} -

2methylpropanoate is an antilipidemic agent which

reduces both cholesterol and triglycerides in the

blood. Fenofibrate exerts its therapeutic effects

through activation of peroxisome proliferator

activated receptor a (PPARa). This increases lipolysis

and elimination of triglyceride-rich particles from

plasma by activating lipoprotein lipase and reducing

production of apoprotein C-III. The resulting fall in

triglycerides produces an alteration in the size and

composition of LDL from small, dense particles, to

large buoyant particles. These larger particles have a

greater affinity for cholesterol receptors and are

catabolized rapidly.



Rosuvastatin and Fenofibrate combinational dosage

forms which include UV spectroscopy, Reverse Phase

High performance Liquid Chromatography,

Densitometric method, HPTLC methods. The present

study illustrate development and validation of simple,

economical, selective, accurate, precise RP-HPLC

method for the determination of Rosuvastatin and

Fenofibrate in bulk and Pharmaceutical dosage forms

as per ICH guidelines. The goal of this study is to

develop rapid, economical HPLC method for the

analysis of Rosuvastatin and Fenofibrate in combined

dosage form using most commonly employed column

(C18) and simple mobile phase preparation. In the

present proposed work a successful attempt had been

made to develop a method for the simultaneous

estimation of Rosuvastatin and Fenofibrate

pharmaceutical dosage form and validate it. From the

economical point of view and for the purpose of

routine analysis, it was decided to develop a more

economical RP-HPLC method with simple mobile

phase preparation for the estimation of Rosuvastatin

and Fenofibrate combinational dosage form. The

method would help in estimate of drugs in single run



which reduces the time of analysis and does not




forms.



performance liquid chromatograph -Waters

e2695Alliance HPLC system connected with PDA

Detector 2998 and Empower2 Software. The drug

analysis data were acquired and processed using

Empower2 software running under Windows XP on a

Pentium PC and Hypersil ODS C18 column of

dimension 250 × 4.6, 5µm particle size. In addition an

analytical balance (DENVER 0.1mg sensitivity),

digital pH meter (Eutech pH 510), a sonicator

(Unichrome associates UCA 701) were used in this

study.

Standards and chemicals used: The reference

samples of Rosuvastatin and Fenofibrate standards

were kindly supplied as gift samples by Dr.Reddy’s.,

Hyderabad, Andhra Pradesh, India. All the chemicals

were analytical grade.ortho phosphoric acid from

Dr.Reddy’s., Hyderabad,Andhra Pradesh, India, while

Methanol (HPLC grade) and Water (HPLC grade)

from Merck Pharmaceuticals Private Ltd., Mumbai,

India. Rosuvastatin and Fenofibrate Tablets available

in the market as RosvasF (J.B. Chemicals &

Pharmaceuticals Ltd.) in composition of Rosuvastatin

(190mg), Fenofibrate (6mg).

Preparation of mobile phase: Transfer 1000ml water

into 1000ml of beaker.Then adjust its pH-3.0 with

Ortho phosphoric acid (OPA) and filtered through

0.45µ membrane filter and degassed by sonication.

Preparation of calibration standards:Rosuvastatin

6mg and 190mg Fenofibrate was taken into a 10, 25ml

of volumetric flask and add 10ml of Diluent and

sonicated for 10 minutes and made up with Diluent. It

was further diluted to get stock solution of

Rosuvastatin and Fenofibrate.This is taken as a 100%

concentration. Working standard solutions of

Rosuvastatin and Fenofibrate was prepared with

mobile phase. To a series of 10 ml volumetric flasks,

standard solutions of Rosuvastatin and Fenofibrate in

the concentration range of 50- 150µg/ml were

transferred respectively.

System suitability: System suitability is an integral





Rosuvastatin and Fenofibrate to check the

reproducibility of the system. At first the HPLC

system was stabilized for 40 min. One blank followed

by six replicate analysis of solution containing 100%

target concentration of Rosuvastatin and Fenofibrate

were injected to check the system suitability. To

ascertain the system suitability for the proposed

method, a number of parameters such as theoretical

plates, peak asymmetry, and retention time were taken

and results were presented in Table 1.

Calibration curves for Rosuvastatin and

Fenofibrate: Replicate analysis of solution containing

50-150µg/mL of Rosuvastatin and Fenofibrate sample

solutions respectively were injected into HPLC

according to the procedure in a sequence and





drugs and represented in Table .6

Analysis of marketed formulation: The content of

ten tablets was weighed accurately. Their average

weights were determined. Powder of tablets

equivalent to one tablet weight (488mg) were weighed

and taken in a 50 ml volumetric flask, dissolved in

diluents, shaken and sonicated for about 20 minutes

then filtered through 0.45µ membrane filter. The

filtered solution was further diluted (5 to 50ml) in the

diluents to make the final concentration of working

sample equivalent to 100% of target concentration.

The prepared sample and standard solutions were

injected into HPLC system according to the

procedure. From the peak areas of Rosuvastatin and

Fenofibrate the amount of the drugs in the sample

were computed. The contents were calculated as an

average of six determinations and experimental results

were presented in Table 4. The representive standard

and sample chromatograms were shown in fig.2 and

fig.3.

Validation study of Rosuvastatin and Fenofibrate:

An integral part of analytical method development is

validation. Method validation is the process to

confirm that the analytical procedure employed for a

specific test is suitable for its intended use. The newly

developed RP-HPLC method was validated as per

International Conference on Harmonization (ICH)

guidelines for parameters like specificity, system

suitability, accuracy, linearity, precision

(repeatability), limit of detection (LOD), limit of

Quantification (LOQ) and robustness.

Specificity: The effect of wide range of excipients

and other additives usually present in the formulation

http://www.healthkartplus.com/drugs/manufacturer/56048/j-b-chemicals-pharmaceuticals-ltd

http://www.healthkartplus.com/drugs/manufacturer/56048/j-b-chemicals-pharmaceuticals-ltd



of Rosuvastatin and Fenofibrate in the determination

under optimum conditions were investigated. The

specificity of the RP-HPLC method was established

by injecting the mobile phase and placebo solution in

triplicate and recording the chromatograms.

Precision: precision study of sample (Rosuvastatin

and Fenofibrate) was carried out by estimating




within the acceptable criteria of not more than 2.0.



of 50-150µg/ml Rosuvastatin and Fenofibrate

respectively. Method of least square analysis is carried

out for getting the slope, intercept and correlation

coefficient, regression data values. The representative

chromatograms indicating the sample were shown in

fig.2&3. A calibration curve was plotted between

concentration and area response.

Accuracy (Recovery studies): The accuracy of the

method is determined by calculating recovery of

Rosuvastatin and Fenofibrate by the method of

addition. Known amount of Rosuvastatin and

Fenofibrate at 50%, 100%, 150% is added to a pre

quantified sample solution. The recovery studies were

carried out in the tablet in triplicate each in the

presence of placebo. The mean percentage recovery of

Rosuvastatin and Fenofibrate at each level is not less

than 98% and not more than 102%.


analysis of Rosuvastatin and Fenofibrate under

different experimental conditions such as making

small changes in flow rate (±0.2 ml/min), λmax (±5),

column temperature (±5), mobile phase composition

(±5%), and pH of the buffer solution.




conditions, the limit of quantification is the lowest










for the determination of Rosuvastatin and Fenofibrate.

Preliminary experiments were carried out to achieve



Several column types and lengths were tried

considering other chromatographic parameters. C18

column with a 4.6 mm inner diameter and 5µm

particle size was chosen. The detection wave length

was selected as 238nm with PDA detector.









isocratic elution system using a mixture of OPA

buffer, Methanol in the ratio of (65:35) adjusted to

pH- 3.0 at a flow rate of 1.2 ml/min. A typical

chromatogram for simultaneous estimation of the two

drugs obtained by using a above mentioned mobile

phase. Under these conditions Rosuvastatin and

Fenofibrate were eluted at 1.950min and 2.858

minutes respectively with a run time of 6 minutes.

The OPA buffer, MeOH in the ratio of (65:35)

adjusted to pH- 3.0 was chosen as the mobile phase.

The run time of the HPLC procedure was 6 minutes at

flow rate of 1.2ml/min was optimized which gave

sharp peak, minimum tailing factor. The system

suitability parameters were shown in Table 1 were in

within limit, hence it was concluded that the system

was suitable to perform the assay. The method shows

linearity between the concentration range of 50-

150µg/ml for Rosuvastatin and Fenofibrate. The

experimental results were shown in table 6 and

fig.6&7.

The % recovery of Rosuvastatin and

Fenofibrate was found to be in the range of 98.00 to

101.00 % and 98.00to 101.00% respectively. As there

was no interference due to excipients and mobile

phase, the method was found to be specific. As both

compounds pass the peak purity, the method was

found to be specific. The method was robust and

rugged as observed from insignificant variation in the

results of analysis by changes in Flow rate, column

oven temperature, mobile phase composition and

wave length separately and analysis being performed

by different analysts. The results were shown in Table

5. The LOD and LOQ values were calculated based

on the standard deviation of the response and the slope

of the calibration curve at levels approximately the

LOD and LOQ. The limit of detection was obtained as

0.0053µg/mL for Rosuvastatin and 0.00019µg/mL for



Fenofibrate. The limit of quantitation was obtained as

0.017µg/mL for Rosuvastatin and 0.00063µg/mL for

Fenofibrate which shows that the method is very

sensitive.

Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions

Instrument Waters e2695 Alliance HPLC with Empower2 software

Column C18 Hypersill ODS (250×4.6mm.5µ)

Detector PDA Detector 2998

Diluents Methanol

Mobile phase Methanol :OPA buffer pH 3.0(35:65)

Flow rate 1.2ml/min


Temperature 25°c


Retention time Rosuvastatin:1.950; Fenofibrate:30858

Theoretical plate count Rosuvastatin:4726; Fenofibrate:3170

Tailing factor Rosuvastatin:1.138; Fenofibrate:1.400

USP Resolution 10.310

Table.2.Specificity study

Name of the solution Retention time in min

Blank No peaks

Rosuvastatin 1.950

Fenofibrate 3.858

Table.3.Recovery data

Table.3a.Recovery data of the proposed Rosuvastatin

Spiked level Sample

weight

Sample area μg/ ml

added

μg/ ml found % Recovery % Mean

50% 732.00 1132260 29.400 29.71 101

100 100% 1464.00 2203343 57.800 57.81 98

150% 2196.00 3363910 88.200 88.25 100

Table.3b.Recovery data of the proposed Fenofibrate

Spiked level Sample

weight

Sample area μg/ ml

added

μg/ ml found % Recovery % Mean

50% 732.00 10666213 950.400 951.38 100

100 100% 1464.00 21488849 1900.800 1916.72 100

150% 2196.00 31569646 2851.00 2815.89 99

Table.4.Results of Precision study


RT Peak area

Rosuvastatin

1 1.941 2255177

2 1.944 2252365

3 1.941 2223745

4 1.938 2223773

5 1.938 2252119

6 1.938 2252119

Mean 2243216

%RSD(NMT 2.0) 0.72

Fenofibrate

1 3.838 21070608

2 3.838 21107354

3 3.836 21246011

4 3.831 21284382

5 3.830 21532673

6 3.830 21532673

Mean 21295617

%RSD(NMT 2.0) 0.94



Table.5.Robustness studies

Table.5a.Robustness data for Rosuvastatin

Parameter RT Theoretical plates Asymmetry

Decreased flow rate 2.205 2670 1.474

Actual flow ate 1.950 3233 1.403

Increased flow rate 1.752 2473 1.502

Decreased temperature 2.358 2567 1.461

Actual temperature 1.950 3233 1.403

Incrased temperature 2.659 3045 1.486

Table.5b.Robustness data for Fenofibrate

Parameter RT Theoretical plates Asymmetry

Decreased flow rate 4.366 4011 1.218

Actual flow ate 3.858 4734 1.128

Increased flow rate 3.426 3658 1.244

Decreased temperature 4.874 3729 1.266

Actual temperature 3.858 4734 1.128

Incrased temperature 5.317 4770 1.313

Table.6.Linearity data

Table.6a.Linearity data of the Rosuvastatin

S.No Conc(μg/ml) RT Area

1 50 1.930 1136335

2 75 1.922 1691065

3 100 1.917 2259388

4 125 1.916 2817812

5 150 1.916 3386369

Std.dev 889685

Slope 22507

Intercept 7467

Correlation coefficient (r2) 0.999

Table.6b.Linearity data of the Fenofibrate

S.No Conc(μg/ml) RT Area

1. 50 3.801 10624304

2. 75 3.786 15847690

3. 100 3.784 21180479

4. 125 3.789 26450357

5. 150 3.798 31769938

Std.dev 8363306

Slope 21157

Intercept 16980

Correlation coefficient (r2) 0.999


Name LOD LOQ

Rosuvastatin 0.0053 0.017

Fenofibrate 0.00019 0.00063

Rosuvastatin Fenofibrate



Figure.1.Typical Chromatogram of standard Rosuvastatin and Fenofibrate

Figure.2.Typical chromatogram of Rosuvastatin and Fenofibrate tablets in marketed formulation

Figure.3.Linearity of Rosuvastatin

Figure.4.Linearity of Fenofibrate

CONCLUSION

A new validated RP-HPLC method has been

developed for the quantitative and Qualitative

determination of Rosuvastatin and Fenofibrate in

tablet dosage forms in bulk and pharmaceutical

dosage forms was established. The method was

completely validated shows satisfactory results for all

the method validation parameters tested and method

was free from interferences of the other active

ingredients and additives used in the formulation.

Infact results of the study indicate that the developed

method was found to be simple, reliable, accurate,

linear, sensitive, economical and reproducible and

have short run time which makes the method rapid.

Hence it can be concluded that the proposed method

was a good approach for obtaining reliable results and

1136335

1691065

2259388

2817812

3386369 y = 21157x + 16980 R² = 0.99999

0

500000

1000000

1500000

2000000

2500000

3000000

3500000

4000000

0 50 100 150 200

Are

a

Axis Title

Linearity Of Fenofibrate



found to be suitable for the routine analysis of

Rosuvastatin and Fenofibrate in Bulk drug and

Pharmaceutical formulations.

ACKNOWLEDGEMENT

The authors would like to thank beloved parents and

all my well wishers, one and all who have helped me

directly and indirectly in completing this project work.

REFERENCES

D A Skoog. J. Holler, T.A. Nieman, Principle of

Instrumental Analysis, 5th edition, Saunders College

Publishing, 1998, 778-787.

Gurdeep Chatwal, Sahm K. Anand, Instrumental

methods of Chemical Analysis, 5th edition, Himalaya

publishing house, New Delhi, 2002, 1.1-1.8, 2.566-

2.570

H.H. Willard, L.L. Merritt, J.A. Dean, F.A. Settle,

Instrumental Methods of Analysis, 7th edition, CBS

publishers and Distributors, New Delhi, 1986, 518-

521, 580-610.

Hiren N. Mistri, S, C.Seetman, C.Saravanan, Rajiv

Sharma, K.Mukkanti, Developed simultaneous

quantification of Rosuvastatin and Fenofibrate in

human plasma by Mass spectroscopy. International

Journal of Chem Tech Research, 2011, 3(1), 2011,

455-463.

John Adamovies, Chromatographic Analysis of

Pharmaceutical, Marcel Dekker Inc. New York, II Ed,

74, 5-15.

John Wiley, Mahesh

Duggamati,B.Dejaegher,Development and validation

of a LC–MS–MS method for simultaneous

determination of Rosuvastatin and Fenofibrate in

tablet dosage form, Acta pharmacutica Sinica B, 2(6),

2008, 345-355.

Sharma BK, Instrumental methods of chemical

analysis, Introduction to analytical chemistry, 23th

edition, Goel Publishing House Meerut, 2004, 12-23.

Skoog, Holler, Nieman,

Principals of Instrumental Analysis, 5thEdition,

Harcourt Publishers International Company, 2001,

543-554.

Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A new development and validated RP-HPLC method for the assay and related

substances of Itraconazole in capsule dosage form Sarvani Paruchuri*, Haritha Pavani K


*Corresponding author:Email:[email protected]

ABSTRACT

The present investigation reveals about a simple, economic, selective, precise and accurate reverse

phase high performance liquid chromatography method for analysis of Itraconazole and Related

Substances of Itraconazole was developed and validated according to ICH guidelines. Itraconazole was

well separated using ThermoHypersil BDS C18, 150mm Χ 4.6 mm, 5µm column for assay quantification

in isocratic mode with mobile phase comprising of buffer: Acetonitrile (65:35) with a flow rate of

1.5ml/min and ThermoHypersil BDS C18, 100 mm x 4.6 mm, 3 µm column for Related substances

quantification in gradient mode with mobile phase comprising of 0.08M tetra butyl ammonium hydrogen

sulphate: Acetonitrile with a flow rate of 1.5ml/min. the retention time was found to be 6.2min and %

assay was found to be 99.9%. The percentage recovery was found to be 99.6 to 101.2%. Proposed method

was validated for precision, accuracy, linearity, range, specificity and robustness. The drug was subjected

to forced degradation and stability studies. The drug was found to be stable for 4 days in Assay and for 3

days in Related compounds determination.

This method was appropriate for the purpose of quantitating Itraconazole in Drug Product and the

Related Substances of Itraconazole in the Finished Product and has been successfully validated.

Key words: Itraconazole, HPLC, Method development, Method validation, Analysis

INTRODUCTION

Itraconazole is a (1-(butan-2-yl)-4-{4-[4-(4-

{[2R,4S)-2-(2,4-dichlorophenyl)-2-(1H-1,2,4 triazole-

1- ylmethyl) 1, 3 – dioxolan – 4 -yl] methoxy}phenyl)

piperazin -1-yl ] phenyl} 4, 4-dihydro-1H-1,2,4-

triazole-5-one) is member of the drug class known as

anti-fungal. It is used for the inhibition of fungal

cytochrome p450 enzyme “lanosterol 4 demethylase”,

used in the conversion of lanosterol to ergosterol,

which is a main sterol in fungal cell membrane, thus

inhibits replication and promotes cell death in case of

the yeast cells transformation into hypothetically

invasive hyphae.



Itraconazole which include UV spectroscopy, Reverse

Phase High Performance Liquid Chromatography,

Ultra Pressure Liquid Chromatography, LCMS,

HPTLC methods. The present study illustrate

development and validation of simple, economical,

selective, accurate, precise RP-HPLC method for the

determination of Itraconazole and Related Substances

of Itraconazole in pharmaceutical dosage forms as per

ICH guidelines. The goal of the present study is to

develop rapid, economical HPLC method for the

analysis of Itraconazole in pharmaceutical dosage

form using most commonly employed column (C18)

and simple mobile phase preparation. In the present

work a successful attempt had been made to develop a

method for the determination of Itraconazole in

pharmaceutical dosage form and validate it. The

method would help in estimation of the drug in single

run which reduces the time of analysis and does not

require separate method for the drug. Thus the paper



form.


Quantitative HPLC was performed on

Schimadzu 2010 CHT system connected with UV

Visible detector and LC solution software. The drug

analysis data were acquired and processed using LC

solution software running under windows XP on a

Pentium PC and thermohypersil BDS C18 column of

dimension 150 Χ 4.6, 5µm particle size. In addition an

analytical balance (Mettler Toledo 0.1mg sensitivity),

digital pH meter (Polmon), and an ultra sonicator were

used in this study.

Standards and Chemicals used: Itraconazole pure

sample was taken as a gift sample from local labs and

dosage forms “Sporanox” marketed by Janssen

Pharmaceuticas was purchased from local pharmacy.

Other chemicals all are of HPLC grade.

Preparation of Mobile Phase: A suitable quantity of

degassed mixture of buffer and acetonitrile in the ratio

of 65:35 was prepared and filtered through 0.45µ filter

under vaccum filtration. (27.2gm of tetra butyl

ammonium hydrogen sulphate was prepared in

1000ml volumetric flask and is used as buffer)

Preparation of Diluent: Prepare 99:1 mixture of

Methanol and Hydrochloride (v/v)



Preparation of Standard stock solution: About

25mg of itraconazole working standard was taken into

a 50ml volumetric flask and add 30ml of diluent and

sonicate to dissolve. Make up the volume with diluent

to get a concentration of 500µg/ml. From this solution

5ml was taken in to 25ml volumetric flask and make

up the volume with diluent to get a concentration of

200 µg/ml.

Preparation of Sample Solution: The average fill

weight was determined for 20 capsules was added

weigh 25mg equivalent of itraconazole was taken and

transferred in to 50ml volumetric flask. Add 30ml of

diluent and sonicate to dissolve and make up the

volume with diluent. From this solution 5ml was taken

in to 25ml volumetric flask and make up the volume

with diluent to get a concentration of 200 µg/ml.

Method optimisation: The chromatographic

separation was performed using Hypersil BDS C18

(150×4.6mm, 5µm) column. For selection of mobile

phase, various mobile phase compositions were

observed for efficient elution and good resolution. The

mobile phase consisting of Tetra Butyl Ammonium

Hydrogen Sulphate and acetonitrile in the ratio of

65:35 was found to be the optimum composition for

efficient elution of analyte. The mobile phase was

injected to the column at a flow rate of 1.5 ml/min for

12min. The column temperature was maintained at 35

± 10C. The analyte was monitored at 225nmusing UV-

detector. The retention time of the drugs was found to

be 6.2min. 99:1% of methanol and HCl was used as

diluent.

Figure.1.Structure of Itraconazole


Method validation:

System suitability:System suitability of the HPLC

was conducted to find out the system performance and

the results we are getting were accurate.




range. The linearity of Itraconazole was in the

concentration range of 10-200µg/ml. From the




The regression coefficient was found to be 1.000 and

shows good linearity for the drug.






preparations at a concentration of 200ppm/ml. The

results were tabulated in table No 3









of the drug.

Forced degradation of Itraconazole:

Acid/base hydrolysis: Weigh 25mg equivalent of

Itraconazole and transfer into 50ml volumetric flask.

To this add 2.5ml of 5N HCl/NaOH and place in a

water bath at about 600c for about 1hr with occasional

shaking. After 1hr, add about 2.5ml of 5N NaOH/HCl

to neutralize, to this add 10ml of Diluent. Sonicate for

30min and allow the solution to equilibrate to room

temperature and dilute with diluent and mix well.

Pipette 5.0ml of the above solution into a 25ml

volumetric flask, dilute to volume with diluent. The

results were tabulated in table No 4 and the

chromatogram was shown in fig no7,8

Oxidative degradation: Weigh 25mg equivalent of


To this add 2.5ml of 1%H2O2 and place in dark for

about 1 day. After 1 day add about 10ml of diluent,

sonicate for 30min and allow the solution to

equilibrate to room temperature and then dilute with

Diluent and mix well. Pipette 5.0ml of the above

solution into a 25ml volumetric flask, dilute to volume

with diluent. The results were tabulated in table No 4

and the chromatogram was shown in fig no 9

Thermal degradation: Weigh 25mg equivalent of


Place it in oven at 1050C and let stand for 24hrs. After

24hrs, add 30ml of diluent and sonicate with

occasional shaking for 30min and allow the solution

to equilibrate to room temperature and then dilute

with diluent and mix well. Pipette 5.0ml of the above


with diluent.

Photolytic degradtion: (UV/LUX): Itraconazole

samples were prepared and the solutions were exposed

to light to determine the irradiation of light on the

stability of the solution. Approximately 200mg of the

drug powder was taken and is spread as a thin layer



and is placed in a photo stability chamber at 200watt

hr/sq mt. After attaining 200 watt hours/sq

mt/1.2million LUX hrs, quantitatively transfer a

portion of the pellets equivalent to about 25mg of

itraconazole into a 50ml volumetric flask and add

30ml of diluent and sonicate, and then dilute to

volume with diluent and mix well. Pipette 5.0ml of the

above solution into a 25ml volumetric flask, dilute to

volume with diluent.

Stability: Analyse the stored samples and standards.

Evaluate the stability of the stored stability solutions

by quantitating the amount of itraconazole found in

the stored solutions against freshly prepared standard

after one to seven days of storage and test atleast 3

days.

Filter study: Make one injection of the filtered

diluent, the filtered standard fractions, the unfiltered

standards, the filtered sample fractions and the

centrifuged sample fractions. Calculate, as area

percentage of the average area from system suitability

working standard injections, any peaks found in the

retention time window of itraconazole from the

filtered diluent blank injections. The percentage

recovery for the filtered standards was calculated, the

unfiltered standards, and the filtered sample and

centrifuged samples.

Discussions: Several trials has made until getting

good peak resolution, acceptable plate count and

tailing factor. Method was optimized and the retention

time was reported as 6.12 minutes.

System suitability: For the system suitability studies

it was found that the %RSD was found to be 0.8%,

theoretical plates 5623, and tailing factor 1.1.

Linearity: From the linearity data it was observed

that linearity concentration range was 500µg/ml.

Correlation coefficient was found to be 1.000

Precision: The percentage RSD for sample was found

to be 0.2

Accuracy: The recovery of pure drug from the

analysed solution of formulation was found to be

100.2%.

Specificity: The chromatograms of standard and

sample are identical with nearly same Retention time.

No interference due to Placebo and Sample at the

retention time of analyte which shows that the method

was specific

Robustness: The %RSD of retention time was within

the limits for variation in flow rate (1.3ml and 1.7ml).

Hence the flow rate should be between 1.3ml to

1.7ml. The % RSD of retention time was within the

limits for variation in pH (1.3 and 1.7) hence the pH

should be with in 1.3 and 1.7. The %RSD of retention

time was within the limits for variation in Buffer

composition (63:37 and 67:33). The system suitability

requirements were met for the method specified

parameters. The % itraconazole found was between

97.0% and 103.0%.

Filter Study: The mean recovery from the filtered

standards was within of the mean from the

unfiltered standards. The mean recovery from the

filtered samples was with in of the mean from

the centrifuged samples

Methods for related substances validation:

Preparation of mobile phase: Mobile phase was

introduced in gradient mode.

Mobile phase A: 0.08M tetra butyl ammonium

hydrogen sulfate (27.2 g of tetra butyl ammonium

hydrogen sulfate per 1000 mL volume of preparation.

Add DI Water and stir to mix. No pH adjustment is

required.)

Mobile phase B: Acetonitrile

Gradient programme

Time

(min)

Mobile phase

A (%)

Mobile Phase

B (%)

0 80 20

20 50 50

25 50 50

30 80 20

35 80 20

Preparation of diluent: In a suitable flask, prepare a

1:1 mixture of methanol and tetrahydrofuran (v/v).

Preparation of Standard Solution: 50mg of

Itraconazole working standard was transferred into

25ml volumetric flask. From this take 5ml of the

solution and transferred to 100ml volumetric flask.

From the above solution transfer 10ml of the solution

in to 100ml volumetric flask to make a concentration

of 10µg/ml

Preparation of sample Solution: Determine the

average fill weight of 20 capsules and weigh 500mg

equivalent of itraconazole and transfer into 100ml

volumetric flask and add 70ml of diluent and sonicate

and dilute to volume with diluent and mix well

(Concentration: 5000µg/ml Itraconazole).

Method optimisation: The chromatographic

separation was performed using Hypersil BDS C18

(100×4.6mm, 3µm) column. For selection of mobile

phase, various mobile phase compositions were

observed for efficient elution and good resolution. The

mobile phase consisting of 0.08MTetra Butyl

Ammonium Hydrogen Sulphate and acetonitrile in

gradient phase was found to be the optimum

composition for efficient elution of analyte. The

mobile phase was injected to the column at a flow rate

of 1.5 ml/min for 35min. The column temperature was

maintained at 30 ± 10C. The analyte was monitored at



225nmusing UV-detector. The retention time of the

drugs was found to be 12.2min. 99:1% of methanol

and HCl was used as diluent. The optimised

chromatographic conditions were mentioned in Table

No 1 and the chromatograms were shown in Fig 10,

11 and 12


Method validation:

RRT and RRF: (Relative retention time, relative

retention factor):

Impurity B and Impurity G Stock Standard

Solution: 25mg of itraconazole WRS was transferred

into 50ml volumetric flask. From this take 5ml of the

solution and transferred to 100ml volumetric flask.

Working Itraconazole standard solutions with

impurities: Prepared 50, 100, 200% of proposed

specification level concentration by preparing aliquot

solutions of 2.5, 5 and 10ml of impurity standard

stock solution into 100ml volumetric flask

individually and dilute to volume with diluent and mix

well.




range. The linearity of Itraconazole was in the

concentration range of 20-300µg/ml. From the




The regression coefficient was found to be 1.000 and

shows good linearity for the drug.






preparations at a concentration of 5000µg/ml.









of the drug.

Forced degradation of Itraconazole:

Acid/base hydrolysis: Weigh 500mg equivalent of


To this add 2.5ml of 5N HCl/NAOH and place in a

water bath at about 600c for about 1hr with occasional

shaking. After 1hr, add about 2.5ml of 5N NAOH/HCl

to neutralize, to this add 10ml of diluent. Sonicate for

30min and allow the solution to equilibrate to room

temperature and dilute with diluent and mix well.

Pipette 5.0ml of the above solution into a 25ml

volumetric flask, dilute to volume with diluent.

Oxidative degradation: Weigh 500mg equivalent of


To this add 10ml of 30%H2O2 and place in water bath

at 800c for 4 hrs. After 4hrs add about 60ml of diluent,

sonicate for 30min and allow the solution to

equilibrate to room temperature and then dilute with

Diluent and mix well. Pipette 5.0ml of the above


with diluent.

Thermal degradation: Weigh 500mg equivalent of

itraconazole and transfer into 100ml volumetric flask.

Place it in oven at 1050C and let stand for 24hrs. After

24hrs, add 70ml of diluent and sonicate with

occasional shaking for 30min and allow the solution

to equilibrate to room temperature and then dilute

with Diluent and mix well. Pipette 5.0ml of the above


with diluent. The results were tabulated in table No 4

and the chromatogram was shown in fig no16

Photolytic degradtion: (uv/lux): Itraconazole

samples were prepared and the solutions were exposed

to light to determine the irradiation of light on the

stability of the solution. Approximately 1000mg of the

drug powder was taken and is spread as a thin layer

and is placed in a photo stability chamber at 200watt

hr/sq mt. After attaining 200 watt hours/sq

mt/1.2million LUX hrs, quantitatively transfer a

portion of the pellets equivalent to about 25mg of

itraconazole into a 50ml volumetric flask and add

30ml of diluent and sonicate, and then dilute to

volume with diluent and mix well. Pipette 5.0ml of the

above solution into a 25ml volumetric flask, dilute to

volume with diluent.

Filter study: Three of the six 100% Accuracy

Samples prepared in Intermediate Precision were

used. Place an aliquot from the three preparations into

three 15-mL volumetric flasks and spin at high speed

for 5 minutes. Remove an aliquot of the supernatant

and place in an auto sampler vial for analysis. Remove

a second aliquot from each of the three preparations

and individually filter and analyse

Preparation of Filter Blanks: Filter the Diluent

through a 0.45 m Nylon (Millipore Brand) filter, fill

an auto sampler vial for analysis. Repeat this two

more times using a new 0.45 m Nylon (Millipore

Brand) filter each time.

Stability of standard and sample solutions:

Specificity – known impurities: The method was

shown to be specific with regards to the Known



Impurities of Itraconazole with a Resolution between

adjacent peaks of 14.1, 4.5, 4.2, 6.8, 4.6, 3.9 and 6.7.

The Acceptance Criteria for the determination of RRT

and RRF was met for all the Known Impurities.

Specificity – placebo: The method was shown to

have a 0.05% of Placebo interference, thus the method

was shown to be specific with regards to the Placebo.

Specificity – forced degradation: The method was

shown to be capable of resolving the Known and

Unknown peaks from each other and from the

Itraconazole peak. The Peak Purity data confirmed

that all peaks detected were pure.

Linearity and range: The method was shown to be

Linear (Correlation Coefficient of 1.0000) over a

Range of 20% to 300% of the Working Standard

Concentration which corresponds to the 2.00 µg/mL

to 30.00 µg/mL of the Test concentration.

Precision - injection repeatability: The method was

shown to have a 0.8% RSD for 10 replicate working

standard injections thus demonstrating acceptable

Injection Reproducibility.

Precision - analysis repeatability: The method was

shown to have a 0.8% RSD for Impurity-B, 0.7%

RSD for Impurity-G. Spiking/Recoveries at the

proposed specification limit for each known impurity

thus demonstrating acceptable analysis

reproducibility.

Intermediate precision – ruggedness: A second

Analyst on a different day, using a different HPLC

and a different column serial number was able to

reproduce Mean Recoveries and %RSD as the first

Analyst thus demonstrating method Ruggedness. The

difference in the mean recovery between analysts was

not greater than 10.0% for each Known Impurity. The

method was found to be Rugged.

Accuracy and recovery from placebo: The method

was shown to be Accurate and Precise by the

successful demonstration of spiking and recovering

the Known Impurities at 50%, 100% and 200% Levels

of the proposed specification limit concentrations. The

mean recovery of replicate preparations at each

spiking level was between 85.0% and 115.0%. The

%RSD at each level was not greater than 10.0%. The

Accuracy and Recovery of this Method was found to

be acceptable.

Robustness: The method was shown to be Robust

with regards to Flow Rate and Organic Phase

composition.

Filter Study: The use of 0.45 µm Nylon Membrane

Filters from Millipore was shown not to contribute

additional components or to absorb the Known

Impurities as long as at least 3-mL of filtrate was

discarded.

There were no new peaks found in the Filtered

Diluent.

Stability of standard and sample solutions: The

Standards and Sample Solutions were shown to be

stable for a period of 3 days at room temperature. Table.1.Optimised chromatographic conditions

Parameters Assay Related substances

Column Thermohypersil BDS C18

150Χ4.6mm, 5µm

Thermohypersil BDS C18 100Χ4.6mm, 3µm

Mobile phase Buffer: ACN (65:35) M.P A: 0.08M tetra butyl ammonium hydrogen

sulphate M.P B: ACN

Flow rate 1.5ml/min 1.5ml/min

Wave length UV at 225nm UV at 225nm

Injection volume 10µl 10µl

Column temperature 250 c 300 c

Run time 12min 35min

Table.2.Linearity data

Assay Related substances


10 168080 6.14 20 36127 11.46

25 424817 6.13 50 92550 11.05

50 849375 6.13 100 180452 10.84

100 1675595 6.14 150 268940 10.69

150 2502949 6.13 200 359644 10.62

200 3339989 6.14 300 544138 10.58

Correlation coefficient = 1.000 Correlation coefficient – 1.000

Intercept = 8150 Intercept = -16



Table.3.Validation parameters

Parameters Assay Related substances

Linearity 10-200mcg/ml 20-300mcg/ml

Precision (%RSD) 0.2 0.8,1.5

Accuracy 100.2 101.2,101.0

Assay 99.9 101.0

Ruggedness(%RSD) 0.33 1.3,1.8

Table.4.Forced degradation studies

Parameter Assay Related substances

Stress Time Rt Time Rt

Imp B Imp G Drug

As such 24hrs 6.2 24hrs 8.49 16.43 12.42

Acid 2hrs 6.19 6hrs 8.53 16.47 12.49

Base 2hrs 6.20 2hrs 8.67 16.38 12.45

Oxidation 24hrs 6.21 4hrs 8.53 16.46 12.47

Photolysis Until attaining

of temperature

6.2(UV)

6.22(LUX)

Until attaining

of temperature

8.46(UV)

8.59 (LUX

16.6 (UV)

16.72 (LUX)

12.63 (UV)

12.74 (LUX)

Thermal 24hrs 6.22 24hrs 8.81 16.56 12.57

Table.5.Filter study

Parameter Name Assay Related substances

Area Rt Area Rt

Centrifuged Impurity B - - 566978 8.97

Impurity G - - 66778747 12.78

Itraconazole 1555452 6.23 357711 16.62

Filtered Impurity B - - 5566193 8.87

Impurity G - - 71257184 12.67

Itraconazole 1571516 6.23 358784 16.51

Table.6.Solution stability

parameter Assay Related substances

Area Rt Name Area Rt

Day 1

1710459

6.07 Impurity B 532302 8.18

Impurity g 366761 15.80

Itraconazole 57636383 11.92

Day 2

1703686

6.09 Impurity B 556700 8.16

Impurity G 385432 15.79


Day 3

1710149

5.97 Impurity B 610776 8.16

Impurity G 415865 15.78


Day 4

1761776

6.19 Impurity B - -

Impurity G - -

Itraconazole - -

Day 7

1943533

6.13 Impurity B 673402 8.48

Impurity G 422648 16.18


Figure.1.Chromatogram of sample Figure.2.Chromatogram of standard



Figure.3.Linearity plot Figure.4. Photolytic degradation (UV)

Figure.5. Photolytic degradation(LUX) Figure.6. Thermal degradation

Figure.7. Acid degradation Figure.8. Base degradation

Figure.9.Oxidative degradation Figure.10.Chromatogram of blank



Figure.11.Chromatogram of std Figure.12. Chromatogram of sample

Figure.13. Linearity plot Figure. 14. Photolytic degradation (UV)

Figure.15. Photolytic degradation (LUX) Figure.16. Thermal degradation

Figure.17. Acid degradation Figure.18.Base degradation

CONCLUSION finally it concludes that all the parameters are within

the limits and meet the acceptance criteria of ICH

guidelines for method validation. The proposed



validated and can be used for routine and stability

sample analysis.



REFERENCES

Beckett and Stenlake, Chromatography, Beckett A.H,

editor, Practical pharmaceutical chemistry, 4th ed,

New Delhi, CBS publishers; 2007, 157 – 161

Guru deep R. Chatwal, Sham K Anand, High

performance liquid chromatography, Arora M, editor,

Instrumental Methods of Chemical Analysis, 5th ed,

Mumbai, Himalaya Publishing House Pvt ltd, 2009,

624 – 638

Thirumala K et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa

paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on

wistar rats Thirumala K

*, Janarthan M, Firasat Ali M

Nimra College of Pharmacy, Vijayawada, India


ABSTRACT

The anti-urolithiatic activity of the Aqueous extract of the stem core of Musa paradisiaca (family:

musaceae) was investigated on Ethylene glycol and ammonium chloride induced on albino rats. A

comparison was made between both plant extract and a known anti urolithiatic drug cystone (5mg/kg-1

).

The dried powder ofstemcore of Musa paradisiaca was subjected to extraction by continuous hot

extraction method using Distilled water as a solvent. Phytochemical estimation was done for the presence

of phytoconstituents. Dose selection was made on the basis of acute oral toxicity study (200mg/kg-1

,

400mg/kg-1

bodyweight) as per OECD guidelines. Oral administration of extract of Musa paradisiaca for

28days resulted in significant reduction in urine level. Ethylene glycol and Ammonium chloride induced

lithiatic rat model and oral urine tolerance test (OUTT) model was used for evaluation of anti lithiatic

activity. The biochemical parameters were analysed. All rats in the lithiatic groups had urine and serum

levels well within the lithiatic range, at the initial stage of the experiment but after four weeks of

treatment with extracts or cystone the urine, serum significantly dropped in dose-dependent manner. The

results suggest that the aqueous extracts of the Stem core of Musa paradisiaca restored the metabolic

changes in Ethylene glycol and ammonium chloride lithiatic rats.

Key words: Musa paradisiacal, cystone, ethylene glycol andammonium chloride, anti-urolithiatic

activity

INTRODUCTION

Urolithiasis also called Nephrolithiasis or

kidney stone. Urolithiasis is the presence of calculi in

the urinary tract. Renal stone disease affects up to

15% of men and 6% of women. Eighty percent of

calculi are composed of calcium (either oxalate or

phosphate), with others composed of struvite, uric

acid or cystine (Bihl G, Meyers A-2001)

approximately one million Americans develop a

kidney stone each year and an estimated 12% of the

population forms a stone some time during their life

(Gerstenbluth RE, Resnick ML-2004). Approximately

0.1–0.4% of the population is believed to have kidney

stones every year in the USA and Europe; about 2–5%

of the population in Asia, 8–15% in Europe and North

America, and 20% in Saudi Arabia develop renal

stones in their lifetime (Pak CYC-1998) Kidney

stones occur more frequently with increasing age and

among men. Within ten years, the disease usually

recurs in more than 50% of patients. Nowadays, about

80% of all kidney stones contain calcium salts

(calcium oxalate and/or calcium phosphate) as their

main crystalline components. Because human urine is

commonly supersaturated with respect to calcium salts

as well as to uric acid, crystalluria is very common,

i.e. healthy people excrete up to ten millions of

microcrystals every day. Recurrent stone formers

appear to excrete lower amounts or structurally

defective forms of crystallization inhibitors which

allows for the formation of large crystal aggregates as

precursors of stones. Alternatively, crystal adhesion to

urothelial surfaces may be enhanced in stone formers.

(Hess B.)


Chemicals: Cystone (Himalaya Lab., India.), ethylene

glycol and ammonium chloride and all other reagents

used were of analytical grade

Plant material: The stem core of Musa paradisiaca

were collected from Sugguna lanka, near to

tenali,Guntur district (A.P). The plant material was

identified and authenticated by Dr.Madhava chetty

department of Botany, SV. University Tirupathi

Chitoor (dist).

Preparation of plant extraction: The collected stem

core was shade dried and powdered in mixer grinder

to get coarse powder. The powdered plant material

(100gms) was extracted with Distilled water by using

soxhlet apparatus. The extract was air dried to

evaporate solvent

Phytochemical screening: The preliminary

phytochemical screening of aqueous extract of Musa

paradisiaca was carried by using standard procedures.

Acute Toxicity Study: toxicity studies were

performed according to OECD-423guidelines.

http://www.scialert.net/asci/result.php?searchin=Keywords&cat=&ascicat=ALL&Submit=Search&keyword=diabetic+rats



Experimental model: Ethylene glycol and

ammonium chloride was weighed individually for

each animal according to their body weight and

solubilised with saline just prior to injection. Lithiasis

was induced by injecting it at a dose of 200 mg/kg

body weight Orally. The animals were kept under

observation and after 24 hrs urine level level was

measured. The lithiatic rats (urine level 200-300

mg/dl) were separated and divided into five different

groups for experimental studies, with each group

containing six animals. Present study has confirmed

that the treatment of aqueous extract of Musa

paradisiaca for a period of 4weeks caused a

significant decreased in urine, serum levels) of

lithiatic rats 200&400 mg/kg of plant extract were

screened for anti lithiatic activity against ethylene

glycol and ammonium chloride induced lithiatic rats.

It produced significant anti lithiatic activity in a dose

dependent manner. The animals treated with ethylene

glycol and ammoniumchloride had low urine level.

The anti urolithiatic activity exhibited by extract was

compared with that of standard drug (cystone).

Experimental design:

The rats were divided into five groups each consist of

six rats. Significant lithiacis was achieved within 24

hrs after ethylene glycol and ammonium chloride (200

mg/kg body weight oral) injection.

Group I- Served as normal control and did not receive

any treatment

Group II- Served as lithiatic control and received

Inducer (ethylene glycol and ammonium chloride-

200mg/kg) and vehicle

Group III- Ethylene glycol and ammonium chloride +

cystone (5 mg/kg p.o.) and served as standard

Group IV- ethylene glycol and ammonium chloride +

AEMP extract (200 mg/kg, p.o.)

Group V- ethylene glycol and ammonium chloride +

AEMP extract (400 mg/kg, p.o.)

Statistical Analysis: The result of the study were

subjected to one way analysis of variance (ANOVA)

fallowed by Dunnet’s test for multiple comparisions.

Values with p<0.05 were consider significant.


Phytochemical Screening: Phytochemical screening

of Aqueous extract of Musa paradisiaca showed the

presence of various chemical constituents mainly

alkaloids, Proteins, glycosides, and saponins. Extract

may be responsible for antilithiatic properties. The

results obtained were comparable and satisfied the

standard literature.

Acute oral toxicity studies: In the present study the

AEMP was subjected for toxicity studies. For the

LD50 dose determination was administered the dose

level of 1000 mg/kg and 2000 mg/kg body weight and

both doses did not produce any mortality. Hence one-

fifth of the dose tested i.e. 200mg/kg and 400mg/kg

body weight was selected for the study in order to

ascertain a scientific base for the useful of this plant in

the treatment of lithiasis. It was decided to evaluate

experimental design of an activity by Ethylene glycol

and ammonium chloride induced model.

Anti-urolithiatic activity:

Ethyleneglycol and ammonium chloride lithiatic

model: The anti-urolithiatic effect of AEMP in

ethylene glycol and ammoniumchloride induced

lithiatic animals is presented. The results showed that

after single dose treatment of the extract in individual

group of ethylene glycol and ammonium chloride

induced rats; there was a significant reduction in

serum, urine levels throughout the entire period of

study (28 days) as compared to lithiatic, control

group. Musa paradisiacal stem core extract were

screened for antilithiatic activity in rats where

ethylene glycol and ammoniumchloride (200 mg/kg,

i.p.) used as the lithiogenetic agent.

The results obtained from the present

investigation demonstrated that the stem core extract

of Musa paradisiaca constantly maintained significant

increase of the urine level in ethylene glycol the

experimental period suggesting the antilithiatic

property of the title plant. Urolithiasis is a chronic

pathological condition characterized by excessive

deposition of minerals in the kidney leading to

formation of large crystals thus obstructing the urine

flow. In the present study, it was observed that the

extract reversed the weight loss of the lithiatic rats.

Different chemicals used to induce Lithiasis in

experimental animals include ethylene glycol (EG),

and ammonium ammonium chloride (Malani M,

1995). To achieve a uniformly high rate of kidney

crystal deposition, the kidney is especially susceptible

to the action of induced ethylene glycol and

ammonium chloride. The dose of 200mg/kg of

ethylene glycol and ammonium chloride can induces

an autoimmune process that results in the destruction

of kidney; it also results in the toxicity.



Table.1.Effect of Musa Paradisiaca on urinary parameters Groups Urinary volume Calcium Magnesium Phosphate Oxalate

Vehicle control 31 ± 1.73 1.25 ± 0.0115 1.30 ± 0.0117 3.54 ± 0.0150 0.49 ± 0.0128

Lithiatic control 15.66 ± 0.05 4.17 ± 0.0192 0.25 ± 0.0066 7.45 ± 0.0114 3.52 ± 0.0079

Standard 30 ± 1.50*** 1.50 ± 0.0076*** 1.23 ± 0.0154*** 3.87 ± 0.0265*** 1.23 ± 0.0076***

Test I 25 ± 0.035*** 3.11 ± 0.0071*** 0.43 ± 0.0031*** 5.37 ± 0.0183*** 2.87 ± 0.0095***

Test II 27 ± 2.14*** 1.97 ± 0.0047*** 1.12 ± 0.0054*** 4.14 ± 0.0182*** 1.76 ± 0.0070***

The values are expressed in Mean ± SEM value.

Statistical comparisons are made with Dunnett’s comparison test at significance value P<0.0001.

*** (P<0.0001) comparison made with Lithiatic control

Table.2.Effect of Musa paradisiaca on serum parameters

Groups BUN Creatinine Calcium

Vehicle control 36.57 ± 0.0057 0.85 ± 0.0060 6.53 ± 0.1358

Lithiatic control 48.55 ± 0.0135 2.61 ± 0.0453 21.64 ± 0.0060

Standard 37.41 ± 0.0113*** 0.94 ± 0.0095*** 7.85 ± 0.0118***

Test I 43.50 ± 0.0094*** 1.12 ± 0.0114*** 16.13 ± 0.0126*** Test II 38.93 ± 0.0192*** 1.05 ± 0.0136*** 9.23 ± 0.0067***

The values are expressed in Mean ± SEM value


*** (P<0.0001) comparison made with Li

Table.3.Effect of Musa paradisiaca on tissue parameters Groups SOD Catalase GSH MDA (LPO)

Vehicle control 7.27 ± 0.0048 33.55 ± 0.0113 17.14 ± 0.0117 175.30 ± 0.0076

Lithiatic control 3.13 ± 0.0105 18.13 ± 0.0169 10.63 ± 0.0067 340.20 ± 0.0058

Standard 6.33 ± 0.0049*** 29.55 ± 0.0127*** 16.27 ± 0.0054*** 147.32 ± 0.0088***

Test I 4.55 ± 0.018*** 21.64 ± 0.0043*** 12.35 ± 0.0094*** 220.34 ± 0.0099***

Test II 5.76 ± 0.0088*** 27.83 ± 0.0070*** 15.75 ± 0.0152*** 199.44 ± 0.0128***

The values are expressed in Mean ± SEM value


*** (P<0.0001) comparison made with Lithiatic control.

CONCLUSION

The results of the present study indicated that

Musa paradisiacal stem core extract

possessessignificant anti lithiatic activity against

ethylene glycol and ammonium chloride induced

lithiatic rats. Thus justifies the traditional use of this

plant in the treatment of diabetes mellitus. Bark

extract of the title plant possesses almost equipotent

anti lithiatic activity when compared with reference

standard Cystone

REFERENCES

Bihl G, Meyers A, Recurrent renal stone disease:

advances in pathogenesis and clinical management,

Lancet, 358, 2001, 651–56.

Gerstenbluth RE, Resnick ML, Medical management

of calcium oxalate urolithiasis, Med Clin North Am,

88, 2004, 431-42.

Hess B, Pathophysiology, diagnosis and conservative

therapy in calcium kidney calculi, Ther. Umsch,

60(2), 2003, 79-87.

Malani M M,Baskar R and Varalaxmi P, Effect of

lupol, a pentacyclic ,tri terpens on urinary enzymes in

hyperoxiluricrats, Jpn J Med Sci Biol, 48(5-6), 1995,

211-220.

Pak CYC, Kidney stones, Lancet, 351, 1998, 1797-

801.

Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Preparation and characterization of bioadhesive vaginal gel of Propranolol

hydrochloride Hardeep Singh Dhaliwal*, Dhruba Sankar Goswami,

Nidhi uppal, Mona Seth, Swati Kashyap, Kapil Sharma,

S.D. College of Pharmacy, Barnala, Punjab, India

*Corresponding author:Email id- [email protected]

ABSTRACT The objective of the present investigation was to prepare and characterize a contraceptive

vaginoadhesive Propranolol hydrochloride gel. To achieve this, various mucoadhesive polymers including

Na CMC (1-4% w/w) and tragacanth gum (1-4% w/w), were dispersed in an aqueous-based solution

containing the drug (0.5% w/w). The mucoadhesive properties of the gels were assessed on sheep vaginal

mucosa in citrate phosphate buffer pH 4 at 37°C. Formulations containing charged functional groups in

their polymeric structure, showed higher mucoadhesive strengths in comparison to those composed of

neutral polymers. In vitro drug release profiles of the gels were determined in citrate phosphate buffer pH

4. Results indicated that, formulation F4 (containing Na CMC 4% w/w), released the drug over 54 hrs,

with a burst release at the initial phase followed by a sustained release pattern. The formulation showed

good bioadhesive strength (24.6±0.05 gm). The %yield was found to be 95.3±0.02. In conclusion,

formulation F4 was considered as the most desirable formulation as it exhibited appropriate

mucoadhesive properties while having the potential of providing a prolonged drug release which is

assumed to render longer contraceptive efficacy.

Key words: Propranolol hydrochloride, Contraceptive gel, Vaginoadhesive, Na CMC, Tragacanth.

INTRODUCTION

Vaginal drug delivery system refers to the

system in which drug formulations are directly applied

in vaginal cavity for producing local action. It is an

important route of drug administration for both

systemic and local effect. The vagina has dense

network of blood vessels and rich blood supply, which

makes the drug absorption so effective. The drug

formulations contain bioadhesive polymers, due to

which drug formulations remain attached to the

vaginal mucosa for longer periods and release drug on

controlled rate. Thus vaginal route is used to treat

vaginal infections, to prevent the sexually transmitted

diseases or for contraception. The main advantages of

vaginal route are local effect, large surface area, rich

blood supply, avoidance of the first pass effect and

self-insertion. For this route semisolid and solid

dosage forms are preferred for good bioadhesion to

prolong the residence time in the vaginal cavity. The

most commonly used mucoadhesive polymers are

synthetic polyacrylates, polycarbophil, chitosan,

cellulose derivatives, hyaluronic acid derivatives,

pectin, tragacanth, carrageenan and sodium alginate.

(Alexander NJ, 2004)

Gels are the semisolid formulations, with

water base (hydrogels), or organic liquid base

(organogels). Hydrogels also possess a degree of

flexibility very similar to natural tissue, due to their

significant water content. These pseudohydrogels

swell infinitely and the component molecules dissolve

from the surface of the matrix. Drug molecules are

released through the spaces in the network and also by

the dissolution and/or disintegration of the matrix.

Mucoadhesive polymers of natural, semisynthetic or

synthetic origin are able to form hydrogels. In the

simplest case the drug is dispersed in a mucoadhesive

polymer, which swells in the presence of water and

exhibits bioadhesive properties. (Kumar L and Verma

R, 2010)

Vaginal gels are used for topical delivery of

contraceptives and anti-bacterial drugs. The desirable

properties of vaginally administered gel against

microbicides are acceptability and feasibility. They

must be easy to use, non-toxic and non-irritating to the

mucus membrane. (Patil SA, 2011)

Propranolol hydrochloride is a β-adrenergic

blocker that is used to treat tremors, angina,

hypertension, heart rhythm disorders etc. Its

bioavailability is very limited (30%) due to the hepatic

first pass effect. Its elimination half life is also

relatively short (3-4 hrs). This drug also possesses

local anesthetic activity of short latency and fairly

long duration and is a potent inhibitor of human sperm

motility in vitro and has a similar effect in vivo in rats.

The concentration of Propranolol hydrochloride,

which inhibits sperm motility by 50%, is 0.3 mM. The

local anesthetic properties of the drug are in fact, the

underlying mechanism which is responsible for

inhibition of sperm motility, rather than its β-blocking

potential. These characteristics give a potential to this



drug for use as a vaginal contraceptive or for

incorporation in an intrauterine contraceptive drug

delivery system, while being devoid of numerous

adverse effects reported from use of other types of

contraceptives. (Hussain A and Ahsan F, 2005)


Propranolol hydrochloride was purchased

from Balaji Drugs, Gujarat. Na CMC, tragacanth,

methyl paraben, propyl paraben, citric acid and

disodium hydrogen phosphate were obtained from

Central Drug House Pvt. Ltd., New Delhi.

Preformulation studies of drug including organoleptic

properties, melting point and flow properties were

studied.

Preparation of bioadhesive vaginal gel: Propranolol

hydrochloride gel formulations were prepared using

sodium alginate and guar gum as gelling agents.

Table.1.Formulation chart of Propranolol bioadhesive gel

Formulation

code

Drug

(mg)

Na CMC

(gm)

Tragacanth

(gm)

Methyl

paraben (gm)

Propyl paraben

(gm)

F1

500

1 -----

0.4

0.6

F2 2 -----

F3 3 -----

F4 4 -----

F5 ----- 1

F6 ----- 2

F7 ----- 3

F8 ----- 4

Gelling agent was dispersed in small quantity of

citrate phosphate buffer [0.1(M), pH 4] and stored

overnight to ensure complete hydration. The drug was

initially dissolved in a mixture of PVP K30 and water

(5:3) and added to polymer dispersion. Methyl

paraben and propyl paraben were also added slowly

with continuous stirring. The final weight of the gel

was adjusted to 100 gm with citrate phosphate buffer

[0.1(M), pH 4]. Entrapped air bubbles were removed

by keeping the gels in vacuum desiccators.

Evaluation of bioadhesive vaginal gel:

Percentage yield: The percent yield was calculated as

the weight of the formulations recovered from each

batch divided by total weight of drug and other all

ingredients used to prepare Formulations multiplied

by 100. The percentage yield of each formulation was

replicated three times. The yield was calculated by the

following formula:

Y={Pm-Zg}/Tm[P+Ig]×100, Where Y = yield, Pm =

practical mass, ZG = vaginal gel, Tm = theoretical

mass, P = polymer and Ig = ingredients. (Chatterjee A,

2011)

Determination of pH: The pH of the gel was

determined by a digital pH meter. 1 gm of gel was

dissolved in 25 ml of distilled water and the electrode

was then dipped in to gel formulation and constant

reading was noted. The measurement of pH of each

formulation was replicated three times. (Nayak SB,

2010)

Syringibility: Syringibility study was carried out by

using a 22 gauze needle. (Yellanki SK, 2010)

Estimation of drug in vaginal gel: About 6 gm of gel

was weighed accurately and dissolved in citrate

phosphate buffer pH 4 of sodium lauryl sulphate (1%

w/v SLS). After appropriate dilutions, the drug

content was analyzed spectrophotometerically at 290

nm. (Nayak S, 2010)

Drug content uniformity: Initially, the formulations

were tested for homogeneity by visual inspection. To

ensure the homogeneity of drug content in the

formulation of the gel, six tubes were sampled from

the different locations of the mixer and assayed for the

drug content as stated above. Studies were performed

in triplicate for all the formulations. (Nayak SB, 2010)

Determination of spreadability: Spreadability study

was carried out by transferring the 6 gm of gel

formulation to the center of a glass plate and

compressed under several glass plates having wt

100±5 gm each after every 1 min and the spread

diameters recoded each time. (Yellanki SK, 2010)

Extrudability study: In conducting the test, a closed

collapsible tube containing above 20 gm of the gel

was pressed firmly at the crimped end and a clamp

was applied to prevent any rollback. The cap was

removed and the gel was allowed to extrude until the

pressure was dissipated. (Nayak SB, 2010)

Bioadhesion measurement: Isolated goat vaginal

tissue (Capra hircus, local breed, obtained

immediately after killing of animals at a slaughter

house) was cleaned and then separated from the

supporting muscular and connective tissues taking

care to maintain integrity of mucosa, and kept at 0°C



till further use. Before experiments, goat vaginal

tissue was thawed in normal saline. The bioadhesion

measurement was performed using a modified balance

method intact with freshly excised goat vaginal

mucosal membrane as an in vitro model. The

two pans of physical balance were removed. Right pan

was replaced with a 100 ml beaker and on left side, a

glass slide was hanged. For balancing the assembly, a

weight of 20 gm was hanged on left side. Another

glass slide was placed below the hanged slide.

Portions of vaginal membranes were attached with

both slides. The height of this setup was so adjusted,

in such a way that it leaves a space of about 0.2 cm

between two vaginal membrane faces. 1 gm of gel

was placed between two vaginal membrane faces.

Little pressure was applied to form bioadhesion bond,

and then slowly drop of water was added on right side

beaker, till the gel was separated from one face of

vaginal membranes attached. Volume of water added

was converted to mass. This gave the bioadhesive

strength of gel in gm. An initial investigation

examined the reproducibility of the system using three

same formulations. The study was carried out for all

formulations. (Yellanki SK, 2010)

Partition coefficient determination: An equal

volume from n-octanol and citrate phosphate buffer

pH 4 were saturated with each other for 24 hrs, the

two phases were separated. Certain weight of either

the drug or an equivalent weight of the gel was

dissolved in 10 ml of the aqueous phase to give the

concentration of 0.5 mg/ml. The final solution

transferred to a stoppered glass bottle. The final

solution transferred to a stoppered glass bottle

containing 10 ml of n-octanol. The systems were

agitated in a thermostated water bath at 37±1ºC for 24

hrs, the phases were then separated, the aqueous phase

was filtered and the concentration of the max drug

was determined spectrophotometrically at 290 nm

against a blank solution prepared in an analogous

manner. The concentration of the drug in octanol was

calculated from the difference between the initial and

final concentrations of the drug in the buffer phase.

The partition coefficient was calculated according to

Nernst equation.

K = Corg/Caqu.

Where: K = partition coefficient, Corg is the

concentration of the drug in organic phase, Caqu is the

concentration of the drug in buffer. (Ramadan AA,

2008)

In vitro drug release: The in vitro release of drug was

determined from different vaginal gel formulations

using a dialysis bag prepared by cellophane membrane

placed in the release medium. A cellophane

membrane cut to suitable size boiled in distilled water

for 1 hr, soaked in absolute alcohol for half an hour

and stored in citrate phosphate buffer pH 4 for 24 hrs

before use. 6 gm of gel formulations were packed into

the cellophane membrane bags (50 mm). The release

medium was 100 ml citrate phosphate buffer pH 4

containing 1% tween 80, providing sink conditions for

Propranolol hydrochloride. The medium was

maintained at 37ºC and stirred at 100 rpm. At various

time intervals (1 hr), 5 ml of dissolution fluid was

collected. Levels of drug in the samples were analyzed

with the UV spectrophotometer at 290 nm. (Chatterjee

A, 2011)

Accelerated stability study: Stability studies were

performed according to ICH guidelines. The

formulations were stored at room temperature and

accelerated storage conditions at 45±1°C for a period

of 3 months. The samples were analyzed for drug

content by UV spectrophotometer at 290 nm. (Nayak

SB, 2010)


In this study bioadhesive vaginal gel of

Propranolol hydrochloride with different amounts of

Na CMC and tragacanth were prepared and prolonged

release of the drug was demonstrated. The

compatibility between the drug and polymers were

confirmed by IR spectrophotometer. The pH, %yield

and drug content of the gel formulations F1-F8 was

found to be in the range of 4.02±0.06 to 4.28±0.04,

91.9±0.13 to 95.3±0.02 and 25.37±0.05 to

27.78±0.1respectively (Table 3). The bioadhesion

strength of the gel formulations F1-F8 was found to be

in the range of 13.2±0.01 to 24.6±0.05 gm

respectively (Table 4). The optimum partition

coefficient of either Propranolol hydrochloride alone

or formulated into vaginal gel between n-octanol and

citrate phosphate buffer pH 4 was determined and

found to be 3.12±0.14 at 37ºC. It was also observed

that with increase in polymer concentration the

syringibility becomes difficult but the extrudability

improved.



Table.2.Preformulation parameters of Propranolol hydrochloride

Characters Inference

Nature Crystalline powder.

Colour White

Odour Odourless

Taste Slightly bitter taste

Melting point 165ºC

Solubility:

In water

In acetone

In methanol

In ethanol

In chloroform

Practically insoluble

Fully soluble

Soluble

Soluble

Soluble

Bulk density 0.65±0.03 gm/cc

Tapped density 0.55±0.02 gm/cc

Carr’s index 19.23±0.12

Hausner’s ratio 1.24±0.03 Good flow

Angle of repose 26.5º±0.05

Assay 99.1%

Table 3: Physical appearance, pH, %yield and drug content of Propranolol hydrochloride gel formulations (F1-F8) Formulation Physical appearance pH# %yield# Drug content#

F1 White emulsion 4.13±0.11 94.6±0.07 27.78±0.1

F2 Off white emulsion 4.02±0.06 92.1±0.03 27.42±0.07

F3 Off white lotion 4.16±0.07 94.5±0.08 26.97±0.09

F4 Off white lotion 4.21±0.05 95.3±0.02 26.4±0.11

F5 Dark gray cream 4.08±0.11 92.7±0.12 26.68±0.12

F6 Gray emulsion 4.28±0.04 93.5±0.11 26.19±0.03

F7 Blackish gray lotion 4.24±0.07 91.9±0.13 25.84±0.08

F8 Light brown 4.12±0.06 92.8±0.06 25.37±0.05 # Mean±SD (n=3)

Table.4.Bioadhesion strength, syringibility and extrudability study of Propranolol hydrochloride gel formulations F1-

F8 Formulation Bioadhesion strength# (gm) Syringibility Extrudability

F1 19.8±0.03 *** *

F2 21.2±0.07 *** *

F3 23.1±0.09 *** *

F4 24.6±0.05 *** *

F5 13.2±0.01 *** *

F6 14.7±0.04 *** *

F7 16.3±0.12 ** *

F8 18.1±0.13 ** * # Mean±SD (n=3), *-poor, ** good, *** very good, **** excellent

Figure.1.Spreadability of mucoadhesive vaginal gel formulations F1-F4



Figure.2.Spreadability of mucoadhesive vaginal gel formulations F5-F8

Figure 3: In vitro drug release profile of formulation F1–F4

Figure.4. In vitro drug release profile of formulation F5–F8

Table.2.Stability study of formulation 8

Time(months) pH#

Syringability Extrudability Drug content# (mg) %CDR

1 4.21±0.05 *** * 26.4±0.11 87.542613

2 4.45±0.05 ** ** 25.8±0.08 90.654467

3 5.23±0.05 ** ** 24.6±0.07 93.123223 # Mean±SD (n=3), *-poor, ** good, *** very good, **** excellent

CONCLUSION

In-vitro drug release of Propranolol

hydrochloride from the bioadhesive gel formulations

showed that the films containing higher concentration

of polymers released the drug slowly as compared to

the formulations with lower concentration. The

formulations maintained the sustained drug release for

a period of more than 54 hrs. The formulation F4

having 4% Na CMC concentration was selected as the

best formulation. The results of the study give a

rational guideline for formulating a sustained release

vaginal drug delivery system of Propranolol

hydrochloride for effective contraception.

REFERENCE

Alexander NJ, Baker E, Kaptein M and Miller L, Why

consider vaginal drug administration, Fertilization

Sterilization, 8(2), 2004, 1-12.

Chatterjee A, Bhowmik BB and Thakur YS;

Formulation, in vitro and in vivo pharmacokinetics of

anti HIV vaginal bioadhesive gel, Journal of Young

Pharmacists, 3(2), 2011, 83-89.



Hussain A and Ahsan F, The vagina as a route for

systemic drug delivery, Journal of Controlled Release,

103, 2005, 301-313.

Kumar L, Verma R, Advantages of intra-vaginal drug

delivery system: an overview, International Journal of

Pharmaceutical Research and Development, 2(6),

2010, 15-23.

Nayak SB, Rout PK, Nayak UK and Bhowmik BB,

Development and characterization of bioadhesive gel

of microencapsulated metronidazole for vaginal use,

Iranian Journal of Pharmacy Research, 9(3), 2010,

209-219.

Patil SA, Rane BR, Bakliwal SR and Pawar SP,

Pragmatic hydrogels, International Journal of

Research in Ayurveda and Pharmacy, 2(3), 2011 758-

766.

Ramadan AA, Formulation and evaluation of

bioadhesive gels containing miconazole nitrate,

Journal of Applied Science and Research, 4(9), 2008,

1052-1065.

Yellanki SK, Narella NK, Goranti S and Deb SK,

Development of metronidazole intravaginal gel for the

treatment of bacterial vaginosis, effect of

mucoadhesive natural polymers on the release of

Metronidazole, International Journal of

Pharmaceutical Research and Development, 2(3),

2010, 1-6.

Sadat Ali et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

Volume 1(4) July-August 2013 Page 875

Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment

of osteoarthritis of the knee: a randomized controlled trial Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali*, Ahmed A Tantawy

Department of Orthopaedic Surgery, College of Medicine, University of Dammam, Saudi Arabia.

King Fahd Hospital of the University, AlKhobar, 31952, Saudi Arabia.

*Corresponding author: Email: [email protected], Tel: +966505848281, Fax: +966138820887

ABSTRACT Osteoarthritis of the knee is common among Saudi Arabian men and women. Oral NSAIDS are

most commonly used, however, it often have serious adverse effects especially GI complications. This

study is designed to determine if this herbal topical cream (Max-Relief-MR a combination of menthol,

camphor and Bosweilla serrata) has beneficial, long-term effects on osteoarthritis (OA) comparable or

superior to the gold standard Diclofenac gel.

Key words: Osteoarthritis, Herbal topical cream, Bosweilla serrata, NSAIDS

1. INTRODUCTION

Osteoarthritis (OA) is the degenerative aging

process, which can affect any joint of the body but the

weight bearing joints like knee and the hip are most

commonly affected. It has been suggested that age, sex

and body weight influence the severity of the disease.

The prevalence of OA of the knee is unknown but

recently it was estimated that 12.5% of the general

population aged

45 years suffer from OA of the knee

(Jordan, 2005). Among the ethnic Saudi Arabian

population OA of the knee was reported to be between

1.19 to 3.5% (Sadat-Ali, 1996; Ahlberg, 1990), but in a

decade and half the prevalence of clinical OA of the

knee jumped to 13% (Al-Arfaj, 2003) and radiological

OA of knee to 53% in males and 60.9% in females (Al-

Arfaj, 2002). In the last decade the incidence of OA

among the Saudi Arabian population has increased

drastically (Sadat-Ali, 1996; Al-Arfaj, 2003), but still

our treatment modalities have not changed beyond

NSAIDs and physical therapy. Although majority of

patients show progression with increase of pain, joint

destruction and decrease in the quality life. The

severity of the disease varies among ethnic populations

and among the same populations groups.

Traditionally OA has been managed by

pharmacological treatments which include NSAIDS,

Opioid analgesics, topical applicants, intra-articular

injections and nutritional supplements (Jawad, 2007;

Brabant, 2005; Schuh, 2007; Bellamy, 2006; Bruyere,

2007; Sadat-Ali, 2006). NSAIDS often have serious

adverse effects especially GI complications, reno-

vascular and respiratory complications. Recent

research witnessed innovations in technology of drug

delivery to overcome the disadvantages of oral drug

therapy (Alarcon, 2002). As a result topical

applications of NSAIDs are formulated to penetrate the

skin, subcutaneous fatty tissue, and muscle in amounts

sufficient to exert local therapeutic effects, without

reaching higher plasma drug concentrations.

Recently herbal products have been used in the

management of early in OA and one, which stands out,

is Bosweilla Serrata (BS) (Frankincense). Frankincense

is the resin from the trees of the genus Boswellia,

native to Arabia and Asia. It has a long history of use

and its medicinal properties have been appreciated for

millennia. Several trials of the oral use of BS in the

treatment of osteoarthritis have been published

(Sander, 1998; Kimmatkar, 2003; Sontakke, 2007;

Schuh, 2007; Abdel-Tawab, 2011), but to date there is

no report of topical use of BS. Max-Relief is a

topical analgesic for use of arthritis, backache, sprains

etc was developed at King Fahd University Hospital of

the University of Dammam, University of Dammam.

Max-Relief is USFDA approved as over the counter

(OTC) use and sold in US market since 2008. We have

embarked on this study for use of Max-Relief in OA

of knee and its efficacy as an herbal topical agent and

to compare with topical diclofenac. The study will also

assess the safety of the herbal topical applicant NSAID

over a 12-week treatment course in symptomatic

primary OA of the knee.


King Fahd Hospital of the University,

AlKhobar is a 480-bed tertiary care hospital of the

College of Medicine, Dammam University, Dammam.

The study was carried out at the Osteoarthritis and

Arthroplasty Unit of the Department of Orthopaedic

Surgery, between February 2012 and January 2013.

Two hundred and fifty consecutive patients with a

confirmed diagnosis of OA of the knee were included

in the study after informed consent was obtained. The

demographic data such age, sex weight and height,

duration of OA, known diseases, medications in use

were collected at the interview and from the medical

records. The physical function and pain were assessed

by mWOMAC score. After recruitment, the subjects

were randomly distributed into two groups. The

inclusion criteria included participants who were able


ISSN: 2321-5674(Print)

ISSN: 2320 – 3471(Online)

Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology


to understand risks and benefits of the protocol and be

able to give informed consent. Patients (both male and

female) between 40 to 70 years of age with

radiographically confirmed grade 1, 2 & 3 were

included the study.

Following Exclusion criteria will be strictly

adhered:

Secondary arthritis (inflammatory arthropathy,

rheumatoid arthritis, gouty arthritis)

Prior knee surgery

History of ligament instability of knee,

traumatic meniscal tear or traumatic cartilage

damage

Known or suspected pregnancy.

Hypersensitivity to nonsteroidal anti-

inflammatory drugs, abnormal liver or kidney

function tests, history of peptic ulceration and

upper gastrointestinal hemorrhage.

Severe OA requiring surgical intervention

(Grade-4)

Intra-articular corticosteroid or Hyaluronic

acid within the preceding 6 months.

After enrollment Subjects were helped to

complete baseline questionnaires, blood work and

radiological study was performed to assess grade of

osteoarthritis and rule out secondary causes. WOMAC

scoring was recorded before starting their treatment.

(Changes made because WOMAC scoring is a

functional scoring system). Patients were asked to

apply approximately 5 ml of the ointment three times a

day for 12 weeks. They were seen clinically at 0

weeks, 6 weeks and 12 weeks. Investigators

interviewed each subject on a preset questionnaire.

Various parameters of serum biochemistry,

hematology were carried out on each evaluation day (at

0, 6 and 12 weeks). Safety was monitored by clinical

and laboratory assessments during the study visits and

patient-reported adverse events during the treatment

will be recorded. The data was analyzed using SPSS

(Statistical Package for the Social Sciences), version

14.0, Chicago, Illinois. Data was expressed as mean ±

standard deviation (SD). Statistical significance

differences between groups were determined with

Student's t-test and p values of 0.05 using Confidence

Interval (CI) of 95% were considered as significant.

Two hundred and forty two men and women,

age 40–73 years, with radiologically confirmed

primary OA of the knee and who presented to the

Osteoarthritis and Arthroplasty Unit (OAU) of the

King Fahd Hospital of the University, AlKhobar for

pain relief were the study individuals. After informed

consent assessment of function was measured by the

modified Western Ontario and McMaster Universities

(mWOMAC) grading and pain assessment by VAS

(Visual Analouge Scale). Patients were randomized

into two groups, oral NSAIDs were discontinued and

they received either Max-Relief or Diclofenec gel.

Patients were allowed to take Paracetamol unto 1.5

gm/day along with the ointment if required. If patients

required more analgesia the case was excluded from

the study and it was considered failure of treatment.

Participants were instructed to apply either of the

treatment modality three times a day directly to the

painful knees for 12 weeks. The patients were

evaluated after a run-in period of one week (week 0)

and then at 6 weeks and 12 weeks. The clinical

assessments included visual analog scale (VAS) score

that assessed pain and stiffness and measured by the

(mWOMAC) LK3 , as well as physician's and patients'

overall opinions on improvement. Safety assessments

included any adverse events directly related to the

topical applications. Baseline demographic data and

clinical variables were analysed by Chi-square or

Student's t-Test. The incidence of adverse event will

be analyzed by Fisher's Exact Test. Continuous

variables (WOMAC dimensions, PGA and pain on

walking) were analyzed by ANCOVA with baseline

score as the covariate.


Two hundred and forty-two patients (122 study

group and 120 control group) completed the stay for 12

weeks. There were no complications in both the groups

to stop the treatment protocol. All the parameters in the

demographic data was not statistically significant

except the weight for the study group was more than

the control group 79.4618.05 versus 75.3216.4

(p<0.006). The comparison of stiffness, pain during

day and pain at night showed that at 6 weeks pain

improved significantly during day P<0.01 and 12

weeks the three parameters improved significantly in

the study group patients at P<0.001. The fourth

parameters compared of daily activities; prayers, STS

(sit to stand), walking flat and climbing stairs. There

was no improvement at prayers at 12 weeks in both the

groups but walking on flat surface the improvement at

6 weeks (P<0.002) and 12 weeks of P<0.3, stairs

climbing was improved in the study group at 12 weeks

P<0.001. (Table.3).

In this randomized controlled trial, we tested

the Max-Relief (a combination of Bosweilla Serrata,

Camphor and Menthol) and were evaluated for its

clinical efficacy in patients suffering from OA of knee

876





(K/L grades mainly I–III). Our data supports the

efficacy of the of MR in the reduction of pain and

improvement in activities between 6 and 12 weeks of

the continuous use from the baseline compared to the

control group who were using diclofenac in patients

with OA of knee. This study suggests that MR was

effective in improving pain and some of the symptoms

associated with knee OA. However, one thing was

certain that the patients using MR was better than

diclofenac and MR did not significantly improve all

the parameters tested. In the recent past the gum resin

extracted from the ancient herb, Frankincense

(Boswellia serrata) has gained lot of attention as a

potent anti-inflammatory, anti-arthritic and analgesic

agent (Ethan, 2004; Singh, 1986). 3-O- acetyl-11-keto-

beta-boswellic acid (AKBA) is the most active

component of Boswellia extract and has been

demonstrated to be a potent inhibitor of 5-lipoxygenase

(5-LOX), which is a key enzyme in the biosynthesis of

leukotriene’s from arachidonic acid in the cellular

inflammatory cascade (Sailer, 1996). Sengupta, 2008,

showed that 5-Loxin® reduces pain and improves

physical function in patients with OA and it is safe for

human use. This study which used topical BS showed

that it could be used in the management of OA of knee.

Pharmacologic agents in the management of for OA

include, from oral analgesics to anti-inflammatory

agents, intra-articular corticosteroids, and hyaluronic

acid in mild-to-moderate OA-related pain (Zhang,

2008; Zhang, 2007; Zhang, 2005; Jordan, 2003).

Presently based on evidence it is recommended that the

use of topical NSAIDs and rubefacients (Walker-Bone,

2000; Altman, 2000) as a therapeutic option be

potentially with fewer gastrointestinal risks than oral

NSAIDs (Evans, 1995).

Reports indicate that topical NSAIDs are

comparable and alternative to oral NSAIDs with fewer

severe adverse events and provide good levels of pain

relief in knee osteoarthritis (Klinge, 2013). Camphor

and menthol are well known analgesics and the

addition of BS an anti-arthritic proved to be a better

combination in the relief of pain but also reduced

stiffness and increased the quality of daily life of the

men and women suffering with OA knee. Our clinical

study has some limitations. Firstly, we did not assess

the biomarkers for synovial inflammation and to detect

the articular changes and CII degradation biomarkers,

such as CTX-II, C1, 2C and C2C and secondly for a

condition like OA we should have more of patients, as

this is a pilot study the results and its implications are

justified. The strength of this pilot study is that this is

the first study randomized to test the topical BS and

was compared with a known NSAID. In conclusion our

study has shown that BS in combination of camphor

and menthol (Max-Relief) is a safe potent analgesic

and anti-arthritic ointment, which improves the pain,

stiffness and daily life activities in patients with OA of

knee. We believe the product should be further

investigated in large-scale patients.

4. CONCLUSION

This randomized control study shows that

Max-Relief a combination of camphor, menthol and

Bosweilla serrata is potentially a safe and effective

topical treatment in the management of OA and

produced comparative pain relief to the Diclofenac gel.

ACKNOWLEDGEMENT

The authors thank deanship of scientific

research, University of Dammam for awarding a grant

to complete this study vide # 2012099 of 2011.

Table.1. Demographic Data of the Study and the Control Groups

Parameter Study Group Control Group P Value

Number of Patients 122 120

Age in years 59.189.25 59.128.1 0.9

Males 45 50 0.3

Females 77 70 0.4

Duration of Symptoms months 43.49 58.1 42.739.1 0.8

Weight in KGs 79.4618.05 75.3216.4 0.006 (CI at 95% <7.05)

Height in centimeters 165.28.31 164.657.49 0.4

Kellegren and Lawrence Grading 2.481.20 2.460.96 0.8





Table.2. Pain and stiffness parameters


Stiffness 0 5.961.29 5.98 1.34 0.8

Stiffness 6 3.451.6 3.541.57 0.7

Stiffness 12 weeks 2.151.36 3.181.23 0.001 (CI at 95% <-0.8117)

Pain during day 0 4.681.26 4.781.43 0.4

Pain at 6 weeks 2.230.94 2.761.1 0.001 (CI at 95% <0.3348

Pain at 12 weeks 1.330.92 1.930.94 0.001 (CI at 95% <-0.4332)

Night Pain at 0 5.61.98 5.391.75 0.1

Night pain at 6 weeks 2.961.3 3.141.2 0.1

Night Pain at 12 weeks 1.631.32 2.841.27 0.001 (CI at 95% <-0.9840)

Table.3.Comparison of the daily activities


Prayers at 0 6.452.76 6.361.89 0.5

Prayers at 6 4.861.41 4.651.38 0.7

Prayers at 12 3.21.4 3.321.3 0.1

Sit to Stand 0 6.271.89 6.321.89 0.6

Sit to Stand 6 3.631.39 3.751.36 0.8

Sit to Stand 12 2.21.43 2.391.13 0.1

Walk Flat 0 4.630.9 4.650.9 0.7

Walk Flat 6 2.121.26 2.460.94 0.002 (CI at 95% <-0.1732)

Walk Flat 12 1.271.46 1.531.36 0.03 (CI at 95% <-0.0187

Stairs 0 6.121.07 6.151.07 0.8

Stairs at 6 3.60.96 3.720.97 0.1

Stairs at 12 2.51.11 2.971.1 0.001(CI at 95% <-0.2748)

REFERENCES Abdel-Tawab M, Werz O, Schubert-Zsilavecz M,

Boswellia serrata: an overall assessment of in vitro,

preclinical, pharmacokinetic and clinical data, Clin

Pharmacokinet, 50(6), 2011, 349-69. doi:

10.2165/11586800.

Ahlberg A, Linder B, Binhemd TA. Osteoarthritis of

the hip and knee in Saudi Arabia, Int Orth, 14(1), 1990,

29-30.

Alarcon L, Escnbano E, A comparative study of the

transdermal penetration of a series of nonsteroidal anti-

inflammatory drugs, Journal of Pharmaceutical

Sciences, 86 (24), 2002, 503-308.

Al-Arfaj A, Al-Boukai AA, Prevalence of radiographic

knee osteoarthritis in Saudi Arabia, Clin Rheumatol,

21(2), 2002, 142-5.

Al-Arfaj AS, Alballa SR, Al-Saleh SS, Al-Dalaan AM,

Bahabry SA, Mousa MA, Knee osteoarthritis in Al-

Qaseem, Saudi Arabia, Saudi Med J, 24(3), 2003, 291-

3.

Altman RD, Hochberg MC, Moskowitz RW, Schnitzer

TJ, Recommendations for the medical management of

osteoarthritis of the hip and knee: New OA practice

management guidelines from the ACR, Arthritis

Rheum, 43, 2000, 1905-1915.

Bellamy N, Campbell J, Robinson V, Gee T, Bourne

R, Wells G. Intra-articular corticosteroid for treatment

of osteoarthritis of the knee, Cochrane Database Syst

Rev, 19;(2), 2006, CD005328.

Brabant T, Stichtenoth D, Pharmacological treatment

of osteoarthritis in the elderly, Z Rheumatol, 64(7),

2005,

467-72.

Bruyere O, Reginster JY, Glucosamine and chondroitin

sulfate as therapeutic agents for knee and hip

osteoarthritis, Drugs Aging, 24(7), 2007, 573-80.

Ethan B, Heather B, Theresa DH, Ivo F, Sadaf H, Jens

H, David S, Catherine U, Boswellia: An evidence-

based systematic review by the natural standard

research collaboration, J Herbal Phar- macother, 4,

2004, 63-83.

878

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Abdel-Tawab%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Werz%20O%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Schubert-Zsilavecz%20M%22%5BAuthor%5D



http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Ahlberg%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Linder%20B%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Binhemd%20TA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Arfaj%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Boukai%20AA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Alballa%20SR%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Saleh%20SS%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Dalaan%20AM%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Bahabry%20SA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Mousa%20MA%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Bellamy%20N%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Campbell%20J%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Robinson%20V%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Gee%20T%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Bourne%20R%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Bourne%20R%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Wells%20G%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Brabant%20T%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Stichtenoth%20D%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Bruyere%20O%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Reginster%20JY%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus





Evans JM, McMahon AD, McGilchrist MM, White G,

Murray FE, McDevitt DG, MacDonald TM, Topical

non-steroidal anti- inflammatory drugs and admission

to hospital for upper gastrointestinal bleeding and

perforation: a record linkage case- control study, BMJ,

311, 1995, 22-26.

Jawad AS, Irving K, Drug treatment modalities in

patients with chronic osteoarthritis of the hip or knee,

Saudi Med J, 28(3), 2007, 375-8.

Jordan K, Croft P, The prevalence and history of knee

osteoarthritis in general practice: a case–control study,

Family Practice, 22(1), 2005, 103-108.

Jordan KM, Arden NK, Doherty M, Bannwarth B,

Bijlsma JW, Dieppe P, EULAR Recommendations

2003: an evidence based approach to the management

of knee osteoarthritis: Report of a Task Force of the

Standing Committee for International Clinical Studies

Including Therapeutic Trials (ESCISIT). Ann Rheum

Dis, 62, 2003, 1145-1155. 5.

Kimmatkar N, Thawani V, Hingorani L, Khiyani R,

Efficacy and tolerability of Boswellia serrata extract in

treatment of osteoarthritis of knee—a randomized

double blind placebo controlled trial, Phytomedicine,

10, 2003, 3-7.

Klinge SA, Sawyer GA, Effectiveness and safety of

topical versus oral nonsteroidal anti-inflammatory

drugs: a comprehensive review, Phys Sportsmed,

41(2), 2013, 64-74.

Mazieres B, Rouanet S, Velicy J, Topical Ketoprofen

Patch (100 mg) for the treatment of Ankle Sprain, a

randomized, double-blind, placebo-controlled study,

American Journal of Sports Medicine, 33 (4), 2005,

515- 524

Sadat-Ali M, Al-Gindan Y, Al-Mousa M, Al-Rubaish

A, Al-Omari E, Osteoarthritis of the knee among Saudi

Arabian security forces personnel, Mil Med, 161(2),

1996, 105-7.

Sadat-Ali M, Al-Habdan I, El-Hassan AY, Is there an

alternative to NSAIDs and Cox-2 Inhibitors in the

Management of Osteoarthritis of Knee, Ostetoporosis

Inter, 17(1), 2006, 192.

Safayhi H, Mack T, Sabieraj J, Anazodo MI,

Subramanian LR, Ammon HPT: Boswellic acids:

novel, specific, nonredox inhibitors of 5-

lipoxygenase, J Pharmacol Exp Ther, 26, 1992, 1143-

1146.

Sailer ER, Subramanian LR, Rall B, Hoernlein RF,

Ammon HPT, Safayhi H: Acetyl-11-keto-β-boswellic

acid (AKBA): structure requirements or binding and 5-

lipoxygenase inhibitory activity, Br J Pharmacol, 117,

1996, 615-618.

Sander O, Herborn G, Rau R. Is H15 (resin extract of

Boswellia serrata, “incense”) a useful supplement to

established drug therapy of chronic polyarthritis?

Results of a double-blind pilot study. [German] Z

Rheumatol, 57, 1998, 11-16.

Schuh A, Jezussek D, Fabijani R, Honle W,

Conservative therapy of knee osteoarthritis, MMW

Fortschr, 149, 2007, 31-32.

Sengupta K, Alluri KV, Satish AR, Mishra S, Golakoti

T, Sarma KV, A double blind, randomized, placebo

controlled study of the efficacy and safety of 5-

Loxin(R) for treatment of osteoarthritis of the knee,

Arthritis Res Ther, 10, 2008, R85. doi:10.1186/ar2461.

Singh GB, Atal CK, Pharmacology of an extract of

salai guggal ex-Boswellia serrata, a new non-steroidal

anti-inflammatory agent, Agents Actions, 18, 1986,

407-412.

Sontakke S, Thawani V, Pimpalkhute P, Kabra P,

Babhulkar S, Hingorani H, Open, randomized,

controlled clinical trial of Boswellia serrata extract as

compared to valdecoxib in osteoarthritis of knee,

Indian J Pharmacol, 39, 2007, 27-9.

Walker-Bone K, Javaid K, Arden N, Cooper C,

Regular review:medical management of osteoarthritis,

BMJ, 321, 2000, 936-940. 6.

Zhang W, Doherty M, Arden N, et al. EULAR

evidence based recommendations for the management

of hip osteoarthritis: report of a Task Force of the

EULAR Standing Committee for International Clinical

Studies Including Therapeutics (ESCISIT), Ann

Rheum Dis, 64(5), 2005, 669-681.

878

879

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Jawad%20AS%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Irving%20K%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/pubmed?term=Klinge%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=23703519

http://www.ncbi.nlm.nih.gov/pubmed?term=Sawyer%20GA%5BAuthor%5D&cauthor=true&cauthor_uid=23703519

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Sadat-Ali%20M%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Gindan%20Y%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Mousa%20M%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Rubaish%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Rubaish%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Al-Omari%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus





Zhang W, Doherty M, Leeb BF, EULAR evidence

based recommendations for the management of hand

osteoarthritis: report of a Task Force of the EULAR

Standing Committee for International Clinical Studies

Including Therapeutics (ESCISIT), Ann Rheum Dis,

66(3), 2007, 377-388.

Zhang W, Moskowitz RW, Nuki G, OARSI

recommendations for the management of hip and knee

osteoarthritis, part II: OARSI evidence-based, expert

consensus guidelines, Osteoarthritis Cartilage, 16(2),

2008, 137-162.

880

Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Analytical method development and validation for the estimation of Olmesartan

medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana Pattan

1, Haritha Pavani

1, Chandana N

1, Karimulla M

2

1.Department of pharmaceutical analysis, Nimra College of Pharmacy, Vijayawada

2.Department of pharmaceutical analysis, Krishna University, Machilipatnam

*Corresponding Author: E.mail:[email protected], Phone no: 8885818293

ABSTRACT

A simple rapid, accurate, precise and reproducible validated reverse phase UPLC method was

developed for the determination of Olmesartan medoxomil in bulk and pharmaceutical dosage forms. The

quantification was carried out using Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm) column run

in Isocratic way using pH 3.4 Buffer: Acetonitrile (60:40% v/v)] and a detection wavelength of 250nm,

and injection volume of 4µL, with a flow rate of 0.3mL/min. The retention times of Olmesartan

medoxomil was found to be 3.418. The method was validated in terms of linearity, precision, accuracy,

LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed

method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 10% to 150% and with

correlation coefficient of r2=0.9999.The assay of the proposed method was found to be 98.79%. The

recovery studies were also carried out and mean % Recovery was found to be 100.5%. The % RSD from

reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied

for routine quality control analysis of Olmesartan medoxomil in bulk and in Pharmaceutical dosage form.

Key Words: Olmesartan medoxomil, RP-UPLC, Waters acquity UPLC BEH C18, Tablets, Validation.

1. INTRODUCTION

Olmesartan medoxomil is (5-methyl-2-oxo-

2H-1,3-dioxol-4-yl)methyl 4-(2-hydroxypropan-2-yl)-

2-propyl-1-({4-[2-(2H-1,2,3,4-tetrazol-5-

yl)phenyl]phenyl}methyl)-1H-imidazole-5-

carboxylate.The molecular weight is 558.59,molecular

formula is C29H30N6O6. Olmesartan is a prodrug that

works by blocking the binding of angiotensin II to the

AT1 receptors in vascular muscle; it is therefore

independent of angiotensin II synthesis pathways,

unlike ACE inhibitors. By blocking the binding rather

than the synthesis of angiotensin II, olmesartan

inhibits the negative regulatory feedback

on renin secretion. As a result of this blockage,

olmesartan reduces vasoconstriction and the secretion

of aldosterone. This lowers blood pressure by

producing vasodilation, and decreasing peripheral

resistance and is used as antihypertensive.

Literature review reveals very few methods

are reported for the assay of Olmesartan medoxomil in

Tablet dosage forms using RP-HPLC method and no

method has been developed by RP-UPLC. The

proposed RP-UPLC method utilizes economical

solvent system and having advantages like less time

consuming, better retention time, less flow rate, very

sharp and symmetrical peak shapes. The aim of the

study was to develop a simple, precise, economic and

accurate RP-UPLC method for the estimation of

Olmesartan medoxomil in Tablet dosage forms.

Figure.1.Structure of olmesartan medoxomil



win 5software UV-VISIBLE spectrophotometer, with

1cm matched quartz cells. UPLC ACQUITY; 2996

PDA, Waters Acquity UPLC BEH column

Chemicals and reagents: Gifted sample of

Olmesartan medoxomil pure sample and dosage form

of marketed formulation was purchased from local

pharmacy. Other chemicals all are of HPLC grade and

GR grade.

Preparation of mobile phase: Preparation of pH

3.4 Buffer: Dissolve 2.04gm of monobasic

potassium phosphate in 1000mL of water, mix well

adjust to pH 3.4 with diluent OPA (1mL in 10mL of

water) and filtered through 0.22µm filter.and mix the

pH3.4Buffer and CAN in the ratio of(60:40%v/v)

Standard solution preparation: weighed and

transferred about 50mg of Olmesartan medoxomil

working standard in to a 100ml volumetric flak, added

60ml of acetonitrile and sonicated to dissolve, diluted

up to the volume with acetonitrile. Diluted 4ml of the

above solution to 50ml with diluents and filtered

through 0.22um filter.


http://en.wikipedia.org/wiki/Prodrug

http://en.wikipedia.org/wiki/Angiotensin

http://en.wikipedia.org/wiki/ACE_inhibitor

http://en.wikipedia.org/wiki/Renin

http://en.wikipedia.org/wiki/Vasoconstriction

http://en.wikipedia.org/wiki/Aldosterone

http://en.wikipedia.org/wiki/Vasodilation



Preparation of sample solution: Five tablets were

weighed and finely powdered and a powder quantity

equivalent to 50mg of Olmesartan medoxomil were

accurately weighed and transferred to a 100ml

volumetric flask and 60ml of acetonitrile was added to

the same. The flask was sonicated and volume was

made up to the mark with acetonitrile. Diluted 4ml of

the above solution to 50ml with diluents and filtered

through 0.22um filter,mixed well and injected. The

amount present in each tablet was calculated by

comparing the area of standard Olmesartan

medoxomil and tablet sample.

Method optimization: The chromatographic

separation was performed using Waters Acquity

UPLC BEH C18 (100 mm X 2.1 mm, 1.7µm) column.

For selection of mobile phase, various mobile phase

compositions were observed for efficient elution and

good resolution. The mobile phase consisting of pH

3.4 Buffer: ACN (60:40% v/v)] was found to be the

optimum composition for efficient elution of analyte.

The mobile phase was injected to the column at a flow

rate of 0.3 ml/min for 6min. The column temperature

was maintained at 25oC, Injection volume was 4L.

The analyte was monitored at 250 nm using PDA-

detector. The retention time of the drugs was found to

be 3.418min. Water:ACN(50:50) was used as diluent

during the standard and test samples preparation. The

optimized chromatographic conditions are mentioned

in Table-1 and chromatogram for standard was shown

in the figure no: 2


Method Validation

System suitability: System suitability tests are an

integral part of method validation and are used to

ensure adequate performance of the chromatographic

system. Retention time (RT), number of theoretical

plates (N) or column efficiency and tailing factor (T)

were evaluated for six injections of standard solution

at a solution of 40µg/ml of Olmesartan medoxomil.







(40ppm). The diluent and placebo solutions were also

injected to observe any interference with the drug

peak.




range. The linearity of Olmesartan medoxomil was in

the concentration range of 10-150%.From the linearity

studies calibration curve was plotted and



The regression coefficient was found to be 0.9999

shows good linearity.






amount of the pure drug (50%,75%,100% ,150%) at

four different concentration levels in its solution has

been added to the pre analyzed working standard

solution of the drug.

Precision: The precision of the analytical method was

studied by analysis of multiple sampling of

homogeneous sample. The Precision expressed as

standard deviation or relative standard deviation.

System precision: System precision was performed

by injecting a standard solution of Olmesartan

medoxomil for six times.

Method precision: Method precision was performed

by analyzing a sample solution of Olmesartan

medoxomil by injecting six replicates of the same

sample preparations at a concentration of

44.8ppm/mL. Intermediate precision(Ruggedness):

Intermediate precision was performed by analyzing a

standard and sample solutions of Olmesartan

medoxomil by injecting six replicates of the same

standard and sample preparations at a concentration of

40ppm/mL

Robustness: Robustness shows the reliability of an

analysis with respect to deliberate variations in

method parameters. If measurements are susceptible

to variations in analytical conditions, the analytical

conditions should be suitably controlled or a

precautionary statement should be included in the

procedure.

LOD and LOQ:Calibration curve was repeated for

five times and the standard deviation (SD) of the

intercepts was calculated.The results shows,the limit

of detection with a signal to noise ratio of 3:1 was

found to be 0.010 µg/ml. the limit of quantification

with a signal to noise ratio of 10:1 was found to be

0.032 µg/ml.


studies it was observed that retention time of

Olmesartan medoxomil was found to be 3.418 min. %

RSD of peak area was found to be 0.08. Theoretical



plates were found to be more than 40289. USP tailing

factor was found to be 1. All the parameters were

within the limit.





specific.



concentration range of 10-150μg/ml. Correlation

coefficient was found to be 0.9999.


analyzed solution of formulation were in the range of

98%-102%, which shows that the method was

accurate.

Precision: System precision: The percentage relative standard

deviation (RSD) for the peak area 0.08.

Method precision: The percentage relative standard

deviation for the assay values found to be 1.06

Ruggedness: Comparison of both the results obtained

for two different Analysts shows that the method was

rugged for Analyst-Analyst variability. The %RSD for

intermediate precision was 0.09.

Robustness

As the % RSD of retention time and

asymmetry were within limits for variation in

flow rate (± 0.2 ml). Hence the allowable flow

rate should be within 0.1 ml to 0.5 ml.

As the % RSD of retention time and

asymmetry were within limits for variation (+

50C) in column oven temperature. Hence the

allowable variation in column oven

temperature is + 50C.

The results obtained were satisfactory and are in good

agreement as per the ICH guidelines.

Table.1.Optimized chromatogram conditions for Olmesartan medoxomil

Column Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm)

Mobile phase pH 3.4 Buffer: ACN (60 :40 % v/v)

Flow rate 0.5 ml/ min

Wavelength 250 nm

Injection volume 4 L

Column temperature Ambient

Run time 6 min

Table.2.System suitability data for Olmesartan medoxomil

System suitability parameters Results

% RSD 0.08

Tailing factor 1

Theoretical plates 40289

Table.3.Linearity Data for Olmesartan medoxomil

Level Con. (mg/ml) Peak area

10% 5 65673

50% 20 259905

75% 35 395268

100% 45 525796

150% 65 787084

Slope 11674.33

Intercept 826.20

Correlation coefficient (R2) 0.9999

Table.4.Accuracy Data for Olmesartan medoxomil

Level % Recovery % RSD

50% 100 65673

75% 100.6 259905

100% 100.8 525796

150% 100.6 787084



Table.5. System precision of Olmesartan medoxomil

No of injections Area RT

1 524321 3.418

2 523789 3.417

3 523912 3.418

4 524832 3.418

5 524721 3.416

6 524198 3.416

Average 524297 -

SD 420.1 -

% RSD 0.08 -

Table.6.Method precision and intermediate precision Data for Olmesartan medoxomil

Sample no. Assay

Method precision Intermediate precision

1 98.79 98.76

2 98.74 98.66

3 98.94 98.86

4 98.76 98.76

5 98.94 98.86

6 98.9 98.66

Mean 98.81 98.76

%RSD 1.06 0.090

Table.7.Variation in flow rate, column temperature for Olmesartan medoxomil

Parameter Flow (mL/min) Temperature(oC)

Low

(0.1ml/min)

Actual

(0.3ml/min)

High

(0.5ml/min)

Low

(20 oC)

Actual

(25 oC)

High

(30 oC)

%RSD 0.16 0.08 0.11 0.15 0.089 0.1

Retention time 4.451 3.336 2.528 3.856 3.418 3.014

Plate count 51056 40289 38529 42106 40289 40562

Tailing factor 1 1 1 1 1 1

Figure.2.Standard chromatogram Figure.3.Sample chromatogram

Figure.4.Linearity plot Figure.5.Chromatogram for specificity



4. CONCLUSION






validated and can be used for routine sample analysis.

REFERENCES

Abdullah Al Masud, Md. Mahfuzur Rahman, Moynul

Hasan, Validated Spectrophotometric method for

estimation of Olmesartan medoxomil in

pharmaceutical formulation, International journal of

pharmaceutical and life sciences volume, 1 (11), 2012,

2305-0330.

Chaitanya Prasad MK, Vidyasagar G, Sambasiva Rao

KRS, developed RP-HPLC method for the estimation

of olmesatan medoxomil in tablet dosage form, Der

pharma chemica, 3(6), 2011, 208-212

Jain Pritam, Chaube Udit, Chaudhari Rakesh, UV-

Spectrophotometric method for determination of

Olmesartan medoxomil in bulk and in formulation,

Internationale pharmaceutica sciencia, 1(7), 2011,

2231-5896.

Lakshmi surekha M, Kumara swamy G, RP-HPLC

method for the estimation of olmesartan medoxomil in

bulk and tablet dosage form, Contemporary

Investigations and observations in pharmacy, 2(1),

2013, 3-6, 2278-7429.

Selvadurai Muralidharan, Kumar, developed Sensitive

estimation of olmesartan medoxomil tablets by RP-

HPLC method, International journal of pharmacy &

life sciences, 1(7), 2012, 0976-7126.

Sharma Ritesh, Pancholi Syam S, RP-HPLC-DAD

method for determination of Olmesartan medoxomil

in bulk and tablets exposed to forced conditions,

INIST-CNRS, 60, 2010, 1330-0075.

Suman.avula.K.Naveen babu, M.V.Ramana, RP-

HPLC method for the estimation of olmesatan

medoxomil in bulk and tablet dosage form, An

international journal of advances in pharmaceutical

sciences, 2(2-3), 2011, 0976-3090.

http://www.researchgate.net/researcher/84302066_Selvadurai_Muralidharan/

T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Modern hygienic industrial canteen amenity: A change factor for healthy physical

work environment of the work force in Indian industrial units TN Murty

1*, GV Chalam

2, Md Aasif Siddique Ahmed Khan

3, T Abhinov

3 and T Abhilash

3

1. Director, Nimra College of Business Management, Vijayawada- 512456.

2. Professor in Commerce & Business Administration, Acharya Nagarjuna University, Nagarjuna Nagar- 522 510

3. Shadan Institute of Medical Sciences, Hyderabad

*Corresponding author: Email: [email protected]

ABSTRACT

Physical Working environment influences to a greater extent of the health of the workers. Hygienic

environment is an important requisite for the maintenance of good health. The term ‘hygiene’ includes not

only the material environment but also personal hygiene. The importance of the personal hygiene should

continually be brought home to the industrial workers. The pre-employment interview with the doctor,

nurse or welfare officer gives an opportunity for hints on personal hygiene. All the employees in a

factory should become health-minded as Human Resources (HR) Capital plays a very crucial role in the

growth and prosperity of any industry. The fundamental conditions of a healthy working environment

must be maintained in every factory. In this connection good canteen assumes an importance, in keeping

the air fresh and free from germs. The main purpose of this study is to study work environment of the

workforce and its impact on the employees’ hygiene and to know the modern hygienic canteen facility as

welfare amenity being provided by selected Indian Industrial Units. The study may help to the policy

makers like management, trade unions, Government to improve the existing state of affairs mainly by

emphasizing on the amenities and welfare of the employees in corporate sectors.

Key words: Hygiene, Workforce, Work Environment, Motivation, Canteen.

INTRODUCTION

Human Resources (H R) Capital plays a very

crucial role in the growth and prosperity of any

industry. The workers can be motivated and their

productivity can be increased only when a conducive

and hygienic physical work environment is created

and adequate Canteen facility is provided by the

management irrespective of the sector. The subject of

Canteen facility is thus fairly wide and is not limited

to any one country, one region, on sector, one industry

or occupation. Its scope has been described by

different writers in different perspectives. But the

common objective of canteen facility is to provide

quality food stuff at reasonable price to the workers.

Canteen provision is neither philanthropy nor

charity. It is a method of creating more satisfactory

working conditions for men and women employed in

an industry. It is quoted that by Narayana Murty

(2000) in his work Labour Welfare Measures in

Indian Industrial Organizations that the welfare

measure would greatly reduce turnover and

absenteeism among workers and improves workers

efficiency to a greater extent and also create a

permanent settled labor force by making service

attractive to the labor. A canteen can help in

improving the morale of the workers further, the

availability of food stuff within the factory areas

reduces the botheration and saves time of the workers.

(Report of the Bombay Textiles Labor Enquiry

Committee, 1953, P: 166).

The high rate of absenteeism and turnover in

Indian Industries is indicative of the lack of

commitment on the part of the workers, for they want

to escape from their environment whenever possible.

Bigger undertakings like private and public sectors

have provided modern and hygienic canteens as

compared with co-operative sector. But in some

organizations the management passes on the

responsibility of running the canteens to the

contractors. Similarly the managements of public and

private sector units feel that the Labor Welfare is their

social responsibility. So, the representatives of the

both workers and management make the canteen

facility more attractive to the workers.

Objectives of the Study

1. To Study work environment of the workforce

and its impact on the employees’ hygiene,

2. To Know the modern hygienic canteen facility

as welfare amenity being provided by selected

Indian Industrial Units, and

3. To make appropriate suggestions to policy

makers for the improvement of hygienic canteen

facility in order to maintain healthy work

environment of workforce in selected Indian

Industrial Units.

REVIEW OF THE LITERATURE Canteen is a very important facility for the

workers through which a better standard of food and

refreshments can be obtained, when compare to the



make shift hotels that spring up around factories.

Moreover, through these canteens wholesome food

and refreshments can be provided to the workers at

reasonable prices so as to make available to them a

balanced sand hygienic food. This is likely to improve

their health and efficiency. Canteens also serve as

places where workers can meet informally and refresh

themselves by a relaxing conversation. The canteens

are also instruments of social change, as the workers

belonging to different religions and castes will have to

sit at the same tables and take their food. Thus, a

canteen can help in improving the morale of the

employees. Further, the availability of the food stuffs

within the factory area reduces botheration and saves

time of the workers; otherwise they will have to go

out of the factory. The review of the literature has

been done in order to assess the extent and quality of

Hygienic Canteen facility to employees provided by

various organizations in various industries. There

have been a number of studies conducted so far in this

area. However, a few studies of importance have been

presented here.

1. Rizwana Ansari (2011) found out in her study

physical environment and employee industrial

safety, a remarkable improvement of employee

performance. It is found that one fourth of the

employees in public sector units are dissatisfied

with the provision of safety, health amenities

and canteen facilities to the workforce.

2. Maja Dijkic (2008) in his study on physical

environment an expanded model of job

satisfaction concludes with positive correlation.

The purpose of the study was to examine the

effect of perceived physical work environment

on job satisfaction.

3. Kudchedkar (2008) differentiates between the

labour welfare activities and the personnel

functions and gives some suggestions for better

working and living standards.

4. Morris (2008) describes industrial history of

Bombay and gives the growth of labour force,

work regulation, wages, discipline, trade unions

and arbitration between 1854 to 1917 in the

Cotton Mills of Bombay (India). It is found that

the Bombay Mills Association Voluntarily

appointed personal officers to look into the

matters on safety, welfare, canteen, health and

other personnel functions.

5. Saxena (2000) gives socio-economic

background of workers in the five selected units

in Meerut district and discussed promotion

policies, training, transfers, welfare measures,

bonus, remuneration and the functioning of the

trade unions. It is found that the personnel

policies on promotion, training, internal

mobility, wage and welfare includes canteen are

created healthy work environment in the units in

Meerut ( India).

6. Narayana Murty (2000) has studied socio-

economic profile of the workforce and

employee welfare activities in Indian Industrial

Organizations. It is found that majority of the

Employees in Co-operate Sector Units are

satisfied with the existing welfare, canteen, and

health facilities.

All these studies help the management, unions and

governments to improve the existing state of affairs

mainly by emphasizing on functional areas of Human

Resources Management and existing welfare

amenities in a single unit or two units or more with a

comparative study in the same sector like private or

public or co-operative. There have been very few

comprehensive studies in the field of work

environment and less concentration on the provision

of welfare facilities and amenities provided by the

Government and the managements of the undertakings

as well. However, surprisingly, very few attempts

have been made by the researchers to study the extent

of Canteen facility to the employees of any unit. The

study shows the gap and also furnishes the reasons

between the practice and precept.

METHODOLOGY OF THE STUDY

The Coastal Districts of Andhra Pradesh,

India have been deliberately chosen in data collection

and also to obtain meaningful insights. The provision

of Canteen laid down in the Factories Act, 1948 are

common to all the public, private and co-operative

sectors. The public sector undertakings will think to

implement them seriously as they are bound by it.

The private sector seeks to implement the measures up

to the level as exactly how they are incorporated in

laws. They do not beyond what the enactment

provide for. Finally the co-operative sector seeks to

implement the provisions at a minimum level thinking

that the burden of implementation falls on both the

management and the workers. Keeping these in view,

some industrial units in Andhra Pradesh, India are

selected for field study.

The study is conducted by using both

analytical and descriptive type of methodology. The

study depends on primary and secondary data. By

using Pilot Study, the filled up Questionnaires are

collected from 290 (130 in Private Sector Unit and160

in Public Sector Unit) respondents. Based on the pilot

study, the questionnaire is modified suitably to elicit

response from the sample group. Primary data were



collected on the basis of stratified random sample

survey of employees. The views of the workers are

elicited by way of well-structured Questionnaire,

Interviews, Discussions, and Observations. The

Secondary data were collected from Journals,

Magazines, Publications, Reports, Books, Dailies,

Periodicals, Articles, Research Papers, Websites,

Company Publications, Manuals and Booklets. The

processing, classification, tabulation and interpretation

and analysis of data are done with the help of

Statistical and Mathematical Techniques. These have

been employed depending on the nature of the data

collected from the respondents.

Modern Hygienic Canteen Facility- An Analysis:

The canteens are also instruments of social change, as

the workers belonging to different religions and castes

will have to sit at the same tables and take their food.

In this context the Bombay Textiles Labor Enquiry

Committee observed. “Besides good lighting and

ventilation, adequate dining accommodation is also an

essential requirement for the workers. It is necessary

that such accommodation should be more ample for

night workers than for day workers because it is

usually not possible at night to go outside the

company premises for that purpose.”

The view of ILO in this connection is that the

“Canteen movement must be accepted by the State as

a definite changes and running of canteens must be

accepted by the employers as a national investment.

The object of the canteen was laid down very clearly

by the Labor Investigation Committee in its report

when it said “to introduce an element of nutritional

balance into the otherwise deficient unbalanced

dietary of the workers, to provide cheap and clean

food and an opportunity to relax in comfort near the

place of work, to save time and trouble to workers on

account of exhausting journey to end from work after

long hours in factory and to enable them to surmount

the difficulties experienced in obtaining meals of

foodstuffs are imperative of factory management.”

Section 46(1) of the Factories Act, 1948,

provides that the “The State Government may make

rules requiring that in any specified factory wherein

more than 250 workers are ordinarily employed, a

canteen or canteens will be provided and maintained

by the occupier for the use of the workers.” Sub

section (2) of the same section also empowers the

State Government to provide for the standards in

respect of construction, accommodation, furniture and

other equipment of the canteen and the food stuffs to

be served therein and the charges which may be made

thereof”.

DISCUSSIONS AND RESULTS

Public Sector Unit provided a full pledged

canteen with all modern facilities like proper

ventilation, adequate number of fans, neatness and

cleanliness. The canteen is run on ‘no profit no loss’

basis. The cost of power, fuel, furniture utensils are

borne by the management of Public Sector Unit. This

canteen will cater to the needs of the employees in

each shift. The canteen is working under the

supervision of Personnel Officer (Welfare- Canteen)

and a canteen committee comprising of the

representatives of workmen nominated by the

management of Public Sector Unit. The rates of the

items in the canteen have been fixed by the

management in consultation with the trade union

leaders. The Personnel officer (Welfare – Canteen)

sells the tokens to the workers from first to tenth of

every month and there is also a credit facility available

to the workers.

Price level of items in modern hygienic canteens:

The canteens are located in the midst at the yard of the

factory with an easy access to all workmen. And there

is a separated canteen also available to the

supervisors, officers and managers of Public Sector

Unit. It is observed that all the canteens in Public

Sector Unit look very neat at all times. Breakfast and

Lunch are served at the canteen for ‘A’ ( 6 am to 2

pm) and ‘G’ ( 8 am to 4 pm) shift employees, dinner

is served for ‘B’(2 pm to 10 pm) shift employees.

Tea is also served twice during the shift time at the

respective working spots. For ‘B’ shift employees

along with tea, snacks are also supplied at subsidized

price. The management of Private Sector Unit is

spending huge amount per year for the running of the

canteen. Canteen is supervised by an Assistant

Welfare Officer and Canteen Manager.

The list of items which are available in

canteen with price are placed in the canteen and have

been fixed by the management in consultation with

the office bearers of the recognized union. The

canteen also provides meal consist of cooked rice,

vegetable curry, sambar, rasam, pickles, (Chutney),

dall and curd. In addition to the canteen there is also

one tea stall, which works round the clock to supply

tea and snacks.

Besides, the various stated purposes of the

canteen provision, the objective of the industrial

canteen is to provide food to the employees at

minimum Price. The Indian worker still belongs to

the low income group and cannot afford to spend

much on his food in the canteen through his/her

position is gradually improving, and in not distant

future, the skilled worker at least would be classified



as belonging to middle class if not to the upper middle

class.

Frequency of visit to modern hygienic canteens by

the workers: Table 1 shows the data on the extent to

which the workers are utilizing the canteen facilities

available in the selected units. It is evident from the

information that in these units, about half of the

workers are frequent visitors to the canteen.

However, it is obvious that 44.14 percent of the

workers are not motivated to visit the canteen

frequently. They are going to the canteen only now

and then and only a small and negligible portion of the

workers (2.41 percent) never visited the canteen for

utilizing canteen facility in their organizations.

Table.1.Frequency of visits to canteen in selected units Opinion Frequently Sometimes Never Total

Public

Sector

Unit

Service Wise

( Years)

1-10 22 (44.00) 26 (52.00) 02 (4.00) 50 (100.00)

11-20 33 (44.00) 39 (52.00) 03 (4.00) 75 (100.00)

Above 20 14 (42.86) 18 (51.43) 02 (5.71) 35 (100.00)

Native

Background

Rural 39 (43.33) 47 (52.22) 04(4.45) 90 (100.00)

Urban 31 (44.28) 26 (37.14) 03 (4.28) 70 (100.00)

Type of

Employee

Skilled 49 (43.75) 58 (51.79) 05 (4.46) 112 (100.00)

Unskilled 21 (43.75) 25 (52.08) 02 (4.17) 48 (100.00)

Total 70 (43.75) 83 (51.88) 07 (4.37) 160 (100.00)

Private

Sector

Unit

Service Wise

( Years)

1-10 18 (66.67) 09 (33.33) - 27 (100.00)

11-20 45 (65.20) 24 (34.80) - 69 (100.00)

Above 20 22 (64.70) 12 (35.30) - 34 (100.00)

Native

Background

Rural 78 (65.00) 42 (35.00) - 120 (100.00)

Urban 07 (70.00) 03 (30.00) - 10 (100.00)

Type of

Employee

Skilled 39 (65.00) 21 (35.00) - 60 (100.00)

Unskilled 46 (65.70) 24 (34.30) - 70 (100.00)

Total 85 (65.38) 45 (34.62) - 130 (100.00)

Note: Figures in parentheses are Percentages

Unit wise analysis shows that in case of Public Sector

Unit, 43.75 percent of the workers are frequent

visitors to the canteen, about half of the workers are

not visit the canteen frequently. When we observe the

service wise and native background wise data, it is

clear from the table that the workers in the service

group of 1-20 years and urban background and

making best utilization of the canteen facility, while

the workers with more than 20 years of service and

rural background were making less utilization of the

canteen. And a negligible percentage of the workers

never visited the canteen in Public Sector Unit.

In Private Sector Unit, about two-third of the

workers are frequent visitors to the canteen and the

rest of the workers are not habituated to visit the

canteen frequently. They are going to the canteen

only now and then. When we make service-wise

analysis, it can be observed from the table that the

workers in the service-group of 11-20 years are

making best use of the canteen. It is also evident that

the urban workers are more frequent visitors of the

canteen in Private Sector Unit.

It is found from the foregoing discussion that

an overwhelming majority of the respondents are

frequent visitors to the canteen in Private Sector Unit

than that of the Public Sector Unit. It is interesting to

note that the workers in the service of 11-20 years are

making best utilization of the canteen facility, while

the workers with more than 20 years of service were

making less visits of the canteen and the urban

workers are more frequent visitors of the canteen in

the selected units of the study.

Quality of Items in the Modern Hygienic Canteens:

Table2 gives the information on the opinion of the

respondents on the quality of items in canteen in the

selected units. It is obvious from the information that

half of the workers in the selected units of the study

felt that the quality of the items in their canteen was

good and 42.90 percent of them in these units felt

satisfactory about the quality of the items in their

canteens.

Unit wise data shows that in case of in Public Sector

Unit 43.75 percent of the workers expressed good

opinion and 48.12 percent of the workers felt that the

quality of items in the canteen was satisfactory.

However, 4.38 percent of them did not say anything

and 3.57 percent of them expressed their opinion on

the quality of items in canteen was poor. When we

make service – wise analysis it is clear from the data

that 44 percent of the workers in the service group of

1-20 years and 42.86 percent of the workers in the

service group of above 20 years had expressed good

opinion on the quality of items of canteen.

In Private Sector Unit 57.69 percent of the

workers felt that the quality of the items in canteen

was good. It is obvious from the data that 36.15



percent of the workers felt that the quality of the items

in the canteen was satisfactory and the negligible

percentage of them had negative opinion on the

quality of items in modern Canteen in Private Sector

Unit. On the whole, it is found that the majority of the

workers in the service group of 1-10 years, 11-20

years and urban background had positive opinion on

the quality of items which are available in their

respective canteens. It is very interesting to note that

on the whole or individual unit-wise less than 4.83

percent of the workers felt that the quality of items in

their canteen was poor.

Table.2.Respondents’ opinion on quality of items in canteen in selected units Opinion Good Satisfactory Poor Not Aware Total

Public

Sector

Unit

Service Wise

( Years)

1-10 22 (44.00) 24(48.00) 02 (4.00) 02 (4.00) 50(100.00)

11-20 33 (44.00) 36 (48.00) 03 (4.00) 03 (4.00) 75 (100.00)

Above 20 14 (42.86) 17 (48.57) 01 (2.86) 02 (5.71) 35 (100.00)

Native

Background

Rural 39 (43.33) 43 (47.77) 04 (4.45) 04 (4.45) 90 (100.00)

Urban 31 (44.28) 34 (48.57) 02 (2.86) 03 (4.29) 70 (100.00)

Type of

Employee

Skilled 49 (43.75) 54 (48.21) 04 (3.57) 05 (4.47) 112 (100.00)

Unskilled 21 (43.75) 23 (47.91) 02 (4.17) 02 (4.17) 48 (100.00)

Total 70 (43.75) 77 (48.12) 06 (3.75) 07 (4.38) 160 (100.00)

Private

Sector

Unit

Service Wise

( Years)

1-10 16 (59.25) 10 (37.00) 01(3.75) - 27 (100.00)

11-20 40 (58.00) 25 (36.25) 04(5.75) - 69(100.00)

Above 20 19 (55.90) 12 (35.30) 03 (8.80) - 34(100.00)

Native

Background

Rural 69 (57.50) 43 (35.85) 08 (6.65) - 120 (100.00)

Urban 06 (60.00) 04 (40.00) - - 10 (100.00)

Type of

Employee

Skilled 35 (58.35) 22 (36.65) 03 (5.00) - 60 (100.00)

Unskilled 40 (57.15) 25 (35.70) 05 (7.15) - 70 (100.00)

Total 75 (57.69) 47 (36.15) 08 (06.16) - 130 (100.00)


Quality of services in the modern hygienic

canteens: Quick supply refers to speediness of

service. The worker normally would like to take his

lunch in about 15 minutes and rest for some time

before he resumes work for the second half of his

shift. Speedy meal and service depend on the type of

the canteen services practiced, the number of staff in

the canteen, the equipment available and other

resources. Table3 shows the data on the workers’

opinion on the supply of items in the canteen of the

selected units for the study. It is evident from the

Table that on the whole about half-of the workers felt

that the service in the canteen was satisfactory.

However, it is also clear from the data that 4.83

percent of the workers felt that the service in their

canteens was poor.

Table 3: Respondents’ opinion on services in canteen in selected units Opinion Good Satisfactory Poor Not Aware Total

Public

Sector

Unit

Service Wise

( Years)

1-10 22 (44.00) 24 (48.00) 02 (4.00) 02 (4.00) 50 (100.00)

11-20 33 (44.00) 36 (48.00) 03 (4.00) 03 (4.00) 75 (100.00)

Above 20 14 (42.86) 17 (48.57) 01 (2.86) 02 (5.71) 35 (100.00)

Native

Background

Rural 39 (43.33) 43 (47.77) 04 (4.45) 04 (4.45) 90 (100.00)

Urban 31 (44.28) 34 (48.57) 02 (2.86) 03 (4.29) 70 (100.00)

Type of

Employee

Skilled 49 (43.75) 54 (48.21) 04 (3.57) 05 (4.47) 112 (100.00)

Unskilled 21 (43.75) 23 (47.91) 02 (4.17) 02 (4.17) 48 (100.00)

Total 70 (43.75) 77 (48.12) 06 (3.75) 07 (4.38) 160 (100.00)

Private

Sector

Unit

Service Wise

( Years)

1-10 11 (40.75) 15 (55.55) 01(03.70) - 27 (100.00)

11-20 27 (39.15) 37 (53.60) 05(07.25) - 69 (100.00)

Above 20 14 (41.20) 18 (52.95) 02(05.85) - 34 (100.00)

Native

Background

Rural 48 (40.00) 65 (54.15) 07(05.85) - 120(100.00)

Urban 04(40.00) 05(50.00) 01(10.00) - 10(100.00)

Type of

Employee

Skilled 24(40.00) 32(53.35) 04(06.65) - 60(100.00)

Unskilled 28(40.00) 38(54.30) 04(05.70) - 70(100.00)

Total 52 (40.00) 70(53.84) 08 (6.16) - 130(100.00)


The analysis on unit-wise indicates that in case of

Public Sector Unit 43.75 percent of the workers had

good opinion, 48.12 percentage of them satisfied with

the service available in canteen and a very low percent

of the workers viewed on the services available in

canteen was poor and only 4.38 percent of them did



not say anything on the service in the Canteen. In

Private Sector Unit, about more than half-of the

workers felt that the service in the canteen was

satisfactory, whereas 6.16 percent of the workers felt

that the service in the canteen was poor.

It is found that more than 93 percent of the

workers in the Selected Industrial units were satisfied

with the quality of canteen services. It is observed

that the services in Private Sector Unit canteen as

controlled by canteen committee and labor officer,

and Public Sector Unit canteen was controlled by the

Canteen Committee and Senior Personnel officer.

Cleanliness in modern hygienic canteens: The

canteen should be installed in a clean and hygienic

place and its kitchen, counter as well as the dining

rooms. The canteen area should be maintained in

clean and health conditions, free from the files, dust

and dirt. The Computed Data shows the information

on workers’ opinion on the sanitation and cleanliness

in their respective canteens of the selected units. It is

evident from the data that 63.45 percent of the

workers on an average in the industrial units, felt that

the cleanliness in their canteens was good, about

30.68 percent of the workers opined that the

cleanliness in their canteens was satisfactory and only

less than 3.79 percent of them felt dissatisfied with the

cleanliness in the canteens of the selected units for the

study.

Unit-wise data reveals that in case of Public

Sector Unit 48.12 percent of the workers felt that the

cleanliness and sanitation in canteen was good, about

43.75 percent of them had expressed satisfactory

opinion and 3.75 percent of the workers in did not say

anything about the sanitation conditions in their

canteen. However, a very low percentage of the

workers felt dissatisfied with the cleanliness in the

Public Sector Unit canteen. In Private Sector Unit

about four fifths of the workers felt that the

cleanliness in Private Sector Unit canteen was good.

It is also interesting to note that only an insignificant

portion of the workers felt dissatisfied with the

cleanliness in the canteen.

Major Findings of the Study

1. It is found that the bigger organization in the

private sector and public sector units are

financially sound and they are able to provide

the clean and hygienic food items to their

worker at minimum price in the Canteens in

Indian Industrial Organizations.

2. It is found that the Indian workers in the

selected units expressed their satisfaction and

the prices are reasonably charged in the

hygienic canteens.

3. It is found that an overwhelming majority of

the respondents are frequent visitors to their

hygienic canteen in Private Sector Unit than

that of the Public Sector Unit.

4. It is found from the foregoing analysis that

half-of the workers in the selected unit felt

that the quality of items in the canteen was

good. It is also found that an insignificant

percentage of the respondents had poor

opinion on the quality of items in their

canteen.

5. It is found that an average earning in Indian

Industrial worker is not in a position to take

his/her food items with quality in his house as

compared with the items in their canteens at

their work spots.

6. It is found that more than 93 percent of the

Indian Industrial workers in were satisfied

with the service in the canteen.

7. It is also found that the majority of the Indian

Industrial workers were satisfied with the

cleanliness and sanitation in their canteens.

Suggestions for the improvement of Canteen for

Healthy Physical Work Environment of the

Workforce:

1. It is suggested that the management of private

and public sector units can provide the clean

and hygienic food items to their worker at

minimum price in their canteens and to

mitigate the dissatisfied workers in Indian

Industrial Units.


and public sector units may maintain the same

price for food items in the Canteen in future

also through subsidy created by the

management of Industrial units.


and public sector units may create the habit of

visits in the minds of employees to visit

canteen and to take their food in the canteen

in order to save their productivity time on the

work-spot and to get some relax.


and public sector units may take steps to

improve the services in their canteen in

speedy and quick manner.

5. It is suggested that management of Public

Sector Unit should maintain cleanliness and to

establish good sanitation at the canteen as a

part of the welfare and health of workmen in

India.



6. It is suggested that the managements of

Indian Industrial Units should maintain high

quality of items and to mitigate the rest of the

dissatisfied workers also.

Scope for Further Research

The study can be extended to the related

business Information Technology Export Services

(ITES) and Business Process Outsourcing industry

(BPO). Leadership and administration styles are to be

studied as the employees are lagging behind in these

qualities in India and similar studies can be conducted

on other type of industries. Society comprises of the

workers, management, Government and general

public. The present study is of much relevance from

the point of view of the society. The Central and State

Government are enabling several labor legislations

and adopted a policy to create better working of

industrial canteen to the workers.

CONCLUSION

On the basis of the results obtained in the

study, it is observed that the canteen in the units

prevailing have deep impact on workers psychology

and the presence of such factors always motivate the

workers towards their job in a laudable manner.

Hence, it is concluded that the workers employed are

satisfied with their job and their positive approach

towards the management has been responsible for the

overall growth of in the Indian corporate sector.

Besides, it has also been found that the concept of

canteen facility assumes immense importance in the

present business scenario which requires highly

skilled and competent human resources for the

transformation of traditional economies into the

modern and industrial economies.

ACKNOWLEDGEMENTS

We thank Smt. S. Tehniath Khan President of

Nimra and Shadan Group of Colleges, India, Dr.

Mohd Saqib Rasool Khan, Secretary, Nimra College

of Business Management, Vijayawada, India, Dr.

Mohd Sarib Rasool Khan, Managing Director, Shadan

Institute of Medical Sciences, Hyderabad, India, Dr. K

V Rao, Vice- Chancellor, Acharya Nagarjuna

University, India for their support and encouragement

during this study.

REFERENCES

Bhatia W.J, Principles and Practices of Personnel

Management and Human Resource Management,

Edition II, Deep & Deep Publication, New Delhi,

1994.

Bhattacharya S.K, Organizational Culture and Indian

Perspectives, 1988.

Dale S.Beach, Human Resource and Personnel

Management, Tata McGraw Hill, Ed.3, New Delhi,

2002.

Frederick Herzberg, B.Mausner and B. Synderman,

The Motivation to work, John Wiley and Sons, New

York, 1985.

Garry Steiner, Human Behavior, New York Harcourt,

Brace & World, 1964.

Gupta C.B, Human Resource Management, Sultan

Chand and Sons, V Edition, 2006.

Maslow A.H, Motivation and Personality, Harper &

Row, New York, 1954.

Memoria C.B, Personnel Management, Himalaya Pub.

House, Bombay, 1984.

Narayana Murty.T, Labour Welfare Measures in

Indian Industrial Organizations, Un- Published Thesis,

Nagarjuna University, Nagarjuna Nagar, India, 2000.

Rizwana Ansari, Physical work environment and

industrial safety of the employees in power sector, un-

published thesis, Vinayaka missions university,

Salem, India, 2011.

T. N. Murty and T Abhinov, Safety and Health

Environment of Workforce in Indian Public sector

Units- An Injection for Occupational Health Hazards,

ICME 2013Sri Lanka, ISBN 978-955-1507-23-7,

February 2013, Matara, Sri Lanka.

Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Design and development of Metformin hydrochloride Trilayered sustained release

tablets Venkateswara Rao T

1*, Bhadramma N

1, Raghukiran CVS

2 and Madubabu K

3

Bapatla College of Pharmacy, Bapatla, Guntur-522101

Tigala Krishna Reddy College of Pharmacy, Hyderabad.

Hetro Drugs Ltd, Hyderabad

Corresponding author: E-Mail: [email protected]

ABSTRACT

Diabetes is one of the major causes of death and disability in the world. Diabetes results from decreased

secretion of insulin, decreased insulin action or both. The main aims of the investigation was to design and

development of trilayer floating tablets of metformin hydrochloride and also study the influence of concentrations

of HPMCK 100 on various properties of tablet and tri-layer tablets were formulated by wet granulation method.

Drug - excipient compatibility studies were conducted by FTIR spectroscopy. The prepared granules, tablets were

evaluated. In-vitro release data revealed that F5 formulation sustained the release for 12 hours and the release

data was fitted into zero order, first order, Higuchi and Peppas equations. The drug release from the formulation

followed zero kinetics and exhibits Peppas mechanism. Release exponents ‘n’ was found less than 0.85 indicating

the release governed by non-fickian anomalous transport mechanism.

Key words: Tri ilayer floating tablets, Hydroxy propyl methyl cellulose (HPMCK100)

INTRODUCTION

Diabetes is one of the major causes of death

and disability in the world. Diabetes mellitus is a

group of metabolic diseases characterized by

hyperglycemia (fasting plasma glucose ≥ 7.0 mmol /

1 or 2 hours post 75 g oral glucose load plasma

glucose ≥ 11.1 mmol / on two or more occasions).

Diabetes results from deficient insulin secretion,

decreased insulin action, or both. The oral route of

drug administration was most convenient method for

controlled delivery of drug. It provides the continuous

oral delivery of a drug also the system that target the

delivery of a drug to a specific region within the GI

tract for either local / systemic action. One of the

most feasible approaches for affecting a prolonged

and predictable drug delivery in the GI tract is to

control the GRT.

Metformin hydrochloride is an anti-

hyperglycemic agent, which improves the glucose

tolerance in type 2 diabetes. People with type 2

diabetes are not able to make enough insulin or

respond normally to the insulin their bodies make.

This leads to serious medical problems including

kidney damage, amputations and blindness. The

absolute bioavailability of Metformin hydrochloride is

50-60% , biological half life is 1.5 - 3 hours and the

main site of absorption of metformin hydrochloride is

proximal end of small intestine. The HBS system was

planned for Metformin hydrochloride as such a system

when administered it remain buoyant on the gastric

fluids for a prolonged period of time and the drug it

remain buoyant on the gastric fluids for a prolonged

period of time and the drug would be available in the

dissolved format. This would leads to improvement in

the bioavailability of the drug, to increase its

bioavailability gastro retentive drug delivery systems

were choosen for development in the form of tablet. In

this way it stands as an advantage over conventional

dosage form, which needs to be administered twice or

thrice a day.


Metformin hydrochloride was received from

Alkem laboratories ltd, Mumbai as gift sample,

HPMC, sodium bicarbonate, talc was procured from

S.D fine chem.All other chemicals and solvents used

in this study were LR grade

Preparation of tri-ilayer Metformin Hydrochloride

floating tablets: The preparation of tri layer tablet

involves three steps and the granules were prepared

by wet granulation method using water as binding

solution, lactose as diluent.

Formulation of the upper and bottom layer: The

granules for upper and bottom layer were prepared as

per the formulae shown in table no 1.1.The cohesive

mass were prepared passed through sieve no 12. The

granules were dried in an oven at 550 for 2 hrs. the

dried granules were passed through sieve no 16,

lubricated with talc and magnesium stearate for

compression into tablet.

Formulation of the middle layer: The granules were

prepared by wet granulation method as per the

formulae shown in table no 1.1.The dough mass was

prepared by the addition of water as binding a solution

into the mixture of drug, polymer and diluent . The

obtained dough mass was passed through sieve no 12 ,

granules were dried in an oven at 550 for 2hrs. The

dried granules were passed through sieve no 16. The



dried granules were mixed with talc and magnesium

stearate, then subjected to compression.

Compression of tri layer tablet: The compression of

the tablet involves three steps. The granules for

bottom layer were compressed slightly, then the

granules for middle layer were poured over the above

compact, again compressed with minimum force to

form a second layer and then top layer granules were

added over the above layer, then compressed into a

tablet by Cadmach Rotary tablet machine ie tri-

layered tablet by using a16 mm flat - faced punches.

Table.1.Composition of metformin hydrochloride trilayer floating tablets with HPMC K100M Ingredients

( mg/ tablet)

F1 F2 F3 F4 F5

Su

sta

ined

lay

er

Flo

ati

ng

up

per l

ay

er

Flo

ati

ng

bo

tto

m l

ayer

Su

sta

ined

lay

er

Flo

ati

ng

up

per l

ay

er

Flo

ati

ng

bo

tto

m l

ayer

Su

sta

ined

lay

er

Flo

ati

ng

up

per l

ay

er

Flo

ati

ng

bo

tto

m l

ayer

Su

sta

ined

lay

er

Flo

ati

ng

up

per l

ay

er

Flo

ati

ng

bo

tto

m l

ayer

Su

sta

ined

lay

er

Flo

ati

ng

up

per l

ay

er

Flo

ati

ng

bo

tto

m l

ayer

Metformin

hydrochloride

500 - 500 - 500 - 500 - 500 -

HPMC K 100

M

60 40 40 80 40 40 100 40 40 120 40 40 140 40 40

Sodium

bicarbonate

- 45 45 - 45 45 - 45 45 - 45 45 - 45 45

Lactose 80 - 60 - 40 - 20 - - -

Talc 7.5 - 7.5 - 7.5 - 7.5 - 7.5 -

Magnesium

stearate

7.5 - 7.5 - 7.5 - 7.5 - 7.5 -

Total weight 825 825 825 825 825

Characterization of granules: The prepared

granules were evaluated for the following

parameters[10,11].

Bulk density: The bulk density was determined by

measuring the volume occupied by the pre weighed

granules,It was calculated by the following equation.

Bulk density = Mass of Granules /Volume of packing

Tapped bulk density: The granules whose weight

was determined earlier was transferred in to 100ml of

graduated cylinder and subjected to 100 taps. Then the

volume occupied by the granules (Tapped volume)

were determined. Tapped density was calculated by

the following formula

Tapped density = Mass of granules/tapped volume

Carr'sindex: The percentage of compressibility of

granules was determined by Carr's/Compressibility

index.

Carr's index (%) = Tapped density- Bulk density

/tapped density× 100

Hausner’s ratio: Hausner’ratio of granules

determined by comparing the tapped density to the

bulk density by using the formulae

Hausner,s ratio = Tapped density/Bulk density

Angle of repose: The prepared granules were

assessed for its flow property by determining the

angle of repose by open tube method. The angle of

repose was determined by the following formula

h = height of heap

r = radius of the base.

Loss on drying: Granules (Igm) were kept in an oven

at 105° c and dried up to constant weight. Loss on

drying was calculated using the following formulae.

Loss on drying = (Initial weight - Final weight)/initial

weight ×100

Moisture content: Granules (1gm) were kept in an

oven at 105° c and dried up to constant weight.

Moisture content was calculated using the following

formulae.

Moisture content = (Initial weight - Final weight)/final

weight × 100

Evaluation of tablets: The formulated tablets were

evaluated for the following parameters.

Thickness: The thickness and diameter of the

formulated tablets were measured by using Vernier

calipers.



Weight variation: The formulated tablets were tested

for weight uniformity. 20 tablets were collectively and

individually. From the collective weight, average

weight was calculated. Each tablet weight was then

compared with average weight to ascertain whether it

is within permissible limits or not.

% Weight Variation = (Average weight-Individual

weight)/ average weight× 100

Hardness: The tablet crushing strength, which is the

force required to break the tablet by compression in

the diametric direction was measured in triplicate by

using Pfizer tablet hardness tester.

Friability: The Roche friability test apparatus was

used to determine the friability of the tablets. 20 pre

weighed tablets were placed in the apparatus, which

was subjected to 100 revolutions. Then the tablets

were reweighed. The percentage friability calculated

was using the formula.

% Friability = Initial weight- Final weight / initial

weight × 100

Floating characteristics: Floating characteristics

were determined by using USP dissolution XI

apparatus at 100 rpm using 900 ml of 0.1 N HCl and

temperature was maintained at 37°c.

Floating lag time: The tablet was placed in

dissolution apparatus and the time taken to float on the

dissolution medium was noted.

Floating time: The total duration of the time that the

tablets float on dissolution medium was noted.

Swelling index: Tablet was weighed (W0) and placed

in dissolution medium containing 0.1N

HClmaintained at 37°c. At predetermined time

intervals the tablet was and blotted to remove excess

water and weighed (Wt). The percentage of swelling

index calculated.

Swelling index = (Wt - Wo)/Wt x 100

Wt= final weight of the tablet

Wo = initial weight of the table

Drug content: Twenty tablets were weighed and

powdered. The quantity of powder equivalent to 100

mg of Metformin hydrochloride was dissolved in 0.1 N

HC1 diluted to 100ml with 0.1N HC1 then the

solution was filtered and suitably diluted. The drug

content was estimated spectrometrically at 233 nm.

In-vitro dissolution studies: In-Vitro dissolution

studies were conducted by using USP type II paddle

dissolution apparatus with 900ml of 0.1N

Hydrochloric acid as dissolution medium, maintained

the temperature of medium at 37±0.5° and stirrer speed

at 100 rpm. 5 ml of aliquots of dissolution medium

was withdrawn at regular time intervals and the same

volume of pre-warmed (37±0.5°) fresh dissolution

medium was replaced. The samples were filtered and

drug content of Metformin hydrochloride in each

sample was analyzed after suitable dilutions, filtered

and filtrates are analyzed by Shimadzu UV-

spectrophotometer at 233 nm.


Drug- excipient compatibility studies were

conducted by FTIR spectroscopy, results revealed that no

chemical interactions were observed from the FTIR as

shown in fig 2, 3 and 4. The prepared granules for floating

layer and sustained release layer were evaluated found to

have free flow properties, results given in table 2 and also

the tablets were subjected to thickness, weight variation,

hardness, floating time, floating log time, swelling index,

drug content and in-vitro dissolution studies.The thickness

of the tablets was found in the range of 3.1+ 0.01mm to

3.8+0.05mm. The weight variation ranged between 4.2+

0.02 to 4.62+0.02, the hardness of the floating tablets were

ranged between 6.0 kg/cm2 to 7..3kgcm

2. The percent

friability of prepared tablets was well as within the

acceptable limit. The range between the formulations had

desired floating log time 3.0 + 0.01 to 4.0 + 0.04mg and

total floating time found between 6.5 -9hrs regardless of

concentrations of polymers incorporated, results given in

the table 3.

The swelling index result was observed in a range

between 28.17 ± 0.02 to 46.62 ± 0.03, that increase in

percent swelling was increasing with increasing

concentration of polymers. The drug content in all

formulations was within the range of 499.2mg ± 0.01 to

499.5mg ± 0.03, ensuring the uniformity of the drug content

in the formulation. The percentage of drug release for F1,

F2, F3, F4, F5 were found to be 98.44 ± 0.23, 98.42 ± 0.53,

99.32 ± 0.04, 98.33 ± 0.85 and 82.81 ± 0.357 at the end of

6.5, 7.5, 8.5, 9 and 11hours respectively, in vitro release

profiles as shown in fig 1. In vitro release data fitted into

the zero order, first order, matrix and peppas equations.

The formulations followed zero order kinetics and exhibited

peppas transport mechanism, release exponent found less

than 1, indicates non fickian diffusion mechanism. Results

revealed that as concentration of polymer increases, the

floating time was found to be increased and prolonged the

release of the drug due to the swelling of HPMC and high

uptake of medium, floating time influenced by the gas

generating agent and also it influences the drug release.

Among all prepared formulation F5 sustained the release

for prolonged time; hence it was suitable for the sustained

release for the patient in the treatment of diabetes and

enhances the bioavilabilty of the drug in the form of

floating delivery system. In trilayer tablet, the drug was

sustained for prolonged period of time due to the gelling

property of polymer and drug layer sand witched between

the two layers formulated with the HPMCK100M so drug

release was prolonged for more time.



Table.2.Characterization of Metformin hydrochloride trilateral floating granules formulated with HPMC

K100M Formulations

Bulk

density(g/ml)

Tapped

density(g/ml)

Carr’s index

(%)

Hausner’s

ratio

Angle of

repose (0)

Loss on

drying (%)

Moisture

content (%)

F1 0.237±00.6 0.262±0.01 5.90±0.02 1.074±0.04 21.61±0.05 6.9±0.01 7.5±0.01

F2 0.342±0.01 0.368±0.03 7.01±0.04 1.076±0.03 20.82±0.04 7.8±0.02 6.4±0.03

F3 0.249±0.02 0.277±0.03 6.4±0.03 1.080±0.01 22.91±0.03 5.4±0.03 7.7±0.02

F4 0.354±0.03 0.389±0.04 8.93±0.04 1.098±0.02 21.03±0.02 6.3±0.05 6.0±0.04

F5 0.251±0.06 0.397±0.02 7.21±0.03 1.099±0.02 24.17±0.03 5.9±0.01 5.8±0.01

Table.3.Characterization of Metformin hydrochloride trilayer floating tablets formulated with HPMC K

100 M Formulations

Thickness(mm) Weight

variation(%)

Hard

ness(kg/cm2)

Friability(

%)

Floating lag

time(min)

Floting time

(hr)

Swelling

index)(%)

Drug

content(mg)

F1 3.1±0.01 4.20±0.01 6.0±0.04 0.98±0.01 4±0.04 6.5 28.17±0.02 489.2±0.01

F2 3.5±0.02 4.42±0.04 6.2±0.03 0.97±0.02 4±0.02 7.5 31.01±0.03 479.3 ±0.03

F3 3.5±0.04 4.47±0.03 6.4±0.01 0.97±0.03 4±0.03 8.5 37.92± 0.01 499.2±0.01

F4 3.8±0.03 4.27±0.02 6.1±0.02 0.96±0.02 3±0.02 9 46.01±0.02 488.4±0.05

F5 3.8±0.05 4.62±0.02 7.3±0.03 0.94±0.04 3±0.03 9 46.62±0.03 499.5±0.03

Figure.1. Dissolution profiles of Metformin hydrochloride bilayer floating tablets formulated with HPMC k100m

Figure.2.IR spectrum of Metformin hydrochloride

Figure.3. IR Spectrum of HPMC K 100 M

0

10

20

30

40

50

60

70

80

90

100

0 1 2 3 4 5 6 7 8 9 10

% D

rug

Rel

ease

d

Time(hrs)

F1

F2

F3

F4

F5



Figure.4. IR spectrum of best formulation

CONCLUSION

The objective of present study was design and

development of tri-layered floating tablet of

Metformin hydrochloride for sustained the release.

The HPMCK 100M as a polymer more reliable and

sustained the drug for a prolonged period of time by

increasing the concentration of it. More over the high

swelling property of the polymer helped in

maintaining the buoyancy with the minimal utilization

of gas evolving excipients such as sodium bicarbonate

which increased a marked impact on the gastro

intestinal fluids by its alkaline nature. The

formulations followed zero order kinetics and exhibits

the peppas transport mechanism and hence finally

concluded that tri layer formulations were found to be

suitable for the floating drug delivery systems.

REFERENCES

Atyabi F, Sharma HL, Mohammed HAH, Fell JT, In

vivo evaluation of a novel gastro retentive formulation

based on ion exchange resins, J. Control Release, 42,

1996, 105 -113.

Dave B.S, Amin A.F & Patel M.M , G astro retentive

drug delivery system of ranidine hydrochloride

formulation and in vitro evaluation, AAPS Pharm.

Sci. Tech, 5(2), 2004, 1-6.

Hwang J, H. Park, K. Park, Gastric retentive drug

delivery systems, Drug carrier Syst, 15, 1998, 243 –

284

Indian pharmacopoeia, The controller of publications,

New Delhi, 4th edition, vol II, 1996, 469.

Vantrappen GR., Peeters TL, Janssen SJ, The

secretary component of interdigestive migratory motor

complex in man: scan d J. Gastro enterol, 19, 1979,

663-667.

Yeole P.G, Khan S., Patel V.F, Floating drug delivery

systems: Need and development, Indian. J.

pharma.sci, 67(3), 2005, 265 -272.

Sivaranjani et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Amlodipine: the upcoming threat to Periodontist Sivaranjani*, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K,

Dept of Periodontics, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Indira nagar, Gorimedu,

Pondicherry-6.

*Corresponding Author: Dr. Sivaranjani, E.Mail:[email protected].

ABSTRACT

Gingival hyperplasia is one of the side effects commonly caused by three major groups of drugs

such as a) anticonvulsants b) antihypertensives – calcium channel blockers c) immunosuppressants.

Previously among antihypertensives Nifedipine induced enlargements were commonly reported in

literature with prevalance rate of 10%. Amlodipine a second generation ca channel blocker was

considered as rare drug causing enlargement with a prevalence rate of about only 3.3%.This paper

discusses about a 60 yr old male hypertensive patient who received amlodipine at a dose of 5 mg /day

remained asymptomatic for 2 yrs later which he reported with massive enlargement of gingiva.

Key words: Amlodipine, gingival enlargement, after 2 yrs at low dose.

Key Messages: Among Ca channel blockers Amlodipine was considered as rare drug causing gingival

enlargement. Recently has become drug of concern since the prevalence of gingival enlargement among

patients under this drug is being reported widely. Regular follow of patients under Amlodipine by

Periodontists is being emphasised in this case report.

INTRODUCTION

Amlodipine induced gingival enlargements

occurs only in 3.3 % of cases under Amlodipine

therapy.(Jorgenson et al).It commonly occurs at a dose

of 10 mg /day and within two months of drug intake.

Earlier studies have reported that Amlodipine can’t

induce gingival enlargements at a dosage of 5 mg/day.

Our case was unique because patient was

receiving a daily dosage of only 5 mg. He was

asymptomatic for two years. After which he reported

with Drug induced gingival enlargement. Patient was

neither receiving 10 mg /day and the symptoms did

not appear in two months the occurrence such cases

were not reported in the recent literature. We

emphasise the regular follow up of patients under

Amlodipine therapy even at low doses and for long

term by the Periodontist.

CASE HISTORY

A 60 year old male patient reported to

Department of Periodontics, with the complaint

unaesthetic appearance of gingiva following gingival

overgrowth in maxillary and mandibular anteriors

&causing discomfort during speech and mastication.

His medical history revealed that he was hypertensive

since two years and was under Amlodipine 5mg/day.

He had no other significant medical or dental history.

On intra oral examination patient revealed massive

gingival overgrowth covering 2/3rd

of crown surface of

lower anterior teeth & in upper anterior teeth

involving interdental gingiva& marginal gingiva.

Supra gingival plaque was present in entire dentition

and there was generalised bleeding on probing (Figure

1: Preoperative view- showing combined gingival

enlargement (inflammatory& drug induced).

Based on medical history and clinical findings

drug induced gingival hyperplasia with concomitant

inflammatory enlargement was diagnosed. Patient

received a session supra and sub gingival scaling. Oral

hygiene measures were instructed & and was under

Chlorhexidine mouth wash for a period of four weeks.

On re-evaluation patient still revealed the presence of

gingival overgrowth which favoured our initial

diagnosis (Figure 2: One month post operative view

showing persistent gingival enlargement even after

removal of inflammatory component by oral

prophylaxis). Patient was referred to physician for

opinion regarding drug substitution and presently is

under regular follow up.

Figure 1: Preoperative view – showing combined gingival

enlargement (inflammatory& drug induced)

Figure 2: One month post operative view showing persistent

gingival enlargement even after removal of inflammatory

component by oral prophylaxis



DISCUSSION

An increasing number of medications are

associated with gingival enlargement. Currently, more

than 20 medications are associated with gingival

enlargement (Jimmy Jose, 2011). Amlodipine a newer

agent of dihydropyridine, used for treatment of

hypertension and angina, was first reported for

causing gingival overgrowth as side effect, by

Seymour et al in 1994.

Compared to conventional therapy (diuretics

&beta blockers) ca channel blockers have been found

to be more effective and hence these are more

frequently prescribed (Levine CB, 2003). The

dihydropyridines have been found to be associated

with enlargement of the gums with nifedipine having

the highest incidence of about 6 % (Ellis JS, 1999).

Amlodipine however is also being found to be

associated with gingival overgrowth and more& more

such cases are being reported. A recent study

comparing the effect of calcium channel blockers&

Renin angiotensin system drugs showed that gingival

enlargements are twofold greater in the former group

of drugs. This association was dose dependant& was

higher in dihydropyridine derivatives (KaurG, 2010).

The pathogenesis of this gingival overgrowth remains

to be fully understood still. These drugs affect

intracellular calcium metabolism or transport may

stimulate gingival fibroblasts to cause increased

deposition of extracellular matrix components such as

glyosaminoglycans in some patients (Dongari

Bagtzoglou A, 2004).

The other proposed non inflammatory

mechanisms include defective collagenase activity,

blockage of aldosterone synthesis in adrenal cortex

which is also calcium dependent& causes a

consequent feedback increase in ACTH levels

&

upregulation of keratinocyte growth factor (Das SJ,

2002).

Recent studies have demonstrated abnormally

high levels of specific cytokines such as IL-6, IL-1

beta, Platelet derived growth factor, Fibroblast growth

factor, Transforming growth factor beta & connective

tissue growth factor in gingival overgrowth tissue

(Trackman P.C, 2004).

Drug induced gingival enlargements are

usually associated with a superimposed inflammatory

component which has to be minimised as it is a major

contributor to the gingival overgrowth (Seymour RA,

2006). Meticulous oral hygiene measures should be

done by the dentist &patient maintenance of the same

plays a major role in decreasing the inflammatory

component. This helps in decreasing the degree of

gingival overgrowth present& improves overall

gingival health.

In cases of severe enlargements consideration

for substitution of amlodipine with isradipine,

lercanidipine or lacidipine which are newer fourth

generation dihydropyridines may be an option.

Substitution with other classes of antihypertensives

such as Beta blockers, A.C.E inhibitors or Thiazide

diuretics can also be considered (Rashi Chaturvedi,

2011). But in cases for drug substitution systemic

health should given prime importance. Discontinuing

the causative drug has been found to reduce the

gingival overgrowth but in cases where enlargement

causes esthetic& masticatory difficulties for the

patient periodontal surgical treatment should be

considered.

CONCLUSION

Though the incidence of Amlodipine induced

gingival enlargements are rare, presently many cases

are being reported even with a minimal dose and also

as late presentation as seen in our patient. The exact

mechanism by which drug causes gingival

enlargement is yet to be explored! Research in this

area would benefit large number of hypertensive

patients. Hence physians and Periodontistss should be

made aware of this fact & regular follow up to be

emphasised for all patients under Amlodipine therapy.

REFERENCES

Das SJ, Olsen I, Keratinocyte growth factor is

upregulated by hyperplasia- inducing drug Nifedipine,

Cytokine, 12, 2000, 1566-9.

Dongari Bagtzoglou A, Research, Science and

Therapy Committee, American Academy of

Periodontology, Drug associated gingival

enlargement, J Periodontol, 75, 2004, 1424-31.

Ellis JS, Seymour RA, Steele JG, Robertson P, Butler

TJ, Thomason JM, Prevalence of gingival overgrowth

induced by calcium channel blockers: A community

based study, J Periodontol, 70, 1999, 63-7.

Jimmy Jose, Santhosh Y, Naveen MR, Vijay kumar,

Asian J Pharm Clin Res, 4, 2011, 65-6.

KaurG, Verhamme K. M. C, Dieleman J.P,

Vanrolleghem A,Van Soest E. M., Stricker B.H.C.et

al. Association between calcium channel blockers and

gingival hyperplasia, J Clin Periodontol, 37, 2010,

625–30.



Levine CB, Fahrbach KR, Frame D, Connelly JE,

Estok RP, Stone LR et al. Effect of amlodipine on

systolic blood pressure, Clin Ther, 25, 2003, 35-57.

Nyska A, Shemesh M, Tal H, Dayan D. Gingival

hyperplasia induced by calcium channel blockers:

mode of action. Med Hypotheses, 43, 1994, 115-8.

Rashi Chaturvedi, Ashish Jain. Amlodipine induced

gingival enlargement - presentation of a clinical case

series, J Clin Exp Dent, 3, 2011, 390-4.

Seymour RA, Effects of medications on the

periodontal tissues in health and disease, Periodontol

2000, 40, 2006, 120-9.

Trackman P.C, Kantarci A, Connective tissue

metabolism and gingival overgrowth, Crit Rev Oral

Biol Med, 15, 2004, 165-75.



Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered

floating tablets of Diltiazem hydrochloride Venkateswara Rao T*, Bhadramma N, Raghukiran CVS2 and Madubabu K3

Department of pharmaceutics, Bapatla college of Pharmacy, Bapatla, India.

Tigala Krishna Reddy College of Pharmacy, Hyderabad.

Hetro Drugs Ltd, Hyderabad

*Corresponding author: Email: [email protected]

ABSTRACT

In the present study an attempt was made to study the effect of formulation variables on bi-

layered floating tablet of Diltiazem hydrochloride. Immediate release layer was formulated by using

various super disintegrants such as sodium starch glycolate, cross carmellose sodium, crospovidone and

sustained release layer was formulated with different grades of hydrophilic polymers like HPMCK4M,

HPMCE5 and HPMCK100M by wet granulation method. The influence of polymer and citric acid

concentrations were also investigated. The prepared tablets were characterized and rate of drug release

from an immediate release layer was 99.9% were found at the end of 20 minutes followed by sustained

the drug release for 12hrs from sustained release layer. The dissolution data were fitted into zero order,

first order, Higuchi and Peppas equations. Results revealed that the drug release from the formulation F20

followed zero order kinetics and exhibited Peppas transport mechanism.

Key words: Diltiazem hydrochloride, wet granulation method, first order kinetics, HPMC-Hydroxy

propyl methylcellulose.

INTRODUCTION

The oral route is considered as the most promising and

predominant route of drug delivery1. Effective oral

drug delivery may depend upon the factors such as GI

transit time of dosage form, gastric emptying process,

drug release from the dosage form and site of

absorption of drug. Most of the oral dosage forms

possess several physiological limitations such as

variable GI transit, because of variable gastric

emptying, leading to incomplete drug release, non-

uniform absorption profiles and shorter residence time

of the dosage form in the stomach. This leads to

incomplete absorption of drugs having absorption

window especially in the upper part of the small

intestine, as once the drug passes down the absorption

site, the remaining quantity goes unabsorbed.

To overcome these limitations, various

approaches have been proposed to increase gastric

residence of drug delivery systems in the upper part of

the GI tract. Dosage forms that can be retained in the

stomach are called gastro retentive drug delivery

systems (GRDDS). GRDDS can improve the

controlled delivery of drugs that have an absorption

window by continuously releasing the drug for a

prolonged period of time before it reaches its

absorption site, thus ensuring its optimal

bioavailability.

One of the novel approaches in the area of sustained

drug delivery was Gastro retentive drug delivery

systems (GRDDS).Several techniques have been

proposed to increases the Gastric residence time of

dosage forms such as floating systems, swelling

systems, hydro dynamically balanced systems and low

density systems etc. In the present investigation

Diltiazem Hydrochloride was selected as model drug

is a calcium channel blocker and it is widely used in

the treatment of hypertension. The drug has short

biological half life 3-4 hrs, low bioavailability and

narrow absorption window in upper part of GIT. Multi

layer concepts have been utilized in this present

investigation. The compatibility studies were

conducted by FT-IR spectroscopy, no compatibility

between drug and polymers were found. Bi-layered

floating tablets having immediate release layer and

sustained release layer, the drug was released within

20 minutes from the IR layer leads to a sudden raise in

blood concentration, blood level was maintained at

steady state as the drug was released from the

sustained release layer.

MATEARIALS AND METHODS

Diltiazem Hydrochloride, gift sample from

Medreich ltd Banglore, Sodium starch glycolate,

Croscarmellose sodium, Crospovidone,

HPMCK100M, HPMCK4M and HPMCE5 were

procured from (Medreich ltd Bangalore),PVPk-30 and

Lactose (SD Fine Chem., Mumbai, India),Talc and

Magnesiumstearate was obtained from (Qualigens

Fine Chem., Mumbai, India).

Drug- Excipient Compatibility Study by IR

spectroscopy: IR spectrums of pure drug of Diltiazem

Hydrochloride and its physical mixtures were carried

out by using FT-IR (Thermonickolat, USA)



employing the KBR pellet method. The spectra were

scanned over a wave range of 400-4000cm-1

Preparation of Diltiazem Hydrochloride Bilayer

Floating tablets: The preparation of Bilayer floating

tablets involved two steps prepared by wet granulation

method. The excipients used in the formulation are

superdisintegrants such as SSG, Croscarmellose

sodium, Crospovidone, PVP in isopropyl alcohol as

binding solution, HPMCK4M, HPMCE5 and

HPMCK100M as polymers, lactose as diluent, and

talc and magnesium stearate as glidant and lubricant.

The dose calculation for the loading dose and

maintenance are given below

Pharmacokinetic parameters of Diltiazem

hydrochloride: Fraction of drug absorbed (F) 0.44

Elimination half life (t1/2) 3.7 hrs

Elimination rate constant (Ke) 0.187hr-1

Clearance 12 ml/min/kg

Volume of distribution 3.1 lit/kg

Calculation of Loading dose (DL): Loading dose (Css avg × Vd)/F

But, Css avg (F×Dose/Ґ)/Clearance

Css avg (0.44×90mg/12hrs)÷12ml/min/kg

Css avg 6.54×10-8mg/ml

DL (6.54×10-8mg/ml×3.1lit)÷0.44

Loading

dose(DL)

34.57

Calculation of Maintainance dose (DM): Maintainance dose Ko (T-t1/2)

But, Ko Ke× loading dose

Maintainance dose Ke× loading dose×(T-t1/2)

Maintainance dose 0.187×34.57× (12-3.7)

So, DM 54.87 mg

Based on the above calculations, the immediate

release dose was considered as 35mg and the

maintenance dose was considered as 55mg.

Preparation of the immediate release layer: The

immediate release layer was prepared as per the

formula given in table 1. The damp mass was passed

through sieve no 12. The granules thus obtained were

dried in an oven at 50 OC. The dried granules were

sieved through sieve no16 and lubricated with talc and

magnesium stearate.

Preparation of the floating sustained release layer:

The SR layer was prepared as per the formula shown

in table2. The damp mass was passed through sieve no

12 to obtain granules. The granules thus obtained were

dried in an oven at 50 OC. The dried granules were

sieved through sieve no 16 and lubricated with talc

and magnesium stearate.

Compression of bilayer floating tablets: The

required quantity of granules for the SR layer was

compressed slightly by using a rotary punch tablet

machine with 9mm punches. Then the required

quantity of granules for the IR layer were placed over

the above compact ,both the layers were compressed

by 9 mm round shaped punches with Cadmach tablet

machine to obtained the tablets.

Evaluation of Diltiazem Hydrochloride bi-layered

floating tablets: All the prepared bi-layered floating

tablets were evaluated for following parameters.

Weight Variation: Formulated tablets were tested for

weight uniformity, in which 20 tablets were weighed

collectively and individually. From the collective

weight, average weight was calculated. The percent

weight variation was calculated by using the following

formula.

Hardness: The hardness of tablets was measured by

Monsanto hardness tester. The hardness was measured

in terms of kg/cm2.

Friability: The Roche friability test apparatus was

used to determine the friability of the tablets. Twenty

pre-weighed tablets were placed in the apparatus and

operated for 100 revolutions and then the tablets were

reweighed. The percentage friability was calculated

according to the following formula.

Drug content: Twenty tablets were weighed,

powdered and quantity of powder equivalent to 100

mg of Diltiazem hydrochloride was dissolved in 0.1 N

HC1 diluted to 100ml with 0.1N HC1 then the

solution was filtered and suitably diluted. The drug

content was estimated spectrometrically at 237 nm.

Swelling index: Tablet was weighed (W0) and placed

in 0.1N hydrogen chloride maintained at 37°c. At

predetermined time intervals the tablets were

reweighed and blotted to remove excess water and

weighed (Wt). The percentage of swelling index

calculated by the following formula

Wt = final weight of the tablet

Wo = initial weight of the table.

Floating characteristics: Floating characteristics

were determined using USP dissolution apparatus at

100rpm using 900 ml of 0.1 N HCl, temperature was

maintained at 37°c.



Floating lag time: The tablet was placed in

dissolution apparatus and the time taken to float on the

dissolution medium was noted.

Floating time: The total duration of the time that the

tablet float on dissolution medium was noted.

In-vitro dissolution studies: In-Vitro Dissolution rate

was studied by using USP type II paddle dissolution

apparatus in 900ml of 0.1N Hydrochloric acid at

37±0.5°at 50 rpm. 5ml of aliquot of dissolution

medium was withdrawn at regular time intervals, the

same volume of pre-warmed (37±0.5°) fresh

dissolution medium was replaced. The samples were

filtered and drug content of diltiazem hydrochloride

in each sample was analyzed after suitable dilution by

Shimadzu UV-spectrophotometer at 237 nm.

Results and discussion: The IR spectra of Diltiazem

Hydrochloride, crospovidone, HPMCK100M and its

physical mixtures were given in fig 1, fig 2 , Fig 3,

fig 4 and fig 5.. The following principle peaks were

observed in the IR spectra of Diclofenac sodium.

Amine stretching N-H (Stretching) 2386.15 cm-1

Acetate C=O (Stretching 1737.15 cm-1

O-Substituted aromatic

C-H out of plane deformation 832.80 cm-1

C-H (Stretching, aliphatic) 2964.58 cm-1

P-Substituted aromatic

C-H out of plane deformation 774.45 cm-1

C – N (amide) 1290 cm-1

C = O 1650 cm-1

The principle peaks of pure peaks were also

observed in the spectra of spectra of physical

mixtures, it was confirmed that no chemical or

physical interactions were exists between the drug and

the excipients employed in this investigation.

Micromeritic properties for formulations were

evaluated, the results revealed that IR layer and SR

layer granules exhibited good flow properties; it was

also further supported by Carr’s Index and Hausner’s

ratios values. The formulated tablets were subjected to

various quality control tests and the results were

shown in table 3. The obtained results were found to

be within limits of pharmacopoeia. The % drug

content in all bilayer formulaitons were observed in

the range of 98.6±0.03% to 99.±0.02%.The floating

lag time for the prepared formulations were found to

be decreased while increasing the concentration of

polymer and also total floating time of SR layer

formulations were increased by increasing the

concentration of polymer.

The formulations of immediate release layer

were shown in table1. In vitro release profiles were

shown in fig 6,7 and 8, in-vitro release data were

fitted into various kinetic models i.e. First order and

zero order, drug release from formulations exhibited

the first order kinetics, the order of drug release from

the formulations were in the following order

F12>F8>F11>F4>F7>F10>F3>F6>F2>F9>F1>F5 i.e.

increasing the concentrations of SSG, Croscarmellose

sodium and Crospovidone in formulations the drug

release rate was found to be increased. Finally F12

was optimized for development of the bi layer

Diltiazem hydrochloride tablets.

In vitro drug release profiles for bilayer

tablets were shown in fig 9,10,11 and 12, percentage

of drug release for the formulations F13, F14, F15,

F16, F17, F18, F19, F20, F21, F22, F23 and F24 are

95.602 ± 0.34, 92.98 ± 0.34, 98.30 ± 0.34,97. 10 ±

0.34, 98.61±0.34, 99.36±0.34, 98.88±0.34,

99.71±0.34, 86.21±0.34, 97.79±0.34, 99.81±0.34 and

99.23±0.34 observed at the end of 6, 8, 10, 4, 6, 8, 6,1

2, 12, 10, 8 and 6 hours respectively. Among all the

formulations F20 retarded the drug release for 12 hrs

where as F21 formulation prolonged the drug release

for more than 12 hrs. So tablets formulated with

HPMCK 100M (F20) was selected and studied the

influence of citric acid on drug release. By the

addition of citric acid into the formulations, floating

lag time and total floating time was decreased when

compared with the previous studies, that is due to

liberation of excess amount of corbondioxide and

hence the total amount of the drug was also released

within 10 hours when compared with the formulations

formulated without citric acid.

The In-vitro release data were fitted into

various kinetic models i.e. First order, zero order,

Higuchi and Peppas equations, drug release from

formulations exhibited zero order kinetics and

exhibited the Peppas transport mechanism. The

exponential coefficient from the Peppas plots was

found to be <0.5 indicating Fickian diffusion transport

mechanism, the order of release retardant was as

follows HPMCK100M>HPMCE5>HPMCK4M, from

the results it indicated that release rate was retarded

by increasing the concentration of the polymer.

In- vitro buoyancy studies revealed that

tablets of hardness 2-4 Kg/cm2 after immersion into

the floating media floated immediately, tablets with

hardness of 4-5 Kg/cm2 sank for 3-4minutes, and then

floated on to the surface. Tablets with different

hardness remained floating for 8-12 hrs. The

buoyancy of the tablets is governed by both the

swelling of the poly hydrocolloid particles in the

tablet surface when it the contacts the gastric fluids

and presence of the internal voids in the centre of the

tablet, hence altering a bulk density <1. The



formulation F20 formulated with HPMC K 100 M

sustained the release for 12 hrs, when compared with

formulations made with HPMC K4 M and HPMC E5

grade of polymers this may be due to the viscosity of

the polymer i.e formation of gel structure. The

concentration of citric acid in the formulations were

also investigated, by increasing the concentration of

citric acid per tablet from 10-20mg, the floating lag

time were found to be decreased due to its reaction

with sodium bicarbonate resulting in generation of

carbon dioxide gas of a faster rate i.e in presence of

excess carbon dioxide and also release rate were

observed very faster.

Finally concluded that, results of the studies

based on the in- vitro performance clearly suggested

that, sustained release floating matrix tablets can be

prepared by immediate release layer of drug with

crospovidone and SR layer comprises the sodium

bicarbonate, citric acid with HPMC K 100 M for

achieving the sustained action and restricted the drug

release in the stomach.

Table.1.Composition of Immediate release layer for bi-layered floating tablets of Diltiazem Hydrochloride formulated

with SSG, Croscarmellose sodium, Crospovidone

Ingredients

Quantity per single tablet(mg)

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

Diltiazem

hydrochloride

35 35 35 35 35 35 35 35 35 35 35 35

Sodium starch

glycolate

1.5 2.25 3 3.75 - - - - - - - -

Croscarmellose

sodium

- - - - 1.5 2.25 3 3.75 - - - -

Crospovidone - - - - - - - - 1.5 2.25 3 3.75

PVPk-30 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5

Lactose 35.5 34.75 34.75 33.25 35.5 34.75 34 33.25 35.5 34.75 34 33.25

Talc 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75

Magnesium

stearate

0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75

Total

weight(mg)

75 75 75 75 75 75 75 75 75 75 75 75

Table.2.Composition of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 4 M,

HPMCK E 5 and HPMCK100M Ingredients Quantity per tablet (mg)

F13 F14 F15 F16 F17 F18 F19 F20 F21 F22 F23 F24

Immediate release layer

Diltiazem

hydrochloride

35 35 35 35 35 35 35 35 35 35 35 35

Crospovidone 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75

PVPk-30 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5

Lactose 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25

Talc 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75

Magnesium stearate 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75

Sustained release layer

Diltiazem

hydrochloride

55 55 55 55 55 55 55 55 55 55 55 55

HPMCK 4 M 60 80 100 - - - - - - - - -

HPMCK E 5 - - - 60 80 100 - - - - - -

HPMCK100M - - - 60 80 100 - - -

HPMCK100M - - - - - - - - - 80 80 100

Citric acid - - - - - - - - - 10 20 20

Sodium bi

carbonate

30 30 30 30 30 30 30 30 30 30 30 30

Lactose 49 31 11 49 31 11 49 31 11 49 31 31

Talc 2 2 2 2 2 2 2 2 2 2 2 2

Magnesium stearate 2 2 2 2 2 2 2 2 2 2 2 2

Total weight(mg) 275 275 275 275 275 275 275 275 275 275 275 275



Table.3.Physico-chemical evaluation of the for bi-layered floating tablets of Diltiazem Hydrochloride

Formulation

Average

weight (mg)

Hardness

(kg/sq cm)

Friability

(%)

Drug content

(%)

Swelling

index (%)

Floating lag

time (sec)

Total floating

time (hrs)

F13 275±0.21 3.9±0.31 0.68 97.3±0.01 37.4±0.03 77 10

F14 275±0.23 4.5±0.22 0.66 97.8±0.04 52.5±0.03 60 12

F15 275±0.34 5.3±0.17 0.75 98.6±0.05 56.2±0.04 55 >12

F16 275±0.3 4.2±0.24 0.70 96.5±0.02 39.4±0.03 68 3

F17 275±0.12 5.4±0.18 0.67 97.4±0.03 46.1±0.02 60 6.5

F18 275±0.24 5.2±0.2 0.64 98.1±0.04 54.5±0.02 58 8.5

F19 275±0.3 4.6±0.15 0.73 99.1±0.05 45.9±0.03 71 5

F20 275±0.18 4.9±0.36 0.71 98.2±0.04 46.1±0.05 59 6.5

F21 275±0.19 3.6±0.24 0.68 97.6±0.02 48.2±0.04 55 8.5

F22 275±0.25 3.3±0.45 0.7 96.6±0.03 37.5±0.03 69 2.5

F23 275±0.12 3.5±0.36 0.72 96.2±0.05 45.1±0.03 60 4.5

F24 275±0.26 5.6±0.01 0.61 99.3±0.02 49.6±0.02 59 6

Figure.1. IR spectra of Diltiazem Hydrochloride

Figure.2.IR spectra of Crospovidone

Figure.3.IR spectra of HPMCK100M



Figure.4. IR spectra of optimized formulation

Figure.5.IR spectra of Diltiazem Hydrochloride, HPMCK100M and Crospovidone

Figure.6.In-vitro release profile of IR layer formulated

with SSG Figure.7.In- vitro release profile of IR layer formulated

with Croscarmellosesodium

Figure.8. In- vitro release profile of IR layer formulated

with Crospovidone Figure.9.In-vitro release profile of bi-layered floating tablets of

Diltiazem Hydrochloride formulated with HPMCK 4 M

Figure.10. In-vitro release profile of bi-layered floating tablets

of Diltiazem Hydrochloride formulated with HPMCK E 5 Figure.11.In-vitro release profile of bi-layered floating tablets of

Diltiazem Hydrochloride formulated with HPMCK 100M



Figure.12.In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 100M

CONCLUSION

The drug and excipients were found to be

compatible, it can be confirmed by FTIR spectral

analysis.. The characteristics of the granules such as

angle of repose, bulk density, tapped density, carr’s

index, hausner’s ratio were studied, found to be good

flow properties. Evaluation parameters of the tablets

such as weight variation, hardness, friability, drug

content, swelling index, floating characteristics, was

found to be satisfactory. The buoyancy lag time was

found to be satisfactory. The swelling index was

found to be increased with increase in the amount of

the polymer employed. The formulations F20 was

found to be, sustained the drug release for 12hrs and

also investigated the effect of citric acid on release

rate of drug. The optimized tablet formulations

showed a satisfactory dissolution profile and floating

characteristics. The drug release from all formulations

followed zero order kinetics and Fickian diffusion.In

the present investigation, successfully developed the

bilayer floating tablets of Diltiazem Hydrochloride by

wet granulation method using super disintegrants

Crospovidone for IR layer and HPMCK100M for SR

layer.

ABBREVIATIONS

IRLayer=Immediate release layer,

SRLayer=Sustained release layer, HPMC=Hydroxy

propyl methyl cellulose, HCl=Hydrochloric acid,

hrs=Hours, rpm=Rotation per Minute. USP=United

States Pharmacopoeia and UV=Ultra-Violet.

ACKNOWLEDGEMENTS

The authors express their gratitude to

Medreich ltd. Banglore for providing gift sample of

Diltiazem Hydrochloride. The authors are thankful to

Bapatla Educational Society, Bapatla for providing

facilities to carry out research.

REFERENCES:

A.A.Shirwaikar and A. Srinath1, sustained release

Bilayered tablets of Diltiazem hydrochloride using

insoluble matrix system: Indian journal of

pharmaceutical science, 2004, 66(4):433-437.

Bharadia P.D, Patel M.M., Gayatri C.Patel, Girish

N.Patel, A primary investigation on sesbania

excipients, Int.J.Pharma.Excip, 2004, 99-102.

Leon lachman, Herbert A Liberman, Joseph L.Kang,

The theory and practice of industrial pharmacy,

Varghese publishing house, Mumbai, 1987, 3rd

edition,

52-53.

S.P.Vyas., Roop K. Khar., Gastrovetentive systems.

In: controlled drug delivery concepts &

Advances, vallabh prakashan, 2005, 96-199.

Shah S.H., Patel J.K., Patel N.V, Stomach specific

floating drug delivery system: A review: International

journal of pharmaTech Research, 1(3), 2009, 623-633.

Tejal Soni, Chirag Nagda, Tejal Gandhi, and N. P.

Chotai, Development of discriminating method for

dissolution of aceclofenac marketed formulations,

Dissolution Technologies, 2008, 31-35.

United States Pharmacopeia, Asian edition, US

Pharmacopieal convention, Rockville, 1995, 1980-

1982.

USP 27/NF 22, Asian edition, General test procedures,

U.S. Pharmacopoeial convention, Rockville MD,

2004, 1204.

Viniia V.Kale, Rahul Kasliwal, Subrat K. Pari da,

Jasmine G.Awari, Formulation and release

characteristics of guar gum tablet containing

Metformin hydrochloride, Int.J.Pharma.Excip, 2004,

75-80.

Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Development and optimization of Diltiazem hydrochloride loaded microspheres by

using different Eudragit polymers V. Kamalakkannan*

1, K.S.G.Arul Kumaran

2

1.Department of Biotechnology (Pharmacy) Periyar Maniammai University, Thanjayur, Tamil Nadu, India

2.Department of pharmaceutics, K.M.C.H College of Pharmacy, Coimbatore, Tamil Nadu, India

* Corresponding author: Email: [email protected]; Contact: +918973750397 ABSTRACT

The problems of frequent administration and variable low bioavailability (40-60%) after oral

administration of conventional dosage forms of Diltiazem hydrochloride can be attenuated by designing it

in the form of microspheres which would prolong the residence time at the absorption site to facilitate

intimate contact with the absorption surface and thereby improve and enhance the bioavailability.

Microspheres of Diltiazem hydrochloride were formulated using Eudragit S 100 and Eudragit L 100 alone

by solvent evaporation methods with an aim to prolong its release. Six formulations prepared by using

different drug to polymer ratios, were evaluated for relevant parameters. Depending upon the drug to

polymer ratio, the entrapment efficiency were found to range between 86.11 ± 0.37, 88.84 ± 0.28, 91.80 ±

0.29, 94.38 ± 0.26, 95.57 ± 0.39, 98.11 ± 0.29 respectively. The scanning electron microscopic study

indicated that the microspheres were spherical in shape and the drug remained dispersed in the polymer

matrix at amorphous state, In vitro studies were carried out at different pH for a period of 12 hours. Drug

polymer interaction was absent as evidenced by FT-IR.

Keywords: Diltiazem hydrochloride, mucoadhesive microspheres, solvent evaporation technique,

Eudragit S and L 100, in vitro evaluation.

INTRODUCTION

Diltiazem h y d r o c h l o r i d e are easily

absorbed from gastrointestinal tract (GIT) and

have a short half-life are eliminated q u i c k l y

f r o m blood c irculat ion . This drug undergoes

substantly hepatic first pass effect it shows to o r a l

b ioavai lab i l i t y 40%. So they require frequent

Dosing to avoid these drawback, the oral

sustained control release formulation have been

developed in an attempt to release the drug surely in

to the GIT and maintained an effective drug

concentration in the serum for longer period of

time Diltiazem hydrochloride an effective drug in

treatment of hypertension and angina pectoris is a

benzodiazepines derivative and Diltiazem

hydrochloride is a calcium channel blockers which

cases coronary and peripheral vasodilatation by

reducing calcium influx through the slow channel

of vascular smooth muscle and cardiac cell

membranes . Administration of conventional tablet

of Diltiazem Hydrochloride has been reported to

exhibit fluctuations in plasma drug level resulting

either in side effect of reduction in drug

concentration at receptor side, also the maintenance

of constant plasma concentration of cardiac

vascular drug is important in ensuring the

designed therapeutic response, again since the half

life of Diltiazem HCL is 3-4 hrs multiple dos e of

drug need to maintained constant plasma

concentration for good therapeutic response and

improve patients compliance. Hence the objective

of study was made to develop control release

microsphere system of Diltiazem Hcl using

polymer like Eudragit L/S 100 which controlled

the released of drug increase the

bioavailability of drug and dose decreasing the

dosing frequency of drug. For formulation of

microsphere formulation was preferred over

conventional tablet or capsule formulation has it

as several advantage like it control the release

pattern thus decreasing the dosing frequency.


Diltiazem Hcl was received as a gift from M/s

Microlabs, Bangalore, India. Eudragit S-100, L-100

were obtained Gift sample from Dr.Reddy’s Lab,

Hyderabad, India. All other reagents and solvents used

were of pharmaceutical or analytical grade.

Preformulation Studies of Pure Drug:

Identification of pure drug: Identification of

Diltiazem Hydrochloride was carried out by

Infrared Absorption Spectroscopy.

Drug - Excipients Compatibility Studies:

Compatibility of Diltiazem Hydrochloride with the

respective polymers that is Eudragit L100 and S100,

and physical mixture of main formulation was

established by Infrared Absorption Spectral Analysis

FTIR. Any changes in the chemical composition after

combining with the excipients were investigated

with IR spectra.




Figure.1.IR Spectrum of Diltiazem Hydrochloride in KBr

Figure.2.IR spectrum of DTZ.HCl, FM1, PF1(Physical mixture corresponding to FM1)

Figure.3.IR spectrum of DTZ.HCl, FM2, PF2 (Physical mixture corresponding to FM2)

Table.1. Wave- number of different functional groups present in Diltiazem.HCl Code Composition Peak for Diltiazem hydrochloride

O-CH3C-H sretch

(cm-1

)

Aromatic C-

H Stretch (cm-

1

)

Amine HCl N-H

stretch (cm-1

)

Acetate

C=O stretch (cm-

1

)

Lactam

C=O stretch (cm-

1

) DTZ.HCl Diltiazem Hcl 3057.27 2837.38 2391.81 1743.71 1681.98

FM1PF1 Formulation

FM1

3055.35

3057.27

2847.03

2839.31

2391.81

2389.88

1743.71

1745.64

1681.98

1681.98

FM2 PF2 Formulation

FM2

3055.35

3057.27

2850.88

285088

2389.88

2389.88

1743.71

1745.64

1681.98

1681.98

2499.490 54.143

2380.215 272.180

1741.135 517.708

1677.176 506.127

1607.113 176.450

1582.429 98.353

1509.160 330.859

1474.152 227.1221443.181 31.995 1411.885 106.259

1321.062 38.426

1292.508 110.346

1253.174 156.567

1237.199 54.842

1215.336 547.746

1178.237 154.926

1159.107 46.164

1138.251 45.290

1111.860 75.176

1084.204 108.010

1056.239 168.260

1026.085 160.930

1007.890 70.993

975.073 227.949

911.019 164.217

863.236 123.200

839.163 149.179

781.477 195.473

755.708 65.550

736.893 58.922

691.144 120.615

665.573 150.053

635.236 102.545

568.653 120.071

531.706 118.491

479.737 218.088

435.884 91.363

415.794 82.985

DITIAZEM DRUG

3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400 200

90

80

70

60

50

40

30

Wavenumber

%T

ransm

itta

nce

2993.239 -4.318

2952.065 43.878

1719.726 171.523

1477.842 1.166

1437.891 58.917

1388.079 89.597

1244.796 822.435

1190.428 90.980

1147.625 839.850

964.392 57.718

840.039 158.695

751.211 256.837

484.899 12.503

DITIAZEM HCL + FM2+ PF2

3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400

100 95 90 85 80 75 70 65 60 55 50 45

Wavenumber

%Transmittance

Wavenumber

%Transmittance 3000.574 2.480

2950.942 214.033

2384.520 1.378

1719.488 -0.009

1607.417 37.041

1582.481 23.143 1508.695 50.904

1474.329 105.891

1442.975 38.038

1388.458 40.893

1252.041 105.720 1193.201 39.705

1150.889 313.281

1060.073 102.523

1026.203 42.485

974.385 74.696

911.107 44.021 839.169 50.642

781.231 48.056 754.878 49.822

665.278 33.312

479.740 99.855

DITIAZEM HCL + FM1+ PF1

3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400 200

100 95 90 85 80 75 70 65 60 55 50 45



Preparation of Diltiazem Hcl microspheres:

Diltiazem hydrochloride loaded microspheres were

prepared by solvent evaporation method. Diltiazem

hydrochloride and each polymer mixture were

dissolved completely in acetone-methanol mixture by

stirring at 500rpm with magnetic stirrer. Magnesium

stearate was added and the mixture was stirred with

magnetic stirrer at 500 rpm in ice-bath at 10o

C for 10

minute. Above mixture was poured into the liquid

paraffin previously cooled at 10oC, while it was being

stirred by mechanical stirrer at 1000 rpm. Resulting

emulsion was stirred at 35oC for 4 hours using

mechanical stirrer and the organic solvent, acetone-

methanol were removed completely by evaporation.

Solidified microspheres were filtered through

Whatmann filter paper (No.1), washed six times with

50 ml n-hexane. Dried under vacuum at room

temperature for 12 h and stored in desiccators

containing calcium chloride.

Table no-2 Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and

Polymer mixtures (Drug: Polymer =1:1) Contents of Formulations FM1 FM2 FM3

Diltiazem hydrochloride

(gm)

2.0 2.0 2.0

Eudragit L 100 (gm) 2.0 - 1.0

Eudragit S 100 (gm) - 2.0 1.0

Magnesium Stearate (gm)

(Dispersing Agent)

0.300 0.300 0.300

Methanol (ml) 3.0 3.0 3.0

Acetone (ml) 7.0 7.0 7.0

Liquid paraffin (ml) 100 100 100

Table.3. Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and

Polymer mixtures (Drug: Polymer =1:2 ) Contents of Formulations FM4 FM5 FM6

Diltiazem hydrochloride (gm) 2.0 2.0 2.0

Eudragit L 100 (gm) 4.0 - 2.0

Eudragit S 100 (gm) - 4.0 2.0

MMagnesium Stearate (gm) 0.600 0.600 0.600

Methanol (ml) 6.0 6.0 6.0

Acetone (ml) 14.0 14.0 14.0

Liquid paraffin (ml) 200 200 200

Evaluation of microspheres

Particle Size analysis: The particle size of

microspheres was determined by optical microscopy

method; approximately 100 microspheres were

counted for particle size using a calibrated optical

microscope. The microspheres were uniformly spread

on a slide. The particle size of the microsphere was

measured, along the longest axis and the shortest axis

(cross shaped measurement). Average of these two

readings was given as mean diameter of particles. The

diameter of a minimum number of 100 microspheres

in each batch was calculated.

SEM Photographs of Microspheres: Instrument

used Lieca stereomicroscope EZ4D and Magnified

10x 20x and 10x30x.

Micromeritic properties of microspheres: The

floating microspheres are characterized by their

micromeritic properties such as bulk density,

compressibility index, Hausner’s ratio and angle of

repose.

Determination of percentage yield: The prepared

microspheres were collected and weighed. The

measured weight was divided by the total amount of

all non-volatile components which were used for the

preparation of the microspheres

Determination of entrapment efficiency (%): 50 mg

of the microspheres were taken for evaluation. The

amount of drug entrapped was estimated by crushing

the microspheres and extracting with aliquots of 0.1N

Hcl repeatedly. The extract was transferred to a 100

ml volumetric flask and the volume was made up

using 0.1N HCL. The solution was filtered and the

absorbance measured after suitable dilution

spectrophotometrically (UV 1700, Shimadzu, Japan)

at 266 nm against appropriate blank. The entrapment

efficiency (%) was calculated according to the

following relationship



In-vitro Release Study of the microspheres: Dissolution studies were carried out by using USP

XXIII dissolution test apparatus (Basket) method.

Capsules were placed in a basket so that the

capsule should be immersed completely in

dissolution media but not float. In order to simulate

the pH changes along the GI tract, three dissolution

media with pH 1.2, 7.4 and 6.8 were sequentially

used referred to as sequential pH change method.

When performing experiments, the pH 1.2 medium

was first used for 2 hrs (since the average gastric

emptying time is 2 hrs) then removed and the fresh

pH 7.4 phosphate buffer saline (PBS) was added.

After 3 hrs (average small intestinal transit time

is 3 hrs) the medium was removed and fresh pH

6.8 dissolution medium was added for subsequent

hrs. 900ml of the dissolution medium was used at

each time. Rotation speed was 100 rpm and

temperature was maintained at 37±0.5 ◦C. 5ml of

dissolution media was withdrawn at predetermined

time intervals and fresh dissolution media was

replaced. The withdrawn samples were analyzed at

237 nm, by UV absorption spectroscopy.


Particle Size analysis: It has been observed that the

particle size increases with increasing polymer

amount. The increase in the mean size with increasing

polymer concentration was attributed to the fact that

higher concentration of polymer in the sample leads to

increase in viscosity of the dispersed phase, which

results in formation of bigger droplets and also, fusion

of semi-formed particles and producing an overall

increase in the size of the microspheres. Eudragit L,-

type microspheres and Eudragit S-type microspheres

prepared with the same polymer concentration did not

show any significant variation in their mean size.

Table.4.Particle Size Distribution of Formulations FM1 to FM6 Particle Size Range FM1 FM2 FM3 FM4 FM5 FM6

0-50 0 0 0 0 0 0

50-100 0 0 0 0 0 0

100-150 10 9 8 0 0 3

150-200 41 60 44 8 11 10

200-250 55 71 71 9 28 14

250-300 56 43 41 12 45 26

300-350 23 10 22 28 58 38

350-400 10 3 8 49 28 51

400-450 5 2 4 47 12 25

450-500 0 2 2 22 9 22

500-550 0 0 0 17 6 7

550-600 0 0 0 8 3 4

600-650 0 0 0 0 0 0

Figure.4.Particle Size Distribution of Formulations FM1 to FM6

Particle Size Distribution of Formulations FM1 to FM6

0

1020

3040

50

6070

80

0-50 50-

100

100-

150

150-

200

200-

250

250-

300

300-

350

350-

400

400-

450

450-

500

500-

550

550-

600

600-

650

Particle Size Range

No

Of

Part

icle

s

FM1

FM2

FM3

FM4

FM5

FM6



SEM Photographs of Microspheres: It shows all microspheres were almost spherical in shape and No

aggregation of microspheres had taken place.

Figure.5. Formulation FM1 Figure.6.Formulation FM2

Figure.7. Formulation FM3

Table.5. Micromeritic properties of microspheres

Batch

Code

Bulk Density

(gm/ml)

Carr’s Index Hausner’s ratio Angle of

repose (θ)

Diltiazem Hcl 0.167 ±0.01 24.38±0.16 1.43 ±0.07

*** FM 1 0.287±0.01 7.12±0.13 1.07 ±0.06 22.92±0.21

FM 2 0.303±0.02 9.82±0.17 1.10 ±0.03 23.96 ±0.63

FM3 0.306±0.01 10.0 ±0.09 1.11 ±0.07 24.30 ±0.55

FM4 0.315 ±0.03 12.5±0.21 1.14 ±0.08 26.56 ±0.41

FM5 0.323±0.02 13.17±0.19 1.15±0.05 28.29 ±0.37

FM6 0.356±0.03 14.21±0.21 1.17±0.09 29.32 ±0.45

Percentage Yield Values and Entrapment

Efficiencies of Formulations: Diltiazem

hydrochloride loaded microspheres having a fairly

high yield (76.48 – 88.94%) were obtained. The

entrapment efficiencies ranged from 86.11 – 98.73%.

The incorporation efficiency of formulations, FM1 –

FM3 was less than formulations FM4 – FM6. The

highest incorporation efficiency of formulation having

drug: polymer ratio 1:2 can be explained through the

fact that the amount of polymer in per unit drug is

greater than that in other formulations.

Table.6. Percentage Yield Values and Entrapment Efficiencies of Formulations Formulation code Percentage Yield (%) Theoretical Drug

Content (%)

Actual Drug Content

(%)* ± S.D.

Entrapment Efficiencies

(%)* ± S.D.

FM 1 76.48 46.51 40.05 ± 0.17 86.11 ± 0.37

FM 2 77.21 46.51 41.32 ± 0.13 88.84 ± 0.28

FM3 77.00 46.51 42.70 ± 0.15 91.80 ± 0.29

FM4 85.07 30.30 28.60 ± 0.09 94.38 ± 0.26

FM5 87.73 30.30 28.96 ± 0.12 95.57 ± 0.39

FM6 88.94 30.30 29.73 ± 0.08 98.11 ± 0.29



Figure.8.Percentage yield values and entrapment efficiencies of formulations

In- vitro release study of the microspheres:

The release of Diltiazem hydrochloride from

different formulations depended on the type of

polymer and the ratio of the polymer in the

formulations. The release of Diltiazem

hydrochloride from microspheres of Eudragit L-

type was more as compared to Eudragit S-type.

This was due to the presence of more functional

quaternary ammonium groups (10%) in L-type

than S-type (5%).It is also observed that as the

amount of polymer in the formulation increased,

the drug release decreased. It can be explained

on the basis that as the polymer amount increases,

the matrix wall of microspheres become thicker.

A burst effect of drug release can be observed on

the various formulations.The burst effect can be

attributed to the presence of non-encapsulated

drug particles on the surface of the microspheres.

The burst effect of drug release also depended

upon the drug: polymer ratio. From the figure of

release profile, it can be observed that burst effect

of drug release is more in formulations having

drug: polymer ratio 1:1, while in the formulation

having drug: polymer ratio 1:2, burst effect is

less. Withdrawn at predetermined time intervals

and fresh dissolution media was replaced. The

withdrawn samples were analyzed at 237 nm, by

UV absorption spectroscopy.

Table.7. Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6 TIME(hrs) Formulation

FM1

(DTZ:EL100,1

:1)

Formulation

FM2 (DTZ

:ES100, 1:1)

Formulation FM3

(DTZ:EL100:

ES100, 1:0.5:0.5)

Formulation FM4

(DTZ:EL100, 1:2)

Formulation

FM5

(DTZ:ES100, 1:2)

Formulation FM6

(DTZ: EL100:

ERS100, 1:1:1)

1:1 1:2

0 0 0 0 0 0 0

1 41.63 18.95 18.07 23.03 15.82 11.29

2 61.18 26.68 34.12 41.58 19.66 17.96

3 74.47 33 46.12 53.58 22.95 23.26

4 82.37 37.04 55.14 60.42 25.68 25.89

5 86.18 39.09 63.63 65.55 29.42 30.94 6 88.16 42.16 70.5 71.04 34.77 35 7 92.33 45.2 75.9 77.07 38.96 39.12

8 98.53 49.32 80.99 81.72 42.74 47.28

9 99.24 52.96 85.09 85.03 46.06 52.14

10 99.28 57.97 88.56 87.11 49.02 58.53

11 99.34 61.99 91.77 89.2 52.23 64.95

12 99.37 65.03 93.85 90.8 54.42 72.75



Figure.13.Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6

CONCLUSION

The objective of this study was to develop and

evaluate stable microsphere of Diltiazem

Hydrochloride, an antihypertensive drug using

Polymethacrylates (Eudragit L/S 100) as polymer

which deliver the drug and at a control rate for

prolonged perod of time. Following conclusion have

been drawn from present study: The analytical method

used in present study was found to be suitable for the

estimation of Diltiazem Hcl in different media, which

was indicated by the high regression values obtained

in the standard plot. The DSC studies revealed that

there was no interaction between Diltiazem Hcl and

Eudragit L/S100 used in the formulation of

microsphere. The size of microsphere mainly affected

by stirring speed, as stirring speed increased the size

of microsphere was decreased. The encapsulation

efficiency was increased by increase in polymer conc.

decreased with increase in drug polymer ratio. SEM

studies of the formulation were carried out for the

confirmation of shape and surface morphology of

microsphere. SEM revealed that microsphere was

discrete and spherical in shape with porous outer

surface. On the basis of, particle size, drug content,

Scanning Electron Microscopy, IR-study, in-vitro

release studies FM3 was selected as an optimized

formulation. Hence, finally it was concluded that the

prepared microspheres be considered as one of the

promising formulation technique for deliver the drug

and at a control rate for prolonged period of time and

hence in management of angina pectoris.

REFERENCES

Awadhesh Kumar Maurya, Vishal Gupta, Naveen

Gupta and Vishal Shrivastav, Development and

evaluation of stable microsphere of Diltiazem

hydrochloride, an antihypertensive drug, int. J. of

pharm & life sci, 2(2), 2011, 583-589.

M Nappinnai, VS Kishore, Formulation and

evaluation of microspheres of Diltiazem

hydrochloride, Indian journal of pharmaceutics, 69(4),

2007, 511-514

Reddy MN, Shriwaikar AA, Rosin, Formulation and

evaluation of Diltiazem hcl microspheres, Indian J

Pharm Sci, 62, 2000, 308-10.

Utsav C Rathod, Anand K Kumar, K Patel, Dushyant

A Shah, Statistical evaluation and optimization of

influence of stirring speed and polymer concentration

on hollow microspheres of Diltiazem hcl, Scholars

Research Library, Der Pharmacia Lettre, 4 (3), 2012,

972-978.

http://www.ijpsonline.com/searchresult.asp?search=&author=M+Nappinnai&journal=Y&but_search=Search&entries=10&pg=1&s=0

Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Formulation and characterization of Methotrexate loaded sodium alginate chitosan

Nanoparticles S.Daisy Chella Kumari

1*, C.B.Tharani

2, N.Narayanan

3, C.Senthil Kumar

4

1.College of Pharmacy, Madras Medical College, Chennai,India.

2.Department of Pharmacology, Saveetha Medical College, Chennai,India.

3.Jaya College of Pharmacy, Thiruninravur, Chennai,India.

4.Anna University, BIT Campus, Tiruchirappalli,India.

*Corresponding author: E.mail: gefann@ yahoo.co.in, Mobile: 9791173875

ABSTRACT

The aim of the present work was to formulate nanoparticles for Methotrexate drug. Methotrexate is an

anticancer, disease modifying anti rheumatic drug, and BCS Class – III drug having high solubility and

low permeability. Nanoparticles were prepared by ionotropic pregelation method using Box Behnen

Formula. The concentration of chitosan (X1),concentration of sodium alginate (X2) and concentration of

Methotrexate (X3) were chosen as independent variables while particle size, drug entrapment efficiency

and percentage drug release at 36th hour, was taken as dependent variables. The dissolution profile of

selected formulations was fitted to zero order, first order, Higuchi and Korsemayer Peppas models to

ascertain the kinetic modeling of drug release. The prepared formulations were further evaluated for

characterization like surface morphology, particle size distribution, zetapotential and drug excipient

interaction study by Fourier Transformer Infra Red Spectroscopy, Differential Scanning Calorimetry and

X-ray Diffraction. All independent variables were found to significantly influence the particle size,

entrapment efficiency and percentage of drug release. The in- vitro drug release profile showed that the

suitability of sodium alginate-chitosan loaded nanoparticles in controlled release of methotrexate for

prolonged time.

Key words: Methotrexate, Sodium alginate, Chitosan, Ionotropic pregelation method.

INTRODUCTION

The use of natural biopolymers specifically

polysaccharides in drug delivery has attracted

particular interest due to their desirable biocompatible,

biodegradable, hydrophilic and protective properties

(Barichello JM, 1999). The interaction between

biodegradable cationic and anionic biopolymers leads

to the formation of polyionic hydrogels, which have

demonstrated favorable characteristics for drug

entrapment and delivery (Chella F, 2000). Chitosan

and Alginate are two biopolymers that have received

much attention and have been shown to maintain their

structure and activity and protect them from

enzymatic degradation (Madan T, 1997). Moreover,

many of these polymers, particularly hydrogels, are

naturally hydrophilic, which is advantageous since

this property is thought to contribute to longer in vivo

circulation time and allow the highest encapsulation of

drug (Douglas KL,2005). Chitosan is a natural

cationic polysaccharide obtained by the N

deacetylation of chitin, a product found in the shells of

crustaceans (Mansouri S,2004). Alginate is an anionic

polysaccharide consisting of linear copolymers of a-L-

guluronate and b-D-mannuronate residues. Alginates

which are a group of hemocompatible polymers have

not been found to accumulate in any major organs and

have shown evidence of in vivo degradation (Mi FL,

2002). In the presence of Calcium ions, ionic

interactions between the divalent Calcium ions and the

guluronic acid residues cause Alginates to form gels.

The properties of Calcium–Alginate gel beads make

them one of the most widely used carriers for

controlled release systems

(Fundueanu G, 1999).

Coating of these beads with other polymers including

Chitosan has been shown to improve their stability

during (shelf-life) storage and their half life in

biological fluids.

Alginate–Chitosan polyionic complexes form

through ionic gelation via interactions between the

carboxyl groups of alginate and the amine groups of

chitosan. The complex protects the encapsulant, has

biocompatible and biodegradable characteristics, and

limits the release of encapsulated materials more

effectively than either Alginate or Chitosan alone

(Yan XL, 2001). A further advantage of this delivery

system is its non-toxicity, which permits its

administration to be repeated as a therapeutic agent.

Therefore, the purpose of this study was to optimize a

method for the preparation of Alginate-chitosan

nanoparticles by the use of Box–Behnken

methodology to design the most appropriate

preparation method.



Rheumatoid arthritis is an autoimmune disease in

which inflammation of the cells lining the synovium

produces pain, swelling, and progressive erosion of

the synovial joints. Methotrexate (MTX), an

antiproliferative and immunosuppressive agent, is the

drug of choice in the treatment of the disease (Suarez-

Almazor ME, 2000). MTX is a folic acid antagonist

used alone or in association with other therapeutic

agents; however, MTX has an extensive toxicity

range, which is the main cause of therapy withdrawal.

MTX treatment is discontinued in 8%–19% of patients

due to adverse reactions that include gastrointestinal,

hepatic, renal, pulmonary, and hematological

disturbances, and may also affect the central nervous

system

(Varatharajan N, 2009).Overall, 26% of

patients discontinued MTX treatment due to poor

response, high toxicity, or both. Thus, in addition to

the relatively high toxicity, variability, and

unpredictability of the pharmacological action, there

are also drawbacks to the use of MTX treatment for

rheumatoid arthritis (Derviex T, 2004).

Unfortunately, progression of joint destruction

cannot be inhibited completely by MTX treatment in

most patients with RA. This lack of efficacy is due to

the fact that large amounts of the administered MTX

are rapidly eliminated by the kidneys, resulting in a

short plasma half life and low drug concentration in

the targeted tissue. To overcome these

disadvantageous and improve the pharmacokinetic

properties, recently introduced MTX-ALG-CS as a

polyelectrolytic complex nanoparticle has a

substantially prolonged half life in the circulation.

The nanoparticulate formulation of MTX was

optimized using design of experiments by employing

response surface methodology. Response surface

methodology determines the optimum level of each

factor by building a mathematical model.

Optimization of particle size and loading efficacy as

the responses were carried out by Box–Behnken

response surface methodology.


The polymer Chitosan (CS) was received as a

gift sample from India Sea Foods, Cochin. Sodium

alginate (ALG) was purchased from Sigma Aldrich

and Pluronic F-68 from S.D fine chemicals.

Methotrexate was provided as gift sample by Aptuit

Pvt. Ltd., Hyderabad. Pluronic F-68 was purchased

from S.D fine chemicals. All other solvents and

materials used were of analytical grade.

Box- Behnken Formula: Formula combination

production was beginning with determination of

maximum and minimum concentration for each

component that being used. Combination formula of

chitosan, alginate, and MTX concentration was

conducted to determine the effect of each component

against nanoparticle characteristic. At early stage,

each component value was entered, including chitosan

0.02-0.06% (w/v), alginate 0.05-0.10% (w/v), and

MTX 0.01-0.07 (w/v) into Box-Behnken program.

This whole data concentration was processed using

Box-Behnken model with 3 level 3 factorial to gain

representative data spread. The analysis resulted 17

formulas as recommended optimum combination,

with some formula replication. The relationship

between independent variables and the response was

calculated by the second order polynomial Equation.

(1)

Y = βo + β1x1 + β2x2 + β3x3 + β12x1x2 + β13x1x3 + β23x2x3

+β11x12 + β22x2

2+ β33x3

2 ……… (1)

where Y was the predicted response; β was the model

constant; x1, x2 and x3 were independent variables; β1,

β2 and β3 are linear coefficients; β12, β13 and β23 are

cross-product coefficients; and β11, β22 and β33 are the

quadratic coefficients. The quality of fit of the

polynomial model equation was expressed by the

coefficient of determination R2.

Nanoparticle preparation: Nanoparticles of ALG

were obtained by counter‐ion induced gelification

method (Rajaonarivony M,1993 , Gupta Jitendra

,2011) .Calcium chloride (0.5ml, 18mM), a cross

linking agent, was added to 9.5 ml of sodium alginate

solution (0.08%w/v) containing MTX under stirring

condition. 2 ml of 0.5% w/v of Pluronic F-68 was

added. Chitosan solution (2ml, 0.05% w/v) was added

followed by sonication at 25 W for 7min and the

mixture was kept at room temperature overnight. Drug

loaded nanoparticles were recovered by centrifuging

at 19,000 rpm for 30‐45 min and washed thrice with

distilled water to obtain the final nanoparticles.

Characterization of nanoparticles

Transmission Electron Microscopy: The

morphological observation of drug-loaded

nanoparticles was performed by transmission electron

microscopy (TEM) (JEM 1200 EX, Japan), using a

negative staining method. A drop of nanoparticle

suspension was spread on a 200-mesh copper grid

coating and the excess droplets were removed with

filter paper. After 5 min, a drop of 4% (w/v)

phosphotungstic acid solution was then dropped onto

the grids. After being negatively stained and air-dried

under room temperature, the samples were subjected

to the TEM investigation.



Measurement of Particle Size: The mean particle

size was obtained by Photon correlation spectroscopy

(PCS) (3000SH, Malvern Instruments Ltd., UK). The

MTX loaded Alg-CS nanoparticle formulations were

diluted with de-mineralized filtered water to an

appropriate scattering intensity. Data was analyzed by

the cumulate method assuming spherical particles.

Accordingly, the results are given as the effective

diameter and the poly dispersity index (PDI) as a

measure for the relative width of the particle size

distribution.

Measurement of Zeta Potential: The zeta potential

value of optimized MTX loaded Alg-CS nanoparticle

formulation was measured with the Zetasizer

(3000SH, Malvern Instruments Ltd., UK).To

determine the zeta potential, optimized formulation

was diluted with double-distilled water and placed in

an electrophoretic cell.

Fourier Transform Infra-Red Spectroscopy

(FTIR): MTX-ALG-CS nanoparticles separated from

nanoparticulate suspensions were dried by a freeze

dryer, and their FTIR transmission spectra were

obtained using a FTIR-8300 spectrophotometer

(Shimadzu, Japan). A total of 2% (w/w) of sample,

with respect to the potassium bromide (KBr; S.D. Fine

Chem Ltd., Mumbai, India) disc, was mixed with dry

KBr. The mixture was ground into fine powder using

an agate mortar before compressing into KBr disc

under a hydraulic press at 10,000 psi. Each KBr disc

was scanned at 4 mm/s at a resolution of 2 cm over a

wave number region of 400–4000 cm1

. The

characteristic peaks were recorded for pure drug and

nanoparticle samples.

Differential scanning calorimetry: Differential

scanning calorimetric (DSC) analysis was used to

characterize the thermal behavior of the drug

methotrexate, blank and methotrexate loaded

nanoparticles. DSC thermograms were obtained using

an automatic thermal analyzer system (Pyris 6 DSC,

Perkin-Elmer, USA). Temperature calibration was

performed using Indium Calibration Reference

Standard (transition point: 156.60 ˚C) as a standard.

Samples were crimped in standard aluminum pans and

heated from 40 to 400˚ C at a heating rate of 10˚C/min

under constant nitrogen at 30 ml/min. An empty pan,

sealed in the same way as the sample, was used as a

reference.

X-ray Diffraction: The X-ray diffraction (XRD)

patterns were determined for the drug methotrexate,

blank and methotrexate loaded nanoparticles. Samples

were exposed to a monochromatic nickel-filtered

copper radiation (45 kV, 40 mA) in a wide-angle X-

ray diffractometer (advanced diffraction system,

Sci.008/ntag Inc., USA) with 2θangle.

Determination of Encapsulation Efficiency: The

encapsulation efficiency of nanoparticles was

determined by the separation of drug-loaded

nanoparticles from the aqueous medium containing

non-associated MTX by ultracentrifugation (REMI

high speed, cooling centrifuge, REMI Corporation,

India) at 18,000 rpm at 4 ˚C for 30 min. The amount

of MTX loaded into the nanoparticles was calculated

as the difference between the total amount used to

prepare the nanoparticles and the amount that was

found in the supernatant. The amount of free MTX in

the supernatant was measured by spectrophotometer at

305 nm in suitable dilution with 0.1N HCl. The MTX

encapsulation efficiency of the nanoparticles was

determined in triplicate and calculated as follows:

Equation—(2)

In-vitro release studies: In-vitro release of drug from

MTX nanoparticle formulation is determined by

dialysis bag method in phosphate buffer saline pH 7.4.

The freeze dried MTX nanoparticles (equivalent to 5.0

mg of drug) was taken in a dialysis bag (molecular cut

off 12,000, pore size 0.2 µm) and placed in 100 ml of

dissolution medium which was continuously stirred at

100 rpm at 37°C using shaker incubator. Definite

aliquots of the dissolution medium were withdrawn at

specific time intervals and the same volume of fresh

dissolution medium was added to the flask to maintain

a sink condition. The samples withdrawn were

analyzed for drug content spectrophotometrically at

303 nm.


TEM Analysis: TEM analysis confirmed that

particles with target size and narrower size

distributions could be prepared using a ionotropic

pregelation method. Fig (1) showed that MTX-NaAlg-

CS nanoparticles had spherical shape with size

ranging 100 nm. This was achieved by adapting the

optimized parameters for the preparation of

nanoparticles.

Particle Size Determination: The particle size of

optimized MTX-NaAlg-CS nanoparticle formulation

was showed in Figure (2).The mean particle size of

the optimised formulation was found to be 188.6 nm

and the PDI was found to be 0.265.The low PDI value

indicates the uniform particle size distribution which

may due to the adoption of optimised formulation

parameters.



Zeta potential: The zeta potentials of about -22.4

mV showed in Figure (3) indicate good stability of

formulation. This might be attributed to surfactant

which decreases the electrostatic repulsion between

the particles and sterically stabilizes the nanoparticles

by forming a coat around their surface.

FTIR Analysis: The characteristic peaks of MTX

was showed (Fig.4a) at 3464 cm1

(-NH stretching),

16483.4 cm1

(COOH), 1653 cm1

(CONH) and

853.88 (aromatic stretch). In the spectrum of MTX-

NaAlg-CS nanoparticles formulation, significant

peaks were obtained at 3437 cm1

, 1679 cm1

, 1639.1

cm1

and 819.49. Because of the presence of polymer,

some additional peaks were present. Fig.(4b). This

indicates that there is no interaction between the drug

and polymers in the formulation.

Differential scanning calorimetry: DSC studies

were performed to investigate the physical state of the

drug in the nanoparticles, because this aspect could

influence the in vitro and in vivo release of drug from

the system. DSC thermogram of MTX and MTX-

NaAlg-CS nanoparticles were showed in Fig (5a, 5b)

The thermogram of the drug showed a sharp melting

peak at 115.82°C. MTX-NaAlg-CS nanoparticles did

not show the melting peak for the MTX at

115.82°C.The endothermic peak of MTX in MTX-

NaAlg-CS nanoparticles was depressed, broadened

and shifted to lower temperature. These thermal

characteristics of MTX corroborate with the reference

value reported by (Renu Sigh, 2006). These results

could indicate that MTX was not in crystalline state,

but is in amorphous state after entrapment with the

polymer because drug crystals completely dissolve

inside the polymer matrix during the scanning of

temperatures up to the melting value or because the

drug remained dispersed at molecular level inside the

solid dispersion after the formation of MTX-NaAlg-

CS nanoparticles (Adamo, 2010).

X-ray diffraction: X-ray diffraction has been used for

the study of molecular structure and polymorphism of

polymeric nanoparticles (Westesen, 1993 and Bunjes,

1996). XRD pattern of pure MTX, Blank, MTX-

NaAlg-CS nanoparticles formulation are illustrated in

Fig 6. The XRD pattern of pure Methotrexate from 2-

70˚ 2θ showed distinctive peaks approximately at

13.7, 14.1, 19.6, 27.8 and 29 degrees obtained were

comparable with XRD pattern of crystalline MTX

reported in literature (Rama, 2012). Blank

nanoparticles do not show any high intensity peak

revealing the amorpous nature of the polymer and

stabilizer respectively. The characteristic peaks of the

methotrexate was absent in MTX-NaAlg-CS

nanoparticle. This indicates that MTX was molecular

dispersed in to the polymeric nanoparticles and there

could be less or no free drug in crystalline form on the

surface of the nanoparticles. From this, it is evident

that an XRD signal of encapsulated drug is very

difficult to detect, which showed that the drug is

dispersed at a molecular level in the polymeric

matrix.(Liu,et al., 2006).

Drug release and Release Kinetics: The in vitro

release pattern of MTX-NaAlg-CS nanoparticle

shown the initial burst release followed by the

sustained release was observed in optimized

formulation (data not shown). During initial hours

minimum burst release of the drug from the polymeric

nanoparticles was observed followed by prolonged

release (68.99%) up to 36 h. The initial burst release

may be probably caused by the drug adsorbed on the

surface of nanoparticles or precipitation of drug from

the nanoparticles. Sustained release was obtained due

to slow diffusion of the drug from the polymeric

matrix.

To determine the release model that best

described the drug release, the in vitro release data

was substituted in equations of zero order, first order

and Higuchi model and the results are noted. Among

them the zero order model showed a high R2 value

0.93443, indicating that the release of the drug

followed zero order release kinetics.( Fig 7a) To

understand the mechanism of drug release,

Korsmeyer–Peppas equation was applied and it

showed a good linearity. The release exponent ‘n’ was

found to be 0.79307. (Fig 7b). According to this

model, if the value of ‘n’ was between >0.43 and

<0.85, it indicated that drug release followed

anomalous transport (Non-Fickian) (Chouhan and

Bajpai, 2009 b) and was controlled by more than one

process (the coupling of Fickian diffusion and

polymer matrix relaxation).

Optimization and validation: The experimental

results were fitted into second-order response surface

model. The composition of optimized formulation was

achieved with 0.05%w/v chitosan, 0.08%w/v of

sodium alginate and 0.04%w/v of MTX, which fulfill

the requirements of optimization. The optimized

formulation has particle size 183.69 nm, entrapment

efficiency of about 93.59% and 68.9 % drug release,

which were in good agreement with the predicted

values. These figures also indicate that the developed

models are adequate and predicted results are in good

agreement with the measured data.



Fig 1 : TEM image of MTX-NaAlg-CS nanoparticles Fig 2: Particle size distribution of optimized MTX-

NaAlg-CS nanoparticle

Fig 3: Zeta potential of MTX-NaAlg-CS nanoparticle

Fig 4a: FTIR spectra of pure Methotrexate Fig 4b : FTIR spectra of MTX-NaAlg-CS nanoparticle

Fig 5a : DSC curve of pure methotrexate Fig 5b: DSC curve of MTX-NaAlg-CS nanoparticle



Fig 6 : X-ray diffraction pattern of A) Pure Methotrexate B) Blank nanoparticle

C) MTX-NaAlg-CS nanoparticle

Fig 7a: Zero order release of MTX-NaAlg-CS nanoparticle

Fig 7b : Korsmeyer-Peppas drug release kinetics of MTX-NaAlg-CS nanoparticle.



CONCLUSION

Methotrexate loaded nanoparticles were

prepared by the ionotropic pregelation method. The

FTIR, DSC, XRD pattern study did not detect any

crystalline drug material in the freshly prepared freeze

dried nanoparticles. The application of factorial design

gave a statistically systematic approach for the

formulation of nanoparticles with desired particle size,

high entrapment efficiency and % drug release.

Concentration of Drug , Polymers were found to

influence the particle size, Entrapment efficiency and

% drug release of MTX loaded NaAlg-CS

nanoparticles. The release was found to follow with

non-Fickian diffusion mechanism for optimized batch.

These results indicate that MTX loaded NaAlg-CS

nanoparticles could be effective in controlled drug

release for a prolonged period would serve the

purpose for long term treatment of Rheumatoid

Arthritis.

ACKNOWLEDGEMENT The authors are thankful to Aptuit Pvt.Ltd,

Hyderabad for providing gift sample of Methotrexate

and India sea food , Cochin for Chitosan. REFERENCES

Adamo F, Cristina C, Giancarlo C, Antonio MR, Bimodal

release of Olanzapine from lipid Microspheres, J Pharm

Sci. 99, 2010, 4251-4260.

Barichello JM, Morishita M, Takayama K, Nagai T,

Encapsulation of hydrophilic and lipophilic drugs in PLGA

nanoparticle by the nano-precipitation method, Drug Dev

Ind Pharm, 25,1999, 471.

Bunjes H, Lipid nanoparticles for the delivery of poorly

water soluble drugs, J Pharm Pharmacol, 62, 1996, 1637–

1645.

Chellat F, Tabrizian M , Dumitriu S , Chornet E, Magny

P, Rivard CH, et al. In vitro and in vivo biocompatibility

of chitosan–xanthan polyionic complex, J Biomed Mat

Res, 51,2000,107–113.

Chouhan, R., Bajpai, A.K, An in vitro release study of 5-

fluoro-uracil from swellable poly-(2-hydroxyethyl

methacrylate) (PHEMA) nanoparticles, J Mater Sci Mater.

Med. 20, 2009b, 1103–1114.

Dervieux T, Furst D, Lein DO, Polyglutamation of

methotrexate with common polymorphisms in reduced

folate carrier, aminoimidazole carboxamide ribonucleotide

transformylase, and thymidylate synthase are associated

with methotrexate effects in rheumatoid arthritis, Arthritis

Rheum ,50(9), 2004, 2766–2774.

Douglas KL,Tabrizian M, Effect of experimental

parameters on the formation of alginate–chitosan

nanoparticles and evaluation of their potential application

as DNA carrier, J Biomat Sci, Polymer Edition, 1, 2005,

43–56.

Fundueanu G, Nastruzzi C, Carpov A, Desbrieres J,

Rinaudo M, Physico-chemical characterization of Ca-

alginate microparticles produced with different methods.

Biomaterials, 20,1999, 1427.

Gupta Jitendra, Prabakaran L, Gupta Reena, Govind

Mohan, Nanoparticle formulation using counter-ion

induced gellification Technique: In-vitro Chloramphenicol

release, Int J Pharm Pharm Sci , 3 (3), 2011, 66-70.

Madan T, Munshi N, De TK, Maitra A, Sarma PU,

Aggarwal SS, Biodegradable nanoparticles as a sustained

release system for the antigens/allergens of Aspergillus

fumigates, Preparation and characterization, Int J Pharm,

159, 1997,135.

Mansouri S, Lavigne P, Corsi K , Benderdour M,

Beaumont E , Fernandes JC ,Chitosan–DNA nanoparticles

as non-viral vectors in gene therapy: Strategies to improve

transfection efficacy, Eur J Phar Biopharm, 57,2004, 12.

Mi FL , Sung W, Shyu SS, Drug release from chitosan–

alginate complex beads reinforced by a naturally occurring

cross-linking agent, Carbohydr Polym, 48, 2002, 61.

Rajaonarivony M, Vouthier C, Couarrze G, Puisieux F,

Couvreur P, Development of a new drug carrier made from

alginate, J Pharm Sci, 82, 1993, 912‐917.

Rama B, Shantha A, Optimization of Methotrexate

Transdermal Patches: Effect of variables on In-Vitro, Ex

Vivo permeation and Flux, Int J Pharm Sci Lett ,2 (2),2012,

53-59.

Renu Singh Dhanikula, Patrice Hildgen, Influence of

molecular architecture of polyether-co- Polyester

dendrimers on the encapsulation and release of

Methotrexate, Biomaterials, 28, 2007, 3140-3152.

Suarez-Almazor ME, Belseck E, Shea B, Wells G, Tugwell

P. Methotrexate for rheumatoid arthritis, Cochrane

Database Syst Rev, 2, 2000, CD000957.

Varatharajan N, Lim IG, Ananda coomarasamy A,

Methotrexate: long-term safety and efficacy in an

Australian consultant rheumatology practice, Intern Med J,

39(4), 2009, 228–236.

Yan XL , Khor E, Lim LY, Chitosan–alginate films

prepared with chitosans of different molecular weights. J

Biomed Mat Res, 58, 2001, 358.

http://dx.doi.org/10.1111/j.2042-7158.2010.01024.x

http://dx.doi.org/10.1111/j.2042-7158.2010.01024.x

Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


Strategies in Dendritic architecture for drug delivery – An over review Pandurangan Dinesh Kumar*

1, Palanirajan Vijayaraj Kumar

2, Govindaraj Saravanan

3

1.Department of Biotechnology, Acharya Nagarjuna University, Guntur - 522510, Andhra Pradesh, India.

2. Faculty of Pharmaceutical Sciences, UCSI (University College Sadaya International) University, Jalan

Menara Gading, 56000-Cheras, Kuala Lumpur, Malaysia.

3.Bapatla College of Pharmacy, Bapatla - 522 101, Guntur (Dt), Andhra Pradesh, India.

E-mail: [email protected], [email protected], Mobile: 99666 39425

ABSTRACT

Dendrimers represent a novel class of structurally controlled macromolecules derived from a

braches upon branches structural motif. These consist of highly branched moieties that radiate from a

central core and synthesizes through a stepwise repetitive reaction sequence. In the field of

pharmaceutical nanotechnology and medicinal chemistry dendrimers play a vital role based on the

structural advantage such as size, shape, surface and interior chemistry flexibility and topology.

Dendrimers have emerged as highly gifted drug delivery molecule because of their exceptional

structure and properties. Solubility enhancement is an important aspect of dendrimers and this is a

synergy with site specific drug delivery. Solubilisations of hydrophobic drug molecule are easily

achieved by the dendrimers because they were entrapped in hydrophobic channels. Extracellular

matrix of tissue particularly vascular tissue it contains a high concentration of negatively charged

glycosaminoglycans which are involved in regulation of cell motility cell proliferation in the

regulation of enzyme activity. Extra cellular matrix can be used as a substrate for binding and

retention of drug delivered intra vascularly. Recently dendrimers have caused an explosion in

biomedical science and created interest in the discovery of the drugs by virtue of their therapeutic

value. The dendrimer polymer suggest that they are promising drugs wound healing ,bone

mineralization cartilage formation, tissue repairing topical treatment for AIDS to prevent HIV

transmission. It also acts as an anti prion, anti Alzheimer, anti coagulants, anti dots, anti inflammatory

and anti cancer agents.

Key Words: Dendrimer, Nano-composites, Dendrimer conjugation, Dendrimer applications.

INTRODUCTION

Dendrimer the name comes from the Greek

“ɗevɗpov”/dendron meaning “tree” synonymous

terms are arborols and cascade molecule (Buhleirier

et al., 1978). Dendrimers are repeatedly branched

molecules that are characterized by structural

perfection. This is based on the evolution of both

symmetry and polydispersity the field of dendritic

molecule can roughly be divided into

1. Low molecular weight

2. Molecular weight species

The first category includes dendrimers and

dendrons and the second includes dendronized

polymers hyper branched polymers and brush

polymers (called as bottle brushes) tailored forms

and function ever realized outside of nature.

Structurally dendrimers posses 3 distinct parts

1. A core

2. Branching units

3. Branches

It is usually produced in an interactive

sequence of reaction steps, in each added lerative

lead to a higher generation material. The size of

dendrimer can be described as a function of

generation (Gn where n is 0, 0.5, 1.0, and 1.5) G is

number of repetition cycles. The molecular weight

of the dendrimer nearly doubles with each additional

generation (Tomalia et al., 2005). Furthermore,

terminal groups can be modified to obtain both

hydrophilic or lipophilic function for the desired

biological and drug delivery application (Bai et al.,

2006). Following properties of dendrimer made

them ideal molecule for drug delivery applications

(Tomalia et al., 2007):

a. Nanoscale sizes that have similar dimensions

to significant bio-building blocks,

b. Numbers of terminal surface groups (Z)

appropriate for bioconjugation of drugs,

signalling groups, targeting moieties or

biocompatibility groups.

c. Functional groups on the surfaces were

designed to augment or resist trans-cellular,

epithelial cell or vascular permeability.

d. An interior void space was used to

encapsulate drug molecule, metals, or

imaging moieties and also reduces the drug

toxicity and facilitates controlled release.

e. Positive biocompatibility patterns that are

coupled with lower generation anionic or

neutral polar terminal surface groups.

f. Low-immunogenicity with modified

dendrimer surfaces by small functional

groups or polyethylene glycol (PEG).

Dendrimers a nano particle based drug

delivery system have numerous applications in

many fields such as supramolecular chemistry or

host–guest chemistry (Elemans et al., 2002 and Al-

Jamal et al., 2005), electrochemistry (Credi et al.,



2004), and photochemistry (Momotake et al., 2004),

nanoparticle synthesis (Wu et al., 2006, Love et al.,

2006 and Yan et al., 2006), pollution management

(Xu et al., 2005, Diallo et al., 2005 and Arkas et al.,

2006), dye decolorization (Cheng et al., 2005 and

Cheng et al., 2005), preparation of monomolecular

membranes (Karthaus et al., 1996, Sayed-Sweet et

al., 1997 and Vladimir, 1998), curing of epoxy

resins (Cheng et al., 2007), catalysis (Lee et al.,

1994, Fujita et al., 1995, Bhyrappa et al., 1996 and

Mak et al., 19970, drug delivery (Patri et al., 2002,

Aulenta et al., 2003, D’Emanuele et al., 2004,

Svenson et al., 2005 and Florence et al., 2005), and

gene transfection (Dufes et al., 2005, Kim et al.,

2006 and Bayele et al., 2006). In recent, dendrimers

usage in drug delivery had attain great development

and different types of dendritic macromolecules

have been synthesized and investigated as a carrier

for drug delivery (Patri et al., 2002), gene delivery

(Schatzlein et al., 2005), targeting (Patri et al.,

2005), solubilization (Gupta et al., 2006), diagnosis

(Wiener et al., 1994), chemical catalysis (Wu et al.,

2006) and as multivalent ligand for interesting

biological applications (Heldt et al., 2004 and

Svenson and Tomalia, 2005).This review article

intends to provide the reader with a glimpse into the

synthesis, types and important applications of

dendrimers.

SYNTHESIS OF DENDRIMERS

The first synthetic procedure towards well

defined branched structures was reported by Vogel’s

in 1978, who named this procedure a “cascade

synthesis” .In the early 1980’s, Denkewalter

patented the synthesis of L-lysrine-based dendrimers

(Denkewalter et al., 1981). The first dendritic

structures that were exhaustively investigated and

that received widespread attention were Tomalia’s

PAMAM (polyamidoamine) dendrimers (Tomalia et

al., 1990) and newkome’s “arborol” systems

(Newkome

et al., 1985). In the synthesis of

dendrimers, monomers lead to a mono disperse

polymer, tree like generational structure. There are 2

methods of dendrimer synthesis they are,

1. Divergent synthesis

2. Convergent synthesis

Divergent synthesis: The dendrimer is prepared

from the core as the starting point and built up

generation by generation. In the divergent reaction

because of the incomplete reaction by end group

will create structural defects which further prevent

formation of next generation. Divergent name is

derived from the manner in which dendrimer grows

outward from the core. The higher generations of

divergently constructed dendrimers always contain

certain structural defects. To prevent side reaction

and to force reactions to completion a large excess

of reagent is required.

Convergent synthesis: The convergent synthesis

starts from the surface and ends up at the core,

where the dendrimer segments (dendron) are

coupled together. Two of these end tips are attached

to a branched monomer to form a dendron and the

process is repeated until a desired size is reached. To

the core molecule the interconnected branches are

attached. To synthesize dendrimers is difficult

because a repeated reaction which consists of many

steps is needed to protect the active site even in both

methods. That why these are obstacles to the

synthesis of large quantities of dendrimers (Hawker

et al., 1990).

Other alternative preparation methods have

been developed that aim to reduce the number of

synthetic and purification steps and increase yields,

such as the double-stage convergent growth

approach (Labbe et al., 1996 and Ihre et al., 1998),

double-exponential dendrimer growth approach

(Kawaguchi

et al., 1995), and orthogonal coupling

(Zeng et al., 1996).

TYPES OF DENDRIMERS Now days, dendrimers with different

designed functionalities have become objects of

particular academic and practical interest because of

their unique superbranched structural, symmetrical

shapes, good monodispersity and peripheral

functionalities,. Here, some of the dendrimers

having different functionalities are briefly described.

PAMAM dendrimer: The PAMAM

(polyamidoamine) dendrimers are synthesized up to

generation 10 (G10) by the divergent method

starting from ammonia or ethylene diamine

initiation cone reagents (fig. 1). They are

constructed using a reiterative sequence consisting

of a double Michael addition of methyl acrylate to a

primary amino group followed by amidation of the

resulting carbomethoxy intermediate with a large

excess of ethylene diamine. Many surface modified

PAMAM dendrimers are non-immunogenic, high

water solubility and modified terminal-arms amine

functional groups for binding various targeting or

guest molecules. PAMAM dendrimers generally

display concentration-dependent toxicity and

haemolysis. PAMAM dendrimers with their amide

backbones undergo hydrolytically degradation at

physiological temperatures only on harsh conditions

(Lee et al., 2005). The internal cavities of PAMAM

dendrimers with tertiary amines and amide linkages

can host metals or guest molecules to produce a

unique functional architecture. PAMAM dendrimers

are the most extensively reported moiety for almost

all existing applications of dendrimers.



Fig. 1: PAMAM dendrimers

PPI dendrimers: PPI (polypropyleneimines)

dendrimers (fig. 2) were created by Meijer at DSM

of the Netherlands (DeBrabander-vandenBerg et al.,

1993). PPI dendrimers up to generation 5 are

synthesized by the divergent method starting from 1,

4. diamino butane. They grow by a reiterative

sequence consisting of (A) a double Michael

addition of acryloritrile to the primary amino groups

followed by (B) Hydrogenation under pressure in

the presence of Raney cobalt. Today, these PPI

dendrimers are synthesized in large quantities by

DSM and are commercially available. DSM uses its

own designation to describe its dendrimers, where

the core is diaminobutane, dendrindictes the interior

dendritic branch cell; and n is the number of end

groups.

Fig. 2: PPI dendrimers

Liquid crystalline dendrimers: These are

mesogenic (liquid crystalline) monomers e.g.

mesogen functionalized carbosilane dendrimers.

Functionalization of end group of carbosilane

dendrimers with 36 mesogenic units, attached

through a C-5 spacer, leads to liquid crystalline

dendrimers that form broad smetic A phase in the

temperature range of 17–130C (Lorenz et al., 1996).

Boiko et al.,. had synthesized first photosensitive

liquid crystalline dendrimer with terminal

cinnamoyl groups (Boiko et al., 1996). They have

confirmed the structure and purity of this LC

dendrimer by 1H NMR and GPC methods.

Dendrimers under UV irradiation, can undergo E-Z

isomerisation of the cinnamoyl groups and [2 + 2]

photocycloaddition leading to the formation of a

three-dimensional network.

Tecto dendrimers: Tecto-dendrimers are composed

of a core dendrimer, which may or may not contain

the therapeutic agent, surrounded by dendrimers of

different types, each type designed to perform a

function necessary to a smart therapeutic nanodevice

(Betley et al., 2002). The Michigan Nanotechnology

Institute for Medicine and Biological Sciences (M-

NIMBS) are developing a tecto dendrimers which

are used to perform the functions like diseased cell

recognition, drug delivery, diagnosis of disease

state, reporting location and outcome of therapy.

The future planning was to produce a smart

therapeutic nanodevice for the diseased cell like a

cancer cell or a cell infected with a virus.

Chiral dendrimers: In chiral dendrimers the

construction of core was based on different

constitution but with similar chemical branches.

Asymmetric catalysis and chiral molecular

recognition are the main applications of chiral,

nonracemic dendrimers (Ritzén and Frejd, 1999).

PAMAMOS dendrimers: PAMAMOS (poly

amidoamine-organosilicon) are radially layered,

inverted unimolecular micelles that consist of

hydrophilic, nucleophilic polyamidoamine

(PAMAM) interiors and hydrophobic organosilicon

(OS) exteriors. These are exclusively useful for the

preparation of honeycomb like networks with

nanoscopic PAMAM and OS domains (Dvornic et

al., 2000).

Hybrid dendrimers: Hybrid dendrimers are

combination of dendritic and linear polymers in

hybrid block or graft copolymer forms. The small

dendrimer segment coupled to multiple reactive

chain ends provides an opportunity to use them as

surface active agents, compatibilizers or adhesives,

e.g. hybrid dendritic linear polymers (Jain and

Khopade, 2001).

Peptide dendrimers: Peptide dendrimers are

defined as dendrimer containing peptides on the

surface of the dendrimer frame work with amino

acids as a branching (or) core unit. Peptide

dendrimers with their peptide molecule had

excellent compatibility in biological and

therapeutical levels make them a potential candidate

for various drug delivery systems. The main

applications of the peptide dendrimers includes

cancer, antimicrobials, antiviral, central nervous

system, analgesia, asthma, allergy, Ca+2

metabolism,

magnetic resonance imaging (MRI), magnetic

resonance angiography (MRA), fluorogenic imaging

and serodiagnosis (Bruckdorfer et al., 2004 and

Crespo et al., 2005).

Glycodendrimers: Dendrimers that incorporate

carbohydrates into their structures are termed as

glycodendrimers. Glycodendrimers are three types

(i) carbohydrate-coated; (ii) carbohydrate centered;

and (iii) fully carbohydrate-based. Glycodendrimers

have been used to study the protein–carbohydrate



interactions that are in many intercellular

recognition events. The main applications of

glycodendrimers are study of protein–carbohydrate

interactions, incorporation into analytical devices,

gel formulation, MRI contrast agents, and gene

delivery systems (Colinger, 2002 and Turnbull and

Stoddart, 2002).

APPLICATIONS OF DENDRIMERS

Dendrimers have attracted the most

attention as potential drug delivery scaffolds due to

their unique characteristics. Dendrimers have

narrow polydispersity; nanometer size range of

dendrimers can allow easier passage across

biological barriers. Dendrimers can be used to

deliver drugs either by encapsulating the drug in the

dendrimer interior void spaces or by conjugation to

surface functionalities. All these properties make

dendrimers as suitable carrier for drug delivery.

Dendrimers in transdermal drug delivery: Now

day’s dendrimers had key role for the improvement

transdermal drug delivery system. In transdermal

dosages drug delivery is difficult because of the

hydrophobic nature and inefficient cell entry. Highly

water soluble dendrimer are designed which

improve the drug solubility, plasma circulation, and

entry to cells make efficiently delivery drug from

transdermal formulation.

Non-steroidal anti-inflammatory drug

(NSAIDs) used for acute and chronic rheumatoid

and osteoarthritis are limited there clinical usage by

adverse events such as dyspepsia, gastrointestinal

bleeding and renal side effects when give orally.

Transdermal formulation will overcome adverse

events and also provide good therapeutic blood level

maintains for longer time. But poor rate of

transcutaneous delivery pulls down transdermal

delivery system. Drug permeation through the skin

was enhanced by PAMAM dendrimer complex with

NSAIDs (Ketoprofen, Diflunisal) as skin penetration

enhancers. Permeation studies on rat skin were

carried out for ketoprofen and diflunisal drug. High

permeation was achieved by drug dendrimer

complex (ketoprofen 3.4times and diflunisal

3.2times) when compared to drug. Antinociception

effect of ketoprofen shows that dendrimer complex

reduced writhing for period 1-8hr but drug reduced

writhing up to 4-6hr.

In another study indomethacin and

PAMAM dendrimer investigated (Chauhan et al.,

2003). In-vitro and in-vivo studies were carried out

for PAMAM dendrimer complex. In-vivo

pharmacokinetic and pharmacodynamic studies in

Wistar rats showed that significant higher

concentration and effective concentration could be

maintain for 24h in blood by G4 dendrimer

indomethacin transdermal formulation.

Various transdermal penetration enhancers

based on chemical and physical approach were

carried out chemical penetration enhancers such as

sulfoxide, oxazolidionesis, fatty acids essential oil,

pyrrllidoions, terpenes and terpenoirds were used.

Inotophoresis, electrophoresis, ultrasound, gel and

patch are physical penetrates which used to

exchange absorption of drug (Pathan and Setty,

2009, Santander-Ortega et al., 2010 and Shembale et

al., 2012).

Recently Zhao et al., conjugated PEGylated

PAMAM dendrimers for transdermal delivery of

bioactive molecules delivery of bioactive by pre-

treatment or co treatment technique using different

vehicle lime water, chloroform isopropyal myristal

chloroform water mixture and octanal water mixture

emulsion. Further he reviewed the three different

mechanisms which use to deliver the bioactives

(Sun et al., 2012).

In another study Welowie et al., used that

PAMAM dendrimers to conjugate 8-methoy psiralae

(a photo sentizier for puva therapy). Here solubility

of 8-methoxypsiralane PAMAM conjugate

increased. Moreover in another study solubility of

riboflavin was enhanced with increase in generation

of PAMAM dendrimers. Moreover diffusion of

riboflavin in pig ear skin was enhancing with

increase in generation (Borowska et al., 2010).

Moghmin et al., show that furful permeation

enhances through rat skin model using pamam

dendrimers (G5) in water vehicle by pretreatment

(Moghimi et al., 2010).

Yang et al., reported that smaller G2 pamam

dendrimers penetrate the skin layers more efficiently

than the larger ones (G4). Increased skin absorption

and retention were produced by G2 dendrimeric olic

acid conjugates because of their increase in partition

coefficient. Here permeation across skin layers is

directly based on the size, surface charge and

hydrophobicity of PAMAM dendrimers (Yang et

al., 2012).



Fig. 3: Schematic representation of the internalization mode of PAMAM dendrimers with different

surface attachments (Yang et al., 2012).

In transdermal applications nanoparticles

(polysacchird and dendrimers) are used to increase

the potential of transdermal drug delivery system.

Permal and co had extensive research work on

dendrimer application in transdermal system they

reveal that physico chemical properties of

dendrimers play a vital role in delivery of drug by

increase the penetration (Venuganti et al., 2009).

Therefore data suggested that dendrimer drug

complex make transdermal delivery system was

effective and might be a safe and efficacy method

for treating different diseases (Cheng et al., 2007).

Dendrimers in oral drug delivery: Traditional

Oral drug-delivery system has been the dominant

route for many years because of its significant

advantages. A major challenge for drugs is the

possibility of oral delivery, but main drawback was

the limited drug transport across the intestitinal

epithelium due to their large size relative to the tight

epithelial barrier of the gastrointestinal tract.

Duncan’s and his research group showed that

macromolecules of 3nm diameters could penetrate

through the rat’s intestinal membranes, which

allows G2.5-G3.5-PAMAM dendrimers to transport

across the intestine (Duncan and Izzo, 2005).

Moreover the acidic nature of the GI-tract enzymes

and stomach can affect the drug and the nanocarrier.

D’Emanuele group investigated effect of dendrimer

generation and conjugation on the cytotoxicity,

permeation and transport mechanism of surface-

modified cationic G3-PAMAM propranolol

dendrimer conjugation across Caco-2 cell

monolayers (D’Emanuele et al., 2004). They

suggested that the route of propranolol transport was

initially transcellular, while the conjugate was able

to bypass the P-gp efflux transporter, and they

arrived as the same inference as above concerning

the penetration pathway of the intestinal membrane.

Najlah investigated transepithelial permeability of

naproxen, a low solubility drug (Najlah et al., 2007).

Stability studies of G0 PAMAM conjugates in 50%

liver homogenate was compared to that in 80%

human plasma showed the lactate ester linker gave

prodrug of elevated stability in plasma with sluggish

hydrolysis in liver homogenate. So, these

conjugations exhibit potential nanocarriers for the

enrichment of oral bioavailability. The Cheng and

Xu group, reviewed that a PAMAM dendrimer

complex of the anti-inflammatory drug ketoprofen

sustained antinoninceptive activity (inhibit rate >

50%) until 8 h of oral administration to Kunming

mice, whereas this activity was absent with the free

drug after 3 h (Na et al., 2006). Increase in

permeability and cellular uptake was produced by

G4- PAMAM 7-ethyl-10-hydroxycamphtothecin

complexation with respect to free 7-ethyl-10-

hydroxycamphtothecin. They reported that complex

has the potential to improve the oral bioavailability

of drug.

Lin et al., carried out study on effects of

PAMAM dendrimer in intestinal absorption of

poorly absorble drug such as 5(6)- carboxyfluorsin

isothicynate dextran, calctitonin and insulin in rat

(Lin et al., 2011). Drug carboxylorescin and

calcitonin showed increase in absorption in rats

small intestine for 0.5%w/v G2 PAMAM dendrimer

complex. But fluorescine isothiocynate dextran and

insulin had not produced any desirable effects.

Moreover absorption in small intestine is mainly

base on molecular weight of drug ie the molecular

weight of drug increase absorption of drug

decreases.

Recently Kolhatkar et al., explored oral

delivery of SN – 38 (a potent topisomers –I inhibtor)

and active metabolize of irinotecan hydrochloride

(cpt-11) was improved by conjugation with G4

PAMAM dendrimer.10 fold increase in caco3 cell

monolayer and 100 fold increase in cellular uptake



by SN-38 and G4 PAMAM dendrimer than plain

drug (Kolhatkar et al., 2008) .

Dendrimers in targeted drug delivery: Targeted

drug delivery system had fetched great importance

in the pharmaceutical field mainly because it create

wide scope in utilization of existing drug and

reduced in draw backs. In treatment of cancer and

tumour existing drug molecules are ineffective

because of the cytotoxicity nature. The main reason

for cytotoxicity is low molecule weight and high

pharmacokinetic volume of distribution, quick

elimination, so high dose of drug is required for the

desired therapeutic effect which ultimately leads to

high toxicity and unwanted harmful effects,

moreover when these drug administered alone will

develop high resistance and lack of specification

will produce toxicity effect on the other healthy

cells. Further these chemopathetic drugs had poor

solubility and low bioavailability. Moreover these

drug formulations are formulated with toxic solvents

to produce effect dosage forms.

Above mentioned problems are overcome

by the usage dendrimers as a carrier for delivery the

drug in targeted manner. Dendrimers are able to

produced specific targeting of drug to cells and

thereby improving efficacy minimising side effects.

Various research works are carried to prove that

dendrimers can able to deliver the drug to the

targeted tissue in controlled manner. Cisplatine was

conjugate with pamam dendrimer by Malik et al

(Malik et al., 2000). The conjugate shows increased

solubility, reduced toxicity and EPR properties. It

was observed that this formulation showed superior

activity over cisplatin when injected into mice

bearing B16F10 tumor cells.

Doxorubicin is complexed with 2-3-bis (hydro

methyl) proxamic acid dendrimers and characterise

for in-vitro and in-vivo studies. The complexation of

drug with dendrimer mainly by covalently bond

through hydrazone linkage to high molecule weight

3-arm polyethylene oxide, exhibits reduced

cytotoxicity in-vitro. But in-vivo studied shows

minimum accumulation in vital organs and increase

half life for conjugate drug compared to free drug.

Jesus and group had concluded that dendrimer

formulation increase half life of the drug and there

reduced the amount of drug administered (De Jesus

et al., 2002).

The in-vivo characterize in the mice of

dendrimer conjugate should increased solubility,

reduced toxicity and EPR properties when compared

with free drug. Dendrimer conjugate of Cisplatine

produced superior activity in targeted manner when

compared with free drug. Poly amide amine

dendrimers was conjugated with 1-bromoacetyl-5-

flurouracil to produce dendrimer 5Fu-conjugates.

Zhou et.al demonstrated that release of the drug

from the dendrimer was base on generation and

further indicates that dendrimer are promising drug

for targeted drug delivery (Zhuo et al., 1999).

Dendrimer conjugates showed good

elimination compared with drug in in-vitro studies

carried out in the mice by Lee group. Doxurubin

model drug was conjugated with polyester based

dendrimer. Dendrimer-PEO-doxorubine conjugate

inhibit the growth of C-26 tumor which was

implanted subcutaneously in mice (Lee et al., 2006).

Anti-cancer drugs 5-Flurouracil was

conjugated with pamam dendrimer to measure its

activity through blood level studies in the mice.

Dendrimer formulation had increase drug loading

capacity and stability with reduction hemolytic

toxicity (Bhadre et.al 2003). In another study by

Asthan in 2005 had confirmed that pamam

dendrimer had increase residence time, good

stability and increase the half life of drug. They

perform in-vivo studies in rat with flurbiprofan

loaded pamam dendrimer conjugates which reveals

that drug release from dendrimer is rapid in initial

and slow release in latter stage (Asthana et al.,

2005). In the same year imaging and targeting of

tumor cells by using pamam dendrimer was carried

out by the choi groups. They formulated pamam

dendrimer conjugated with folic acid as targeted

drug fluorescein isothiocyanate as imaging agent by

oligonucleotides linkage. They conform that

dendrimers can be used as imagine and drug

targeting simultaneously (Choi et al., 2005).

The galactose linked PPI dendrimer was

conjugated with primaquine phosphate and

subjected for in-vivo testing to find out

accumulation in the rat liver. Galactose linked PPI

dendrimer with primaque phosphate showed less

accumulation in the liver which compared the free

drug and uncoated PPI dendrimer. These results had

showed that coating of PPI dendrimer can improve

the effective delivery of drug and reduced toxicity

there by increasing the stability (Bhadra et al.,

2005). Kukowska-Lattalo et al synthesis the

dendrimers conjugated with folic acid and

methotrexate. An in-vivo study in mice was carried

out to conclude that dendrimer conjugated are more

effective then free drug. In confocal microscopic

image showed consider numbers of cells are

targeted by dendrimeric conjugate and this results

where further confirmed by analysis of isolated

tumour cells (Kukowska-Latallo et al., 2005).

Doxorubicin was taken as model drug and

conjugated with 6th generation cationic poly-L-

lysine dendrimers. The dendrimer conjugate had a

increase penetration and delay in growth of prostate

3D multicellular tumor spheroids (MTS) compared



with free drug (Khuloud et al., 2013). Xiangyang

Shi et al., had synthesis conjugate of pamam

dendrimer with anti cancer drug 2-methoxyestradiol.

The dendrimer conjugated release drug in sustained

manner and specifically targeted the cancer cells in

MTT assay. This study makes dendrimer as one of

the novel carrier for anticancer drug (Yin et al.,

2011).

Umesh Gupta et al., explore potential

delivery activity PPI dendrimer and folated

conjugated PPI dendrimer. Doxorubine was used as

model drug. The folate conjugated PPI shows faster

drug release in acidic environment and high cell

uptake in MCFT cancer cell line compared with PPI

dendrimer. So it had been conclude that folic acid

conjugated PPI dendrimer are better carrier agents

(Gupta et al., 2010). Garcia-vallejo et al., synthesis

pamam dendrimer conjugated with leb. The

characterisation of dendrimer conjugated showed

enhanced binding, optimal internalisation, increase

lysosomal delivery, increase antigen presentation

and cytokine response. It had been conclude that

dendrimer can be used for targeting peptide antigen

cancer immunotherapy, auto immunity and

infectious disease (García-Vallejo et al., 2013).

Pamam dendrimer of generation 5th was

conjugated with N-acetylgalactosamine via peptide

and thiourea linkage. Hepatic cell line studies

showed that dendrimer conjugated had increase

cellular uptake by ASGPR mediated endocytosis.

Moreover increase in concentration of dendrimer

produced more effective cell targeting. The

dendrimer conjugated produced Michaelis menten

kinetics. It had concluded that dendrimer conjugate

are effectively used as targeted carrier for hepatic

targeting (Scott et al., 2011).

Fig. 4: A schematic drawing showing the composition of a drug-loaded G5-NAcGal conjugate binding to the ASGPR expressed

on the surface of hepatic cancer cells (e.g. HepG2), which triggers receptor-mediated endocytosis of these G5-NAcGal

conjugates followed by endosomal escape and release of the therapeutic cargo into the cytoplasm while the ASGPR recycles

back to the cell surface (Scott et al., 2011).

Anupama et al., synthesized 4.0 G PAMAM

dendrimer and conjugated with Gallic acid [GA] for

cancer targeted drug delivery system (Anupama et

al., 2011). The Cytotoxicity study in MCF-7 cell

line showed dendrimer conjugates had showed

increase activity on cells.

Dendrimers in gene delivery: Gene therapy is one

novel approach to cure the chronic disease. In this

therapy the defective gene which is responsible for

the over expression or under expression corrected.

The gene therapy is mainly based on vector used

because it will decide the success of gene therapy.

Dendrimers are ideal vector in the gene delivery.

Dendrimer are more stable, monodispersity,

generation, modification in terminal and size of the

dendrimer are controlled. Above mention properties

made the dendrimer as one the vital carrier for the

gene delivery.

Pamam starburst dendrimers were complexed

with DNA through ethidium bromide. As the

generation of the dendrimers increase the DNA

regions also increase (Kukowska-Latallo et al.,

2000). Kukowska-catallo et al synthesised G9

pamam dendrimer pCF1CAT plasmid complex.

Intravenous administration of dendrimer complex in

rat show high level of expressions in lung tissues. In

another study a cyclodextrin surfaced G5 pamam

dendrimer conjugate were produced by Kihara et al

(Kihara et al., 2003). High level transgene

expression was reported in intravenous

administration in rat. In the same manner Wade et al

developed manner coated pamam dendrimers as new

transgene vector (Wada et al., 2005). In vitro studies

should that mannose coated dendrimer conjugates

showed high transfection dendrimer. Mamede et al.,

used 111In-oligo/G4100 and 111In-oligo/G4-bt-



Av100 as gene transfer vectors and in vivo

biodistribution evaluation showed more

accumulation in kidney and lung when compare to

liver (Mamede et al., 2004). Furthers authors

summarized that the positively charged

DNA/dendrimer complexes condensed to form

complexes of several nanometres and resulted in

uptake by lung tissues.

A study by Schatzlein et al., showed surface

treatment of PPI dendrimers with methylated

quaternary amines improved the DNA complexation

and decreased cytotoxicity (Schatzlein et al., 2005).

PPI dendrimers of various generation acts as

transfection agents and target gene efficiently

expressed in the liver were studied by Dufes and

groups (Dufes et al., 2005). They demonstrated that

intravenous administration of a gene medicine and

G3 PPI dendrimer complex could result in

intratumoural transgene expression and regression

of the established tumours in all animals.

Arginine peptide dendrimer of 5th and 6

th

generation was developed by Zhongwei group.

Further characterization of dendrimer conjugates

showed high transfection and high biosafety

compared branched polyetherimide (PEI) on all cells

in breast tumor models (Kui et al., 2012). Another

study by Bing and co synthesized β-cyclodextrin

complexed PAMAM dendrimer with human

neuroblastoma SH-SY5Y cells. Dendrimer

conjugates showed low cytotoxicity and high

transgene activity compared with PAMAM (G

4)/pDNA complex (Bing et al., 2013).

A comparative study was carried out by

Ajay and co between PAMAM G4 dendrimers and

the surface modified dendrimers was conducted in

HEK 293T, GM7373 and NCI H157G cell lines in

gene transfer (Ajay et al., 2010). Effect of excess of

ornithine (100µM) on transfection efficiency of the

ornithine-conjugated PAMAMG4 dendrimers was

investigated in separate experiment. Transfection

efficiency of PAMAMG4-ORN60 dendrimer

complex was slightly higher in cancer cells (NCI

H157G) as compared to HEK 293T cells.

Transfection efficiency of the PAMAMG4-ORN60

dendrimers decreased in presence of excess of

ornithine while there was no effect on the parent

PAMAMG4 dendrimers. Jose et al., produced

conjugates of plasmid DNA and PAMAM

dendrimer G5 for gene delivery (Jose et al., 2010).

Further characterization of dendrimer conjugates

showed high efficiency in the gene expression.

Kui et al., synthesis different generations of

dendritic poly(L-lysine) vectors for in vitro gene

transfection (Kui et al., 2011). The higher

generations tended to produce the greater positive

potentials, indicating a stronger potency of the

complexes to interact with negatively charged cell

membranes. Dendrimer conjugates of 5th generation

showed good biocompatibility and higher efficiency

transfection compared with other generation

dendrimer complex.

Based on these results, we concluded that

dendrimers were one of promising gene vectors

which might be able to deliver gene into liver,

spleen, lung, kidney, and even the tumor at

therapeutic levels.

Dendrimers in pulmonary drug delivery: Bai and

groups investigated Enoxaparin PAMAM

dendrimers complex for pulmonary drug delivery

(Bai

et al., 2006). In this research enoxparin-

PAMAM dendrimer complex were formulated and

evaluated for the drug enachment. The dendrimer

formulation was administered into lungs of

anaesthetized rats and drug absorption was observed

by measuring plasma anti-factor Xa activity, and by

observing prevention efficacy of deep vein

thrombosis in a rodent model. Bioavailability of

enoxaparin was increased to 40% in G2 and G3

PAMAM dendrimers which are positively charged.

They reported that positively charged dendrimers

are suitable carrier for pulmonary delivery of

Enoxaparin.

Seabrook and coworkers described the

boosting effect with intranasal dendrimeric Aβ1-15

(16 copies of Aβ1-15 on a lysine tree) but not Aβ1-

15 peptide affording immune response following a

single injection of Aβ1-40/42 in heterozygous APP-

tg mice (Seabrook et al., 2006).

Inapagolla et al., carried study on in-vivo

efficacy of methylprednisolon conjugate G4

PAMAM dendrimers showed good lung anti

inflammation potency (Inapagolla et al., 2010).

Further methylprednisolon-G4-PAMAM dendrimers

conjugate at the dose of 5mg/kg improved the

airway delivery in pulmonary inflammatory model

based on a 11 fold enchament of eosinophil lung

accumulation following five daily inhalation

exposure of sensitized mice to allergen and albumin.

Here allergen induced inflammation reduced by

drug loaded dendrimer conjugate was mainly base

on improved drug residence time in the lung.

Dong et al., carried out invivo pulmonary

absorption on for G0-G3 PAMAM dendrimers

conjugates of insulin and calction. Here absorption

of insulin and calction was increased by PAMAM

dendrimers conjugates. Moreover absorption rate

was increased as generation of PAMAM increases

(Dong et al., 2010).

To target regional lung deposition

dendrimers emerged has very powerful carries in

nano size. Review paper by carvalho et al., and choi



et al., has explained the important and influence of

particle size, charge, and coating on lung deposition

(Carvalho et al., 2011 and Choi et al., 2010).

Dendrimers did posses characteristic to emerge as

nanocarrier for delivery bioactives through

inhalation route.

CONCLUSION

The application of dendrimers to drug

delivery system has experienced rapid growth.

Dendrimers are expected to play key role in

pharmaceutical field as drug carriers. Dendrimers

role in the biomedical applications is widely

expanded. The supramolecular properties of the

dendrimers made them major agent to delivery

drugs and other function. As per reviewed in this

article dendrimers are widely used in encapsulation

various drugs and to deliver the drug to the targeted

site. More over high level of controllable features of

dendrimers such as size, shape, branching length

and surface modifications make them an ideal drug

carrier. Further dendrimers offer generation number

and terminal groups and the chance to introduce two

or more functional group types at the periphery are

mammoth advantages of dendrimers over polymers.

Few drawbacks like toxicity, localization, bio-

distribution and costly synthesis step pull them

down. In spite of above drawbacks, several

dendrimers have already been commercialized, and

some are in clinical trials. To make dendrimers

commercial successful tool for drug delivery more

research work has to be done on cost effective

synthesis, toxicity reduction and drug conjugation.

As reviewed in this article dendrimer moiety hold

great promise and potential tool for drug delivery

system.

REFERENCE

Ajay K, Venkata KY, Gareth ED, Strychar KB,

Srinath P, Enhanced gene transfection efficiency by

polyamidoamine (PAMAM) dendrimers modified

with ornithine residues, Int J Pharm, 392, 2010,

294–303.

Al-Jamal KT, Ramaswamy C, Florence AT,

Supramolecular structures from dendrons and

dendrimers, Adv Drug Deliv Rev, 57, 2005, 2238–

2270.

Anupama S, Surya PG, Arun KG, Surface modified

dendrimers: Synthesis and characterization for

cancer targeted drug delivery, Bioorganic &

Medicinal Chemistry, 19, 2011, 3341–3346.

Arkas M, Allabashi R, Tsiourvas D, Mattausch EM,

Perfler R, Organic/Inorganic Hybrid Filters Based

on Dendritic and Cyclodextrin ‘‘Nanosponges’’ for

the Removal of Organic Pollutants from Water,

Environ Sci Technol, 40, 2006, 2771– 2777.

Asthana A, Chauhan AS, Diwan PV, Jain NK,

Poly(amidoamine) (pamam) dendritic

nanostructures for controlled site specific delivery of

acidic anti-inflammatory active ingredient, AAPS

Pharm Sci Tech, 6, 2005, E536–E542.

Aulenta F, Hayes W, Rannard S, Dendrimers: A

new class of nanoscopic containers and delivery

devices, Eur Polym J, 39, 2003, 1741–1771.

Bai S, Thomas C, Rawat A, Ahsan F, Recent

progress in dendrimer-based nanocarriers, Crit Rev

Ther Drug Carrier Syst, 23, 2006, 437–495.

Bai S, Thomas C, Rawat A, Ahsan F, Recent

progress in dendrimer-based nanocarriers, Crit Rev

Ther Drug Carrier Syst, 23, 2006, 437–495.

Bayele HK, Ramaswamy C, Wilderspin AF, Srai

KS, Toth I, Florence AT, Protein transduction by

lipidic peptide dendrimers, J Pharm Sci, 95, 2006,

1227–1237.

Betley TA, Hessler JA, Mecke A, Banaszak Holl,

MM, Orr BG, Uppuluri S, Tomalia, DA, Baker JR,

Tapping mode atomic force microscopy

investigation of poly(amidoamine) core–shell

tecto(dendrimers) using carbon nanoprobes,

Langmuir, 18, 2002, 3127–3133.

Bhadra D, Bhadra S, Jain S, Jain NK, A PEGylated

dendritic nanoparticulate carrier of fluorouracil, Int J

Pharm, 257, 2003,111–124.

Bhadra D, Yadav AK, Bhadra S, Jain NK,

Glycodendrimeric nanoparticulate carriers of

primaquine phosphate for liver targeting, Int J

Pharm, 295, 2005, 221-233.

Bhyrappa P, Young JK, Moore JS, Suslick KS,

Dendrimer-metalloporphyrins: Synthesis and

catalysis, J Am Chem Soc, 118, 1996, 5708–5711.

Bing L, Jun JD, Fang Y, Ning Y, Wei L, Jian RY,

Shu Xiang Pu, Long CX, Cong G, Li MZ, Efficient

gene transfection in the neurotypic cells by star-

shaped polymer consisting of β-cyclodextrin core

and poly(amidoamine) dendron arms, Carbohydrate

Polymers, 94, 2013, 185–192.

Boiko N, Zhu X, Bobrovsky A, Shibaev V, First

photosensitive liquid crystalline dendrimer:

synthesis, phase behavior, and photochemical

properties, Chem Mater, 13, 1996, 1447–1452.

Borowska K, Laskowska B, Magon AM, Pyda M,

Wolowiec S, PAMAM dendrimers as solubilizers

and hosts for 8-methoxypsoralene enabling

transdermal diffusion guest, Int J Pharm, 398, 2010,

185–189.

Bruckdorfer T, Marder O, Albericio F, From

production of peptides in milligram amounts for



research to multi-tons quantities for drugs of the

future, Curr Pharm Biotechnol, 5, 2004, 29–43.

Buhleirier E, Wehner W, Vogtle F, Cascade and

non-skid – chain like” synthesis of molecule cavity

topologies, Synthesis, 2, 1978, 155-158.

Carvalho TC, Peters JI, Ill ROW, Influence of

particle size on regional lung deposition — what

evidence is there?, Int J Pharm, 406, 2011, 1–10.

Chauhan AS, Sridevi S, Chalasani KB, Jain AK,

Jain SK, Jain NK, Diwan PV, Dendrimer-mediated

transdermal delivery: enhanced bioavailability of

indomethacin, J Control Release, 90, 2003, 335–

343.

Chen W, Turro NJ, Tomalia DA, Using ethidium

bromide to probe the interactions between DNA and

dendrimers, Langmuir, 16, 2000, 15-19.

Cheng Y, Man N, Xu T, Fu R, Wang X, Wang X,

Wen L, Transdermal delivery of nonsteroidal anti-

inflammatory drugs mediated by polyamidoamine

(PAMAM) dendrimers, J Pharm Sci, 96, 2007, 595–

602.

Cheng YY, Chen DZ, Fu RQ, He PS, Behavior of

polyamidoamine dendrimers as curing agents in bis-

phenol a epoxy resin systems, Polym Int, 54, 2005,

495–499.

Cheng YY, Xu TW, Fu RQ, Polyamidoamine

dendrimers used as solubility enhancers of

ketoprofen, Eur J Med Chem, 40, 2005, 1390–1393.

Cheng YY, Xu TW, He PS, Polyamidoamine

(PAMAM) dendrimers as curing agents: The

optimum PAMAM concentration selected by

dynamic torsional vibration method and

thermogravimetric analyses, J Appl Polym Sci, 103,

2007, 1430– 1434.

Choi HS, Ashitate Y, Lee JH, Kim SH, Matsui A,

Insin N, Bawendi MG, Semmler-Behnke M,

Frangioni J, Tsuda A, Rapid translocation of

Nanoparticles from lung airspaces to the body, Nat

Biotechnol, 28, 2010, 1300–1304.

Choi Y, Thomas T, Kotlyar A, Islam MT, Baker JR,

Synthesis and functional Evaluation of DNA-

assembled polyamidoamine dendrimer clusters for

cancer cell-specific targeting, Chem Biol, 12, 2005,

35–43.

Colinger M, Biological applications of dendrimers,

Curr Opin Chem Biol, 6, 2002, 742–748.

Credi A, Ribera BF, Venturi M, From

supramolecular electrochemistry to molecular-level

devices, Electrochim Acta, 49, 2004, 3865–3872.

Crespo L, Sanclimens G, Pons M, Giralt E, Royo M,

Albericio F, Peptide and amide bond-containing

dendrimers, Chem Rev, 105, 2005, 1663–1681.

D’Emanuele A, Jevprasesphant R, Penny J, Attwood

D, The use of a dendrimer–propranolol prodrug to

bypass efflux transporters and enhance oral

bioavailability, J Control Release, 95, 2004, 447–

453.

D’Emanuele A, Jevprasesphant R, Penny J, Attwood

D, The use of a dendrimer–propranolol prodrug to

bypass efflux transporters and enhance oral

bioavailability, J Control Release, 95, 2004, 447–

453.

De Jesus OLP, Ihre HR, Gagne L, Frechet JMJ,

Szoka FC, Polyester dendritic systems for drug

delivery applications: In vitro and in vivo

evaluation, Bioconjug Chem, 13, 2002, 453–461.

DeBrabander-VandenBerg EMM, Meijer EW,

Poly(propyleneimine) Dendrimers: Large scale

synthesis by hetereogeneously catalyzed

hydrogenations. Angew Chem Int Ed Engl, 32,

1993, 1308–1311.

Denkewalter RG, Kolc J, Lukasavage WJ,

Macromolecular highly branched homogeneous

compound based on lysine units, Untied states

patent, US Patent 4289872, 1981.

Diallo MS, Christie S, Swaminathan P, Johnson JH,

Goddard WA, Dendrimer enhanced ultrafiltration.

Recovery of Cu(II) from aqueous solutions using

PAMAM dendrimers with ethylene diamine core

and terminal NH2 groups, Environ Sci Technol, 39,

2005, 1366–1377.

Dong Z, Katsumi H, Sakane T, Yamamoto A,

Effects of polyamidoamine (PAMAM) dendrimers

on the nasal absorption of poorly absorbable drugs

in rats, Int J Pharm, 30, 2010, 244–252.

Dufes C, Keith WN, Bilsland A, Proutski I,

Uchegbu IF, Schatzlein AG, Synthetic anticancer

gene medicine exploits intrinsic antitumor activity

of cationic vector to cure established tumors, Cancer

Res, 65, 2005, 8079–8084.

Dufes C, Uchegbu IF, Schatzlein AG, Dendrimers in

gene delivery, Adv Drug Deliv Rev, 57, 2005,

2177–2202.

Duncan R, Izzo L, Dendrimer biocompatibility and

toxicity, Adv Drug Deliv Rev, 57, 2005, 2215–2237.

Dvornic PR, De-Leuze-Jallouli AM, Owen MJ, Perz

SV, Radially layered poly(amidoamine-

organosilicon) dendrimers, Macromolecules, 33,

2000, 53–66.

Elemans JAAW, Boerakker MJ, Holder SJ, Rowan

AE, Cho W-D, Percec V, Nolte RJM,



Supramolecular chemistry and self-assembly special

feature: Plastic- and liquid-crystalline architectures

from dendritic receptor molecules, PNAS, 99, 2002,

5093–5098.

Florence AT, Preface — Dendrimers: A versatile

targeting platform, Adv Drug Deliv Rev, 57, 2005,

2104–2105.

Fujita M, Oguro D, Miyazawa M, Oka H,

Yamaguchi K, Ogura K, Self-assembly of ten

molecules into nanometre-sized organic host

frameworks, Nature, 378, 1995, 469–471.

García-Vallejo JJ, Ambrosini A, Overbeek A, van

Riel H, Bloem K, Unger WWJ, Chiodo F, Bolscher

JG, Nazmi K, Kalay H, van Kooyk Y, Multivalent

glycopeptide dendrimers for the targeted delivery of

antigens to dendritic cells, Mol Immunol, 53, 2013,

387-397.

Gupta U, Agashe HB, Asthana A, Jain NK,

Dendrimers: Novel Polymeric Nanoarchitecture for

Solubility Enhancement, Bio macromolecules, 7,

2006, 649-658.

Gupta U, Dwivedi SK, Bid HK, Konwar R, Jain

NK, Ligand anchored dendrimers based

nanoconstructs for effective targeting to cancer

cells, Int J Pharm, 393, 2010, 185–196.

Hawker CJ, Fréchet JMJ, Preparation of polymers

with controlled molecular architecture. A new

convergent approach to dendritic macromolecules, J

Am Chem Soc, 112, 1990, 7638–7647.

Heldt JM, Durand NF, Salmain M, Vessieres A,

Jaouen G, Prepration and charactyerization of

poly(amidoamine) dendrimers functionalized with a

rhenium carbonyl complex and PEG as new IR

probes for carbonyl metallo immunoassay, J

Organometallic chem, 689, 2004, 4775-4782.

Ihre H, Hult A, Fréchet JMJ, Gitsov I, Double-stage

convergent approach for the synthesis of

functionalized dendritic aliphatic polyesters based

on 2,2-bis(hydroxymethyl)propionic acid,

Macromolecules, 31, 1998, 4061–4068.

Inapagolla R, Guru BR, Kurtoglu YE, Gao X, Lieh-

Lai M, Bassett DJP, Kannan RM, In vivo efficacy of

dendrimer-methylprednisolone conjugate formation

for the treatment of lung inflammation, Int J Pharm,

339, 2010, 140–147.

Jain NK, Khopade AJ, Dendrimers as potential

delivery systems for bioactives. in: Jain, N.K. (Ed.),

Advances in controlled and novel drug delivery.

New Delhi: CBS Publishers & Distributors; 2001, p.

361–380.

Jose LS, Hugo O, Deepti P, Joao R, Ana PP, Pedro

LG, Helena T, Functionalization of

poly(amidoamine) dendrimers with hydrophobic

chains for improved gene delivery in mesenchymal

stem cells, J Control Release, 144, 2010, 55–64.

Karthaus O, Ijoro K, Shimomura M, Hellmann J,

Irie M, Monomolecular layers of diarylethene-

containing dendrimers, Langmuir, 12, 1996, 6714–

6716.

Kawaguchi T, Walker KL, Wilkins CL, Moore JS,

Double exponential dendrimer growth, J Am Chem

Soc, 117, 1995, 2159–2165.

Khuloud TA, Wafa TA, Julie TW, Wang, Noelia R,

Joanna B, David G, Mire Z, Kostas K, Cationic

poly-L-lysine dendrimer complexes doxorubicin and

delays tumor growth in vitro and in vivo, ACS

Nano, 7, 2013, 1905-1917.

Kihara F, Arima H, Tsutsumi T, Hirayama F,

Uekama K, In vitro and in vivo gene transfer by an

optimized α-cyclodextrin conjugate with

polyamidoamine dendrimer, Bioconjug Chem, 14,

2003, 342–350.

Kim J, Choi J, Nam K, Lee M, Park J, Lee J,

Enhanced transfection of primary cortical cultures

using arginine-grafted PAMAM dendrimer,

PAMAM-Arg, J Control Release, 114, 2006, 110–

117.

Kolhatkar RB, Swaan P, Ghandehari H, Potential

oral delivery of 7-ethyl-10- hydroxy-camptothecin

(SN-38) using poly(amidoamine) dendrimers,

Pharm Res, 25, 2008, 1723–1729.

Kui L, Caixia L, Gang W, Yu N, Bin H, Yao W,

Zhongwei G, Peptide dendrimers as efficient and

biocompatible gene delivery vectors: Synthesis and

in vitro characterization, J Control Release, 155,

2011,77–87.

Kui L, Caixia L, Li L, Wenchuan S, Gang W,

Zhongwei G, Arginine functionalized peptide

dendrimers as potential gene delivery vehicles,

Biomaterials, 33, 2012, 4917-4927.

Kukowska-Latallo JF, Candido KA, Cao Z,

Nigavekar SS, Majoros IJ, Thomas TP, Balogh LP,

Khan MK, Baker JR, Nanoparticle targeting of

anticancer drug improves therapeutic response in

animal model of human epithelial cancer, Cancer

Res, 65, 2005, 5318–5324.

Kukowska-Latallo JF, Raczka E, Quintana A, Chen

C, Rymaszewski M, Baker JR, Intravascular and

endobronchial DNA delivery to murine lung tissue

using a novel, nonviral vector, Hum Gene Ther, 11,

2000, 1385–1395.

Labbe G, Forier B, Dehaen W, A fast double-stage

convergent synthesis of dendritic polyethers, Chem

Commun, 18, 1996, 2143–2144.




Lee CC, MacKay JA, Fréchet JMJ, Szoka FC,

Designing dendrimers for biological applications,

Nat Biotechnol, 23, 2005, 1517-1526.

Lee CC, Gillies ER, Fox ME, Guillaudeu

SJ, Fréchet JM, Dy EE, Szoka FC, A single dose of

doxorubicin-functionalized bow-tie dendrimer cures

mice bearing C-26 colon carcinomas, Proc Natl

Acad Sci, 103, 2006, 16649-16654.

Lee JJ, Ford WT, Reactivity of organic anions

promoted by a quaternary ammonium ion

dendrimer, Macromolecules, 27, 1994, 4632–4634.

Lin Y, Fujimari T, Kawaguchi N, Tsujimoto Y,

Nishimi M, Dong Z, Katsumi H, Sakane T,

Yamamoto A, Polyamidoamine dendrimers as novel

potential absorption enhancers for improving the

small intestinal absorption of poorly absorbable

drugs in rats, J Control Release, 149, 2011, 21–28.

Lorenz K, Holter D, Stuhn B, Mulhaupt R, Frey H,

Amesogen-functionized carbosilane dendrimer: A

dendritic liquid crystalline polymer, Adv Mater, 8,

1996, 414–416.

Love CS, Ashworth I, Brennan C, Chechik V, Smith

DK, Dendron-protected Au nanoparticles — Effect

of dendritic structure on chemical stability, J Colloid

Interface Sci, 302, 2006, 178–186.

Mak CC, Cow HF, Dendritic catalysts: Reactivity

and mechanism of the dendritic bis(oxazoline) metal

co1228–1230mplex catalyzed Diels- Alder reaction,

Macromolecules, 30, 1997, 1228–1230.

Malik N, Wiwattanapatapee R, Klopsch R, Lorenz

K, Frey H, Weener JW, Meijer EW, Paulus W,

Duncan R, Dendrimers: relationship between

structure and biocompatibility in vitro, and

preliminary studies on the biodistribution of 125I-

labelled polyamidoamine dendrimers in vivo, J

Control Release, 65, 2000, 133–148.

Mamede M, Saga T, Ishimori T, Higashi T, Sato N,

Kobayashi H, Brechbiel MW, Konishi J, Hepatocyte

targeting of 111In-labeled oligo-DNA with avidin or

avidin-dendrimer complex, J Control Release, 95,

2004, 133-141.

Moghimi HR, Varshochian R, Kobarfard F, Erfan

M, Reduction of percutaneous absorption of toxic

chemicals by dendrimers, Cutan Ocul Toxicol, 29,

2010, 34–40.

Momotake A, Arai T, Photochemistry and

photophysics of stilbene dendrimers and related

compounds, J Photochem Photobiol C Photochem

Rev, 5, 2004, 1–25.

Na M, Yiyun C, Tongwen X, Yang D, Xiaomin W,

Zhenwei L, et al., Dendrimers as potential drug

carriers, Part II: Prolonged delivery of ketoprofen

by in vitro and in vivo studies, Eur J Med Chem, 41,

2006, 670–674.

Najlah M, Freeman S, Attwood D, D’Emanuele A,

In vitro evaluation of dendrimer prodrug for oral

drug delivery, Int J Pharm, 336, 2007, 183–190.

Newkome GR, Yao Z, Baker GR, Gupta VK.

Micelles, Part 1. Cascade molecules: A new

approach to micelles. A [27]-arborol, J Org Chem,

50, 1985, 2003–2004.

Pathan IB, Setty CM, Chemical penetration

enhancers for transdermal drug delivery systems,

Trop J Pharm Res, 8, 2009, 173–179.

Patri AK, kukowska lotallo JF, Baker JR, Targeted

drug delivery with dendrimers comparison of the

release kinetics of covalently conjugated drug and

non covalent drug inclusion complex, Adv Drug Del

Rev, 57, 2005, 2203-2214.

Patri AK, Majoros IJ, Baker J, Dendritic polymer

macromolecular carriers for drug delivery, Curr

Opin Chem Biol, 6, 2002, 466–471.

Ritzén A, Frejd T, Synthesis of a chiral dendrimer

based on polyfunctional amino acids, Chem

Commun, 2, 1999, 207–208.

Santander-Ortega MJ, Stauner T, Loretz B, Ortega-

Vinuesa JL, Bastos-Gonzalez D, Wenz G, Schaefer

UF, Lehr CM, Nanoparticles made from novel

starch derivatives for transdermal drug delivery, J

Control Release, 141, 2010, 85–92.

Sayed-Sweet Y, Hedstrand DM, Spinder R, Tomalia

DA, Hydrophobically modified poly(amidoamine)

(PAMAM) dendrimers: Their properties at the air–

water interface and use as nanoscopic container

molecules, J Mater Chem, 7, 1997, 1199–1205.

Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C,

Chim YT, Roberts CJ, Davies MC, Munro A, Gray

AI, Uchegbu IF, Preferential liver gene expression

with polypropylenimine dendrimers, J Control

Release, 101, 2005, 247-258.

Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C,

Chim YT, Roberts CJ, Davies MC, Munro A, Gray

AI, Uchegbu IF, Preferential liver gene expression

with polypropylenimine dendrimers, J Control

Release, 101, 2005, 247-258.

Scott HM, Venkatesh T, Maxim VC, Donna SS,

William DE, Mohamed EH El-Sayed, N-

acetylgalactosamine-functionalized dendrimers as

hepatic cancer cell-targeted carriers, Biomaterials,

32, 2011, 4118-4129.

Seabrook TJ, Jiang L, Thomas K, Lemere CA,

Boosting with intranasal dendrimeric Aβ1–15 but

not Aβ1–15 peptide leads to an effective immune

response following a single injection of Aβ1–40/42

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20CC%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Gillies%20ER%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Fox%20ME%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Guillaudeu%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Guillaudeu%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Fr%C3%A9chet%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Dy%20EE%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed?term=Szoka%20FC%5BAuthor%5D&cauthor=true&cauthor_uid=17075050

http://www.ncbi.nlm.nih.gov/pubmed/17075050/

http://www.ncbi.nlm.nih.gov/pubmed/17075050/

http://www.ncbi.nlm.nih.gov/pubmed?term=Davies%20MC%5BAuthor%5D&cauthor=true&cauthor_uid=15588909

http://www.ncbi.nlm.nih.gov/pubmed?term=Munro%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15588909

http://www.ncbi.nlm.nih.gov/pubmed?term=Gray%20AI%5BAuthor%5D&cauthor=true&cauthor_uid=15588909


http://www.ncbi.nlm.nih.gov/pubmed?term=Uchegbu%20IF%5BAuthor%5D&cauthor=true&cauthor_uid=15588909

http://www.ncbi.nlm.nih.gov/pubmed?term=Davies%20MC%5BAuthor%5D&cauthor=true&cauthor_uid=15588909

http://www.ncbi.nlm.nih.gov/pubmed?term=Munro%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15588909



http://www.ncbi.nlm.nih.gov/pubmed?term=Uchegbu%20IF%5BAuthor%5D&cauthor=true&cauthor_uid=15588909



in APP-tg mice, J Neuroinflammation, 3, 2006, 1–

10.

Shembale AI, Borole DK, Lohiya RT, Useful

permeation enhancers for transdermal drug delivery:

A review, Int J Pharm Res Dev, 2, 2012, 1–6.

Sun M, Fan A, Wang Z, Zhao Y, Dendrimer-

mediated drug delivery to the skin, Soft Matter, 8,

2012, 4301–4305.

Svenson S, Tomalia DA, Dendrimers in biomedical

applications reflection on the field, Adv Drug Deli

Rev, 57, 2005, 2106 -2129.

Tomalia DA, Birth of a new macromolecular

architecture:dendrimers as quantized building blocks

for nanoscale synthetic polymer chemistry, Prog

Polym Sci, 30, 2005, 294–324.

Tomalia DA, Naylor AM, Goddard III WA,

Starburst Dendrimers: Molecular-level control of

size, shape, surface chemistry, topology and

flexibility from atoms to macroscopic matter,

Angew Chem Int Ed Engl, 29, 1990, 138-175.

Tomalia DA, Reyna LA, Svenson S, Dendrimers as

multi-purpose nanodevices for oncology drug

delivery and diagnostic imaging, Biochem Soc

Trans, 35, 2007, 61–67.

Turnbull WB, Stoddart JF, Design and synthesis of

glycodendrimers, Rev Mol Biotechnol, 90, 2002,

231–255.

Venuganti VVK, Perumal OP, Poly(amidoamine)

dendrimers as skin penetration enhancers: influence

of charge, generation and concentration, J Pharm

Sci, 98, 2009, 2345–2356.

Vladimir VT, Dendritic macromolecules at

interfaces, Adv Mater, 10, 1998, 253–257.

Wada K, Arima H, Tsutsumi T, Hirayama F,

Uekama K, Enhancing effects of galactosylated

dendrimer-β-cyclodextrin conjugates on gene

transfer efficiency, Biol Pharm Bull, 28, 2005, 500–

505.

Wiener EC, Brechbiel MW, Brothers H, Magin RL,

Gansow OA, Tomalia DA, Lauterbur PC,

Dendrimer based metal chelates: A new class of

magnetic resonance imaging contrast agents, Magn

Reson Med, 31, 1994, 1-8.

Wu H, Liu Z, Wang X, Zhao B, Zhang J, Li C,

Preparation of hollow capsule-stabilized gold

Nanoparticles through the encapsulation of the

dendrimer, J Colloid Interface Sci, 302, 2006, 142–

148.

Wu L, Li BL, Haung YY, Zhou HF, He YM, Fan

QH, Phosphine dendrimer stabilized palladium

Nanoparticles, a highly active and recyclable

catalyst for the Suzuki miyaura reaction and

hydrogenation, Org Lett, 3(8), 2006, 3605-3608.

Xu Y, Zhao D, Removal of copper from

contaminated soil by use of poly(amidoamine)

dendrimers, Environ Sci Technol, 39, 2005, 2369–

2375.

Yan S, Zhou Z, Zhang F, Yang S, Yang L, Yu X,

Effect of anionic PAMAM with amido groups

starburst dendrimers on the crystallization of

Ca10(PO4)6(OH)2 by hydrothermal method, Mater

Chem Phys, 99, 2006, 164–169.

Yang Y, Sunoqrot S, Stowell C, Ji J, Lee CW, Kim

JW, Khan SA, Hong S, Effect of size, surface

charge and hydrophobicity of poly(amidoamine)

dendrimers on their skin penetration,

Biomacromelecules, 13, 2012, 2154–2162.

Yin W, Rui G, Xueyan C, Mingwu S, Xiangyang S,

Encapsulation of 2-methoxyestradiol within

multifunctional poly(amidoamine) dendrimers for

targeted cancer therapy, Biomaterials, 32, 2011,

3322-3329.

Zeng F, Zimmerman SC, Rapid synthesis of

dendrimers by an orthogonal coupling strategy, J

Am Chem Soc, 118, 1996, 5326–5327.

Zhuo RX, Du B, Lu ZR, In vitro release of 5-

fluorouracil with cyclic core dendritic polymer, J

Control Release, 57, 1999, 249-257.




http://www.ncbi.nlm.nih.gov/pubmed?term=Zhuo%20RX%5BAuthor%5D&cauthor=true&cauthor_uid=9895412

http://www.ncbi.nlm.nih.gov/pubmed?term=Du%20B%5BAuthor%5D&cauthor=true&cauthor_uid=9895412

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu%20ZR%5BAuthor%5D&cauthor=true&cauthor_uid=9895412

