Upload
debjit-bhowmik
View
2.041
Download
7
Tags:
Embed Size (px)
Citation preview
IJRPB 1(6) www.ijrpb.com November-December 2013
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Editor B.Pragati Kumar, M.Pharm, Assistant Professor,
Nimra College of Pharmacy
Consulting editor
Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy
Associate Editors
Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy
Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy
Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy
Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy
Editorial Advisory Board
Dr.Y.Narasimaha Reddy, M. Pharm., Ph D.
Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal.
Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy),
Kerala
Dr.V.Gopal, M. Pharm., Ph D.
Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6
Dr. M.Umadevi, M.Sc. (Agri), Phd Research Associate, Tamil Nadu Agricultural
University, Coimbatore
Dr. J.Balasubramanium, M. Pharm., Ph D. General Manager, FR&D
R A Chem Pharma Ltd., Hyderabad
Dr. V.Prabhakar Reddy, M. Pharm., Ph D.
Principal, Chaitanya College of Pharmacy Education & Research, Warangal
Dr.P.Ram Reddy, M. Pharm., Ph D.
General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad
Dr. S.D.Rajendran, M. Pharm., Ph D.
Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad
IJRPB 1(6) www.ijrpb.com November-December 2013
INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY
Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication
provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the
review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t
copy and paste the article content from internet or other sources like e-books etc. Authors are the sole
responsible persons for the article, article content; results of the research conducted and copy right issues
if any. The editor and the editorial board are not entitled to change the article content, results and
diagrammatic representations which are given by authors. The article will be published only after getting
the approved galley proof from the authors.
Kindly follow the below guidelines for preparing the manuscript:
1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any
decorative borders anywhere in the text including the title page.
2. Don’t leave any space between the paragraphs.
3. Divide the research article into
a. Abstract
b. Introduction
c. Materials and Methods
d. Results
e. Discussion
f. conclusion
g. References
4. References should include the following in the same order given below
a) Author name followed by initials
b) Title of the book/ if the reference is an article then title of the article
c) Edition of the book/ if the reference is an article then Journal name
d) Volume followed by issue of the journal
e) Year of publication followed by page numbers
5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it
after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post
or scanned attachment to [email protected].
6. Keep in touch with the editor through mail or through phone for further clarifications as well as
for timely publication of your article.
Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna
District, Andhra Pradesh, India-521456 Printed at:
F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456
Visit us at www.ijrpb.com
Contact us/ send your articles to: Email: [email protected]
Phone no: 9490717845; 9704660406
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Volume 1 Issue 6 www.ijrpb.com November-December 2013
S.No. Contents Page No.
1 Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker
Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif 765-771
2 Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release
tablets in QbD environment
V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala
Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja
772-777
3 Development and validation of a stability indicating HPLC method for analysis of Altretamine
in bulk drug and pharmaceutical formulations
M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao
778-785
4 A review of various analytical methods on Atrovastatin
N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana 786-792
5 A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular
cancer
Praveen D, Ranadheer Chowdary P
793-796
6 Method development and validation for the simultaneous estimation of Ofloxacin and
Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method
Y.Bhargav, K Haritha Pavani, S Amareswari
797-802
7 Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against
Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats
Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S
803-807
8 Method development and validation for the simultaneous estimation of Atazanavir and
Ritonavir in tablet dosage form by RP-HPLC
Nuli Vasavi, Afroz Patan
808-814
9 Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats
Marri Praveen, M.Janarthan 815-818
10 Some H.R. methodology/ techniques for costs reduction in companies to improve profit
M. Sarkar, B. K. Sarkar, M. D. Gora, S. C. Verma 819-821
11 Analytical method development and validation of Artesunate and Amodiaquine hydrochloride
in tablet dosage form by RP-HPLC P RajaRao, Nanda Kishore Agarwal
822-827
12 Analytical method development and validation for the simultaneous estimation of
Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by
RP-HPLC
Syed Shaheda, Nanda Kishore Agarwal
828-834
13 Formulation and evaluation of herbal anti-dandruff shampoo
Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel
835-839
14 Analytical method development and validation for the simultaneous estimation of
Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms
V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy
840-845
15 Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and
Gentamycin induced nephrotoxicity in Albino rats
Radha.B, Janarthan M, Durraivel S
846-849
16 Analytical method development and validation for the simultaneous estimation of
Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid
chromatography
M. Sumalatha, K.Haritha Pavani
850-856
17 A new development and validated RP-HPLC method for the assay and related substances of
Itraconazole in capsule dosage form
Sarvani Paruchuri, Haritha Pavani K
857-865
18 Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca
againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats
Thirumala K, Janarthan M, Firasat Ali M
866-868
19 Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride
Hardeep Singh Dhaliwal, Dhruba Sankar Goswami 869-874
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Volume 1 Issue 6 www.ijrpb.com November-December 2013
20 Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic
treatment of osteoarthritis of the knee: a randomized controlled trial
Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy
875-880
21 Analytical method development and validation for the estimation of Olmesartan medoxomil
by RP-UPLC in bulk and pharmaceutical dosage forms
Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M
881-885
22 Modern hygienic industrial canteen amenity: A change factor for healthy physical work
environment of the work force in Indian industrial units
TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash
886-892
23 Design and development of Metformin hydrochloride Trilayered sustained release tablets
Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K
893-897
24 Amlodipine: the upcoming threat to Periodontist
Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, 898-900
25 Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets
of Diltiazem hydrochloride
Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3
901-907
26 Development and optimization of Diltiazem hydrochloride loaded microspheres by using
different Eudragit polymers
V. Kamalakkannan, K.S.G.Arul Kumaran
908-914
27 Formulation, characterization and optimization of Methotrexate loaded sodium alginate
chitosan Nanoparticles using 32
factorial design
S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar
915-921
28 Strategies in Dendritic architecture for drug delivery – An over review
Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan 922-934
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 765
Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker
Showkat Hussain Ganie1, Deepak Yadav
1, Altaf Ahmad
2, Anis Chadhry
1, Mohd Asif
1*
1. Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India
2. Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062
*Corresponding author: Email: [email protected], Phone: 8860142069
ABSTRACT
Nigella sativa, commonly known as kalongi is an important drug of traditional system of
medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and
jaundice. Because of increased demand and high price, there are chances that the herb could be
adulterated in the trade by other related species. Therefore, a reliable authentication method is needed
to facilitate identification of this genuine material from its adulterants. To carry out the work, the
market samples were procured from the crude-drug markets of different geographical regions of India.
The RAPD derived LAMP technique was employed for the characterization of different accessions of
Kalongi. 19 primers were used of which one unique band, common in all accessions were eluted,
cloned and sequenced. LAMP primers were designed and LAMP product formation was detected at
60°C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands.
One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was
developed into LAMP marker for identification of N. Sativa. The primers successfully amplified the
genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification. The
LAMP markers developed in this study may provide guidance for the authentication of plant materials
traded as Kalongi.
Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP);
Molecular markers; kalongi; RAPD.
1. INTRODUCTION
The traditional knowledge of herbal
medicine is widespread- ranging from tribal folklore
use to age-old practices and closely guarded recipes
handed down from generation to generation, to
highly evolved systems of medicine like Ayurveda,
Unani and Siddha. These systems have served the
humanity through the centuries and it is certain that
they will continue to be in use for times to come.
However, in the process of urbanization the contact
with nature was cut off and, consequently, the
knowledge about the identification of medicinal
plants deteriorated to a great extent. Additionally,
the crude drugs sold in the market are adulterated,
sophisticated or substituted by quite unrelated plant
materials. The adulteration of market samples is one
of the greatest drawbacks in promotion of herbal
products (Dubey, 2004). Plant samples in the market
are stored under undesirable conditions over the
years and often contain a mixture of other plant
species (Khatoon, 1993), thus, adversely affecting
their bio efficacy. The efficacy of many of the drugs
has become suspect because of the adulterated, dried
raw materials profusely available in the indigenous
market (Anonymous, 1996). Very often the identity
of market drugs is taken for granted without
subjecting the plant material to stringent methods of
botanical identification. This result in the loss of
therapeutic potential of the preparations if the plant
used is adulterated or substituted. It results in the
production of misleading or overlapping data on
phytochemical, pharmacological, pharmacognostical
and clinical aspects.
Nigella sativa (Family: Ranunculaceae) is
considered one of the most important medicinal herb
used in various Indigenous System of Medicine. The
plant cultivated almost all over India, is an annual
herb with linear- lance late leaves. Pale blue flowers
are solitary, fruit is capsule; seeds are black,
flattened, angular and funnel shaped. Seeds of the
herb are mostly used in medicine. Many
formulations containing Kalongi as a single drug or
in combination with other drugs are available in
Indian market. The important Unani formulations
using the drug are “Anquriya Kabir, Habe-e-Halteet,
Roghan Kalan, Qairuti Arad Karsana, Mujun
Nankhaw”. Traditionally the drug is used against
cough, fever, abdominal disorders, skin infections,
paralysis and jaundice (Paarakh, 2010). Seed oil is
used as a local anaesthetic (Paarakh, 2010). As far
as its pharmacological activities are concerned, the
drug is hypoglycaemic, hypocholestermic
(Bamosaet, 2002) and antioxidant (Kanter, 2003).
Thymoquinone (constituent of seed oil extract) is
antitumor, found to kill the pancreatic cancer cells
and its derivatives are used in blood, skin and breast
cancers (Paarakh, 2010).
The aqueous decoction of kalonji revealed
significant antibacterial potential against
Staphylococcus aureus, Micrococcus roseus,
Streptococcus mutans, Streptococcus morbillorium,
Streptococcus sanguis, Streptococcus intermedius,
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 766
Klebsiella ozaenae, Aeromonas hydrophila, and
Streptococcus salivarius (Chaudhry and Tariq,
2008). Considering the medicinal importance of
Kalongi, the authentication of this herb is highly
mandatory. DNA fingerprinting techniques are very
useful for correct identification of taxa. Among
various DNA markers, loop-mediated isothermal
amplification (LAMP) is convenient because the
reaction could be conducted under isothermal
conditions, thereby facilitating amplification and the
results could be achieved in less than 1 hr.
To the best of our knowledge, no attempt
has been made to characterize this herb using
molecular biology. To fill this gap, we employed
LAMP markers to authenticate the said drug. For
this, samples were collected from the crude drug
dealers of North and West India.
2. MATERIALS ANDMETHODS
2.1. Plant material: The samples of N. Sativa were
collected from crude drug dealers of Delhi,
Kolkatta, Uttarakhand and Uttar Pradesh. Voucher
specimens of these samples were prepared and kept
in the Herbarium, Department of Botany, Hamdard
University, New Delhi, 110062. The seeds are
stored in seed bank, Department of Botany,
Hamdard University, New Delhi, 110062. The
identified specimens were compared with
authenticated voucher specimens preserved in the
herbarium of National Institute of Science and
Information Resources (NISCAIR). The seeds were
used for DNA isolation.
2.2. DNA Isolation: The modified CTAB protocol
of Doyle and Doyle (1990) and purification kit
(HiPurA, India) were used to extract DNA from the
overnight soaked seeds.
2.2.1. Reagents and Solutions: CTAB extraction
buffer (2M Sodium Chloride, 100mM TrisHCl (pH
8), 20 mM EDTA) 0.2% β-mercaptoethanol,
Chloroform:Isoamylalcohol (24:1), absolute alcohol,
3M Potassium acetate, Isoamyl alcohol. All the
chemicals chemical were of analytic grade.
Enzymes (Taq polymerase, Bst polymerase and
RNAase A), Taq buffer, MgCl2 and dNTPs were
purchased from Bangalore Genei (Bangalore, India).
2.2.2. Protocol: In order to avoid surface
contamination, the seeds were washed with 0.2%
Cetrimide for 3 min, followed by treatment with
0.5% streptomycin sulphate and 0.5% bavistine for
5 min each. After these treatments the seeds were
rinsed with 70% alcohol for 1 min andfinally
washed with sterile double distilled water and kept
overnight. 1g seeds were pulverized to fine powder
by liquid nitrogen in a chilled mortar and pestle
followed by the addition of 100 mg of poly vinyl
pyrollidone (PVP, insoluble) and 10 ml pre-heated
CTAB buffer (containing 0.2 % β-mercaptoethanol).
The slurry was transferred into autoclaved 50 ml
centrifuge tube and incubated at 60oC for 1 hr. 10 ml
of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1)
was added to the centrifuge tubes and mixed
carefully for 15 min.
The content was centrifuged at 8000 rpm for
15 min. at 15oC. The upper phase was transferred
into new autoclaved centrifuge tubes. 10µl of
RNAase was added and the tubes were incubated at
37oC for 30 min. 10 ml of CHCl3: IAA (24:1) was
added carefully and the tubes were centrifuged at
8000 rpm for 15min at 15oC. The upper phase was
transferred again into autoclaved centrifuge tube and
0.5 vol. of 3M Potassium acetate (pH 5.2) was
added. For DNA precipitation equal volume of
chilled isopropanol (chilled absolute ethanol was
also used) was used and the tubes were kept at -20oC
for 2 hrs. It was recentrifuged at 8000 rpm for 15
min at 4oC. The supernatant was discarded and the
pellet was washed with 70% ethanol, air dried and
dissolved in 250 µl of sterile water. The DNA thus
obtained was purified by DNA purification
(HiPurA, India) kit according to manufacturer’s
instructions.
2.3. Polymerase Chain Reaction (PCR)
Amplification: The PCR was carried out in 20 µl
reaction volume containing 50ng DNA, 0.5 u/µl Taq
DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer
primers, 200 µM of each dNTPs, 2x Taq polymerase
buffer with minor changes as described by Shaik et
al. (2006). The final volume was made-up with
sterile MilliQ water. The amplifications were carried
out in DNA thermal cycler (Eppendorf, Germany).
The PCR amplification conditions for RAPD
consisted of initial step of denaturation at 94°C for 4
min, 35 cycles of denaturation at 94°C for 1 min,
annealing at 35°C for 1 min, extension at 72°C for 2
min, followed by final extension at 72°C for 10 min.
The amplified DNA was loaded on 1.2% agarose gel
in 0.5x TBE buffer containing 10 µl of EtBr
(10mg/ml) and photographed using gel
documentation system (UVP, Germany). Twenty
10-mer RAPD primer series OPAA, purchased from
Qiagen, USA and five (BG series) from Bangalore
Genei (India) were screened.
2.4. Gel purification, Cloning and sequencing of
RAPD amplified product: RAPD fragment was
excised from the gel with a sharp and sterile scalpel
to avoid any contamination. Elution of DNA from
agarose gel was carried out using MiniElute® kit
from Qiagen (USA) following manufacturer’s
instructions and the product was run on 1.2% gel
along with the Gene Rular DNA ladder, to check the
presence of the desired product. The eluted DNA
was ligated into pGEM®-T easy vector (Promega,
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 767
USA). Ligation reaction was carried out in 10μl
reaction containing 10x ligase buffer (5.0 μl),
pGEM®-T easy vector (0.5 μl), T4 DNA Ligase
(1.0 μl) and PCR product 3.0 μl) and the final
volume was set up with autoclaved Milli Q water.
Competent cells of E. coli DH5α were prepared by
CaCl2 method (Sambrook et al. 2001) and 5μl of the
ligation mixture was mixed with an aliquot of 100 μl
competent cells. The transformed cells were plated
on LB-X-gal/Amp plates and the recombinant
colonies were selected through blue-white
screening. The plasmid was isolated from the
positive bacterial colonies using plasmid isolation
kit (Qiagen, Germany). The cloned fragments were
sequenced using T7 primers through the centre for
Genomic Application, New Delhi, India.
2.5. Design of LAMP Oligonucleotides: A total set
of four LAMP primers were designed using Primer
Explorer V3
(http://primerexplorer.jp/elamp3.0.0/index.html) for
the specific detection of PCR product. The primer
set consisted of two outer (F3 and B3), and two
inner (FIP and BIP); the inner primers cover two
distinct sequences of the target (F1c/B1c and
F2c/B2c). Sequences of the LAMP primers are
given in table 1.
2.6. LAMP reaction: The LAMP reaction was
carried out in a 25 µl reaction volume containing
60pmol each of the primers FIP and BIP, 10 pmol
each of the outer primers F3 and B3, 8mM MgSO4,
1.4mM dNTPs, 0.8M betaine, 10 units of the Bst
DNA polymerase and 2 µl of DNA template. The
optimum temperature for the LAMP reaction was
60°C. 1μlSYBR Green-Ι dye was added at the end
of the reaction. Visual inspection for amplifications
was performed through observation of colour
change following addition of 1μl of SYBR Green I
(fluorescent dsDNA intercalating dye) to the tube.
3. RESULTS
RAPD reaction was performed in order to
find out unique specie specific monomorphic bands
present in all the samples, meant for LAMP
analysis. Twenty five 10-mer RAPD primers were
used of which six did not amplify the DNA. Each
RAPD reaction was repeated thrice and only
reproducible bands were taken in to account. A total
of 524RAPD bands (table 2) were obtained and to
develop the LAMP marker, we analyzed the
nucleotide sequences of 5 species-specific RAPD
amplicons, consisting of 5 DNA fragments for N.
saitva. From the resulting nucleotide sequences, one
unique RAPD amplicon from primer OPAA-9 has
been registered in the NCBI Gene Bank dbGSS, and
used to develop RAPD derived LAMP marker (Fig.
1). The specific amplicon of 600bp (fig.2) RAPD
fragment, specific for all the accessions of N. sativa,
was used for designing primers of LAMP reaction.
The reaction was carried out using genomic
DNA as a template to determine the optimal
temperature and reaction time and to evaluate the
use of primers. LAMP product formation was
detected at a temperature range of 60−64°C and
consequently, 60°C was considered to be the
optimal reaction temperature for the LAMP assay.
The tube containing the amplified products were
visualised in the presence of fluorescent
intercalating dye SYBR Green I under UV
transilluminator. In case of positive amplification,
the original colour of the dye was changed into
green that was judged under natural light as well as
under UV light (302 nm) with the help of UV
transilluminator. In case of negative control
(Catharanthus roseus) there was no amplification,
the original orange colour of the dye was retained
(Figure.3)
Figure.1. RAPD profile of Kalonji (N. sativa) representing specific band present in all accessions amplified with
OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1–K5 corresponds to the 5 accessions (K1-
Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- Dehradun-
Uttarakhand)
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 768
Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N. sativa used for development LAMP marker
Figure.3.Analysis of LAMP under UV light (A) and natural light (B). 1-5 accessions of Nigella sativa.(1- Kolkatta,
2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, C-
Negative control (Catharanthus roseus)
Table 1.Primer Sequences used in this study
Name sequence (5′ → 3′) Bases
F3 catttgccccgacggc 16
B3 cggctgctgtagaccga 17
FIP (F1c+F2) tcggccactgcactctgcgcgaggacaccctgctct 36
BIP (B1+B2c) tccgcctctgcctggaggaccacaggttctcgaagagc 38
Table 2.Number of amplified products generated by 20 arbitrary primers in 5 accessions of Kalonji (Nigella
sativa)
Primer code sequence (5′ → 3′) No. of amplification products Fragment size (kb)
OPAA -01 AGACGGCTCC 37 0.45-1.20
OPAA -02 GAGACCAGAC 31 0.3-1.15
OPAA -03 TTAGCGCCCC 29 0.3-1.20
OPAA -04 AGGACTGCTC 0 0
OPAA -05 GGCTTTAGCC 20 0.3-1.00
OPAA -06 TCAAGCTAAC 11 0.5-1.10
OPAA -07 CTACGCTCAC 24 0.2-1.20
OPAA -08 TCCGCAGTAG 29 0.4-1.40
OPAA -09 AGATGGGCAG 35 0.5-1.20
OPAA -10 TGGTCGGGTG 34 0.3-1.15
OPAA -11 ACCCGACCTG 32 0.35-1.10
OPAA -12 GGACCTCTTG 40 0.35-1.20
OPAA -13 GAGCGTCGCT 26 0.35-1.10
OPAA -14 AACGGGCCAA 14 0.5-1.00
OPAA -15 ACGGAAGCCC 14 0.3-1.20
OPAA -16 GGAACCCACA 33 0.3-1.20
OPAA -17 GAGCCCGACT 23 0.3-1.10
OPAA -18 TGGTCCAGCC 39 0.4-1.15
OPAA -19 TGAGGCGTGT 28 0.3-1.20
OPAA-20 TTGCCTTCGG 32 0.4-1.20
Total 524
gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga
ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca
gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa
cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct
tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct
acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac
ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 769
4. DISCUSSION
Correct identification of plants forming
the drug is a prerequisite and fundamental to
whole realm of medicine and science. Most of
the regularity guidelines and pharmacopoeia
recommend macro- and microscopic evaluation
and chemical analysis of botanical material for
quality and quantity control and standardization
(Anonymous, 1996). Morphological or
macroscopic identification of plant materials is
based on parameters like shape, size, texture,
colour, surface feature, odour, taste and other
organoleptic characters that are compared to
standard reference materials. Though this
method is simple and direct, its accuracy and
authenticity which are sometimes subjective,
depends on examiners.
Histological or microscopic
examinations are done to study comparative
microscopic inspection of broken as well as
powdered, crude, botanical materials to reveal
the characteristics of tissue structure and
arrangement of cells in different organs and
tissues. Chemical authentication establishes a
chemical composition of plant, which is used
for differentiation. The variation of chemical
composition may hinder the authentication, and
in some cases, may be misleading if the samples
are adulterated. Moreover, it is difficult to
distinguish closely related species due to similar
chemical compounds. Molecular or DNA-based
markers are now becoming a popular means for
the identification of medicinal plants (Yip,
2007).
Molecular markers have the advantage
over chemical markers as the genetic
composition is unique for each individual and is
least affected by age (Kumble, 2003),
environmental factors and physiological
conditions (Macbeath and Schreiber, 2000),
harvest, storage and processing of the samples
(Schweitzer, 2003). Molecular markers are not
stage and tissue specific and thus can be
detected at any stage of development. Ours is
the first attempt to characterize Kalongi using
LAMP markers. Although in earlier reports
RAPDs were used for the authentication
purpose (Rivera-Arce, 2007; Shinde, 2007;
Hammad and Qari 2010; Ganie, 2012),
however, these markers are very sensitive and
the big blow to these markers are
reproducibility problem. Therefore, in the
present study RAPDs were converted into
LAMP markers. These markers are very
specific and highly reproducible because these
markers could amplify a specific gene from the
whole genome discriminating a single
nucleotide difference (Parida, 2008). As the
reaction is carried out under optimal and
isothermal conditions, therefore, there are
negligible chances of inhibition reaction at the
later stage of amplification compared with the
PCR.
The results can be easily monitored by
checking the turbidity obtained from the
precipitate and most importantly the detection
of the desired gene could be completed in a
single step by incubating mixture of gene
sample, primers, DNA polymerase with strand
displacement activity and substrates at constant
temperature (Parida, 2008). In our study, the
amplification was not detected when the
concentration of the template was 0.3 ng,
however when the template concentration was
in the range of 0.8-1.5 ng, amplifications
occurred; therefore, it was thought that DNA
concentration of 0.8 ng is the detection limit in
N. sativa. Such type of results was also
observed in the studies of P. Ginseng (Sasaki,
2008) in which 0.5 ng of template was the
detection limit.
The optimized reaction parameters that
showed positive results were 10 ng template
DNA, 10pmol of outer primers (F3 and B3),
60pmol of each of forward internal and
backward outer primers (FIP and BIP), 20 mM
reaction buffer, 10 mmMgSO4, 0.8 M betaine
and 10 units of Bst DNA polymerase. The
optimum temperature for the reaction was set at
60°C, which is considered optimum for the
activity of Bst DNA polymerase. The use of
LAMP markers for the authentication of
medicinal plants, although is rare; however,
there are some recent reports in which the
technique has been successfully applied for the
identification purposes and some of which
include Curcuma longa (Sasaki and Nagumo;
2007), Panex ginseng (Sasaki, 2008),
Catharanthus roseus (Choudhry, 2011).
We have developed LAMP, a rapid,
highly sensitive, and specific method for the
authentication of N. sativa. The present study
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 770
could be applicable to identify N. Sativa to
differentiate the herb from the spurious and
adulterated drugs sold in the market in the name
of geniuine drugs. Efforts are in progress to
develop LAMP markers to medicinal plants in
order to provide accurate method for
authenticating the medicinal plants.
5. CONCLUSION
LAMP technology could be efficiently used to
characterize the medicinal plants like of N.
sativa. By analysing the genetic profiling it is
possible to identify the said drug; this
information could be employed for
identification of authenticN. sativa devising
from the spurious and adulterated drugs.
ACKNOWLEDGMENTS
This work was financed by the CCRUM,
AYUSH, Ministry of Health and Family
Welfare, Government of India.
REFERENCES
Anonymous, The Useful Plants of India. PID,
CSIR, 1996, New Delhi
Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The
effects of thymoquinone on blood lipids on rats,
Indian. J. Physio. Pharmacol, 46, 2002, 195-
201.
Chaudhary A.A, Hemant, Mohsin M, Ahmad A,
Application of loop-mediated isothermal
amplification (LAMP)-based technology for
authentication of Catharanthus roseus (L.) G.
Don. Protoplasma, 249, 2012, 417-422.
Chaudhry N.M.A, Tariq P, In-vitro anti
bacterial activities of Kalonji, Cumin and Poppy
Seed. Pak. J. Bot, 40, 2008, 461-467.
Doyle J.J, Doyle J.J, Isolation of plant DNA
from fresh tissue, Focus, 12, 1990, 13-15.
Dubey N.K, Kumar R, Tripathi P, Global
promotion of herbal medicine: India’s
opportunity. Curr. Sci. 86, 2004, 37-41.
Ganie S.H, Srivastava P.S, Narula A, Ali Z,
Sharma M.P., Authentication of shankhpushpi
by RAPD markers. Eurasia. J. Biosci, 6, 2012,
39-46.
Hammad I, Qari S.H, Genetic diversity among
Zygophyllum (Zygophyllaceae) populations
based on RAPD analysis. Genet. Mol. Res. 9,
2010, 2412-2420.
Kanter, M., Meral, I.,Dede, S., Effects of
Nigella sativa L. and Urticadioica L. on lipid
peroxidation, antioxidant enzyme systems and
some liver enzymes in CCl4-treated rats. J. Vet.
Med. Physiol. Pathol. Clin. Med. 50, 2003, 264-
268.
Khatoon, S., Mehrotra, S., Shome, U.,
Mehrotra, B.N., Analysis of commercial
Ratanjot; by TLC fluorescence fingerprinting.
Int. J. Pharmacol. 31, 1993, 269-277.
Kumble, K.D., Protien microarrays, new tools
for pharmaceutical development. Analyt. Bio.
Chem. 377, 2003, 812-819.
MacBeath, G., Schreiber, S.L., Printing proteins
as microarrays for high-throughput function
determination. Sci., 289, 2000, 1760-1763.
Paarakh, P.M., Nigella sativa Linn.- A
Comprehensive Review. Ind. J. Nat. Prod.
Resour. 1, 2010, 409-429.
Parida, M., Sannarangaiah, S., Dash, P.K., Rao,
P.V.L., Morita, K., Loop mediated isothermal
amplification (LAMP): a new generation of
innovative gene amplification technique;
perspectives in clinical diagnosis of infectious
diseases. Rev. Med. Virol. 18, 2008, 407-421.
Rivera-Arce, E., Gattuso, M., Alvarado, R.,
Zarate, E., Aguero, J., Feria, I., Lozoya, X.,
Pharmacognostical studies of the plant drug
Mimosa tenuifloraecortex. J. Ethnopharmaco.
113, 2007, 400-408.
Sasaki, Y., Komatsu, K., Nagumo, S., Rapid
detection of Panax ginseng by loop-mediated
isothermal amplification and its application to
authentication of Ginseng. Biol. Pharm. Bull,
31, 2008, 1806-1808.
Sasaki, Y., Nagumo, S., Rapid identification of
Curcuma longa and C. aromatic by LAMP.
Biol. Pharm. Bull, 30, 2007, 2229-2230.
Schweitzer, B., Predki, P., Synder, M.,
Microarrays to characterize protein interactions
on a whole-protoeme scale. Proteomics. 3,
2003, 190-199.
Shaik Y.B, Castellani M.L, Perrella A, Conti
F, Salini V, Tete S, Madhappan B, Vecchiet
J, De Lutiis M.A, Caraffa A, Cerulli G, Role of
quercetin (a natural herbal compound) in allergy
Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 771
and inflammation, J. Biol. Regul. Homeost.
Agents, 20(3-4), 2006, 47-52.
Shinde M, Dhalwal K, Mahadik K.R, Joshi,
K.S, Patwardhan B.K, RAPD Analysis for
Determination of Components in Herbal
Medicine, Evi. Based Complemen. Alterna.
Med, 4, 2007, 21-23.
Yip P.Y, Chau C.F, Mak C.Y, Kwan H.S, DNA
methods for identification of Chinese medicinal
materials, J. Chin. Med, 2, 2007, 1-19.
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 772
Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed
release tablets in QbD environment V Malleswari Bai*
1, M Prasada Rao
1, M Chandana
1, K Naga Harini
1, B Naga Deepthi
1, K Thirumala Devi
1,
P Lakashmana Rao1, Vinay U rao
2 and J Naga raja
1
1. Department o f Pharmaceuitical Analysis, Medarametla Anjamma Masthanrao College of Pharmacy, Narasarao
Pet, Guntur district, Andhra Pradesh, India.
2. Institutes of Pharmaceutical Sciences, Hyderabad-500049
*Corresponding author: E.Mail:[email protected]
ABSTRACT
Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release
tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide
the resistance of drug release in acidic environment of stomach and allow the drug to be released in
alkaline environment of the intestine. A large number of enteric polymers are available which provide
excellent protection to drug release in acidic environment. However, each polymer dissolves at different
alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH
6.5 and above. HPMC Phthalate P5.5 dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at
pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on
which enteric polymer is used to provide the delayed release. The aim of the current work was to
comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which
brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing
was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that brand 1 and 5 are equivalent to
each other while brands 2, 3 and 4 are equivalent to each other. Similarity factor f2 was used for
comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to
withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping
test. This indicates that patients may have to counsel not to concomitantly consume alcohol while on
Diclofenac sodium delayed release tablets.
Key words: Diclofenac sodium, Quality by design (QbD), Delayed release, Dissolution test
INTRODUCTION Quality by Design (QbD) is a concept first
outlined by well-known quality expert Joseph M
Juran in various publications, most notably Juran on
Quality by Design. Juran believed that quality could
be planned, and that most quality crises and problems
relate to the way in which quality was planned in the
first place. While Quality by Design principles has
been used to advance product and process quality in
every industry, and particularly the automation
industries, they have most recently been adopted by
the U.S Food and Drug administration (FDA) as a
vehicle for the transformation of how drugs are
discovered, developed, and commercially
manufactured (Juran, 1992).
MATERIALS AND METHODS
Development of a predictive dissolution method:
The effects of dissolution medium pH, stirring speed,
volume of the dissolution medium, type of apparatus
used were systemically evaluated to develop the
predictive dissolution method
Effect of dissolution medium: An initial attempt at
developing the discriminating dissolution method that
would be predictive of in vivo performance was made
using USP apparatus 2 .Effect of dissolution medium
pHof both the innovator product and the four brands
were subjected to dissolution testing using USP
apparatus 2 at 50 rpm in 900 mL of various media
including water, 0.1 N HCl, pH 5.5 phosphate buffer,
and pH 6.8 phosphate buffer. The drug release of the
marketed samples in comparison with the innovator at
different time intervals was obtained in all the
mediums. The similarity factor of the brands using
innovator product as the reference is calculated
Effect of dissolution medium volume: The drug
release of innovator products and all the marked
brands was evaluated using pH 1.2(0.1N HCl)
dissolution medium volumes of1000ml and 500ml.
The stirring speed was 50 rpm in each case. The drug
release profile of the marketed samples in comparison
with the innovator product at various time intervals
were obtained in all two volumes. The similarity
factor of the brands using innovator product as the
reference is calculated
Effect of stirring speed: Dissolution testing of all the
marketed samples and the innovator product was
conducted at25, 50, 75, and 100 rpm in 900 mL of pH
1.2(0.1NHCl) dissolution medium. The similarity
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 773
factor of the brands using innovator product as the
reference is calculated
Effect of type of dissolution apparatus: Dissolution
testing of all the marketed samples and the innovator
product was conducted using both USP1 (Basket) and
USP2 (Paddle) apparatus in 900ml of pH
1.2(0.1NHCl) dissolution medium. The drug release
profiles of all the marketed samples in comparison
with the innovator product at various time intervals
were obtained. The similarity factor of the brands
using innovator product as the reference is calculated
QbD development process includes:
Begin with the target product profile that
describes the use, safety and efficacy of the
product.
Defining a target quality profile that will be
used by formulators and process engineers as
a quantitative surrogate for aspects of clinical
safety and efficacy during product
development.
Gather relevant prior knowledge about the
substance, potential excipients and process
operation.
Design a formulation and identify the quality
attributes to the final product that must be
controlled to meet the target product quality
profile.
Design a manufacturing process to produce a
final product having this critical material
attributes.
Identify the critical process parameters and
raw material attributes that must be controlled
to achieve these critical material attributes of
the final product.
Establish a control strategy for the entire
process that may include input material
controls, process controls and monitors design
space around individual or multiple unit
operation and/ or final product tests.
Continually monitor and update the process to
assure consistent quality.
Quality by Design for drug release
Two primary aspects:
1. Clinical relevance of release and stability
specifications
2. Correlation between process parameters
and ability to achieve specifications (and
therefore remain clinically relevant)
Dissolution testing and drug release:
Dissolution testing has been widely used as
the primary tool to evaluate drug release
Dissolution is the process by which a solid
solute enters a solution, and is characterized
by rate (amount dissolved by time).
In the pharmaceutical industry, it may be
defined as the amount of drug substance that
goes into solution per unit time under
standardized conditions of liquid/solid
interface, temperature and solvent
composition.
Dissolution is the quality control measure and
potential to provide in sight into the in vivo
performance of the drug product.
In vitro release test that predicts the drug in
vivo would be optimal and highly desirable.
A variety of designs of apparatus for
dissolution testing have been proposed and
tested, varying from simple beaker with stirrer
to complex systems.
Different apparatus, procedures and
techniques are required for different dosage
forms because of significant differences in
formulation design and the physicochemical
properties of the drugs.
Dissolution tests have been developed for
various drug delivery systems including
immediate release solid dosage forms, several
controlled release solid dosage forms and
many novel and special dosage forms.
Most of the tests with recommended apparatus and
other specifications are now available as compendial
standards in Pharmacopoeias and are used in
pharmaceutical analysis and drug development for the
various drug delivery systems.
RESULTS AND DISCUSSION
Five brands of Diclofenac sodium delayed
release tablets 50 mg were procured from the market
and subjected to assay and comparative dissolution
profile testing as per USP guidelines for determining
in vitro equivalence of modified release products.
Assay of Diclofenac sodium delayed release tablets:
Twenty tablets were weighed and crushed using
mortar and pestle. Quantity of powder equivalent to
100 mg of Diclofenac sodium was weighed accurately
and transferred to 100 ml volumetric flask.
Approximately 70 ml of methanol AR grade was
added and syndicated for 15 minutes. The volume was
made up to 100 ml with methanol and filtered. From
the clear filtrate and aliquot equivalent to 100 ppm
was pipette out and transferred to 10 ml volumetric
flask. The volume was made up to 10 ml with
Methanol (10 µg/ml solution). The absorbance of this
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 774
solution was measured on UV spectrophotometer at
276 nm wavelength. The drug content was calculated
by simultaneously measuring the absorbance of a
standard 10 µg/ml solution of Diclofenac sodium. The
assay values for all five brands are given in Table 1.
Disintegration test for Enteric coated tablets (IP):
The DT test for enteric coated tablets as described in
IP was performed for 6 tablets of each brand and it
was observed that all brands pass this test
Comparative dissolution testing in 0.1N HCl: It is
mandatory for all delayed release products to show <
10% drug release in 0.1N HCl when in vitro
dissolution testing is performed for 2 hours in this
medium. The results for the dissolution testing of the
5 brands are given in Table 2 and shown in Figure.1.
All five brands passed the criteria of <10% in two
hours in pH 1.2 medium.
Comparative dissolution testing in pH 5.5: pH 5.5
simulates the duodenum and upper intestinal portion.
Comparative dissolution testing was conducted in pH
5.5 acetate buffer for 1 hour (Figure.2)
The dissolution profiles were statistically
compared by calculating the similarity factor (f2). The
f2 factor for brand 2, 3, 4 and 5 was calculated by
comparing with brand 1. Only brand 5 showed f2 >
50. Hence this may be considered as equivalent to
brand 1 for dissolution profile testing in pH 5.5. The
f2 factor for brand 1, 3, 4 and 5 was calculated by
comparing with brand 2. Brand 3 and 4 showed f2 >
50. Hence these may be considered as equivalent to
brand 2 for dissolution profile testing in pH 5.5. The
f2 factor for brand 1, 2, 4 and 5 was calculated by
comparing with brand 3. Brand 5 showed f2 > 50.
Hence this may be considered as equivalent to brand 3
for dissolution profile testing in pH 5.5. The f2 factor
for brand 1, 2, 3 and 5 was calculated by comparing
with brand 4. Brand 2 showed f2 > 50. Hence this may
be considered as equivalent to brand 4 for dissolution
profile testing in pH 5.5. The f2 factor for brand 1, 2,
3 and 4 was calculated by comparing with brand 5 as
standard. Only brand 1 showed f2 > 50. Hence this
may be considered as equivalent to brand 5 for
dissolution profile testing in pH 5.5.
Comparative dissolution testing in pH 6.0: pH 6.0
simulates the duodenum and upper intestinal portion.
Comparative dissolution testing was conducted in pH
6.0 Phosphate buffer for 1 hour. (Figure.3)
The dissolution profiles were statistically
compared by calculating the similarity factor (f2). The
f2 factor for brand 2, 3, 4 and 5 was calculated by
comparing with brand 1. Only brand 5 showed f2 >
50. Hence this may be considered as equivalent to
brand 1 for dissolution profile testing in pH 6.0. The
f2 factor for brand 1, 3, 4 and 5 was calculated by
comparing with brand 2. Brand 3 and 4 showed f2 >
50. Hence these may be considered as equivalent to
brand 2 for dissolution profile testing in pH 6.0. The
f2 factor for brand 1, 2, 4 and 5 was calculated by
comparing with brand 3. Brand 2 and 5 showed f2 >
50. Hence these may be considered as equivalent to
brand 3 for dissolution profile testing in pH 6.0. The
f2 factor for brand 1, 2, 3 and 5 was calculated by
comparing with brand 4. Brand 2 and 3 showed f2 >
50. Hence these may be considered as equivalent to
brand 4 for dissolution profile testing in pH 6.0. The
f2 factor for brand 1, 2, 3 and 4 was calculated by
comparing with brand 5. Brand 1 and 3 showed f2 >
50. Hence these may be considered as equivalent to
brand 5 for dissolution profile testing in pH 6.0.
Comparative dissolution testing in pH 6.8: pH 6.8
simulates the middle and lower portion of the gut.
Comparative dissolution testing was conducted in pH
6.0 Phosphate buffer for 1 hour. (Figure.4).
The dissolution profiles were statistically
compared by calculating the similarity factor (f2). The
f2 factor for brand 2, 3, 4 and 5 was calculated by
comparing with brand 1. Brand 2 and 4 showed f2 >
50. Hence these may be considered as equivalent to
brand 1 for dissolution profile testing in pH 6.8. The
f2 factor for brand 1, 3, 4 and 5 was calculated by
comparing with brand 2. Brand 3 and 4 showed f2 >
50. Hence these may be considered as equivalent to
brand 2 for dissolution profile testing in pH 6.8. The
f2 factor for brand 1, 2, 4 and 5 was calculated by
comparing with brand 3. Brand 1 and 5 showed f2 >
50. Hence these may be considered as equivalent to
brand 3 for dissolution profile testing in pH 6.8. The
f2 factor for brand 1, 2, 3 and 5 was calculated by
comparing with brand 4. Brand 2 and 5 showed f2 >
50. Hence these may be considered as equivalent to
brand 4 for dissolution profile testing in pH 6.8. The
f2 factor for brand 1, 2, 3 and 4 was calculated by
comparing with brand 5. Brand 1, 2 and 3 showed f2 >
50. Hence these may be considered as equivalent to
brand 5 for dissolution profile testing in pH 6.8.
The multimedia dissolution study indicates
that the differences in the rate and extent of
dissolution between different brands are significantly
more at pH 5.5 and pH 6 than at pH 6.8. This may
most likely be due to the fact that each brand may
have been coated with enteric materials of different
chemistries having different solubility profiles in
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 775
alkaline pH. For e.g. the reported solubility of
Eudragit L100 is pH 6 and above while that of
Eudragit L100-55 is pH 5.5 and above. Consequently,
tablets coated with L-100-55 will show significantly
faster and more complete dissolution at pH 5.5 as
compared to Eudragit L-100. All pH dependent
enteric polymers completely dissolve at pH 6.8 and
above. Hence the difference between the brands is
significantly reduced in case of dissolution profile
testing in pH 6.8 buffer.
In order to simulate the way the dosage form is
exposed to pH change in vivo, dissolution profile
testing for all brands was conducted by using the in
situ pH change method. The in situ pH change method
of dissolution testing indicates that all five brands
achieve > 80% release within 30 minutes of reaching
the pH 6.8. However, dissolution profiles for Brand 1
and brand 5 are significantly faster at pH 6 than those
of brands 2, 3 and 4. Hence, from this study it may be
predicted that Brands 1 and 5 may show therapeutic
equivalence to each other while brands 2, 3 and 4 may
be equivalent to each other. But brand 1 and 5 may
not show therapeutic equivalence to brands 2, 3 and
4.(Figure.7).
Alcohol dumping study: For modified release
products, different types of polymers are used to get
the same kind of effect. Each of these polymers has
different solubility profiles in commonly used
solvents. The probability that this may affect the
intended release profile in vivo is very genuine if we
consider that patients may consume alcohol when
under treatment with modified release products. The
solubility profile of the polymer in alcohol may
adversely affect the release rate of the drug from the
dosage form and the actual drug release may be
entirely different from the intended release.
Hence, the US FDA in its latest guidelines has
mandated that the alcohol dumping studies should be
carried out for modified release products in order to
demonstrate that the dosage form is able to perform
within its specified standards even in presence e of
significant levels of alcohol. For the five marketed
brands of Diclofenac sodium delayed release tablets, a
comparative alcohol dumping study was performed in
0.1N HCl without alcohol, and 0.1N HCl with 5%,
10% 20% and 40% v/v of alcohol respectively. The
dissolution profile testing was carried out for two
hours. The study indicates that only Brand 1 is able to
maintain the enteric effect of < 10% release in acidic
pH even in presence of 40% alcohol. All other brands
fail the alcohol dumping test at 40% level of alcohol.
Brand 2 fails the test even at 10% and 20% level of
alcohol. (Figure.8).
Table.1. Assay values for all five Brands of Diclofenac sodium 50 mg delayed release tablets BRANDS Brand 1 Brand 2 Brand 3 Brand 4 Brand 5
% Assay 98.76 99.27 97.54 98.04 97.56
Table.2.Comparative dissolution profile testing in 0.1N Hcl Time Brand1 Brand2 Brand3 Brand4 Brand5
0 0 0 0 0 0
30 2.78 1.45 2.87 2.87 1.56
45 5.8 3.55 4.07 3.09 2.34
60 7.9 5.07 6.27 4.13 4.09
120 9.17 6.17 6.59 5.87 4.35
Figure.1. Dissolution profiles for 5 brands of Diclofenac
sodium delayed release tablets in 0.1N HCl
Figure.2.Comparative dissolution profile of five brands in
ph 5.5
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 773
Figure.3.Comparative Dissolution Profile In Ph 6.0
Phosphate Buffer
Figure.4.Comparative Dissolution Profile In Ph 6.8
Phosphate Buffer
Figure.5. Comparative Dissolution Profile In Ph 6.0
Phosphate Buffer
Figure.6.Comparative Dissolution Profile In Ph 6.8
Phosphate Buffer
Figure.7. Dissolution profile by in situ ph change method Figure.8.Alcohol Dumping study for Diclofenac sodium
delayed release tablets market brands
SUMMARY AND CONCLUSION
Diclofenac sodium tablets are available as
delayed release tablets in the market. Delayed release
tablets are typically produced by coating the tablet
with enteric coating polymers. These polymers
provide the resistance of drug release in acidic
environment of stomach and allow the drug to be
released in alkaline environment of the intestine. A
large number of enteric polymers are available which
provide excellent protection to drug release in acidic
environment. However, each polymer dissolves at
different alkaline pH. For e.g. Eudragit L-100
dissolves at pH 6 and above while Eudragit S-100
dissolves at pH 6.5 and above. HPMC Phthalate P5.5
dissolves at pH 5.5 and above while HPMC Phthalate
P dissolves at pH 6 and above. Hence, for the same
drug the bioavailability can subtly but significantly
change based on which enteric polymer is used to
provide the delayed release.
The aim of the current work was to
comparatively evaluate five brands of Diclofenac
sodium enteric coated tablets and determine which
brands may be equivalent to each other based on in
vitro testing. Comparative dissolution profile testing
was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It
was determined that Brand 1 and 5 are equivalent to
each other while brands 2, 3 and 4 are equivalent to
Page 776
Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 773
each other. Similarity factor f2 was used for
comparing the dissolution profiles.
Alcohol dumping studies indicated that only
brand 1 was able to withstand the enteric effect at
40% level of alcohol. All other marketed brands fail
the alcohol dumping test. This indicates that patients
may have to counsel not to concomitantly consume
alcohol while on Diclofenac sodium delayed release
tablets.
ACKNOWLEDGEMENT
The authors are grateful thanks to Indian
Pharmaceutical Sciences, Arabindo pharma lim,
EMCO industries-hyd, FMC-US, Ashaland specialty
chemicals-US for providing gift samples of
Diclofenac Sodium.
REFFERECES
1. Juran JM, Juran on Quality by Design, The Free
Press, A Division of Macmillan, Inc., New York,
1992, 407-425
2. Kearney PM, Baigent C, Godwin J, Halls H,
Emberson JR, Patrono C: Do selective cyclo-
oxygenase-2 inhibitors and traditional non-steroidal
anti-inflammatory drugs increase the risk of
atherothrombosis? Meta-analysis of randomised trials,
BMJ, 3, 2006, 1302
3. Solomon DH, Avorn J, Sturmer T, Glynn RJ,
Mogun H, Schneeweiss S: Cardiovascular outcomes
in new users of coxibs and Nonsteroidal anti-
inflammatory drugs: high-risk subgroups and time
course of risk, Arthritis Rheum, 54(5), 2006, 1378-
89.
4. FitzGerald GA, Patrono C, The coxibs, selective
inhibitors of cyclooxygenase-2, N Engl J Med, 345(6),
2001, 433-42.
5. Graham DJ: COX-2 inhibitors, other NSAIDs, and
cardiovascular risk: the seduction of common sense,
JAMA, 296(13), 2006, 1653-6.
6. Brater DC, Renal effects of cyclooxygyenase-2-
selective inhibitors, J Pain Symptom Manage, 23(4
Suppl), 2002, 15-20.
7. Sigma Aldrich Gan TJ: Diclofenac: an update on its
mechanism of action and safety profile, Curr Med
Res Opin, 26(7), 2010, 1715-31.
Page 777
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 778
Development and validation of a stability indicating HPLC method for analysis of
Altretamine in bulk drug and pharmaceutical formulations M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao
*
V.V. Institute of Pharmaceutical Sciences, Gudlavalleru, Andhra Pradesh, India. *Corresponding author: E-mail: [email protected]
ABSTRACT
A simple, sensitive and accurate stability indicating HPLC method has been developed and
validated for determination of Altretamine in its bulk form and pharmaceutical formulations.
Chromatographic separation was achieved on a Hypersil BDS C18 column (100 mm x 4.6 mm I.D.,
particle size 5 µm) by a mobile phase consisted of phosphate buffer and acetonitrile (90:10, v/v) with
apparent pH of 3.1±0.5 and a flow rate of 1.0 mL/min. The detection wave length was set at 227 nm. An
excellent linearity was observed for Altretamine in the concentration range of 25-150 µg/mL with a
correlation coefficient of 0.999. The retention time was 2.533 min. The percentage assay of Altretamine
was 99.98%. The method developed was validated for accuracy, precision, linearity, ruggedness,
robustness, solution stability, selectivity and forced degradation studies like acidic, alkaline, oxidative,
thermal, hydrolytic and photolytic stress conditions were performed as per ICH guidelines. The results
demonstrated that the method would have a great value when applied in quality control and stability
studies of Altretamine.
Key Words: HPLC, Altretamine, Stability, Formulation.
INTRODUCTION
Altretamine (Figure 1) is a synthetic cytotoxic
antineoplastic agent (Neil, 2006). Chemically it is
N,N,N',N',N'',N''-hexamethyl-1,3,5-triazine-2,4,6-
triamine. Altretamine is indicated for use as a single
agent in the palliative treatment of patients with
persistent or recurrent ovarian cancer following first-
line therapy with a cisplatin and/or alkylating agent-
based combination (Wiernik, 1992). Altretamine is
structurally related to the alkylating agents. Its precise
mechanism of action is unknown but hydroxy methyl
intermediates in the metabolism process are possibly
the reactive species, and may act as alkylating agents
(Rhoda, 1995). Altretamine interferes with the growth
of cancer cells and slows their growth and spread in
the body.
Literature survey revealed that few HPLC
methods (Ghiorghis, 1991; Barker, 1994) were
reported for the determination of Altretamine. But no
stability indicating HPLC method was reported.
Hence the objective of this method is to develop and
validate a simple, rapid and accurate stability
indicating HPLC method (Snyder, 1997) in
accordance with ICH guidelines (ICH Q2(R1), 2005;
ICH Q1A(R2), 2003) for the determination of
Altretamine in bulk sample and its pharmaceutical
formulations.
MATERIALS AND METHODS
Chemicals and solvents: The working standard
of Altretamine was provided as gift sample from
Spectrum Labs, Hyderabad, India. The market
formulation CANTRET capsules (Altretamine 50
mg) were procured from local market. HPLC
grade acetonitrile and water were purchased from
E.Merck (India) Ltd, Mumbai, India. Potassium
dihydrogen phosphate, orthophosphoric acid and
triethylamine of AR grade were obtained from
S.D. Fine Chemicals Ltd, Mumbai, India.
Instrumentation: To develop a high
performance liquid chromatographic method for
quantitative determination of Altretamine using
Waters HPLC system on Hypersil BDS C18
column (100 mm x 4.6 mm I.D., particle size 5
µm) was used. The instrument is equipped with
an auto sampler and UV detector. A 10 μL
rheodyne injector port was used for injecting the
samples. Data was analyzed by using Empower 2
software.
Chromatographic conditions: A mixture of
phosphate buffer pH 3.1 and acetonitrile (90:10,
v/v) was found to be the most suitable mobile
phase for ideal chromatographic separation of
Altretamine. The solvent mixture was filtered
through 0.45 μ membrane filter and sonicated
before use. It was pumped through the column at
a flow rate of 1.0 mL/min. Injection volume was
10 µL and the column was maintained at a
temperature of 300C. The column was
equilibrated by pumping the mobile phase
through the column for at least 30 minutes prior
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 779
to the injection of the drug solution. The detection
of the drug was monitored at 227 nm. The run
time was set at 6 minutes.
Preparation of phosphate buffer pH 3.1: 2.72
grams of potassium dihydrogen phosphate was
weighed and transferred into a 1000 mL beaker
and dissolved. 1 mL of triethylamine solution was
added to the above solution and diluted to 1000
mL with HPLC water. pH was adjusted to 3.1
with orthophosphoric acid solution.
Preparation of mobile phase and diluent: 900
mL of phosphate buffer was mixed with 100 mL
of acetonitrile and was used as mobile phase. The
solution was degassed in an ultrasonic water bath
for 5 minutes and filtered through 0.45 µ filter
under vacuum. The mixture of 800 mL of water
and 200 mL of acetonitrile was used as diluent.
Preparation of standard solution: 10 mg of
Altretamine was accurately weighed, transferred
to 10 mL volumetric flask and is dissolved in 7
mL of the diluent. Sonicated the solution for few
minutes to dissolve the drug completely. Then it
is filtered through 0.45 μ filter and the volume is
made up to 10 mL with diluent to get a
concentration of 1 mg/mL stock solution. Further
pipetted 1.0 mL of the above stock solution into a
10 mL volumetric flask and diluted up to the
mark with diluent to obtain required
concentrations.
Preparation of sample solution: Twenty
commercial capsules were emptied and
powdered. A quantity of the powder equivalent to
10 mg of Altretamine was accurately weighed,
transferred to 10 mL volumetric flask and is
dissolved in 7 mL of the diluent. Sonicated the
solution for few minutes to dissolve the drug
completely. Then it is filtered through 0.45 μ
filter and the volume is made up to 10 mL with
diluent to get a concentration of 1 mg/mL stock
solution. Further pipetted 1.0 mL of the above
stock solution into a 10 mL volumetric flask and
diluted up to the mark with diluent to obtain
required concentrations of Altretamine in
pharmaceutical dosage forms. Inject 10 µL of the
above solution into the HPLC system. All
experiments were conducted in triplicate.
Linearity: Several aliquots of standard solution
of Altretamine was taken in different 10 mL
volumetric flasks and diluted up to the mark with
diluent such that the final concentrations of
Altretamine were in the linearity range of 25-150
µg/mL. Evaluation of the drug was performed
with UV detector at 227 nm, peak area was
recorded for all the peaks. The response for the
drug was linear and the regression equation was
found to be y=19094x-10685 and correlation
coefficient value of Altretamine was found to be
0.999. The results show that an excellent
correlation exists between peak area and
concentration of drug within the concentration
range indicated.
Limit of detection and limit of quantification:
The limit of detection (LOD) and limit of
quantification (LOQ) of the developed method
were determined by injecting progressively low
concentrations of the standard solution using the
developed HPLC method. The LOD and LOQ for
Altretamine were found to be 0.46 μg/mL and
1.39 μg/mL respectively.
System suitability: System suitability parameters
like retention time, theoretical plates and tailing
factor were calculated and compared with
standard values.
Accuracy: The accuracy of the method was
assessed by recovery study of Altretamine in the
dosage form at three concentration levels. A fixed
amount of preanalyzed sample was taken and
standard drug was added at 50%, 100% and 150%
levels. The standard concentration was fixed as
100 μg/mL and three concentration levels of 50
μg/mL, 100 μg/mL and 150 μg/mL were added to
the standard concentration. Each level was
repeated three times. The content of Altretamine
per capsule was calculated. The percentage
recovery ranges from 99.62-100.27% and the
mean recovery of Altretamine was 99.92% and
the recovery values of Altretamine indicate the
method is accurate.
Precision: The precision was determined for
Altretamine in terms of system and method
precision. For system precision evaluation,
%RSD for Altretamine was 0.32% (limit %RSD
< 2.0%). In addition, the method precision was
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 780
studied and the %RSD for Altretamine was
0.77% (limit %RSD < 2.0%).
Ruggedness and robustness: The ruggedness of
the method was determined by carrying out the
experiment on different instruments by different
operators using different columns of similar
types. Robustness of the method was determined
by making slight changes in the chromatographic
conditions like changes in flow rate and mobile
phase composition. It was observed that there
were no marked changes in the chromatograms,
which demonstrated that the HPLC method so
developed is rugged and robust.
Solution stability: The stability of solution under
study was established by keeping the solution at
room temperature for 24 hrs. The result showed
no significant change in concentration and thus
confirms the stability of the drug in the mobile
phase used for the analysis.
Analysis of the marketed formulations: The
proposed method was applied for the
determination of Altretamine in pharmaceutical
formulatons of Altretamine capsules. 10 µL of
each standard and sample solution were injected
and from the peak area of Altretamine, amount of
drug present in samples were computed. The
result of assay undertaken yielded 99.98% of
label claim of Altretamine. The assay obtained is
more than 99% and no interference of impurity
peak observed in Altretamine peak.
Acidic degradation s tudies: To 1 mL of stock
solution of Altretamine, 1 mL of 2N hydrochloric
acid was added and refluxed for 30 mins at 600C.
The resultant solution was diluted to obtain 100
µg/mL solution and 10 µL solution were injected
into the system and the chromatograms were
recorded to assess the stability of sample.
Alkaline degradation s tudies: To 1 mL of
stock solution of Altretamine, 1 mL of 2N
sodium hydroxide was added and refluxed for
30 mins at 600C. The resultant solution was
diluted to obtain 100 µg/mL solution and 10 µL
solution were injected into the system and the
chromatograms were recorded to assess the
stability of sample.
Oxidative degradation studies: To 1 mL of
stock solution of Altretamine, 1 mL of 20%
hydrogen peroxide (H2O2) was added separately.
The solutions were kept for 30 mins at 600C.
The resultant solution was diluted to obtain
100 µg/mL solution and 10 µL solution were
injected into the system and the chromatograms
were recorded to assess the stability of sample.
Thermal degradation s tudies: The standard
Al t re t amine solution was placed in oven at
1050C for 6 hrs to study thermal degradation.
The resultant solution was diluted to obtain 100
µg/mL solution and 10 µL solution were
injected into the system and the chromatograms
were recorded to assess the stability of the
sample.
Hydrolytic degradation s tudies: Stress testing
under hydrolytic conditions was studied by
refluxing the s t a n d a r d A l t r e t a m i n e
s o l u t i o n in water for 6 h r s at a temperature
of 60ºC. The resultant solution was diluted to
obtain 100 µg/mL solution and 10 µL solution
were injected into the system and the
chromatograms were recorded to assess the
stability of the sample.
Photolytic degradation studies: The photolytic
stability of the drug Altretamine was studied by
exposing the standard Altretamine solution to UV
light by keeping the beaker in UV chamber for 7
days or 200 Watt hours/m2
in photo stability
chamber. The resultant solution was diluted to
obtain 100 µg/mL solution and 10 µL solution
were injected into the system and the
chromatograms were recorded to assess the
stability of sample.
RESULTS AND DISCUSSION
In the present work, a simple, accurate
and precise stability indicating HPLC method has
been optimized, developed and validated for the
determination of Altretamine in pharmaceutical
formulations with UV detector by using Hypersil
BDS C18 column (100 mm x 4.6 mm I.D.,
particle size 5 µm) in isocratic mode with mobile
phase composition of phosphate buffer pH 3.1:
acetonitrile (90:10, v/v) and pH adjusted to 3.1
with orthophosphoric acid. The use of phosphate
buffer and acetonitrile in the ratio of 90:10, v/v
resulted in peak with good shape and resolution.
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 781
The flow rate was 1.0 mL/min and the drug
component was measured with UV detector at
227 nm. The results of optimized HPLC
conditions were shown in Table 1.
The method was linear in the range of 25-
150 µg/mL for Altretamine with correlation
coefficient of 0.999. The linearity results were
shown in Table 2 and the linearity curve of
Altretamine was shown in Figure 2. The %
recoveries of Altretamine were found in the range
of 99.62-100.27% and the % mean recovery was
found to be 99.92% for Altretamine, which
indicate the method is accurate. The results of
recovery studies were shown in Table 3. The
%RSD for system precision and method precision
for Altretamine were found to be 0.32 and 0.77,
which indicate the method is precise. The results
of precision studies were shown in Table 4 and
Table 5. The retention time of Altretamine was
2.533 min, cuts down on overall time of sample
analysis and the method was more cost effective
as it utilizes very less quantity of mobile phase.
The number of theoretical plates was 4253 and
tailing factor was 1.49 for Altretamine, which
indicates efficient performance of the column.
Typical chromatogram of drug Altretamine was
shown in Figure 3.
Selectivity of the method was
demonstrated by the absence of any interfering
peaks at the retention time of the drug. The
limit of detection and limit of quantification for
Altretamine were found to be 0.46 μg/mL and
1.39 μg/mL, which indicate the sensitivity of
the method. A system suitability test was
performed to evaluate the chromatographic
parameters and the summary of system
suitability parameters were shown in Table 6.
Validated method was applied for the
determination of Altretamine in commercial
formulations. The % assay was found to be
99.98% for Altretamine and the assay results
were shown in Table 7.
HPLC studies of Altretamine under
different stress conditions indicated the following
degradation behavior. In acidic degradation, the
degradation product of Altretamine was appeared
at retention time of 2.522 min and the %
degradation is 9.08%. In alkaline degradation, the
degradation product of Altretamine was appeared
at retention time of 2.522 min and the %
degradation is 6.96%. In oxidative degradation,
the degradation product of Altretamine was
appeared at retention time of 2.504 min and the %
degradation is 7.40%. In thermal degradation, the
degradation product of Altretamine was appeared
at retention time of 2.498 min and the %
degradation is 5.27%. In hydrolytic degradation,
the degradation product of Altretamine was
appeared at retention time of 2.503 min and the %
degradation is 0.21%. In photolytic degradation,
the degradation product of Altretamine was
appeared at retention time of 2.498 min and the %
degradation is 1.05%. The results of analysis are
given in Table 8. The typical chromatograms of
degradation behavior of Altretamine in different
stress conditions are shown in Figure 4 to Figure
9.
Figure.1. Molecular structure of Altretamine
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 782
Figure.2. Calibration curve of Altretamine
Figure.3. Typical chromatogram of Altretamine
Figure.4. Acidic degradation chromatogram of Altretamine
Figure.5. Alkaline degradation chromatogram of Altretamine
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 783
Figure.6. Oxidative degradation chromatogram of Altretamine
Figure.7. Thermal degradation chromatogram of Altretamine
Figure.8. Hydrolytic degradation chromatogram of Altretamine
Figure.9. Photolytic degradation chromatogram of Altretamine
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 784
Table.1. Optimized chromatographic conditions of Altretamine
Parameter Condition
Mobile phase Phosphate buffer:acetonitrile (90:10, v/v)
pH 3.1±0.5
Diluent Water:acetonitrile (80:20, v/v)
Column Hypersil BDS C18 column (100 mm x 4.6 mm, 5 μm)
Column temperature 300C
Wave length 227 nm
Injection volume 10 µL
Flow rate 1.0 mL/min
Run time 6 min
Table.2. Linearity results of Altretamine
Concentration (μg/mL) Area
25 450417
50 968416
75 1393682
100 1884563
125 2406916
150 2845543
Table.3. Recovery results of Altretamine
Level Concentration
added (μg/mL)
Concentration
found (μg/mL) % Recovery Mean recovery
50% 50 49.81 99.62%
99.92% 100% 100 99.88 99.88%
150% 150 150.42 100.27%
Table.4. System precision data of Altretamine Table.5. Method precision data of Altretamine
S. No. Area of Altretamine
1 1889572
2 1891733
3 1888707
4 1883428
5 1894047
Average 1891566
SD 6188.9
%RSD 0.32
S. No. Area of Altretamine
1 1903347
2 1883489
3 1880659
4 1911086
5 1879578
6 1907331
Average 1894248
SD 14512.7
%RSD 0.77
Table.6. System suitability parameters of Altretamine
Parameter Results
Linearity range (μg/mL) 25-150
Correlation coefficient 0.999
Theoretical plates (N) 4253
Tailing factor 1.49
LOD (μg/mL) 0.46
LOQ (μg/mL) 1.39
Retention time (min) 2.533
Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 785
Table.7. Assay results of Altretamine
Formulation Label claim Amount found %Assay
CANTRET 50 mg 49.99 mg 99.98%
Table.8. Degradation studies of Altretamine
Stress conditions Degradation
time
Area of
peak
%
Degradation
% of active drug present
after degradation
Standard Drug - 1891733 - -
Acidic 30 mins 1720141 9.08% 90.92%
Alkaline 30 mins 1760088 6.96% 93.04%
Oxidative 30 mins 1751783 7.40% 92.60%
Thermal 6 hours 1792116 5.27% 94.73%
Hydrolytic 6 hours 1887905 0.21% 99.79%
Photolytic 7 days 1872031 1.05% 98.95%
CONCLUSION
The present study represents the first report
that deals with the development of a stability
indicating HPLC method for determination of
Altretamine. This study is a typical example for
development of a stability indicating assay established
by following the recommendations of ICH guidelines.
The proposed method showed acceptable accuracy,
precision, selectivity and wide linear concentration
range. The results of analysis proved that the method
is suitable for the determination of Altretamine in bulk
and capsule dosage forms without any interference
from the degradation products and it is recommended
for routine quality control analysis of the Altretamine
in pharmaceutical formulations.
REFERENCES
Barker IK, Crawford SM and Fell AF, Determination
of Altretamine in human plasma with high-
performance liquid chromatography, Journal of Liquid
Chromatography B, 660(1), 1994, 121-126.
Ghiorghis A and Talebian AH, High-pressure liquid
chromatography separation of potential impurities of
Altretamine, Journal of Liquid Chromatography,
14(12), 1991, 2331-2349.
ICH Harmonised Tripartite Guideline, Stability
Testing of New Drug Substances and Products,
Q1A(R2), International Conference on
Harmonization, 2003, 1-18.
ICH Harmonised Tripartite Guideline, Validation of
analytical procedures: Text and methodology, Q2(R1),
International Conference on Harmonization, 2005, 1-
13.
Neil OJM, The Merck Index, An Encyclopedia of
Chemicals Drug and Biologicals, 14th Ed., Merck
Research Laboratories, Division of Merck and Co.
Inc., White House Station, NJ, 2006, 57.
Rhoda LC and Diana F, Altretamine: A review of its
pharmacodynamic and pharmacokinetic properties
and therapeutic potential in cancer chemotherapy,
Drugs, 49(6), 1995, 932-953.
Snyder LR, Kirkland JJ and Glajch JL, Practical
HPLC Method Development, 2nd
Ed., New York, John
Wiley and Sons, 1997, 184-185.
Wiernik PH, Hexamethylmelamine and low or
moderate dose cisplatin with or without pyridoxine for
treatment of advanced ovarian carcinoma: a study of
the eastern cooperative oncology group, Cancer
Investigation, 10(1), 1992, 1-9.
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 786
A review of various analytical methods on Atrovastatin
N.Delhiraj*, P.Ashok,U.Ravikiran,P.Abhinandhana
Department of pharmaceutical analysis, A.S.N Pharmacy College, Tenali, Andhra Pradesh
*Corresponding author E.Mail:[email protected]
ABSTRACT
There is a review of analytical methods for atorvastatin, such as spectrophotometry, derivative
spectrophotometry and various chromatographic procedures such as, high-performance liquid
chromatography (HPLC), high-performance thin-layer chromatography (HPTLC), and liquid
chromatography tandem mass spectrometry (LC-MS). This review is based on representative publications
that were published between 2000 and 2013.
Key Words: hypolipideamic drugs, HMG-COA analysis, review, spectrophotometry, chromatography
INTRODUCTION
Atorvastatin is the most efficacious and best
tolerated hypolipideamic drugs introduced in
1980.They competitively inhibit conversion of 3-
hydroxy 3-methyl glutaryl coenzyme and (HMG-
COA) to mevalonate Atorvastatin is the most
efficacious and best tolerated hypolipideamic drugs.
They competitively inhibit conversion of 3-hydroxy 3-
methyl glutaryl coenzyme and (HMG-COA) to
mevalonate (rate limiting step in cholesterol (CH)
synthesis) by the HMG-COA reductase. Therapeutic
doses reduce cholesterol synthesis by 20-50%. This
results in compensatory increases in Low density
lipoprotein (LDL) receptor expression on liver cell
leads to increased receptor mediated uptake and
catabolism of Intermediate density lipoprotein (IDL)
and LDL. Over long term feedback induction of
HMG-COA reductase tends to increase CH synthesis
but a steady is finally attained with a dose dependent
lowering of LDL-CH levels. The daily dose of
Atorvastatin for lowering LDL-CH levels by 30-35%
is 10 mg. Morever at their maximum recommended
doses atorvastatin can reduce CH up to 45-55%.5. The
more efficacious atrovastatin given at their higher
doses effectively reduce Triglycerides (TGs) (by 25-
35%) when they are moderately raised but not when
they are markedly raised. Because HMG-COA
reductase activity is maximum at midnight, statins are
administered at bed time to obtain maximum
effectiveness. All statins except rosuvastatin are
metabolized primarily by CYP3A4. Inhibitors and
inducers of this isoenzyme respectively increase and
decrease statin blood levels. (Tripathi,KD 2008)
Chromatographic and spectrophotometric
methods: A novel, precise, accurate and rapid
isocratic reversed-phase high performance liquid
chromatographic/ultraviolet (RP-HPLC/UV)
method was developed, optimized and validated
for simultaneous determination of rosuvastatin
and atorvastatin in human serum using naproxen
sodium as an internal standard. Effect of different
experimental parameters and various particulate
columns on the analysis of these analytes was
evaluated. The method showed adequate
separation for rosuvastatin and atorvastatin and
best resolution was achieved with Brownlee
analytical C18 column (150×4.6 mm, 5 μm) using
methanol-water (68:32, v/v; pH adjusted to 3.0
with trifluoroacetic acid) as a mobile phase at a
flow rate of 1.5 ml/min and wavelength of 241
nm. The calibration curves were linear over the
concentration ranges of 2.0-256 ng/ml for
rosuvastatin and 3.0-384 ng/ml for atorvastatin.
The lower limit of detection (LLOD) and lower
limit of quantification (LLOQ) for rosuvastatin
were 0.6 and 2.0 ng/ml while for atorvastatin
were 1.0 and 3.0ng/ml, respectively. All the
analytes were separated in less than 7.0 min. The
proposed method could be applied for routine
laboratory analysis of rosuvastatin and
atorvastatin in human serum samples,
pharmaceutical formulations, drug-drug
interaction studies and pharmacokinetics studies.
(Shah Y, 2011)
Two simple and accurate methods to
determine atorvastatin calcium and ramipril in
capsule dosage forms were developed and
validated using HPLC and HPTLC. The HPLC
separation was achieved on a Phenomenex Luna
C18 column (250 x 4.6 mm id, 5 microm) in the
isocratic mode using 0.1% phosphoric acid-
acetonitrile (38 + 62, v/v), pH 3.5 +/- 0.05,
mobile phase at a flow rate of 1 ml/min. The
retention times were 6.42 and 2.86 min for
atorvastatin calcium and ramipril, respectively.
Quantification was achieved with a photodiode
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 787
array detector set at 210 nm over the
concentration range of 0.5-5 µg/ml for each, with
mean recoveries (at three concentration levels) of
100.06 +/- 0.49% and 99.95 +/- 0.63% RSD for
atorvastatin calcium and ramipril, respectively.
The HPTLC separation was achieved on silica gel
60 F254 HPTLC plates using methanol-benzene-
glacial acetic acid (19.6 + 80.0 + 0.4, v/v/v) as the
mobile phase. The Rf values were 0.40 and 0.20
for atorvastatin calcium and ramipril,
respectively. Quantification was achieved with
UV densitometry at 210 nm over the
concentration range of 50-500 ng/spot for each,
with mean recoveries (at three concentration
levels) of 99.98 +/- 0.75% and 99.87 +/- 0.83%
RSD for atorvastatin calcium and ramipril,
respectively. Both methods were validated
according to International Conference on
Harmonization guidelines and found to be simple,
specific, accurate, precise, and robust. The mean
assay percentages for atorvastatin calcium and
ramipril were 99.90 and 99.55% for HPLC and
99.91 and 99.47% for HPTLC, respectively. The
methods were successfully applied for the
determination of atorvastatin calcium and
ramipril in capsule dosage forms without any
interference from common excipients. (Panchal
HJ, 2010)
Charged aerosol detector (CAD) detection
approach was applied in a new HPLC method for
the determination of three of the major statins
used in clinical treatment-simvastatin, lovastain
and atorvastatin. The method was optimized and
the influence of individual parameters on CAD
response and sensitivity was carefully studied.
Chromatography was performed on a Zorbax
Eclipse XDB C18 (4.6 mm x 75 mm, 3.5
microm), using acetonitrile and formic acid 0.1%
as mobile phase. The detection was performed
using both charged aerosol detector (CAD) (20
pA range) and diode array detector-238
nm(DAD) simultaneously connected in series. In
terms of linearity, precision and accuracy, the
method was validated using tablets containing
atorvastatin and simvastatin. The CAD is
designated to be a non-linear detector in a wide
dynamic range, however, in this application and
in the tested concentration range its response was
found to be perfectly linear. The limits of
quantitation (0.1 µg/ml) were found to be two
times lower than those of UV detection. (Patil
UP, 2010)
A simple, specific, accurate and precise
high-performance thin-layer chromatographic
method for analysis of Telmisartan and
Atorvastatin calcium in fixed dose combination
has been developed. The method uses aluminium
plates coated with silica gel 60 F254 as stationary
phase and toluene: methanol (7: 3, v/v) as mobile
phase. Densitometric evaluation of the separated
bands was performed at 280 nm. The two drugs
were satisfactorily resolved with RF values 0.50
± 0.01 and 0.29 ± 0.00 for Telmisartan and
Atorvastatin calcium, respectively. The respective
calibration plots were found to be linear over the
range 200–1000 and 200–700 ng/band for
Telmisartan and Atorvastatin calcium,
respectively. This method has been successfully
validated and applied for the analysis of drugs in
pharmaceutical formulation. (Novakova, 2009)
A number of analytical methods were
reported for the estimation of atorvastatin and
ramipril from their individual dosage forms or in
combination with other drugs (Valiyare, 2004;
Vachareau and Neirinck, 2000). Here successful
reverse phase-high performance liquid
chromatographic method and spectroscopic
methods were developed then validated for the
analysis of combined dosage form of atorvastatin
and ramipril. Individual lambda-max for
atorvastatin is 247 nm and that of ramipril is 208
nm. They intersect at 215 nm which is fixed as
wavelength for reverse phase-high performance
liquid chromatographic method. (Joseph, 2008)
A simple, accurate and precise high-
performance thin-layer chromatographic method
has been developed for the estimation of
Atorvastatin Calcium and Metoprolol Tartarate
simultaneously from a capsule dosage form. The
method employed Silica gel 60F254 precoated
plates as stationary phase and a mixture of
Chloroform: Methanol: Glacial acetic acid (dil.)
(9:1.5:0.2 ml %v/v) as mobile phase.
Densitometric scanning was performed at 220 nm
using Camag TLC scanner 3. The method was
linear in the drug concentrations' range of 500 to
2500 ng/spot for Atorvastatin Calcium, also for
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 788
Metoprolol Tartarate with correlation coefficient
of 0.984 for Atorvastatin Calcium and 0.995 for
Metoprolol Tartarate respectively. The retention
factor for Atorvastatin Calcium was 0.45 ± 0.04
and for Metoprolol Tartarate was 0.25 ± 0.02.
The method was validated as per ICH
(International Conference on Harmonization)
Guidelines, proving its utility in estimation of
Atorvastatin Calcium and Metoprolol Tartarate in
combined dosage form. (Patole SM, 2011)
A rapid high performance liquid
chromatographic method was developed and
validated for determination of atorvastatin in
pharmaceutical dosage forms, and for evaluation
of its stability in the solid phase. Separation of
atorvastatin was successfully achieved on a C-18
column utilizing water--acetonitrile at the
volumetric ratio of 48:52, adjusted to pH 2.0 with
80% ortho-phosphoric acid. The detection
wavelength was 245 nm. The method was
validated and the response was found to be linear
in the drug concentration range of 0.04 mg/mol -
0.4 mg/mol. The mean values percentage relative
standard deviation+/- (RSD) of the slope and the
correlation coefficient were 8.192 +/- 0.260 and
0.999, respectively. The RSD values for intra-
and interday precision were < 1.00% and 0.90%,
respectively. The degradation kinetic of
atorvastatin at 363 K in a relative humidity of
76.4% was observed to be autocatalytic first order
reaction. The kinetic parameters were as follows:
k (where k represents the velocity constant; s (-1)
= (1.42 +/- 0.19) 10(-6); t (0.5) (where t (0.5)
represents the time needed for a 50% decay of
atorvastatin; days) = 32.82 +/- 0.9; t (0.1) (where
t (0.1) represents the time needed for a 10%
decay of atorvastatin; days) = 13.86 +/- 0.8.
(Stains B, 2006)
A simple, precise and accurate reversed-
phase liquid chromatographic method has been
developed for the simultaneous estimation of
atorvastatin calcium and telmisartan in tablet
formulations .The chromatographic separation
was achieved on (Waters symmetry C18, 250mm
x 4.6mm, 5μ) analytical column. A mixture of
ammonium acetate (0.02M, pH 4.0 adjusted with
glacial acetic acid) and acetonitrile in ratio (40:60
v/v) at flow rate of 1.0ml/min and detector
wavelength 254 nm. The retention time of
atorvastatin calcium and telmisartan was found to
be 4.6 and 6.1 minutes respectively. The
validation of the proposed method was carried out
for its specificity, linearity, accuracy, precision,
limit of detection and quantification for both
atorvastatin calcium and telmisartan. The
developed method can be used for routine quality
analysis of titled drugs in combination in tablet
formulation (Suresh Kumar GV, 2010).
A simple, specific, accurate and stability
indicating reversed phase high performance liquid
chromatographic method was developed for the
simultaneous determination of atorvastatin
calcium and amlodipine besylate in tablet dosage
forms. A Phenomenex Gemini C-18, 5 mm
column having 250´4.6 mm i.d. in isocratic mode,
with mobile phase containing 0.02 M potassium
dihydrogen phosphate:acetonitrile:methanol
(30:10:60, v/v/v) adjusted to pH 4 using ortho
phosphoric acid was used. The flow rate was 1.0
ml/min and effluents were monitored at 240 nm.
The retention times of atorvastatin calcium and
amlodipine besylate were 11.6 min and 4.5 min,
respectively. The calibration curves were linear in
the concentration range of 0.08-20 µg/ml for
atorvastatin calcium and 0.1-20 µg/ml for
amlodipine besylate. Atorvastatin calcium and
amlodipine besylate stock solutions were
subjected to acid and alkali hydrolysis, chemical
oxidation and dry heat degradation. The degraded
product peaks were well resolved from the pure
drug peak with significant difference in their
retention time values. The proposed method was
validated and successfully applied to the
estimation of atorvastatin calcium and amlodipine
besylate in combined tablet dosage forms (Shah
D.A, 2008)
A reverse phase high performance liquid
chromatographic method was developed for the
simultaneous estimation of atorvastatin calcium
and fenofibrate in tablet formulation. The
separation was achieved by Luna C18 column
and methanol: acetate buffer pH 3.7 (82:18 v/v)
as mobile phase, at a flow rate of 1.5 ml/min.
Detection was carried out at 248 nm. Retention
time of atorvastatin calcium and fenofibrate was
found to be 3.02+0.1 and 9.05+0.2 min,
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 789
respectively. The method has been validated for
linearity, accuracy and precision. Linearity for
atorvastatin calcium and Fenofibrate were in the
range of 1-5 μg/ml and 16-80 μg/ml, respectively.
The mean recoveries obtained for Atorvastatin
calcium and fenofibrate were 101.76% and
100.06%, respectively. Developed method was
found to be accurate, precise, selective and rapid
for simultaneous estimation of atorvastatin
calcium and fenofibrate in tablets. (Jain N, 2008)
An isocratic RP-HPLC method was
developed and validated for the quantitation of
Atorvastatincalcium and Amlodipine besylate in
combined tablet dosage forms. Quantitation was
achieved using a reversed-phase Hypersil silica
BDS (250x4.6mm with 5+ particle size) column
at ambient temperature with mobile phase
consisting of 0.05M ammonium acetate buffer
(pH-4) and acetonitrilein the ratio (40 + 60, v/v).
The flow rate was 1.0 ml/min. Measurements
were made at a wavelength of 240.0nm. The
proposed method was validated for selectivity,
precision, linearity and accuracy. The assay
method was found to be linear from 30.0-
70.0µg/ml for Amlodipine besylate and 60.0-
140.0 µg/ml for Atorvastatin calcium. All
validation parameters were within the acceptable
range. The developed method was successfully
applied to estimate the amount of Atorvastatin
calcium and Amlodipine besylate in combined
dosage forms. (Mishra P, 2007)
A stability indicating UPLC method was
developed and validated for the simultaneous
determination of atorvastatin, fenofibrate and
their impurities in tablets. The chromatographic
separation was performed on acquity UPLC BEH
C18 column (1.7 microm, 2.1 mmx100 mm)
using gradient elution of acetonitrile and
ammonium acetate buffer (pH 4.7; 0.01 M) at
flow rate of 0.5 ml/min. UV detection was
performed at 247 nm. Total run time was 3 min
within which main compounds and six other
known and major unknown impurities were
separated. Stability indicating capability was
established by forced degradation experiments
and separation of known degradation products.
The method was validated for accuracy,
repeatability, reproducibility and robustness.
Linearity, loss of drying (LOD) and loss of
quality (LOQ) was established. (Kadav AA,
2008)
A simple, accurate, rapid and precise
isocratic reversed-phase high-performance liquid
chromatographic method has been developed and
validated for simultaneous determination of
aspirin, atorvastatin calcium and clopidogrel
bisulphate in capsules. The chromatographic
separation was carried out on an Inertsil ODS
analytical column (150×4.6 mm; 5 μm) with a
mixture of acetonitrile: phosphate buffer pH 3.0
adjusted with o-phosphoric acid (50:50, v/v) as
mobile phase; at a flow rate of 1.2 ml/min. UV
detection was performed at 235 nm. The retention
times were 1.89, 6.6 and 19.8 min. for aspirin,
atorvastatin calcium and clopidogrel bisulphate,
respectively. Calibration plots were linear (r 2
>0.998) over the concentration range 5-30 μg/ml
for atorvastatin calcium and 30-105 μg/ml for
aspirin and clopidogrel bisulphate. The method
was validated for accuracy, precision, specificity,
linearity, and sensitivity. The proposed method
was successfully used for quantitative analysis of
capsules. No interference from any component of
pharmaceutical dosage form was observed.
Validation studies revealed that method is
specific, rapid, reliable, and reproducible. The
high recovery and low relative standard deviation
confirm the suitability of the method for routine
determination of aspirin, atorvastatin calcium and
clopidogrel bisulphate in bulk drug and capsule
dosage form. (Londhe SV, 2011)
A UV spectrophotometric method was
developed for the estimation of atorvastatin
calcium & fenofibrate in table dosage form by
using simultaneous equation method. The drug
obeyed Beer’s law & showed good correlation
near to 0.999. Absorption maxima of atorvastatin
calcium & fenofibrate were found to be at 246
and 286nm respectively. Beer’s law was obeyed
in concentration rang of 1-10 μg/ml for
atorvastatin calcium & 2-20μg/ml for fenofibrate.
The method has been validated for linearity,
accuracy & precision. The recovery was more
than 99%. The developed method was found to be
accurate, simple, precise, economical, and
selective for simultaneous estimation of
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 790
atorvastatin calcium &fenofibrate in tablet dosage
form. &fenofibrate in tablet dosage form. (Rupali
Hiravr, 2010)
A UV spectrophotometric method using
simultaneous equation was developed for the
simultaneous determination of Telmisartan and
Atorvastatin calcium in a binary mixture. In the
proposed method, the signals were measured at
296.0 nm and 247.0 nm corresponding to
absorbance maxima of Telmisartan and
Atorvastatin Calcium in methanol respectively.
Linearity range was observed in the concentration
range of 5-30 µg/ml for both the drugs.
Concentration of each drug was obtained by using
the absorptivity values calculated for both drugs
at two wavelengths, 296.0 nm and 247.0 nm and
solving the simultaneous equation. Developed
method was applied to laboratory mixture and its
pharmaceutical formulation. The method was
validated statistically and recovery study was
performed to confirm the accuracy of the method.
(Chaudhari KU, 2010)
Atorvastatin calcium(ATC) is the active
pharmaceutical ingredient (API) of the best
selling lipid-lowering formulation Lipitor.
Twelve ATC crystal forms are known and several
pharmaceutical companies are developing or have
developed generic drug formulations based on
different ATC polymorphs. The strong overlap of
the X-ray diffraction patterns (XRD) of the
polymorphs with the respective patterns of the
excipients, the presence of small API quantities in
the tablet and the similarity of the crystal phase
VIII XRD pattern used in the tablet examined in
this work to that of phases IV and IX made
identification difficult. Quantitative determination
of Atorvastatin was attempted using Raman
spectroscopy (RS), IR spectroscopy and X-ray
powder diffraction. It was found that RS
exhibited lower detection limit and a calibration
model was constructed. Its application on
commercial ATC tablets with 40mg strength
yielded an error of 1.25%. (Skoda D, 2008)
The aim of the proposed work was to
develop and validate a simple and sensitive assay
for the analysis of atorvastatin, ortho- and Para-
hydroxy-ATC, ATC lactone, and ortho- and Para-
hydroxy-ATC lactone in human plasma using
liquid chromatography tandem mass
spectrometry. All six analytes and corresponding
deuterium (d5)-labeled internal standards were
extracted from 50 μL of human plasma by protein
precipitation. The chromatographic separation of
analytes was achieved using a Zorbax-SB Phenyl
column (2.1 mm×100 mm, 3.5 μm). The mobile
phase consisted of a gradient mixture of 0.1% v/v
glacial acetic acid in10% v/v methanol in water
(solvent A) and 40% v/v methanol in acetonitrile
(solvent B). All analytes including ortho- and
Para-hydroxy metabolites were baseline separated
within 7.0 min using a flow rate of 0.35 ml/min.
Mass spectrometry detection was carried out in
positive electro spray ionization mode, with
multiple reactions monitoring scan. The
calibration curves for all analytes were linear
(R2≥0.9975, n=3) over the concentration range of
0.05–100 ng/ml and with lower limit of
quantitation of 0.05 ng/ml Mean extraction
recoveries ranged between 88.6–111%. Intra- and
inter-run mean percent accuracy was between 85–
115% and percent imprecision was≤15%.
Stability studies revealed that ATV acid and
lactone forms were stable in plasma during bench
top (6 h on ice-water slurry), at the end of three
successive freeze and thaw cycles and at −80 °C
for 3 months. The method was successfully
applied in a clinical study to determine
concentrations of ATV and its metabolites over12
h post-dose in patients receiving atorvastatin.
(Macwan JS, 2011)
A rapid, simple, sensitive and specific
LC-MS/MS method has been developed and
validated for the simultaneous estimation of
atorvastatin, amlodipine, ramipril and benazepril
using nevirapine as an internal standard. The
API-4000 LC-MS/MS was operated under the
multiple-reaction monitoring mode using electro
spray ionization. Analytes and IS were extracted
from plasma by simple liquid-liquid extraction
technique using ethyl acetate. The reconstituted
samples were chromatographed on C 18 column
by pumping 0.1% formic acid-acetonitrile (15:85,
v/v) at a flow rate of 1 ml/min. A detailed
validation of the method was performed as per
the FDA guidelines and the standard curves were
found to be linear in the range of 0.26-210 ng/ml
for ATO; 0.05-20.5 ng/ml for amlodipine( AML);
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 791
0.25-208 ng/ml for RAM and 0.74-607 ng/ml
mean correlation coefficient of ≥0.99 for each
analyte. The intra-day and inter-day precision and
accuracy results were well within the acceptable
limits. A run time of 2.5 min for each sample
made it possible to analyze more than 400 human
plasma samples per day. The developed assay
method was successfully applied to a
pharmacokinetic study in human male volunteers.
(Pilli NR, 2011)
CONCLUSION
This review is targeted at out lining the
various analytical methods and other related
aspects of atorvastatin it is however pertinent to
state that newer analytical methods are being
developed with respect to advancing technology
and this may necessitate a future review.
REFERENCES
Bisulphate in Capsules, Indian J Pharm Sci,
73(1), 2011, 23-9.
Chaudhari KU P.D. Gaikwad, V.H. Bankar and
S.P. Pawar, Development and validation of uv-
spectrophotometric method for simultaneous
estimation of telmisartan and atorvastatin calcium
in bulk and tablet dosage form,
Inj.Jour.PharmTech, 2(1), 2010, 255-264.
Jain N, Raghuwanshi R, Jain D.
Development and Validation of RP-
HPLC method for simultaneous
estimation of Atorvastatin Calcium and
Fenofibrate in tablet dosage forms,
Indian J Pharm Sci, 70, 2008, 263-5.
Joseph L, George M, Rao B VR, Simultaneous
estimation of atorvastatin and ramipril by RP-
HPLC and spectroscopy, Pak J Pharm Sci, 21(3),
2008, 282-4.
Kadav AA, Vora DN. Stability indicating UPLC
method for simultaneous determination of
atorvastatin, fenofibrate and their degradation
products in tablets, J Pharm Biomed Anal, 48(1),
2008, 120-6.
Londhe SV, Deshmukh RS, Mulgund SV, Jain
KS, Development and Validation of a Reversed-
phase HPLC Method for Simultaneous
Determination of Aspirin, Atorvastatin Calcium
and Clopidogrel
Macwan JS, Ionita IA, Dostalek M, Akhlaghi F.
Development and validation of a sensitive,
simple, and rapid method for simultaneous
quantitation of atorvastatin and its acid and
lactone metabolites by liquid chromatography-
tandem mass spectrometry (LC-MS/MS), Anal
Bioanal Chem, 400(2), 2011, 423-33.
Mishra P Alkagupta and K. Shah, Simultaneous
estimation of atorvastatin calcium and amlodipine
besylate from tablets, Indian journal of
pharmaceutical sciences, 69(6), 2007, 831-833.
Nováková L, Lopéz SA, Solichová D, Satínský
D, Kulichová B, Horna A, Solich P, Comparison
of UV and charged aerosol detection approach in
pharmaceutical analysis of statins, Talanta, 78(3),
2009, 834-9.
Panchal HJ, Suhagia BN, Simultaneous
determination of atorvastatin calcium and
ramipril in capsule dosage forms by high-
performance liquid chromatography and high-
performance thin layer chromatography, J AOAC
Int, 93(5), 2010, 1450-7.
Patil UP S. V. Gandhi M. R. Sengar, V. S.
Rajmane A, Validated densitometric method for
analysis of telmisartan and atorvastatin calcium in
fixed dose combination, J. Chil. Chem. Soc.,
55,2010,94-96.
Patole S, Khodke A, Potale L, Damle M, A
validated densitometric method for analysis of
atorvastatin calcium and Metoprolol Tartarate as
bulk drugs and in combined capsule dosage
forms, J Young Pharm, 3(1), 2011, 55-9.
Pilli NR, Inamadugu JK, Mullangi R, Karra VK,
Vaidya JR, Rao JV, Simultaneous determination
of atorvastatin, amlodipine, ramipril and
benazepril in human plasma by LC-MS/MS and
its application to a human pharmacokinetic study,
Biomed Chromatogr, 25(4), 2011, 439-49.
Rupali Hirave, Ravindra Bendagude, Manish
Kondawar, RP-HPLC method for simultaneous
estimation of Atorvastatin Calcium and
Fenofibrate in tablet dosage forms, Journal of
Pharmacy Research, 3(10), 2010, 2400-2401
Delhi Raj et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 792
Shah DA, K.K Bhatt, R.S Mehta, S.L Baldania
and T.R Gandhi, Stability indicating RP HPLC
estimation of atorvastatin calcium and amlodipine
besylate in pharmaceutical formulations. Indian
journal of pharmaceutical sciences, 70(6), 2008,
754-760.
Shah Y, Iqbal Z, Ahmad L, Khan A, Khan MI,
Nazir S, Nasir F, Simultaneous determination of
rosuvastatin and atorvastatin in human serum
using RP-HPLC/UV detection: method
development, validation and optimization of
various experimental parameters, J Chromatogr B
Analyt Technol Biomed Life Sci, 879(9-10),
2011, 557-63
Skoda D, Kontoyannis CG, Identification and
quantitative determination of atorvastatin calcium
polymorph in tablets using FT-Raman
spectroscopy, Talanta, 74(4), 2008, 1066-70.
Stanisz B, Kania L, Validation of HPLC method
for determination of atorvastatin in tablets and for
monitoring stability in solid phase, Acta Pol
Pharm, 63(6), 2006, 471-6.
Suresh Kumar GV, Rajendraprasad Y,
Chandrashekar SM, Development and validation
of reversed-phase HPLC method for simultaneous
estimation of Atorvastatin calcium and
Telmisartan in tablet dosage form, International
Journal of Pharma Tech Research, 2(1), 2010,
463-470.
Tripathi KD, Essentials of medical
pharmacology, sixth edition, Jaypee publication,
2008, 614-615.
Praveen and Ranadheer Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 793
A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of
testicular cancer Praveen D*, Ranadheer Chowdary P
School of Pharmaceutical Sciences, Vels University
*Corresponding author: Email.id: [email protected], +919940510419
ABSTRACT
Combination chemotherapy with vinblastine plus bleomycin in disseminated testicular cancer was
pioneered by Samuels and represented a major therapeutic advance (Samuels ML, 1976). Another
milestone in the chemotherapy of testicular cancer was the discovery of the activity of cis-diammine
dichloro platinum (CDDP) in germinal neoplasm. Complete response rates between 60-80% have been
reported for patients with advanced disease and the vast majority of these patients are cured of their
disease as the relapse rates are less than 15% (Robert F, 1983). This discovery has led to a new and better
chemotherapeutic combination in the treatment of testicular cancer. For the first time, in a random
prospective cooperative group clinical trial evaluating the effectiveness of three Chemotherapy
combinations in the treatment of a solid tumor, in which the dose of one drug is the only treatment
variable, a clear-cut relationship has been shown for dose of therapy, not only with response and survival,
but with an increased potential for cure as well. Their plasma half-lives, pharmacokinetic parameters,
toxicities, adverse drug effects were also evaluated in various studies. This combination have been proved
better than Bleomycin-cisplatin-etoposide as the former combination masks the toxic effects of bleomycin
such as mucositis etc. Thus we conclude that this combination is a safer one with a good therapeutic
efficacy and reduced toxicity.
Key Words: Combination chemotherapy, bleomycin, cisplatin, testicular cancer
INTRODUCTION
Testicular cancer is a cancer that develops in
the testicles, a part of the male reproductive system.
Testicular cancer has one of the highest cure rates of
all cancers: a five-year survival rate in excess of 90 %
overall, and almost 100 % if it has not spread
(metastasized). Even for the relatively few cases in
which malignant cancer has spread widely,
modern chemotherapy offers a cure rate of at least
80%. One of the first signs of testicular cancer is often
a lump or swelling in the testes. The three basic types
of treatment are surgery, radiation therapy,
and chemotherapy. Surgery is performed
by urologists; radiation therapy is administered
by radiation oncologists; and chemotherapy is the
work of medical oncologists. In most patients with
testicular cancer, the disease is cured readily with
minimal long-term morbidity. While treatment
success depends on the stage, the average survival rate
after five years is around 95%, and stage 1 cancers
cases (if monitored properly) have essentially a 100%
survival rate (which is why prompt action, when
testicular cancer is a possibility, is extremely
important)
Testicular cancer: Testicular cancer is a disease in
which cells become malignant (cancerous) in one or
both testicles. The testicles (also called testes or
gonads) are a pair of male sex glands. They produce
and store sperm and are the main source of
testosterone (male hormones) in men. These hormones
control the development of the reproductive organs
and other male physical characteristics. The testicles
are located under the penis in a sac-like pouch called
the scrotum. Based on the characteristics of the cells
in the tumor, testicular cancers are classified as
seminomas or nonseminomas. Other types of cancer
that arise in the testicles are rare and are not described
here. Seminomas may be one of three types: classic,
anaplastic, or spermatocytic. Types of nonseminomas
include choriocarcinoma, embryonal carcinoma,
teratoma, and yolk sac tumors. Testicular tumors may
contain both seminoma and nonseminoma cells.
Epidemiology: Testicular cancer accounts for only
1% of all cancers in men in the United States. About
8,000 men are diagnosed with testicular cancer, and
about 390 men die of this disease each year. Testicular
cancer occurs most often in men between the ages of
20 and 39, and is the most common form of cancer in
men between the ages of 15 and 34. It is most
common in white men, especially those of
Scandinavian descent. The testicular cancer rate has
more than doubled among white men in the past 40
years, but has only recently begun to increase among
black men. The reason for the racial differences in
incidence is not known.
Risk Factors:
Undescended testicle (cryptorchidism): Normally,
the testicles descend from inside the abdomen into the
Praveen and Ranadheer Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 794
scrotum before birth. The risk of testicular cancer is
increased in males with a testicle that does not move
down into the scrotum. This risk does not change even
after surgery to move the testicle into the scrotum.
The increased risk applies to both testicles.
Congenital abnormalities: Men born with
abnormalities of the testicles, penis, or kidneys, as
well as those with inguinal hernia (hernia in the groin
area, where the thigh meets the abdomen), may be at
increased risk.
History of testicular cancer: Men who have had
testicular cancer are at increased risk of developing
cancer in the other testicle.
Family history of testicular cancer: The risk for
testicular cancer is greater in men whose brother or
father has had the disease.
Symptoms: Common symptoms are painless lump or
swelling in a testicle, pain or discomfort in a testicle
or in the scrotum, any enlargement of a testicle or
change in the way it feels, a feeling of heaviness in the
scrotum, a dull ache in the lower abdomen, back, or
groin, a sudden collection of fluid in the scrotum.
Diagnosis: Blood tests that measure the levels of
tumour markers. Tumour markers are substances often
found in higher-than-normal amounts when cancer is
present. Tumour markers such as alpha-fetoprotein
(AFP), Beta-human chorionic gonadotropin (HCG),
and lactate dehydrogenase (LDH) may suggest the
presence of a testicular tumor, even if it is too small to
be detected by physical exams or imaging tests.
Ultrasound: A test in which high-frequency sound
waves are bounced off internal organs and tissues.
Their echoes produce a picture called a sonogram.
Ultrasound of the scrotum can show the presence and
size of a mass in the testicle. It is also helpful in ruling
out other conditions, such as swelling due to infection
or a collection of fluid unrelated to cancer.
Biopsy: Biopsy (microscopic examination of
testicular tissue by a pathologist) to determine whether
cancer is present. In nearly all cases of suspected
cancer, the entire affected testicle is removed through
an incision in the groin. This procedure is called
radical inguinal orchiectomy.
Treatment: Chemotherapy is the use of anticancer
drugs to kill cancer cells. When chemotherapy is
given to testicular cancer patients, it is usually given
as adjuvant therapy (after surgery) to destroy
cancerous cells that may remain in the body.
Chemotherapy may also be the initial treatment if the
cancer is advanced; that is, if it has spread outside the
testicle at the time of the diagnosis. Most anticancer
drugs are given by injection into a vein.
Chemotherapy is a systemic therapy, meaning drugs
travel through the bloodstream and affect normal as
well as cancerous cells throughout the body. The side
effects depend largely on the specific drugs and the
doses. Common side effects include nausea, hair loss,
fatigue, diarrhea, vomiting, fever, chills,
coughing/shortness of breath, mouth sores, or skin
rash. Other side effects include dizziness, numbness,
loss of reflexes, or difficulty hearing. Some anticancer
drugs also interfere with sperm production. Although
the reduction in sperm count is permanent for some
patients, many others recover their fertility. Some men
with advanced or recurrent testicular cancer may
undergo treatment with very high doses of
chemotherapy. These high doses of chemotherapy kill
cancer cells, but they also destroy the bone marrow,
which makes and stores blood cells. Such treatment
can be given only if patients undergo a bone marrow
transplant. In a transplant, bone marrow stem cells are
removed from the patient before chemotherapy is
administered. These cells are frozen temporarily and
then thawed and returned to the patient through a
needle (like a blood transfusion) after the high-dose
chemotherapy has been administered.
Combination therapy: Bleomycin is a
glycopeptide antibiotic with a unique mechanism of
antitumor activity. The drug binds to guanosine-
cytosine-rich portions of DNA via association of the
"S" tripeptide and by partial intercalation of the
bithiazole rings. A group of five nitrogen atoms
arranged in a square-pyramidal conformation binds
divalent metals including iron, the active ligand, and
copper, an inactive ligand. Molecular oxygen, bound
by the iron, can produce highly reactive free radicals
and Fe(III). The free radicals produce DNA single-
strand breaks at 3'-4' bonds in deoxyribose. This
yields free base propenals, especially of thymine:
cytotoxicity is cell-cycle-phase specific for G2 phase.
In humans, bleomycin is rapidly eliminated primarily
by renal excretion. This accounts for approximately
half of a dose. In patients with renal compromise or
extensive prior cisplatin therapy, the drug half-life can
extend from 2 to 4 hours up to 21 hours. Thus, dose
adjustments are needed when creatinine clearance is
less than or equal to 3N mL/min (Dorr RT, 1992).
Platinum complexes are clinically used as adjuvant
therapy of cancers aiming to induce tumor cell death.
Depending on cell type and concentration, cisplatin
induces cytotoxicity, e.g., by interference with
transcription and/or DNA replication mechanisms.
Additionally, cisplatin damages tumors via induction
Praveen and Ranadheer Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 795
of apoptosis, mediated by the activation of various
signal transduction pathways, including calcium
signalling, death receptor signalling, and the
activation of mitochondrial pathways. Unfortunately,
neither cytotoxicity nor apoptosis are exclusively
induced in cancer cells, thus, cisplatin might also lead
to diverse side-effects such as neuro- and/or renal-
toxicity or bone marrow-suppression. Moreover, the
binding of cisplatin to proteins and enzymes may
modulate its biochemical mechanism of action ( Ana-
Maria Florea 2011).
There are two high affinity vinblastine-
binding sites per mole of embryonic chick brain
tubulin (KA = 3-5 X 10(5) l./mol). Binding to these
sites was rapid, and relatively independent of
temperature between 37 and 0degreeC. Vincristin
sulfate and desacetylvinblastine sulfate, two other
active vinca alkaloid derivatives, competitively
inhibited the binding of vinblastine. The inhibition
constant for vincristine was 1.7 X 10(-5) M; and for
desacetylvinblastine, 2 X 10(-5) M. The vinblastine
binding activity of tubulin decayed upon aging, but
this property was not studied in detail. Vinblastine did
not depolymerize stable sea urchin sperm tail outer
doublet microtubules, nor did it bind to these
microtubules (Wilson L , 1975). Since 1974, with the
introduction of platinum-based combination
chemotherapy, the complete response rate of patients
with metastatic germ cell neoplasms of the testis has
improved from 10%-30% to 50%-75%. Furthermore,
a significant proportion of patients entering complete
remission are relapse free after 2 years, and may be
considered cured of their disease. Important
prognostic factors predicting for complete response
include initial performance status, tumor histology,
and tumor burden at presentation.
Numerous in vivo studies of antitumor agents
exposed to a variety of transplantable experimental
tumors have indicated a steep dose-response and dose-
toxicity. These observations apply to both cell cycle
specific as well as non-cell-specific agents. In tumors
composed of a heterogenous cell population with both
drug-sensitive and drug-resistant subpopulations the
dose response curve is modified, depending on the
ratio of resistant to sensitive fraction. While there are
few prospective randomized clinical trials addressing
dose as a treatment variable, there appears to be a
confirmation of the fore mentioned concepts in
Hodgkin's and certain non-Hodgkin's lymphoma,
acute lymphocytic leukaemia, and oat cell carcinoma
of the lung, all regarded as chemotherapy-"sensitive"
turners (Michael K, 1984). Previous clinical trials in
testicular cancer incorporating cisplatin (DDP) have
employed either “high-dose’’ (100- 120 mg/m2) or
“low dose” (75 mg/m2) schedules without a clear
definition of dose response testicular cancer is
regarded as a “sensitive” tumor, the Southwest
Oncology Group (SWOG) initiated, in 1978, a
prospective randomized Phase III comparative trial in
which the primary objective was to determine whether
a high dose of DDP (cisplatin) when combined with
vinblastine and bleomycin resulted in a superior
response and survival experience than a lower dose of
DDP with the same combination of vinblastine and
bleomycin (Lawrence H Einhorn, 1980).
CONCLUSION
Platinum, vinblastine, bleomycin combination
chemotherapy consistently produces 70% complete
remissions, and a further 10% of patients will be
rendered disease free following surgical excision of
residual disease. For the first time, in a random
prospective cooperative group clinical trial evaluating
the effectiveness of two chemotherapy combinations
in the treatment of a solid tumour, in which the dose
of one drug is the only treatment variable, a clear-cut
relationship has been shown for dose of therapy, not
only with response and survival, but with an increased
potential for cure as well. Historically, testicular
cancer was one of the first malignancies of non-
hematologic origin in which long-term survival, and
cure, could be achieved with combination
chemotherapy (Lawrence H Einhorn, 1980; Robert F
Ozols, 1983; Michael K. Samson, 1984).
REFERENCES
Ana-Maria Florea and Dietrich Büsselberg, Cisplatin
as an Anti-Tumor Drug: Cellular Mechanisms of
Activity, Drug Resistance and Induced Side Effects,
Cancers, 2011, 3, 1351-1371
Dorr RT, Bleomycin pharmacology: mechanism of
action and resistance, and clinical pharmacokinetics.
Semin Oncology, 1992, 19 (2 Suppl 5), 3-8.
Lawrence H Einhorn, and Stephen D, Chemotherapy
of disseminated testicular cancer -a random
prospective study, Cancer, 46, 1980, 1339- 1344.
Michael K Samson, Dose-response and dose-survival
advantage for high versus low-dose cisplatin
combined with vinblastine and bleomycin in
disseminated testicular cancer, Cancer, 53, 1029-1035,
1984.
Robert F Ozols, Treatment of poor prognosis
nonseminomatous testicular cancer with a "high-dose"
platinum combination chemotherapy regimen, Cancer,
51, 1983, 1803-1807.
Praveen and Ranadheer Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 796
Samuels ML, Lanzotti VJ, Holoye PY, Boyle LE,
Smith TL, Johnson DE, Combination chemotherapy in
germinal cell tumors, Cancer Treat Rev, 3, 1976, 185-
204.
Wilson L, Creswell KM, Chin D, The mechanism of
action of vinblastine, Biochemistry, 30;14(26), 1975,
5586-92.
Wozniak AJ, A randomized trial of cisplatin,
vinblastine, and bleomycin versus vinblastine,
cisplatin, and etoposide in the treatment of advanced
germ cell tumors of the testis: a Southwest Oncology
Group study, Journal of clinical oncology, 1991, 9(1),
70-76.
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 797
Method development and validation for the simultaneous estimation of Ofloxacin
and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC
method Y.Bhargav*, K Haritha Pavani, S Amareswari
Nimra College of Pharmacy, Vijayawada, A.P, India
*Corresponding author: Email: [email protected]; Phone no: 8466941272
ABSTRACT
A new, simple, accurate, rapid, precise RP-HPLC method was developed for the simultaneous
estimation of ofloxacin and tinidazole in bulk and pharmaceutical dosage form. A good chromatographic
separation was achieved with Intersil ODS C18 (250×4.6mm.5µ) column and ammonium acetate buffer
pH 4.0, acetonitrile, and tetrahydrofuran 60:30:10 was used as mobile phase at a flow rate of 1.0ml/min
and the detection was carried out at a wavelength of 304 nm. The retention times was found to be 2.350
min for ofloxacin and 3.613 min for tinidazole. The linearity of the method was in the concentration range
of 15-35µg/mL for ofloxacin and 45-105µg/mL for tinidazole. The developed method was validated for
system suitability, specificity, precision, recovery and linearity according to ICH guidelines. The method
was successfully applied for routine analysis for the determination of oflaxacin and tinidazole in bulk and
dosage forms.
Key Words: Oflaxacin, Tinidazole, RP-HPLC, Validation.
INTRODUCTION
Ofloxacin was chemically (RS) 9-fluoro-2,
3dihydro-3-methyl-10-(4methl-1-piperazinyl)-7- oxo-
7H-prido [1, 2, 3-de]-1, 4benzoxazine-6-carboxylic
acid. Ofloxacin belongs to class of drugs called
quinolone antibiotics. Ofloxacin is a broad spectum
antibiotic that is active against both Gram-positive and
Gram-negitive. It inhibition of topoisomrase enzymes,
which inhibits relaxation of supercoild DNA and
promotes breakage of double stranded DNA. It is
used to treat a variety of bacterial infections.
Tinidazole was chemically 1-[ethanesulfonyl)
ethyl]-2-methyl-5-nitro-1H-imidazole. Tinidazole is
Antiprotozoal, Antibacterial agent. The nitro-group of
tinidazole is reduced by cell extracts of trichomonas.
The free nitro-radical generated as a result of this
reduction may be responsible for antiprotozoal
activiiaty. Chemically reduced Tinidazole was shown
to release nitrites and cause damage to purified
bacterial DNA in vitro.
Literature survey revealed that very few
methods have been reported for the analysis of
Ofloxacin and Tinidazole combinational dosage forms
which include UV spectroscopy, Reverse Phase High
performance Liquid Chromatography, HPTLC
methods. The present study illustrate development and
validation of simple, economical, selective, accurate,
precise RP-HPLC method for the determination of
Ofloxacin and Tinidazole in bulk and Pharmaceutical
dosage forms as per ICH guidelines.
MATERIALS AND METHODS
Shimadzu HPLC equipped with spinchrome
software, Elico UV-Spectrophotometer, Intersil ODS
C18 column (250×4.6mm.5µ), polmon pH Meter,
Weighing Balance Ax200 Shimadzu, LAB INDIA
Sonicator, rheodyne injector.
Preparation of mobile phase: 1.925g of Ammonium
acetate was accurately weighed and dissolved in
500ml of distilled water. The pH of the buffer was
adjusted to 4.0 with ortho phosphoric acid. A suitable
quantity of degassed mixture of pH4.0 Ammonium
acetate buffer, Acetonitrile, Tetra hydro furan in the
ratio of 60:30:10 was prepared and filtered through
0.45µ filter under vacuum filtration.
Preparation of standard stock solution: Accurately
weighed 10mg of Ofloxacin and 10mg of Tinidazole
into a 10ml volumetric flasks and 10ml of diluents
Ammonium acetate Buffer
pH4.0:ACN:THF(60:30:10) was added and sonicated
for 5min and make up to the volume with diluent.
From the stock 1ml of the solution was taken and
diluted to 10ml to get a concentration of 100µg/ml
solution from the above solution 2ml of Ofloxacin and
6ml of Tinidazole and mixed and injected.
Preparation of sample: Twenty tablets were weighed
and powdered the powder equivalent to 25mg of
Ofloxacin and 75mg of Tinidazole were weighed and
taken into a 200ml volumetric flask. To this 50ml of
diluents was added and sonicated for 15min to
dissolve the drugs then made up the volume to
required volume with the diluents. From this solution
5ml was taken into a 50ml flask and made up to final
volume with diluents to get a concentration of
100ppm filtered through 0.45µ filter under vacuum
filtration. From this stock solution further dilutions
were made for the validation of the method developed.
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 798
RESULTS AND DISCUSSION
Optimized method development: Various
experimental conditions were carried out to achieve
the best chromatographic conditions for the
simultaneous determination of the drug substances.
Several column types and lengths were tried for better
elution and for chromatographic parameters. A good
chromatographic separation was achieved with Intersil
ODS C18 (250×4.6mm.5µ) column and ammonium
acetate buffer pH 4.0, acetonitrile and tetrahydrofuran
60:30:10 was used as mobile phase at a flow rate of
1.0ml/min and the detection was carried out at a
wavelength of 304nm. The retention times was found
to be 2.350min for oflaxacin and 3.613min for
tinidazole.
System suitability: From the system suitability
studies it was observed that theoretical plates were
found to be more than 2125 for Ofloxacin and 3873
for Tinidazole. USP tailing factor was found to be
1.76 for Ofloxacin and 1.72 for Tinidazole. All the
parameters were within the limit. The results of
system suitability studies were given in Table.1 and
the standard Chromatograms can be were shown in
the Figure.1.
Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. The results were tabulated in the Table.2. The
chromatograms were shown in the Figures 2,3,4 for
standard, sample, blank and placebo.
Linearity: From the Linearity data it was observed
that the method was showing linearity in the
concentration range of 15-35μg/ml for Ofloxacin and
45-105μg/ml for Tinidazole. Correlation coefficient
was found to be 0.999 and 0.998 for both the
compounds. The linearity data was tabulated in
Table.3. The Chromatograms for the linearity data
were shown in the fig no: and the linearity curve was
plotted and given in the Figures 5,6.
Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were 100.81 % for
Ofloxacin and 99.15 % for Tinidazole, which shows
that the method was accurate. The results were
tabulated in the Table.4.
The chromatograms were shown in the Figure.7.
Precision: The %RSD for the sample chromatograms
of method precision were found to be 0.52 & 0.73 for
Ofloxacin and 0.41 &0.35 for Tinidazole. Hence it
passes method precision. The results were tabulated in
the Table.5. The chromatograms were shown in the
Figure.8.
Assay: The %assay of the Ofloxacin was found to be
99.87% and for Tinidazole 99.23%. The results were
tabulated in the Table.6. The chromatograms were
shown in the Figures 9,10.
Ruggedness: Comparison of both the results obtained
for two different Analysts shows that the method was
rugged for Analyst-Analyst variability. The system
suitability parameters of Ruggedness were found to be
within the limits and were tabulated in Table.7. The
Chromatograms for ruggedness were shown in
Figures 11,12.
Robustness: All the system suitability parameters are
within limits for variation in flow rate (±0.2 ml) and
for variation in the wavelength (±2nm).
Forced degradation studies: A forced degradation
study is an important step in drug development
process to observe the drug products stability. An
attempt has been made to stress the drug products to
acid hydrolysis by using 0.1N HCl, base hydrolysis by
using 0.1N NaoH, oxidative degradation by using 1%
H2O2, thermal treatment heated at 800c, photolytic
degradation for 4hrs to evaluate the stability of the
propose method to separate the drugs and its
degradation products. The results were tabulated in
the Table: 8 The chromatograms were shown in the
Figures 13,14,15,16,17.
Chemical structure of ofloxacin Chemical structure of tinidazole
Table.1.System suitability data for Ofloxacin and Tinidazole
Parameters Ofloxacin Tinidazole Acceptance Criteria
Retention Time 2.350 3.613 -
Theoretical plates 2125 3873 >2000
Asymmetry 1.769 1.724 <2
Resolution 5.793 -
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 799
Table.2. Specificity Data for Ofloxacin and Tinidazole
Ofloxacin Tinidazole
Standard
Retention
time
Area Theoretical
Plates
Retention
time
Area Theoretical
Plates
2.88 314.464 4039 4.140 884.734 5918
2.80 295.781 3817 4.040 850.497 5636
2.88 326.538 4039 4.140 891.542 5918
Sample
2.80 298.113 3817 4.040 863.317 5636
2.88 328.148 4039 4.140 887.046 5918
2.78 303.004 3763 4.003 851.318 5534
Blank - - - - - -
Table.3. Linearity data for Ofloxacin and Tinidazole:
Ofloxacin Tinidazole
Mcg/ml Area Rt Mcg/ml Area Rt
15 160.368 2.750 45 473.440 3.953
20 212.082 2.740 60 589.513 3.940
25 281.411 2.800 75 776.017 4.140
30 350.32 2.733 90 928.174 3.933
35 319.149 2.727 105 1065.057 3.920
Table.4. Accuracy Data For Ofloxacin and Tinidazole
Drug %level Amount
added (mcg)
Amount found
(mcg)
Avg
% reecovery
Mean
%recovery
Ofloxacin
80 25 25.43 101.73
100.81 100 30 30.50 101.67
120 35 34.67 99.05
Tinidazole
80 75 74.03 98.71
99.15 100 90 89.39 99.32
120 105 104.39 99.42
Table.5. Precision data for Ofloxacin and Tinidazole
Ofloxacin Tinidazole Rt Area Rt Area
2.83 300.079 4.014 857.704
2.833 298.969 4.012 851.606
2.800 302.438 4.040 857.331
2.812 296.614 4.003 858.53
2.823 297.816 4.008 852.506
2.800 301.438 4.040 857.331
Table.6.Assay data for Ofloxacin and Tinidazole
Ofloxacin Tinidazole Standard Area Sample area Standard Area Sample area
301.472 290.755 831.425 831.363 300.928 302.911 835.201 827.911 301.613 303.766 827.911 828.218 301.472 308.66 831.845 834.333 306.062 303.37 842.884 828.432 %Assay 99.87% 99.23%
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 800
Table.7.Ruggedness data of Ofloxacine and Tinidazole
Ofloxacin Tinidazole
Area Retention time Area Retention time
Actual 3532.65 2350 4312.863 3.613
Analyst 1
Analyst 2 312.858 2.780 833.419 4.003 306.953 2.717 836.314 3.930
Analyst 1
Analyst 2 308.838 2.717 841.567 3.930 305.234 2.780 852.013 4.003
Table No: 8 Forced degradation data for Ofloxacin and Tinidazole
Stress Conditions Time (hrs) Retention Time
(hrs)
Time
(hrs)
Retention Time (hrs)
As such 4hrs 2.350 4hrs 3.613
Acid Hydrolysis (0.1 N, at RT) 4hrs 2.703 4hrs 3.907
Base Hydrolysis (0.1 N, at RT) 4hrs 2.663 4hrs 3.873
Oxidation (1% H2O2 at RT) 4hrs 2.703 4hrs 3.907
Photolysis (UV light at 254nm at RT) 4hrs 2.663 4hrs 3.873
Thermal (at 800C) 4hrs 2.663 4hrs 3.873
Table.9. Summary of validated parameters of Ofloxacin and Tinidazole
Parameters Ofloxacin Tinidzole
Linearity 15-35µg/ml 45-105 µg/ml
Correlation Coefficient(r2) 0.999 0.998
Slope(m) 11.3 11.234
Intercept(c) 11.0793 68.5073
Precision (%RSD) 0.52,0.73 0.41,0.35
Accuracy 100.81% 99.15%
LOD 2.31 7.06
LOQ 6.99 21.41
Assay % 99.87% 99.23%
Figure.1.Data for System suitability Figure.2.Chromatogram for blank
Figure.3.Data for Specificity standard Figure.4.Data for Specificity sample
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 801
Figure.5.Linearity plot for Ofloxcin Figure.6.Linearity plot for Tinidazole
Figure.7.Data for Recovery Figure.8.Data for Precision
Figure.9.Data for Assay (standard) Figure.10. Data for Assay (sample)
Fig No:11 Data for Ruggedness (standard) Fig No:12 Data for Ruggedness (sample)
y = 11.3x + 11.234 r² = 0.999
0
50
100
150
200
250
300
350
400
450
0 1 2 3 4 5 6
Are
a
Conc
Linearity of Ofloxacin y = 11.0793x + 68.5073
r² = 0.998
0
200
400
600
800
1000
1200
0 1 2 3 4 5 6
Are
a
Conc
Linearity of Tinidazole
Bhargav et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 802
Fig No:13 Acid Degradation Fig No:14 Base Degradation
FigNo:15 Peroxide Degradation FigNo:16 Thermal Degradation
Fig No: 17 Photolysis Degradation
CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of
ich guidelines for method validation. The proposed
method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is
validated and can be used for routine and stability
sample analysis.
ACKNOWLEDGMENT
The authors would like to thank all the staff of
nimra college of pharmacy, beloved parents and all
my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
B Dhandapani, Method development and validation
for the simultaneous estimation of Ofloxacin and
Ornidazle tablet dosage form, Indian journal of
pharmaceutical sciences and research, 1(1), 2010, 78-
83.
M Rama Kotaiah, Shaik Harun Rasheed, Y Narasimha
Rao, Y Venkateswarlu, Konda Ravi Kumar,
Simultaneous estimation of Ofloxacin and Tinidazole
in tablet dosage form by RP-HPLC, Research journal
of pharmaceutical, biological and chemical sciences,
1(4), 2010, 460-466.
Maduri D Game and D.M Sakarkar, Simultaneous
spectrophotometric estimation of Nitazoxinide and
Ofloxcin in tablets, Indian Pharma Sciences, 73(1),
2011, 70-74.
Manisha Puranik, DV Bhawsar Prachi Rathi, PG
Yeole, Simultaneous determination of Ofloxacin and
Ornidazole in solid dosage form by RP-HPLC and
HPTLC techniques, Indian journal of pharmaceutical
sciences, 2(4), 2010, 513-517.
Nargesh Keshar, Kareti Srinivasa Rao, Arijit
Banerjee, Spectrophotometric methods for
simultaneous estimation of Ofloxacin and Tinidazole
in bulk and pharmaceutical dosage forms, Chronicle
of young scientists, 2(2), 2011, 98-102.
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 803
Evaluation of nephro protective activity of methanolic extract of seeds of Vitis
vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in
wistar rats Kalluru Bhargavi*,
N Deepa Ramani, Janarthan M, Duraivel S
Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India.
*Corresponding author: [email protected]
ABSTRACT
The Objective of the study was to investigate the nephroprotective activity of methanolic extract of
seeds of Vitisvinifera (family:vitaceae) against rifampicin induced and carbontetrachloride induced kidney
damage in rats.Male albino wistar rats (150-250gm) were selected and divided in to six groups of six
animals each. Group 1 served as normal control, group 2 served as positive control, group 3 served as
standard, group 4 was treated with MEVV (low dose) and group 5 was treated with MEVV (high dose).
The same grouping was followed for both models (rifampicin and carbon tetra chloride). Inducing agents
are given 3 days once for two weeks to induce nephrotoxicity. The results are evidenced on the basis of
physical, biochemical and histological parameters. One-way analysis of variance followed by tukey’s
multiple comparison tests were used for statistical analysis.Rifampicin and carbontetrachloride produced
significant changes in physical (decreased liver and body weight), biochemical (increased levels of total
protein, uric acid, urea, and creatinine), and histological parameters in rats. Pretreatment with MEVV and
standard drug cystone significantly prevented the physical, biochemical and histological changes
produced by rifampicin and carbon tetrachloride toxicity. Results of the present study suggest that MEVV
has a significant nephroprotective activity probably by acting against free radicals.
Key words: Vitis vinifera, nephrotoxicity, rifampicin, carbontetrachloride, biochemical parameters etc.
INTRODUCTION
Nephrotoxicity is one of the most common
kidney problems and occurs when body is exposed to
a drug or toxin. When kidney damage occurs, body
unable to rid of excess urine and wastes from the body
and blood electrolytes (such as potassium and
magnesium) will all become elevated (Ramyapydi,
2011).A number of therapeutic agents can adversely
affect the kidney resulting in acute renal failure,
chronic interstitial nephritis and nephritic syndrome.
Because of the increasing number of potent
therapeutic drugs like aminoglycoside antibiotics,
chemotherapeutic agents and NSAIDS have been
added to the therapeutic arsenal in recent years.
Exposure to chemical reagents like ethylene glycol,
carbon tetrachloride, sodium oxalate and heavy metals
like lead, mercury, arsenic and cadmium also induces
nephrotoxicity which leads to acute kidney injury
(AKI).
MATERIALS AND METHODS:
Materials: All chemicals were of analytical grade and
obtained locally. Creatinine,totalprotein,urea and uric
acid kit were procured from Robonik diagnostics,
Hyderabad, India.
Plant material: The fresh seeds Vitisvinifera were
collected from Kadapa District; A.P. Identification of
the plant was done by Dr. SreedharMurty, Assistant
Professor, Department of Botany, Government
College of Arts, Kadapa, A.P, India.
Animals: Healthy adult male wistar rats weighing
between 150-250gm were used for the present study.
The animals were housed in groups of six and
maintained under standard conditions (27±2ºC,
relative humidity 44 - 56% and light and dark cycles
of 10 and 14 hours respectively) and fed with standard
rat diet and purified drinking water ad libitum for 1
week before and during the experiments.
Preparation of the extract: The dried flowers of V.
viniferawas collected, cleaned, dried and powdered in
a grinder - mixer to obtain a coarse powder and then
passed through 40 mesh sieve. About 1000 gm of
powdered drug was extracted with aqueous methanol
by soxhlet apparatus. The extraction was carried out
until the drug becomes exhausted. The solvent was
recovered from their extract by distillation under
reduced pressure. The dried extract thus obtained was
kept in a desicator and was used for further
experiments.
Induction of nephrotoxicity in rats: Rifampicin
(1000mg/kg) was dissolved in distilled water and
administered orally to rats for 14 consecutive days at
an interval of 72 hrs to induce experimental nephro
toxicity in rats.
CCl4 (1ml/kg) was dissolved in olive oil and
injected intraperitoneally to rats for 14 consecutive
days at an interval of 24 hrs to induce experimental
nephro toxicity in rats.
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 804
Rifampicin induced nephrotoxicity: The
experimental animals were randomly divided in to 5
groups (n= 6) and treated for duration of 14 days as
per the treatment schedule given in table no: 3.
Nephrotoxicity was induced by administration of
Rifampicin (1000 mg/kg oral) three days once for two
weeks. Methanolic extract of V. vinifera was freshly
suspended in distilled water and administered to
animals by oral feeding needle.
Carbon tetra chloride induced nephrotoxicity: The
experimental animals were randomly divided in to 5
groups (n= 6) and treated for duration of 15 days as
per the treatment schedule given in table no: 4.
Nephrotoxicity was induced by injected
intraperitoneally of ccl4 (1ml/kg i.p) with olive oil
every day for two weeks. Methanolic extract of V.
viniferawas freshly suspended in distilled water and
administered to animals by oral feeding needle.
Treatment schedule Evaluation of
nephroprotective activity of V.vinifera against
Rifapmicin induced nephrotoxicity in wistar Rats:
Groups Treatment (14 days)
Normal Vehicle (1% CMC)
Control Rifampicin (1000mg/kg,p.o.)
Standard Rifampicin (1000mg/kg,p.o.) + Cystone
(500 mg/kg, p.o.)
Low
dose
Rifampicin (1000 mg/kg, p.o.) + VVFE
(100 mg/kg, p.o.)
High
dose
Rifampicin (1000 mg/kg, p.o.) + VVFE
(200 mg/kg, p.o.)
Treatment schedule –Evaluation of
nephroprotective activity of V.vinifera against
carbon tetrachoride induced nephrotoxicity in
wistar Rats:
Groups Treatment (15 days)
Normal Olive oil (5ml/kg.p.o.)
Control CCl4 (1ml/kg,i.p.)
Standard CCl4 (1ml/kg,i.p.) + Cystone (500 mg/kg,
p.o.)
Low
dose
CCl4 (1ml/kg,i.p.) + VVFE (100 mg/kg,
p.o.)
High
dose
CCl4 (1ml/kg,i.p.) + VVFE (200 mg/kg,
p.o.)
I.P = Intra peritoneal, P.O = Per oral.
Parameters measured:
Physical Parameters: The body weight was recorded
on the first day and then last day of the study period in
each group.
Blood Estimations: Levels of creatinine, total
protein, urea, uric acid in blood were determined by
using commercial glucometer kit on final day of the
experiment by collecting blood.
Urine Estimations: Levels of creatinine, total protein,
urea, uric acid in urine were determined by using
commercial glucometer kit on final day of the
experiment by collecting urine.
Histopathological studies: For histopathological
studies, tissue obtained from the excised kidney was
immediately fixed in 10% buffered neutral formalin
solution. The fixed tissues were embedded in paraffin
and serial sections were cut. Each section was stained
with hematoxylin and eosin (H & E stain). The
sections were examined under light microscope and
photomicrographs were taken.
Statistical analysis: All the data was expressed as
mean ± S.E.M. Statistical significance between more
than two groups was tested using one way ANOVA
followed by the Tukey’s multiple comparison test
using computer based fitting program (Prism graph
pad 5.0). Statistical significance was set accordingly.
RESULTS
Effect of plant extract on body and kidney weight:
Carbon tetra chloride treated rats showed significant
(p<0.05) decrease in body and kidney weight
compared to control rats. Pretreatment with test-1,
test-2 and standard significantly (p<0.05) increased
body and kidney weights as compared to carbon tetra
chloride treated rats (table 1)
Rifampicin treated rats showed significant (p<0.05)
decrease in body and kidney weight compared to
control rats. Pretreatment with test-1, test-2 and
standard significantly (p<0.05) increased body and
kidney weights as compared to rifampicin treated rats
(table 2)
Effect of Plant extract on Blood and urine
estimations: Carbon tetra chloride (CCl4) treated rats
showed significant (p<0.05) increase in levels of Total
Protein, urea, uric acid and Creatinine in blood and
urine as compared to control rats. Pretreatment with
test-1, test-2 and Standard significantly (p<0.05)
decreased the elevated levels of these parameters as
compared to CCl4 treated rats (table 3). Rifampicin
treated rats showed significant (p<0.05) increase in
levels of Total Protein, urea, uric acid and Creatinine
in blood and urine as compared to control rats.
Pretreatment with test-1, test-2 and Standard
significantly (p<0.05) decreased the elevated levels of
these parameters as compared to Rifampicin treated
rats (table 4).
Table.1.Effect of extract on Body and kidney weight (CCl4 induced)
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 805
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison
test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no
significance Table 2: Effect of plant extract on body and kidney weights (Rifampicin induced)
Groups Initial body weight
(gm)
Final body weight
(gm)
Change in body
weight (gm)
Kidney weight
(gm)
Normal 180 200 20±0.62 0.815±0.021
Positive Control 210 180 -30±1.02 0.59±0.024
Standard 250 230 -20±1.21 0.86±0.027
Test-1 190 185 -5±0.39 0.62±0.021
Test-2 200 180 -20±0.66 0.75±0.028
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison
test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no
significance
Table 4: Effect of Plant extract on blood and urine estimations in carbon tetra chloride induced
nephrotoxic rats
Group
Blood Parameters Urine Parameters
Total
Protein
Urea Uric acid Creatinine Total
Protein
Urea Uric acid Creatinine
Control 7.355+0.119 22.89+0.8 2.561+0.133 0.603+0.037 41.8+1 25.253+1.302 3.468+0.052 51.95+0.16
Positive
control
19.5+0.086* 52.626+0.958* 7.49+0.109 1.85+0.036* 88.93+1.024* 56.75+2* 10.63+0.089* 2.628+0.045*
Standard 7.74+0.084# 41.5+0.081# 3.12+0.173# 0.3+8.975# 43.51+0.097# 35.611+0.112# 8.34+0.043# 0.675+0.029#
Test 1 9.59+0.082# 34.67+0.89# 50.35+0.038# 0.218+0.011# 62.26+0.099# 40.363+2.127# 4.708+0.035# 0.458+0.108#
Test 2 9.05+0.103# 26.21+1.199# 4.26+0.01# 0.413+0.01# 51.95+0.16# 28.9+2.438# 0.458+0.108# 0.348+0.032# All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where n=6; *-when compared with
Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Table 5: Effect of Plant extract on blood and urine estimations in rifampicin induced nephrotoxic rats
Group
Blood Parameters Urine Parameters
Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine
Control 7.458+0.076 23.96+1.028 2.302+0.06 0.068+0.038 39.46+1.29 26.132+1.507 3.368+0.541 0.822+0.023
Positive
control
18.594+0.180* 51.562+1.18* 7.66+0.076* 1.84+0.043* 90.76+1.196* 62.43+1.467* 10.502+0.12*
2.59+0.056*
Standard 7.22+0.079# 40.23+0.049# 3.007+0.168# 0.284+0.0082# 44.346+0.01# 36.6+0.032# 8.274+0.393# 0.644+0.028#
Test 1 9.93+0.177# 33.4+0.079# 5.32+0.023# 0.504+0.273# 61.63+0.007# 35.54+1.546 4.72+0.027# 0.0386+0.123#
Test 2 8.85+0.032# 25.48+1.468# 4.242+0.003# 0.408+0.127# 51.402+0.008# 26.2+0.222# 4.68+0.02# 0.324+0.029# All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where n=6;
*-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Histopathological studies: Histological changes such
as cortical glomerular, peritubular blood vessels
congestion, and interstitial inflammation etc. were
observed in the CCl4 and rifampicin administered
group. Pretreatment with standard (cystone), low and
high dose of VVFE significantly prevented
histopathological changes towards normal (fig A-E
and F-J respectively)
Normal Group Positive Control (CCl4)
Groups Initial body weight
(gm)
Final body weight
(gm)
Change in body
weight (gm)
Kidney weight
(gm)
Normal 200 230 +30±1.065 0.95±0.033
Positive Control 210 180 -30±0.866* 0.61±0.029*
Standard 190 180 -10±0.578# 0.72±0.016
#
Test-1 240 210 -30±0.87# 0.82±0.012
#
Test-2 200 190 -10±0.613# 0.79±0.025
#
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 806
Standard Group Low dose Extract
High dose extract F. Control
Positive Control (Rifampicin) Standard
Low dose extract High dose extract
DISCUSSION
Percentage change in body weight and
increased the levels of serum and urine markers such
as Creatinine, urea, uric acid, and total protein when
compared with control rats. Pretreatment with VVFE
in CCl4 administered rats significantly reduced the
elevated levels of serum and urine markers when
compared to positive control group. It indicates
protective effect of VVFE against rifampicin induced
nephrotoxicity in rats.
Histological changes such as cortical
glomerular, peritubular blood vessels congestion, and
interstitial inflammation were observed in the CCl4
and rifampicin administered group. The VVFE
pretreated rats significantly prevented these
histological changes, further indicating their
nephroprotective activity. All the histological changes
observed were in correlation with the physical and
biological parameters of the kidney.
From the present study results, it indicates
that VVFE has protective effect against rifampicin and
carbon tetrachloride induced nephrotoxicity in rats
individually.
CONCLUSION
In conclusion, Results of the present study suggest
that VVFE provides adequate protection against
rifampicin induced and carbon tetra chloride induced
nephrotoxicity on albino wistar rats as evidenced by
physical, biochemical and histological parameters.
The protective effect of VVFE may be due to its
antioxidant potential. However, further studies are
needed to confirm its clear mechanism of action in
nephroprotection and to characterize the chemical
constituents responsible for it.
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 807
REFERENCES
Hoitsma AJ, Wetzels JF and Koene RA, Drug induced
nephrotoxicity, Aetiology, clinical features and
management, Drug Saf, 6 (2), 1991, 131-147.
Paller MS, Drug induced nephropathies, Med Clin
North Am, 74 (4), 1990, 909-917.
Porter G. A, Bennett W.M, Nephrotoxic acute renal
failure due to common drugs. American journal of
Physiology, 241(7), 1981, 252-256.
RamyaPydi, IRajalakshmi, S Indumathy, S Kavimani,
Nephroprotective Medicinal Plants - A Review,
International Journal of Universal Pharmacy and Life
Sciences, (2), 2011, 266-281.
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 808
Method development and validation for the simultaneous estimation of Atazanavir
and Ritonavir in tablet dosage form by RP-HPLC
Nuli Vasavi*, Afroz Patan
Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9966136060
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise reverse
phase high performance liquid chromatographic method for the simultaneous estimation of Atazanavir
and Ritonavir in pure and pharmaceutical dosage forms of Atazanavir and Ritonavir were well separated
using a X-Tera C18 (100 x 4.6mm, 3.5m) and Mobile phase consisting of Buffer(pH-2.5): Acetonitrile
(40:60) adjusted to pH- 2.5 at the flow rate 1.2 ml/min and the detection was carried out at 247nm with
PDA detector. The Retention time for Atazanavir and Ritonavir were found to be 1.982 & 2.576
respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity
according to ICH guidelines. The method was successfully applied to Metronidazole and Norfloxacin
combination pharmaceutical dosage form.
Key Words: RP-HPLC, Atazanavir and Ritonavir Accuracy, Precision.
1. INTRODUCTION
Atazanavir Sulphate Methyl is a Antiretroviral
drug N- [(1S)-1-{ [(2S,3S) - 3 - hydroxy-4- [(2S)-2-
[(methoxycarbonyl) amino] - 3, 3 – dimethyl - N' -
{[4-(pyridin-2-yl)phenyl]methyl} butanehydrazido]-1-
phenylbutan-2-yl] carbamoyl}-2, 2 - dimethylpropyl]
carbamate sulphate is a azapeptide HIV-1 protease
inhibitor The compound selectively inhibits the virus-
specific processing of viral Gag and Gag-Pol
polyproteins in HIV-1 infected cells, thus preventing
formation of mature virions.
Ritonavir is a Antiretroviral drug 1,3-thiazol-
5-ylmethyl N-[(2S,3S,5S)-3-hydroxy-5-[(2S)-3-
methyl-2 {[methyl({[2-(propan-2-yl)-1,3-tiazole-4-
yl]methyl})carbamoyl]amino} butanamido]-1,6-
diphenylhexan-2-yl] carbamate. Ritonavir inhibits the
HIV viral protease enzyme. This prevents cleavage of
the gag-pol polyprotein and, therefore, improper viral
assembly results. This subsequently results in non-
infectious, immature viral particles.
Literature survey revealed that very few
methods have been reported for the analysis of
Atazanavir and Ritonavir combinational dosage forms
which include UV spectroscopy, Reverse Phase High
performance Liquid Chromatography, Densitometric
method, HPTLC methods. The present study illustrate
development and validation of simple, economical,
selective, accurate, precise RP-HPLC method for the
determination of Atazanavir and Ritonavir in bulk and
Pharmaceutical dosage forms as per ICH guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of
Atazanavir and Ritonavir in combined dosage form
using most commonly employed column (C18) and
simple mobile phase preparation. In the present
proposed work a successful attempt had been made to
develop a method for the simultaneous estimation of
Atazanavir and Ritonavir pharmaceutical dosage form
and validate it. From the economical point of view
and for the purpose of routine analysis, it was decided
to develop a more economical RP-HPLC method with
simple mobile phase preparation for the estimation of
Atazanavir and Ritonavir combinational dosage form.
The method would help in estimate of drugs in single
run which reduces the time of analysis and does not
require separate method for each drug. Thus, the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage
forms.
2. MATERIALS AND METHODS
Quantitative HPLC was performed on a high
performance liquid chromatograph -Waters
e2695Alliance HPLC system connected with PDA
Detector 2487 and Empower2 Software. The drug
analysis data were acquired and processed using
Empower2 software running under Windows XP X-
Tera C18 (100 x 4.6mm, 3.5m) particle size. In
addition an analytical balance (AFCOSET Model
ER200A), digital pH meter (ADWA Model
AD102U), a sonicator (ENERTECH Model SE60US)
were used in this study. Standards and chemicals used:
The reference samples of Atazanavir and Ritonavir
standards were kindly supplied as gift samples by
Hetero Drugs Ltd., Hyderabad, Andhra Pradesh, India.
All the chemicals were analytical grade. Potassium
dihydrogen orthophosphate and phosphoric acid from
Merck Ltd., Mumbai, India, while acetonitrile (HPLC
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 809
grade) and triethylamine (HPLC grade) from Merck
Pharmaceuticals Private Ltd., Mumbai, India. Ortho
phosphoric acid used was of HPLC grade and
purchased from Merck Specialties Private
Ltd.,Mumbai,India
Preparation of mobile phase: A mixture of above
prepared buffer 400 ml (40%) and 600 ml of HPLC
grade Acetonitrile (60%) were mixed and degassed in
ultrasonic water bath for 5 minutes. The mobile phase
was filtered through 0.45 µ filter under vacuum.
Preparation of calibration standards: Accurately
weighed and transferred 30mg of Atazanavir and
10mg of Ritonavir working standard into a 10ml clean
dry volumetric flask and added about 7ml of diluent.
It was sonicated to dissolve completely and made
volume up to the mark with the same diluent. (Stock
solution)(3000, 1000 µg/ml). From the above stock
solution, 1ml of the solution was pipetted into a 10ml
volumetric flask and diluted up to the mark with
diluent. (300, 100µg/ml). From this, 4ml of the
solution was pipetted into another 10ml volumetric
flask and diluted up to the mark with diluent.
System suitability: System suitability is an integral
part of chromatographic system. To ascertain its
effectiveness, certain system suitability test
parameters were checked by repetitively injecting the
drug solutions at 100% concentration level for
Atazanavir and Ritonavir to check the reproducibility
of the system. At first the HPLC system was stabilized
for 40 min. One blank followed by six replicate
analysis of solution containing 100% target
concentration of Atazanavir and Ritonavir were
injected to check the system suitability. To ascertain
the system suitability for the proposed method, a
number of parameters such as theoretical plates, peak
asymmetry, and retention time were taken and results
were presented in Table 2.
Calibration curves for Atazanavir and Ritonavir: Replicate analysis of solution containing 60-180
µg/ml for Atazanavir and 20-60 µg/ml for Ritonavir
sample solutions respectively were injected into
HPLC according to the procedure in a sequence and
chromatograms were recorded. Calibration curves
were constructed by plotting by taking concentrations
on X-axis and ratio of peak areas of standards on Y-
axis and regression equation were computed for both
drugs and represented in fig:5&6
Analysis of marketed formulation: Accurately
weighed and transferred 49.8mg of Atazanavir and
Ritonavir tablet powder into a 10ml clean dry
volumetric flask and added about 7ml of diluent. It
was sonicated to dissolve it completely and made
volume up to the mark with the same diluent. (Stock
solution).
From the above stock solution, 1ml of the solution
was pipetted into a 10ml volumetric flask and diluted
up to the mark with diluent. From this, 4ml of the
solution was pipetted into another 10ml volumetric
flask and diluted up to the mark with diluent. 20 µL of
the standard and sample solutions were injected into
the chromatographic system and areas for the
Atazanavir and Ritonavir peaks were measured.
Validation study of Metronidazole and
Norfloxacin: An integral part of analytical method
development is validation. Method validation is the
process to confirm that the analytical procedure
employed for a specific test is suitable for its intended
use. The newly developed RP-HPLC method was
validated as per International Conference on
Harmonization (ICH) guidelines for parameters like
system suitability, accuracy, linearity, precision
(repeatability), Intermediate Precision limit of
detection (LOD), limit of Quantification (LOQ) and
robustness.
Precision: precision study of sample (Atazanavir and
Ritonavir) was carried out by estimating
corresponding responses 5 times on the same day for
the 100% target concentration. The percent relative
standard deviation (%RSD) is calculated which is
within the acceptable criteria of not more than 2%.
The results were presented in Table 3.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range
of 30mg of Atazanavir and 10mg of Ritonavir.
Method of least square analysis is carried out for
getting the slope, intercept and correlation coefficient,
regression data values and the results were presented
in Table 5. The representative chromatograms
indicating the sample were shown in fig.2&3. A
calibration curve was plotted between concentration
and area response and statistical analysis of the
calibration curves were shown in fig. 5&6.
Accuracy (Recovery studies): The Amount found
and Amount added for Atazanavir & Ritonavir and
the individual recovery and mean recovery values
were calculated. Known amount of Atazanavir and
Ritonavir at 50%, 100%, 150% is added to a pre
quantified sample solution. The recovery studies were
carried out in the tablet in triplicate each in the
presence of placebo. The mean percentage recovery of
Atazanavir and Ritonavir at each level is not less than
98% and not more than 102%.
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 810
Robustness: The robustness is evaluated by the
analysis of Atazanavir and Ritonavir under different
experimental conditions such as making small
changes in flow rate (±0.2 ml/min), λmax (±5),
column temperature (±5), mobile phase composition
(±5%), and pH of the buffer solution. The results were
presented in Table 4.
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified. Under the stated experimental
conditions, the limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy.
Limit of detection and limit of quantification were
calculated using following formula LOD=3.3(SD)/S
and LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of
the calibration curve.
3. RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred
for the determination of Atazanavir and Ritonavir.
Preliminary experiments were carried out to achieve
the best chromatographic conditions for the
simultaneous determination of the drug substances.
Several column types and lengths were tried
considering other chromatographic parameters. C18
column with a 4.6 mm inner diameter and 3.5µm
particle size was chosen. The detection wave length
was selected as 247nm with 2487 detector.
Chromatographic conditions were optimized by
changing the mobile phase composition and buffers
used in mobile phase. Different experiments were
performed to optimize the mobile phase but adequate
separation of the drugs could not be achieved. By
altering the pH of buffer results a good separation.
Different proportions of solvents were tested.
Eventually the best separation was obtained by the
isocratic elution system using a mixture of
Acetonitrile (40:60) adjusted to Buffer (pH-2.5) at a
flow rate of 1.2 ml/min. A typical chromatogram for
simultaneous estimation of the two drugs obtained by
using a above mentioned mobile phase. Under these
conditions Atazanavir and Ritonavir were eluted at
1.982 & 2.567 minutes respectively with a run time of
5 minutes. The representative chromatogram of this
simultaneous estimation shown in fig. 3 & 4 and
results were summarized in Table 1.
The Buffer (pH-2.5): Acetonitrile (40:60) was
chosen as the mobile phase. The run time of the HPLC
procedure was 5 minutes at flow rate of 1.2ml/min
was optimized which gave sharp peak, minimum
tailing factor. The system suitability parameters were
shown in Table 1 were in within limit, hence it was
concluded that the system was suitable to perform the
assay. The method shows linearity between the
concentration range 30mg of Atazanavir and 10mg of
Ritonavir. The experimental results were shown in
table 5 and fig.5&6. The % recovery of Atazanavir
and Ritonavir was found to be in the range of 98.96 to
101.84 % and 98.29 to 100.54% respectively. As there
was no interference due to excipients and mobile
phase, the method was found to be specific. As both
compounds pass the peak purity, the method was
found to be specific. The method was robust and
rugged as observed from insignificant variation in the
results of analysis by changes in Flow rate, column
oven temperature, mobile phase composition and
wave length separately and analysis being performed
by different analysts. The results were shown in Table
4. The LOD and LOQ values were calculated based
on the standard deviation of the response and the slope
of the calibration curve at levels approximately the
LOD and LOQ. The limit of detection was obtained
for Atazanavir and Ritonavir found to be 0.999 and
0.999. The results were shown in Table-6.
Table.1 optimized chromatographic conditions and system suitability parameters for proposed method
Parameter Chromatographic conditions
Instrument Waters e2695 Alliance HPLC with Empower2 software
Column X-Tera C18 (100 x 4.6mm, 3.5m)
Detector Detector 2487
Mobile phase Phosphate Buffer ( pH2.5): Acetonitrile (40:60)
Flow rate 1.2ml/min
Detection wavelength 247nm
Temperature Ambient
Injection volume 20µl
Retention time Atazanavir: 1.982; Ritonavir: 2.576
Theoretical plate count Atazanavir: 4092.8 ; Ritonavir: 4900.4
Tailing factor Atazanavir: 1.3; Ritonavir: 1.2
Resolution factor 4.2
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 811
Fig. 1: Structure of Atazanavir Sulphate Fig. 2: Structure of Ritonavir
Table.2.System suitability:Flow change observation of atazanavir and ritonavir Flow rate (ml/min) System suitability results
Usp plate count Usp tailing
Atazanavir 1.0 4028.2 1.3
1.2 4092.8 1.3
1.4 4010.7 1.3
Ritonavir 1.0 4727.0 1.2
1.2 4900.4 1.2
1.4 4712.2 1.2
Table.3.Results of Precision study
Sample Injection number Precision
RT Peak area
Atazanavir 1 1.978 1647681
2 1.976 1647899
3 1.979 1642958
4 1.982 1649928
5 1.974 1649877
Mean 1.977 1633919
%RSD(NMT 2.0) 0.10
Ritonavir 1 2.576 595172
2 2.572 596877
3 2.573 596609
4 2.578 597459
5 2.573 596311
Mean 2.574 596485.6
%RSD(NMT 2.0) 0.14
Table 4: Robustness studies Atazanavir and Ritonavir
Sample Paraameters Optimized Used RT USP Tailing Plate count
Atazanavir Flow
rate(±0.2)
1ml/min 1.0 2.541 1.3 4028.2
1.2 1.982 1.3 4.92.8
1.4 1.786 1.3 4010.7
Mobile
phase
variation
0% Less 2.432 1.3 4131.8
Actual 1.982 1.3 4092.8
More 1.785 1.3 4013.1
Ritonavir Flow
rate(±0.2)
1ml/min 1.0 2.956 1.2 4727.0
1.2 2.576 1.2 4900.4
1.4 2.291 1.2 4712.2
Mobile
phase
variation
0% Less 2.952 1.2 4918.2
Actual 2.576 1.2 4900.4
More 2.290 1.2 4878.1
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 812
Table.5.Linearity data of the Atazanavir and Ritonavir Observation of Atazanavir
Linearity Level Concentration Area
I 60ppm 899573
II 90ppm 1254637
III 120ppm 1648501
IV 150ppm 2027034
V 180ppm 2469227
Correlation Coefficient 0.999
Observation Of Ritonavir
I 20ppm 328807
II 30ppm 457715
III 40ppm 602795
IV 50ppm 744367
V 60ppm 904976
Correlation Coefficient 0.999
Table.6.Limit of Detection and Limit of Quantification
Atazanavir Ritonavir mcg Area mcg Area
LOD 1.979 580 2.578 687
LOQ 1.978 1962 2.577 2322
Figure.3.Typical Chromatogram of standard Atazanavir and Ritonavir
Figure.4.Typical chromatogram of Metronidazole and Norfloxacin tablets in marketed formulation
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 813
Figure.5.Linearity for Atazanavir
Figure.6.Linearity for Ritonavir
4. CONCLUSION
The proposed RP-HPLC method was found to
be specific, precise, accurate, rapid and economical
for simultaneous estimation of Atazanavir and
Ritonavir in Tablet dosage form. The developed
method was validated in terms of accuracy, precision,
linearity, robustness and ruggedness and results will
be validated statistically according to ICH guidelines.
The sample recoveries in all formulations were in
good agreement with their respective Label Claims
and this method can be used for routine Analysis.
ACKNOWLEDGEMENT
The authors would like to thank beloved
parents and all my well wishers, one and all who have
helped me directly and indirectly in completing this
project work.
REFERENCES
Adrienne C. Muller, An efficient HPLC method for
the quantitative determination of Atazanavir in
Human Plasma suitable for Bioequivalence and
Pharmacokinetic studies in healthy Human Subjects.
Journal of Pharmaceutical and Biomedical Analysis,
53(1), 2010, 113–118.
J. Venkateswara Rao, K. Srinivasu, N. Appala Raju
and K. Mukkanti, A Validated RP-HPLC method for
the determination of Atazanavir in Pharmaceutical
dosage form, E-Journal of Chemistry, 8(1), 2011, 453-
456.
M. Padmalatha, K.Vanitha Prakash and Eranna
Dopadally, Validated Reversed Phase High
Performance Liquid Chromatography method for the
estimation of Atazanavir Sulphate in Pharmaceutical
formulations. Oriental Journal of Chemistry, 26(1),
2010, 123-127.
R. K. Nanda, A.A. Kulkarni and P.B.Yadav,
Simultaneous Spectrophotometric estimation of
Atazanavir Sulphate and Ritonavir in tablets, Scholars
Research Library Der Pharma Chemica, 3(3), 2011,
84-88.
Ravindra Reddy Y. and A. Swetha Mallesh, Method
development and validation of Atazanavir and
Ritonavir in a combined dosage form by RP-HPLC
Vasavi and Patan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 814
Method, International Journal of Pharmacy &
Technology, 3(3), 2011, 3316-3334.
S. Colombo, N. Guignard, C. Marzolini, A. Telenti, J.
Biollaz and L.A. Decosterd, Determination of the
new HIV-Protease Inhibitor Atazanavir by Liquid
Chromatography after Solid-Phase Extraction. Journal
of Chromatography B Analytical Technologies in the
Biomedical and Life Sciences, 810 (1), 2004, 25-34.
S.G. Khanage, V.K. Deshmukh, P.B. Mohite, V.M.
Dhamak and S. Appala Raju, Development of
Derivative Spectrophotometric estimation of
Atazanavir Sulphate in bulk drug and Pharmaceutical
dosage forms. Int.J.Pharm.& Health Sci., 1(3),
2010, 49-154.
Sreenivasa Rao Chitturia, Yallappa Somappa
Somannavara, Badrinath Gupta Peruria, Srinivas
Nallapatia, and Hemant Kumar Sharmaa, Gradient
RP-HPLC method for the determination of Potential
Impurities in Atazanavir Sulfate, Journal of
Pharmaceutical and Biomedical Analysis, 55(1), 2011,
31-47.
Vishnu P. Choudhari, Nilesh A. Bari, Shailendra P.
Kela, Shailesh N. Sharma and Saroj V. Shirse,
Spectrophotometric simultaneous determination of
Atazanavir and Ritonavir in combined tablet dosage
form by Ratio Derivative and Area Under Curve
Method, Scholars Research Library Der Pharma
Chemica, 4(1),2012, 208-213.
Praveen and Janarthan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 815
Evaluation of anti arthritic activity of aqueous extract of
Hibiscus Platinifolius in albino rats Marri Praveen*, M.Janarthan
Nimra College of Pharmacy, Vijayawada, India
*Corresponding author E.Mail:[email protected]
ABSTRACT
Rheumatoid arthritis is a chronic, inflammatory disorder that may affect many tissues and organs, but
principally attacks flexible (synovial) joints. The process produces an inflammatory responses of the
capsule around the joints, secondary swelling of the synovial cells. The aim of the present study was to
investigate anti-arthritic activity of leaves of Hibiscus platinifolius linn on male Wister rats and estimation
of paw edema, body weight measurement and measurement of activity of marker enzymes like alanine
trans aminases(SGPT)and serum glutamate oxalo acetate transferases (SGOT) in serum by using Aqueous
extract of hibiscus platinifolius line. The study of anti-arthritic activity involves induction of arthritis to
rats of all groups using FCA and turpentine oil induced in i.p route, followed by subsequent treatment
with aqueous extraction at two different doses. i.e AEHP 200mg/kg and AEHP400mg/kg respectively.
Diclofenac sodium is used as a reference standard. paw edemas, paw height, paw volume were estimated
from the serum by using Freund’s complete adjuvant(FCA) and turpentine oil induced arthritis .The bio
chemical parameters were increased in all arthritic rats, there parameters were decreased by the
administration of aqueous extraction of Hibiscus platinifolius at dose of 200mg and 400 mg respectively.
From this study it has been concluded that the aqueous extract of leaves of Hibiscus platinifonlius having
good anti-arthritic activity, which is comparable to Diclofenac sodium.
Key words: Hibiscus platinifolius linn, Anti-Arthritic, Rats, Paw volume, Paw width, and Paw height.
INTRODUCTION
Hibiscus platanifolius Linn (Malvaceae)
known as Mapleleaved mallow is an important
medicinal plant. It is an evergreen tree, growing up to
10 m tall. Leaves are alternate, simple, stipulate,
petiolate and ovate to lanceolate, often with a toothed
or lobed margin. Leaves are usually 3-5 lobed, 6-12 ×
5-12 cm. Leaf are palmetely veined, entire or various
lobed. Flowers are pale pink, with each petal having a
deep pink base. Flowers are about 3-5 inches across.
Sepals are leathery, hairy. Stamen-column is 2-2.5cm
long, pale pink. Maple leaved mallow is native to
India.
MATERIALS AND METHODS
Preparation of extraction: The Hibiscus platinifolius
plant was collected during the march 2013 from Sri
Venkateshwara University, Tirupati, India. The plant
was authenticated by Dr. Madhava Chetty, Deparment
of Botany and voucher specimen of the plant were
preserved at institute herbarium library. Plant was
separately washed, wiped-dry, and subsequently
reduced to a coarse powder. About 100 g of the plant
material were separately extracted for 24 h aqueous
with intermittent vigorous shaking. The extracts were
filtered, concentrated with a rotary evaporator and
dried over a water bath at 45°Cshaking. The extracts
were filtered, concentrated with a rotary evaporator
and dried over a water bath at 45°C. The residue from
the plant parts were used for experimental analysis.
Acute toxicity: The acute toxicity of the Aqueous
extract of Hibiscus platinifolius was determined as per
the OECD guideline no. 423 (Organization for
Economic Cooperation and Development). It was
observed that the test extract was not mortal even at a
dose of 2000 mg/kg body weight. Hence, 200 mg/kg
and 400 mg/kg doses were selected for further study.
Ist Model:
Experimental protocol design:
Assessment of the parameters:
A) Effect of Aqueous extract Hibiscus platinifolius
paw oedema against FCA induced chronic arthritis
in rats: The FCA induced chronic anti-arthritic
activity of Aqueous extract of Hibiscus platinifolius
200mg/kg and 400mg/kg was carried out and Wistar
albino rats (150-200g) were divided into 4 groups,
contains 6 animals in each group.
Group I. Control group received vehicle (10 % v/v
tween 80; p.o.) + FCA induced changes in rat paw
oedema
Group II. Effect of Diclofenac (10 mg/kg; p.o.) on
FCA induced changes in rat paw oedema
Group III. AEHP (200 mg/kg; p.o.) on FCA induced
changes in rat paw oedema
Group IV. AEHP (400 mg/kg; p.o.) on FCA induced
changes in rat paw oedema.
Adjuvant arthritis was induced by the sub-
plantar injection of 0.1ml of Freund’s complete
adjuvant (FCA) on day zero (kalia et al). Everyday
animals were carefully and thoroughly inspected, by
Praveen and Janarthan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 816
examining the affected paw and the animals general
status. In FCA induced animals, the sub-plantar
injection of FCA produces local oedema after few
hours with a progressive increase reaching its
maximum upto 21st thday. On 0th, 7th, 14th, and 21
st
day the paw-oedema volume of each rat was measured
thoroughly in all groups. Inflammation in the paw
oedema was measured by using Digital
Plethysmometer (7140 UGO Basile). The change in
the paw-oedema volume for the Aqueous extract of
Hibiscus Platini folius was summarized in the Table1.
The percentage inhibition of paw oedema volume of
each treated groups is calculated by using the
following equation,Percentage inhibition,
% = (Vc – Vt / Vc) 100
Where, Vt = Mean paw volume of each treated group
Vc= Mean paw volume of control group
The width and height of the right paw of each rat was
measured with a digital Vernier caliper ruler before
and on subsequent testing days, after the induction of
arthritis according to Andersen et al.
Table 1: Effect of Aqueous extract of Hibiscus platinifolius on Body weight against FCA induced chronic arthritis in
rats
Groups Body weight
0 day 7th
day 14th
day 21st day
Control (10% tween80) 163.2±1.138 154.5± 2.405 141.7± 0.918 137.7± 0.988
Diclofenac (10 mg/kg) 154.7±1.647 168.2±1.493** 180.5±1.544*** 179.3±1.764***
AEHP 200mg/kg 163.3±1.054 177.7±1.054* 189.3±2.333** 183.5±1.765***
AEHP 400mg/kg 159.5±1.708 181.5±1.708** 188.3±1.764** 183.5±2.604***
All values are expressed as mean ± SEM, n=6, One way Analysis Variance (ANOVA) followed by Dunnett’s multiple
comparison test; ***p<0.001 as compared to control group; AEHP200mg/kg, AEHP 400mg/kg.
Table 2: Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic
arthritis in rats
2nd
model: (turpentine oil): turpentine oil induced
granuloma pouch in rat: Subcutaneous dorsal granuloma
pouch was made in ether anaesthetized rats by injecting 2
ml of air, followed by injection of 0.5 ml of turpentine oil
into it. All drugs were administered orally one hour prior to
turpentine oil injection and continued for seven consecutive
days. On day 7, the pouch was opened under anesthesia, the
amount of exudate was taken out with a syringe, and later
on the volume was measured and compared with those of
the control and standard group.
The Turpentine induced Acute anti-arthritic activity of
Aqueous extract Hibiscus platanifolius 200mg/kg and
400mg/kg was carried out on Wistar albino rats (150-200g)
were divided into 4 groups, contains 6 animals in each
group.
Group I. Control group received vehicle (10 % v/v tween
80; p.o.) + Turpentine induced changes in rat paw oedema
Group II. Effect of Diclofenac (10 mg/kg; p.o.) on
Turpentine induced changes in rat paw oedema
Group III. AEHP (200 mg/kg; p.o.) on Turpentine induced
changes in rat paw oedema
Group IV. AEHP (400 mg/kg; p.o.) on Turpentine induced
changes in rat paw oedema
Figure.1.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats
Groups Paw oedema volume (ml) (%EI) %inhibition of Oedema
1st day 7
th day 14
st day 21
st day
Control 10% tween80) 0.74±0.01 0.87±0.05 0.92±0.01 1.02±0.03 -----
Diclofenac(10 mg/kg) 0.64±0.01ns 0.48±0.02** 0.37±0.01*** 0.31±0.01*** 69.55
AEHP 200 mg/kg 0.75±0.01ns 0.78±0.03* 0.71±0.02**
0.69±0.01*** 45.58
AEHP 400 mg/kg 0.71±0.00ns 0.74±0.01* 0.68±0.01*** 0.64±0.03*** 32.58
Praveen and Janarthan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 817
Figure.2.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic
arthritis in rats
All values are expressed as mean ± SEM, n=6, One way Analysis of Variance (ANOVA) followed by Dunnett’s multiple
comparison, *p<0.05, **p<0.01 as compared to control group; AEHP 200mg/kg, AEHP 400mg/kg.
Statistical analysis: The data are expressed as mean ±
SEM. Statistical comparisons were performed by one-
way analysis of variance (ANOVA), followed by
Dunnett’s Multiple comparison test (DMCT). The results
were considered statistically significant if the p values
RESULTS AND DISCUSSION
FCA Model:
A. EEffect of Aqueousextract of Hibiscus platinifolius
on Body weight against FCA induced chronic
arthritis in rats: Body weight is one of the parameter in
arthritis there is significant difference between body
weights of each groups immediately after induction of
arthritis in animals. Thereafter control group showed
significant decrease in body weight after 3rd week
(p<0.001) as compared to standard and extract treated
groups. However there is significant increase body
weight in treated groups after 3rd week. standard group
(p<0.001), AEHP [200mg/kg (p<0.001)] and AEHP
[400mg/kg (p<0.001)] as compared to control group.
B. Effect of Aqueous extract of Hibiscus platinifolius
on paw oedema volume against FCA induced chronic
arthritis in rats: In FCA induced chronic arthritis model,
control group animals showed increased paw oedema
gradually upto 21st day. The test extract AEHP 200mg/kg
and AEHP 400mg/kg and Diclofenac showed significant
reduced right paw oedema (p<0.001), as compared to
control group.
C.Effect of Aqueous extract of Hibiscus platinifolius
on FCA induced rat chronic arthritis serum
biochemical parameters: The biochemical marker ALT,
AST and ALP was increased significantly in Control
(FCA) group. Diclofenac and test extract AEHP
200mg/kg and AEHP 400mg/kg was showed
significantly (p<0.001) decreased in ALT, AST ansd
ALP level as compared to control group.
Turpentine oil model:
Effect of Aqueous extract of Hibiscus platinifolius on
paw oedema volume against Turpentine induced
granuloma pouch in rats: The treatment of AEHP (200
and 400 mg/kg) significantly reduced the volume of
exudates (P<0.001) in turpentine oil‐induced granuloma
pouch dose dependently, which was comparable with the
effect of diclofenac (P <0.001).
NSAID’s are widely used clinically for RA.
However, despite their great number, their therapeutic
efficacy seems to be hampered by the presence of a
number of undesired and often serious side effects.
Selective COX-2 inhibitors make alternative approach to
arthritic treatment with reduced GI side effects, but on
long term treatment leads to serious cardiovascular and
thrombotic side effects. However, a series of new
biological monoclonal antibodies (anti-TNF, anti IL-1Ra
anti-CD 20, anti-IL-2, IL-4) were preferred for RA but
these are highly expensive.
The author has immensely fascinated by these aspects of
drug research and looked for some new safer anti-
inflammatory and anti-rheumatic drugs represents a new
challenging goal for acute and chronic inflammatory
conditions. This is the dissertation work consists of four
chapters with title of “Evaluation of AEHP as potential
anti-inflammatory and antiarthritic agents”.
The chronic inflammation involves the release of
various inflammatory mediators like cytokines (IL-1α
and TNF-α), granulocyte monocytes colony stimulating
factor (GM-CSF), platelet derived growth factor (PGDF)
and others. These mediators are responsible for the pain,
destruction of cartilage and leads to severe disability.
Paw swelling is one of the major factors in assessing the
degree of inflammation and efficacy of the drugs.
Adjuvant induced arthritis is non-specific immune
response within the joint can also result in inflammatory
and erosive disease. Paw swelling is an index of
Praveen and Janarthan Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 818
measuring the anti-arthritic activity of various drugs and
it is employed here to determine the activity of AEHP
200mg/kg and AEHP 400mg/kg. Reference standard
Diclofenac sodium, AEHP 200mg/kg and AEHP
400mg/kg administered groups showed marked reduction
in paw volume when compared with the arthritic control
group by inhibiting the release of inflammatory
mediators.
The cytoplasmic enzymes like AST and ALT
serves as indicators and suggestive for disturbances of the
cellular integrity induced by pathological conditions.
These enzymes are used as sensitive markers for
evaluation of protective activity, these markers attribute
towards persistent inflammation. The increased enzyme
activity may result from one of the several mechanisms
which include the release of various enzymes from
leukocytes, from necrotic or inflammed synovial tissue
and production and release of an increased amount of
enzymes due to altered synovial tissue. A positive
correlation observed between the leukocytes in the field
and the enzyme levels is considered as evidence for the
release of enzymes from the leukocytes. A loss of semi-
permeability of the synovial membrane has also been
correlated with the significant elevation of enzyme levels.
In present study, the decreased level of cytoplasmic
enzymes ALT s upports the protective role of the AEHP
200mg/kg, 400mg/kg and Diclofenac sodium. Granuloma
pouch technique was modified using turpentine oil as
irritant. An aseptic inflammationresulting in large volume
of haemorrhage exudate is elicited which resembles the
sub‐acute type of inflammation. Turpentine oil‐induced
granuloma pouch offer a model for exudative type of
inflammation. Though, the chemical mediators of this
type of response are unknown, protein synthesis is
necessary for the formation of granuloma. AEHP has
show potential inhibitory action on exudates formation.
Kinin is said to be the main mediator of granuloma, as it
not only vasodilate but also increase the vascular
permeability in the early stages of inflammation. Thus,
AEHP may possess anti‐kinin like activity.
CONCLUSION
Therefore drugs appear to be effective against
FCA induced arthritis and Turpentine induced
Inflammation. This finding justifies the usefulness of
AEHP in the treatment of inflammatory diseases
associated like arthritis. It is concluded that Aqueous
extract of Habiscus platinifolius possess significant anti-
arthritic activity, which is comparable to diclofenac
sodium.
REFERENCES
Anderson M.L, Eduardo H.R.S, Maria de Lourdes V.S,
Ana A.B.S, Seirgo T, Evaluation of acute and chronic
treatments with Harpagophytum procumbens on Freund’s
adjuvant induced arthritis in rats, J Ethno pharmacol,
2004; 91, 2004, 325-330.
Bradley D.W., Maynard J.E., Emery G., Webster H,
Transaminase activities in serum of long-term
hemodialysis patients, Clinchem, 11 (18), 1972, 1442.
Narendhirakannan R.T, Subramanain S, Kandaswamy M,
Antiinflammatory and lysosomal stability actions of
Cleome gynandra L studied in adjuvant induced arthritic
rats, Food ChemToxicol, 45, 2007, 1001-1012.
Paul H.W, What animal models are best to test novel
rheumatoid arthritis therapies? Current Rheum Review,
4, 2008, 277-288.
Robert A and Nezamis JE, The granuloma pouch as a
routine assay for anti‐phlogistic compounds, Acta
Endocr, 25, 1957, 105‐7.
Sarkar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 819
Some H.R. methodology/ techniques for costs reduction in companies to improve
profit M. Sarkar*
1, B. K. Sarkar
2, M. D. Gora
3, S. C. Verma
4
1.Sri Balaji College of Engineering & Technology, Dept of Pharmaceutical Management, Jaipur, Rajasthan.
2. National Research Institute for Panchakarma Central Council for Research in Ayurvedic Sciences
Cheruthuruthy, Trissur, Kerala.
3. Lohia College, Churu, Rajasthan, India.
4. Central Council for Research in Ayurvedic Sciences, New Delhi.
*Corresponding author: [email protected]
ABSTRACT
It is not easy to compete in the market today. Rising prices, shifting fuel rates, global competition,
varying labor rates around the world, and spiraling health insurance costs have made cost control a
moving target. Sometimes it seems that a company gets one set of expenses under control, and in the
meantime, another area of the company begins experiencing cost overruns. It is a never ending battle to
maintain company profitability. Controlling cost means monitoring and controlling updates and changes
to costs, budget, and the cost baseline of the project. Monitoring and controlling costs has two dimensions
to it: expenditure of project funds and the work performed as a result of those expenditures. One major
aspect of cost monitoring and controlling is to determine the relationship between the expenditures and
the accomplishments. Departments are under increasing pressure to reduce costs. The scale of cost
reduction required means that they will have to look beyond immediate short term savings and think more
radically about how to take cost out of the business and how to sustain this longer term. This will require
strong leadership, disciplined financial management and a corresponding change in organizational
culture.
Key words: Human resources, H R Methodology, Recruitment
INTRODUCTION
Human Resources (HR) is an indispensable
part of every business and HR services ensure the
development of a mutually satisfactory and productive
employer-employee relationship. Small business also
manages to have HR at their office. HR personnel are
responsible for forming employee policies, recruiting
and shortlisting candidates, managing payroll and
employee benefits. Many small businesses appoint a
staff member to manage HR related tasks. HR services
have the expertise to manage tasks efficiently,
protecting business from possible litigations. Now
days HR have shifted its focus from administration to
strategy development, an accurate assessment of HR-
related costs has become more crucial now.
Organizations need to be realistic in their hiring and
prioritize on the areas to focus on in order to find the
right candidates. Ultimate goal of HR should be
maximum utilization of resources to have desired
profit with in confined cost investment; this all
encourages HR to focus on cost reduction and now a
day’s HR practicing many policies as a tool of cost
reduction. (Risser R, 1993; Thomas K and Schmidt
W, 1976)
Methodology/techniques for cost reductions:
(McClure L, 2000; Cox T, 1994; Decker B, 1998)
Cost reduction through appropriate recruitment
Manufacturing cost reduction and process
optimization
Selection of proper business model
Cost reduction through supply chain
Debit/Credit cost reduction
Cost reduction through concession
Reduction in transportation charges
Utilization of resources
Utilization of IT/communication techniques
Outsourcing to reduce cost
Cost reduction through appropriate recruitment:
The hiring process needs to be designed to provide
both parties with information, data and clues, on what
the job will entail, much deeper than what is visible at
the tip of the iceberg. It must provide information on
aspects like information on the informal culture of the
team, how decisions are taken, relationship dynamics
etc. For some roles, job simulation can be a great aid
where the person experiences some challenging aspect
of the job to see how he/she perform and feel. This
gives the candidate a chance to experience the job
even before he/she is actually put on the job. These
assessments are also useful for vertical movements in
the organization, especially when moving from an
operational job, to a managerial role. There are many
situations where managers are not ready to handle a
role as they have never been put in those situations,
such as, giving feedback to an underperformer or
Sarkar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 820
handling delicate issues like complaints and conflicts.
Organizations need to focus on accelerating
development on the first days and weeks from joining
so that the new employee can become productive
faster. In reality, not many organizations focus on
setting expectations, creating net worth for people,
especially in a complex work environment. Early
development has immense benefits: from fewer
mistakes and faster productiveness, to early success.
Developing a cost-reduction strategy that maximizes
efficiency without compromising growth potential is a
tricky proposition. This requires identification of core
competencies where efficiency can be improved, trim
and consolidate non-core functions, and reinvest the
savings in critical business assets.
Manufacturing cost reduction and process
optimization: Challenging economic conditions and
tough competition make production errors and waste
unacceptable. Machine vision technology can help to
reduce manufacturing costs and optimize processes.
By networking vision systems throughout production
to catch defects at the source and potentially prevent
errors altogether, manufacturers can minimize scrap
and costly rework. If profit margins are narrow,
reduced manufacturing and supply chain costs can
often be the difference between profit and loss. This
can be optimized by Improving management of work
in process, reducing inventory, optimizing availability
and use of production tools and minimizing
distribution of non-conforming products.
Selection of proper business model
Organization facing severe margin pressure
has a greater imperative to reduce their costs through a
wide range of cost levers. On the other hand, healthy
companies can continue to focus on incremental
process improvement. The most immediate cost
savings may be achieved in streamlining General and
Administrative functions (G&A) and cutting external
spending on materials and services. Improvements in
these areas can deliver significant savings almost
immediately, with little or no adverse effect on the
operations. Company should also look beyond
organizational silos to include cost reduction
opportunities across the entire enterprise. A quick but
comprehensive analysis of actionable spending (i.e.
costs that are within the company’s control over the
next 12 months) can help identify the biggest
opportunities and set priorities. The selection of right
business model in some cases may be the most
effective way for a company to achieve the required
savings through a transformation of its business
model.
Cost reduction through supply chain: Reduce
supply costs by shopping around to find the best deal
on office supplies, production equipment, and raw
materials. Consider hiring a procurement officer to
monitor and maintain supply levels, as their training
and knowledge are invaluable assets to organization.
Ensure that the decision makers within the company
know how to find the best prices by using a variety of
tools and resources. Internal inventory management is
cost efficient, however; larger companies may find
external inventory management a viable option.
Create an automated system to automatically order
new supplies, which reduces back office labor
expenses. Improve efficiency and maximize space by
organizing inventory supplies and modifying the
layout of the room or warehouse. Keep the aisles free
of debris and narrow, with enough room for handcarts,
forklifts, or other equipment. Consider liquidating
products that are expiring soon or have a history of
poor sales. Consider a variety of programs, such as
vendor managed inventory systems (VIM), vendor
stocking programs (VSP), and common supplier joint
procurement policies. Choosing a VSP reduces
inventory costs for less popular items and increases
supplier reliability and dependency. Alleviate the
nightmare of managing inventory by giving the
responsibility to the vendor, which reduces inventory
and related expenses.
Debit/Credit cost reduction: Encourage cash-based
transactions such as check, money order, and cash.
Form partnerships with processing authorities and
choose a plan that is cost effective for organization.
Streamline the purchasing process by using auto-
generated purchase orders and advanced notification
systems. Additionally automate the shipping and
receiving procedure by using electronic metered
postage and bulk discounts when applicable. Review
PO history as part of cost reduction strategy at the end
of the year.
Cost reduction through concession: Every company
orders certain supplies more than other products.
Consider purchasing non-perishable items with long
shelf lives in bulk to reduce supply and labor costs.
Ordering items less frequently reduces the costs
associated with placing orders and saves money by
lowering the cost per unit. Before placing the order,
ensure the savings per unit are worth the risk, given
current market demands.
Reduction in transportation charges: Attempt to
purchase items in large groups based on the
manufacturer or vendor to save on freight charges,
utilizing merge-in-transit techniques to reduce transit
Sarkar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 821
times. When shipping to consumers, utilize bulk
discounts by shipping multiple quantities of the same
item. Choose carriers and form partnerships with them
to reduce shipping charges. Order inventory early to
avoid rush-processing charges and expedited delivery
fees, which add up quickly for bulk orders.
Maximum utilization of resources
Do comparison shopping and ask current service
providers to match the lowest price.
Reduce maintenance frequency for building,
equipment, etc.
Share office or building space with another
business
Review and refine receiving protocols to ensure
products hit the shelves with minimal delay by
maintaining adequate order supply rates and
throughput levels. Maintain optimal levels by
reducing safety stock inventory and increasing
order fill rates.
Utilization of IT/communication techniques
Computer to computer phone calls are free and
other rates are much lower than traditional
business phone lines.
Establish presence on social media sites for
marketing instead of spending money on
traditional media (newspaper, magazine, mail).
Allow employees to telecommute, where
possible, instead of leasing an office space.
Cut down on printing and paper based
communication. Use electronic communication,
including emails and text messaging.
Use video conferencing services with clients and
employees instead of spending money on travel.
Another great way to improve productivity while
lowering costs is to eliminate paper flow. The best
approach is to place all documents online for
employees to download, read, and make changes to.
Also, instruct all employees not to print e-mails and
other unnecessary documents that will usually end
up in the trash upon a few quick glances.
Outsourcing to reduce cost
Hire temporary workers on as needed basis
instead of permanent ones.
Lease equipments as opposed to buying them.
Outsource computer maintenance for a flat
monthly fee rather than hiring a full-time
employee.
SUMMARY
Companies that are losing money, need to
increase profits, or must become more competitive
need to cut expenses in order to succeed. Knowing
how to implement effective cost reduction strategies
can be the determining factor in the survival of a
business. A good manager understands the importance
of cost reduction to the health of a company. Bloated
expense accounts can eat up profits quickly. A cost
reduction plan is one that focuses on lowering costs in
every business activity. The activities vary by type of
business. The Cost reduction essential for increasing
profits, improving competitive standing and to reduce
waste; which all ultimately improve productivity.
References
Cox T, Cultural diversity in organizations: theory,
research & practice. San Francisco: Berrett-Koehler
Publishers; 1994.
Decker B, The art of communicating: achieving
interpersonal impact in business, Los Altos, CA: Crisp
Publications: 1988.
McClure L, Anger and conflict in the workplace: spot
the signs, avoid the trauma, Manassas Park VA:
Impact Publications; 2000.
Risser R. Stay out of court: the manager’s guide to
preventing employee lawsuits, Englewood Cliffs, New
Jersey: Prentice Hall; 1993.
Thomas K. and Schmidt W, A survey of managerial
interests with respect to conflict, Academy of
Management Journal, 1976.
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 822
Analytical method development and validation of Artesunate and Amodiaquine
hydrochloride in tablet dosage form by RP-HPLC P RajaRao*, Nanda Kishore Agarwal
Department of pharmaceutical analysis, Nimra College of Pharmacy, Jupudi, Vijayawada.
*Corresponding author: [email protected]@gmail.com, phone no: 9652598593.
ABSTRACT
A simple, specific and accurate reverse phase high performance liquid chromatographic method was
developed for the simultaneous determination of Artesunate (ART) and Amodiaquine hydrochloride
(AMO) in pharmaceutical dosage form. The column used was inertsil ODS C18 (250*4.6mm,5µ) in
isocratic mode, with mobile phase containing phosphate buffer- acetonitrile-methanol (50:30:20) adjusted
to pH 5.8 using ortho phosphoric acid was used and injection volume of 20µL, with a flow rate of
1.0ml/min. and effluents were monitored at 208 nm. The retention times of artesunate and amodiaquine
hydrochloride were 5.03 min and 2.77 min, respectively. The linearity for Artesunate and Amodiaquine
hydrochloride were in the range of 15-35 mcg/ml and 45.9-107.1 mcg/ml respectively with correlation
coefficient of r2=0.999 for both.The assay of the proposed method was found to be 98.56% and 99.08%.
The recoveries of artesunate and amodiaquine hydrochloride were found to be 99.81% and 99.3%,
respectively. The % RSD from reproducibility was found to be <2%. The proposed method was
statistically evaluated and can be applied for routine quality control analysis of artesunate and
amodiaquine hydrochloride in bulk and in Pharmaceutical dosage form.
Key Words:, Artesunate & Amodiaquinehydrochloride RP-HPLC, Inertsil ODS, Validation, Forced
degradation studies.
INTRODUCTION
Artesunate belongs to artemesinin group
effective in the treatment of malarial patients.
Amodiaquinehydrochloride is an antimalarial
agent similar to chloroquine in structure and
activity which belongs to the class of 4-
aminoquinoline widely used in both antimalarial
and anti-inflammatory pharmaceutical
formulations, alone or combination with other
drugs. Artesunate is chemically
(3R,5aS,6R,8aS,9R,10S,12R,12aR) - Decahydro -
3,6,9 - trimethyl-3, 12epoxy - 12H - pyrano [4,3-
j] -1,2-benzodioxepin-10-ol,hydrogensuccinate,
and amodiaquine hydrochloride is 4-[(7-chloro-
4-quinolyl)amino]-2-[(diethylamino)methyl]
phenol dihydro chloride dihydrate was
successfully used as one content in association
with other drugs in the treatment of malaria.
Literature survey revealed that a various
analytical methods have been reported for the
determination of Artesunate and Amodiaquine
hydrochloride in pure drug, pharmaceutical
dosage forms and in biological samples using
liquid chromatography either in single or in
combined forms. Confirmation of the
applicability of the developed method was
validated according to the International
Conference on Harmonization (ICH) for the
simultaneous determination of Artesunate and
Amodiaquine hydrochloride in bulk and in tablet
dosage form.
MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV
win 5software UV-VISIBLE spectrophotometer with
1cm matched quartz cells. Schimadzu HPLC equipped
with SPD 20A UV-VIS detector and the column used
was INERTSIL ODS C18 (250*4.6mm, 5µ). The data
acquisition was performed by using LC solutions
software. In addition an analytical balance (DENVER
0.1mg sensitivity), digital pH meter (Eutech pH 510),
a sonicator (Unichrome associates UCA 701) were
used in this study.
Figure.1.Structure of Artesunate Figure.2. Structure of Amodiaquine hydrochloride
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 823
Chemicals and reagents: Artesunate and
Amodiaquinehydrochloride pure sample was taken as
a gift sample from local labs and dosage form
“falcinil” manufactured by zuventus was purchased
from local pharmacy. Other chemicals all are of
HPLC grade.
Preparation of mobile phase: Potassium dihydrogen
phosphate was weighed (2g) and dissolved in 1000 ml
of water. Finally the pH was adjusted to 5.8 with ortho
phosphoric acid (0.1 M). The solution was sonicated
for 10 minutes and filtered using Whatman filter paper
(No.1) and used. Then mix the buffer, acetonitrile and
methanol in 50:30:20 compositions respectively.
Preparation of stock solutions:
Artesunate standard stock solution: An accurately
weighed quantity of artesunate 25 mg was transferred
to the 100ml volumetric flask add 30ml of diluents
(buffer:ACN:methanol 50:30:20), sonicate to dissolve,
dilute upto the mark with diluent and mix
well.(Concentration of artesunate is about 250 g/ml).
Amodiaquine hydrochloride standard stock
solution: An accurately weighed quantity of
Amodiaquine hydrochloride 76.5 mg was transfer to
the 100ml volumetric flask add 30ml of diluent,
sonicate to dissolve, dilute up to the mark with diluent
and mix well. (Concentration of
Amodiaquinehydrochloride is about 765 g/ml).
Preparation of standard: Take 10 ml solution from
standard stock solution of Artesunate and 10ml
solution from standard stock solution of Amodiaquine
hydrochloride in 100 ml volumetric flask and make up
the volume upto the mark with diluents.
(Concentration of Artesunate is about 250 g/ml).
(Concentration of Amodiaquine hydrochloride is
about 765g/ml).
Preparation of the sample solution:
The powder equivalent to 25 mg of Artesunate and
76.5mg of Amodiaquine hydrochloride were weighed
and taken into a 100mL volumetric flask. To this
25mL of diluents was added and sonicated for 15min
to dissolve the drugs then made up the volume to
required volume with the diluents. From this solution
10ml was taken into a 100mL flask and made up to
final volume with diluents to get concentration of
Artesunate is about 250g/ml, concentration of
Amodiaquine hydrochloride is about 765g/ml and
filtered through 0.45µ filter under vacuum filtration.
From this stock solution further dilutions were made
for the validation of the method developed.
RESULTS AND DISCUSSION
Method Validation:
Specificity: Specificity is the ability of analytical
method to measure accurately and specifically the
analyte in the presence of components that may be
expected to be present in the sample. The specificity
of method was determined by spiking possible
impurities at specific level to standard drug solution
(100ppm). The diluent and placebo solutions were
also injected to observe any interference with the drug
peak. The results are tabulated in the table no-2 and
the chromatogram was shown in the figure no- 2, 3.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given
range. The linearity of ARTESUNATE was in the
concentration range of 15- 35 %, for
AMODIAQUINEHYDROCHLORIDE 45.9-107.1%.
From the linearity studies calibration curve was
plotted and concentrations were subjected to least
square regression analysis to calculate regression
equation. The regression coefficient was found to be
0.999 and shows good linearity for both the drugs.
The results are tabulated in the table no-3 and the
chromatogram was shown in the figure no-.4, 5.
Precision: Precision is the degree of closeness of
agreement among individual test results when the
method is applied to multiple sampling of a
homogeneous sample. Study was carried out by
injecting six replicates of the same sample
preparations at a concentration of Artesunate 25
ppm/ml & Amodiaquinehydrochloride 76.5 ppm/ml.
The results are tabulated in the table no-5.
Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the
measure of exactness of the method. Accuracy of the
method was evaluated by standard addition method.
Recovery of the method was determined by spiking an
amount of the pure drug (80%,100% ,120%) at three
different concentration levels in its solution has been
added to the pre analyzed working standard solution
of the drug. The results are tabulated in the table n-5.
LOD & LOQ: LOD is the lowest concentration of
analyte in a sample that can be detected but not
quantified under experimental conditions. The LOD
values were determined by the formulae LOD=3.3σ/s
(where σ is the standard deviation of the responses
and s is the mean of the slopes of the calibration
curves).
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 823
LOQ is the lowest concentration of analyte in a
sample that can be determined with acceptable
precision and accuracy under experimental conditions.
It is a parameter of the quantitative determination of
compounds in the mixtures. The LOQ values were
determined by the formulae LOD=10σ/s. The results
are tabulated in the table no-5
Forced degradation of Artesunate and
Amodiaquine hydrochloride Acid degradation: Acid degradation was determined
by taking 5ml of stock solution in 10ml volumetric
flask and to this 2ml of 0.1N HCl was added and
sonicate for 5min, kept aside for 12hrs at room
temperature. After 12hrs the solution was neutralized
with 2ml of 0.1N NaoH then diluted with diluents to
get a concentration of 10µg/ml solution and analysed
to recorded chromatogram.
Base Degradation: Base degradation was determined
by taking 5ml of stock solution in 10ml volumetric
flask and to this 2ml of 0.1N NaoH was added and
sonicate for 5min, kept aside for 12hrs at room
temperature. After 12hrs the solution was neutralized
with 0.1N HCl then diluted with diluents to get a
concentration of 10µg/ml solution and analysed to
recorded chromatogram.
Oxidative degradation: Oxidative degradation was
determined by taking 5ml of stock solution in 10ml
volumetric flask and diluted up to the mark with 5%
H2O2 and kept aside for 12hrs. After 12hrs the
solution was diluted with diluents to get a
concentration of 10µg/ml solution and analysed to
recorded chromatogram.
Thermal degradation: Sample powder equivalent to
100mg of Artesunate and 12.5mg of Amodiaquine
hydrochloride was taken and kept in a controlled
temperature oven at 800
c for 12hrs. After 12hrs the
powder was diluted with diluents to get a
concentration of 10µg/ml solution and analysed to
recorded chromatogram.
Photolytic degradation: The Artesunate and
Amodiaquine hydrochloride powder and solutions of
both were prepared and exposed to light to determine
the irradiation of light on the stability of solution and
powder form of drugs. Approximately 100mg of drug
powder and 1mg/ml solution were spread on a glass
dish in a layer that was less than 2mm thickness and
were placed in a light cabinet and exposed to UV light
at 300-400nm for 12hrs. After 12hrs the samples are
removed and diluted with diluents to get a
concentration of 10µg/ml solution and analysed to
recorded chromatogram.
Several trials has made until getting good
peak resolution, acceptable plate count and tailing
factor. Method was optimized and the retention times
of Artesunate and Amodiaquine hydrochloride was
reported as 5.03 &2.77
Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. Hence the proposed method was found to be
specific.
Linearity: From the Linearity data it was observed
that the method was showing linearity in the
concentration range of 15-35μg/ml for Artesunate and
45.9-107.1 μg/ml for Amodiaquinehydrochloride
Correlation coefficient was found to be 0.999 for both
the compounds.
Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were 99.81% for
Artesunate and 99.30% for
Amodiaquinehydrochloride, which shows that the
method was accurate.
Precision: The %RSD for the sample chromatograms
of method precision were found to be 0.21 &1.48 (Rt
& Area) for Artesunate and 0.24 &0.73 (Rt & Area)
for Amodiaquinehydrochloride. Hence it passes
method precision.
Robustness: All the system suitability parameters are
within limits for variation in flow rate (±0.2 ml).
Hence the allowable flow rate should be within 0.8 ml
to 1.2 ml. All the system suitability parameters are
within limits for variation (±2nm) in wavelength.
Hence the allowable variation in wavelength is ± 2nm
LOD & LOQ: LOD and LOQ of Artesunate was
found to be 2.07, 6.27 and for Amodiaquine
hydrochloride was found to be 1.58, 4.78 respectively.
All the system suitability parameters are within in the
limits when the drugs are subjected to stress
conditions like acid, base peroxide, thermal and
photolysis. The results obtained were satisfactory and
good agreement as per the ICH guidelines.
Table.1.Details of marketed Formulation
Brand name Content Mfg.Company
FALCINIL AQ ART & AMO (100mg & 306mg Respectively)
Zuventus
824
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 824
Table.2.Optimized chromatogram conditions for Artesunate and Amodiaquine hydrochloride
Table.3.Specificity Data for Artesunate and Amodiaquine hydrochloride
Table.4.Linearity data for Artesunate and Amodiaquine hydrochloride
Table.5.Summary of validation parameters Parameter Artesunate Amodiaquine hydrochloride
Linearity 15-35µg/ml 45.9-107.1µg/ml
Precision(% RSD) 0.21 (Rt) 1.48(Area) 0.24 (Rt) 0.73(Area)
Accuracy 99.81% 99.3%
LOD & LOQ 2.07,6.27 1.58, 4.78
Assay 98.56% 99.08%
Table.6.Summary of Forced degradation data for Artesunate and Amodiaquinehydrochloride
Stress Condition Time(hrs) Retention
Time
Time(hrs) Retention Time
As such 12hrs 5.033 12hrs 2.777
Acid Hydrolysis (0.1 N, at RT) 12hrs 5.033 12hrs 2.777
Base Hydrolysis (0.1N at RT) 12hrs 5.033 12hrs 2.777
Oxidation (5% H2O2 at RT) 12hrs 5.053 12hrs 2.783
Photolysis(UV Light and sunlight) 12hrs 5.053 12hrs 2.783
Thermal (at 800c) 12hrs 5.040 12hrs 2.780
Column Inertsil ODS C18 (250*4.6mm,5µ)
Mobile phase Phosphate Buffer pH 5.8:ACN:Methanol(50:30:20)
Flow rate 1.0 ml/ min
Wavelength 208 nm
Injection volume 20 l
Column temperature Ambient
Run time 8 min
Artesunate Amodiaquine hydrochloride
Standard
Injection
Retention
time
Area Theoretical
Plates
Retention
time
Area Theoretical
Plates
5.03 315.58 4028 2.777 4586.64 2808
5.04 324.64 4039 2.780 4549.66 2973
5.05 298.92 3919 2.783 4538.27 2821
Sample
Injection
5.05 319.49 4060 2.783 4587.39 2980
5.03 304.96 4338 2.770 4512.74 2952
5.06 309.21 4220 2.790 4564.21 2995
Blank injection - - - - - -
For Artesunate For Amodiaquine hydrochloride
Mcg/ml Area Rt Mcg/ml Area Rt
15 214.518 5.060 45.9 2981.917 2.787
20 277.385 5.023 61.2 3680.566 2.740
25 337.549 5.053 76.5 4650.723 2.777
30 409.413 5.063 91.8 5266.344 2.790
35 463.805 5.060 107.1 6014.413 2.787
Slope 12.61 Slope 50.66
Correlation
coefficient
0.9987 Correlation
Coefficient
0.9954
Intercept 25.233 Intercept 663.41
825
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 825
Figure.1.Chromatogram of standard drug
Figure.2.Chromatogram for specificity sample
Figure.3.Chromatogrphy for blank
Figure.4. Linearity plot for Artesunate Figure.5.Linearity plot for Amodiaquine
hydrochloride
y = 12.612x + 25.233 r² = 0.9987
0
50
100
150
200
250
300
350
400
450
500
0 10 20 30 40
Are
a
Conc
Linearity of Artesunate
y = 50.659x + 663.41 r2= 0.9954
0
1000
2000
3000
4000
5000
6000
7000
0 20 40 60 80 100 120
Are
a
Conc
Linearity of Amodiaquine Hcl
826
Raja Rao and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 826
Figure.6. Acid degradation Figure.7. Base degradation
Figure.8.Thermal Degradation Figure.9.Photolytic Degradation
Figure.10.Peroxide degradation CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of
ICH guidelines for method validation. The proposed
method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is validated
and can be used for routine and stability sample analysis
REFERENCES
Catherine Orrell, Francesca Little, Peter Smith,
Peter Folb, Walter Taylor, Piero Olliaro, Karen I.
Barnes, Pharmacokinetics and tolerability of
Artesunate and Amodiaquine alone and in
combination in healthy volunteers, Eur J Clin
Pharmacol, 64, 2008, 683–690.
Odedara MH, Faldu SD, Dadhania KP, RP-
HPLC Method for Simultaneous Estimation of
Artesunate and Amodiaquine HCL in their
combined pharmaceutical dosage form, JPSBR,
2(3), 2012, 114-117.
P.S.Jain, A.J.Chaudhari, and S.J.Surana, Selective
high performance liquid chromatographic
determination of amodiaquine and artesunate in
bulk and pharmaceutical formulation, Journal of
applied pharmaceutical science, 3(3), 2013, 066-
070.
Santosh Gandhi, Padmanabh Deshpande, Pankaj
Jagdale, Godbole Varun, A simple and sensitive
RP-HPLC method for simultaneous estimation of
Artesunate and Amodiaquine in combined tablet
dosage form, Journal of Chemical and
Pharmaceutical Research, 2(6), 2010, 429-434
429.
827
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 828
Analytical method development and validation for the simultaneous estimation of
Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage
forms by RP-HPLC Syed Shaheda*, Nanda Kishore Agarwal,
Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9030167419
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise reverse
phase high performance liquid chromatographic method for the simultaneous estimation of Rabeprazole
sodium and Itopride hydrochloride in pure and pharmaceutical dosage forms. Rabeprazole and Itopride
were well separated using a Thermohypersil ODS C18 column of dimension 250 × 4.6, 5µm and Mobile
phase consisting of Sodium dihydrogen orthophosphate:Acetonitrile ( pH-5.8) in the ratio of 60:40v/v at
the flow rate 1 ml/min and the detection was carried out at 209nm. The Retention time for Rabeprazole
and Itopride were found to be 1.950, 5.027 respectively. The developed method was validated for
recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was
successfully applied to Rabeprazole sodium and Itopride hydrochloride combination pharmaceutical
dosage form.
Key Words: RP-HPLC, Rabeprazole sodium, Itopride hydrochloride.
INTRODUCTION
Rabeprazole is chemically 2- [[[4-(3-
Methoxypropoxy) – 3 – Methyl – 2 - Pyridinyl] -
Methyl]Sulfinyl]-1H-Benzimidazole Sodium salt,
belongs to a class of antisecretory compounds
(substituted benzimidazole proton-pump inhibitors)
that do not exhibit anticholinergic or histamine H2-
receptor antagonist properties, but suppress gastric
acid secretion by inhibiting the gastric H+/K
+ATPase
(hydrogen-potassium adenosine triphosphatase) at the
secretory surface of the gastric parietal cell. Because
this enzyme is regarded as the acid (proton) pump
within the parietal cell, rabeprazole has been
characterized as a gastric proton-pump inhibitor.
Rabeprazole blocks the final step of gastric acid
secretion.
Itopride hydrochloride, N - [[4 - (2 -
Dimethylaminoethoxy) phenyl] methyl] - 3, 4-
dimethoxybenzamide is a synthesized gastroprokinetic
agent. It has been shown to involve an amplification
of the prokinetic action of acetylcholine in the
gastrointestinal tract by increasing the release of
acetylcholine through the inhibition of the D2
receptors, as well as decreasing the metabolism of this
transmitter by inhibiting acetylcholinesterase enzyme.
Itopride increases acetylcholine concentrations by
inhibiting dopamine D2 receptors and
acetylcholinesterase. Higher acetylcholine increases
GI peristalsis, increases the lower esophageal
sphincter pressure, stimulates gastric motility,
accelerates gastric emptying, and improves gastro-
duodenal coordination. Literature survey revealed that
very few methods have been reported for the analysis
of Rabeprazole and Itopride combinational dosage
forms which include UV spectroscopy, Reverse Phase
High performance Liquid Chromatography, HPTLC
methods. The present study illustrate development and
validation of simple, economical, selective, accurate,
precise RP-HPLC method for the determination of
Rabeprazole sodium and Itopride hydrochloride in
bulk and Pharmaceutical dosage forms as per ICH
guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of
Rabeprazole sodium and Itopride hydrochloride in
combined dosage form using most commonly
employed column (C18) and simple mobile phase
preparation. In the present proposed work a successful
attempt had been made to develop a method for the
simultaneous estimation of pharmaceutical dosage
form a Rabeprazole sodium and Itopride
hydrochloride and validate it. From the economical
point of view and for the purpose of routine analysis,
it was decided to develop a more economical RP-
HPLC method with simple mobile phase preparation
for the estimation of Rabeprazole sodium and Itopride
hydrochloride combinational dosage form. The
method would help in estimate of drugs in single run
which reduces the time of analysis and does not
require separate method for each drug. Thus, the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage
forms.
MATERIALS AND METHODS
Quantitative HPLC was performed on a high
performance liquid chromatograph –Shimadzu
prominance HPLC system connected with
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 829
Spinchrome-CFR Software. The drug analysis data
were acquired and processed using Spinchrome-CFR
software running under Windows XP on a Pentium
PC and Thermohypersil ODS C18 column of
dimension 250 × 4.6, 5µm particle size. In addition an
analytical balance (SHIMADZU 0.1mg sensitivity),
digital pH meter (Polmon Lp-137), a sonicator (Lab
india) were used in this study.
Standards and chemicals used: Pharmaceutical
grade Rabeprazole sodium and Itopride hydrochloride
were kindly supplied as a gift sample by Chandra
Labs, Hyderabad,Andhra Pradesh, India. Acetonitrile
was of HPLC grade and Purchased from E. Merck,
Darmstadt, Germany. Water HPLC grade was
obtained from a Milli-QRO water purification system.
Rabeprazole sodium and Itopride hydrochloride
Capsules available in the market as Rablet-IT (Hetero
labs limited, Himachalpradesh, India.) in composition
of Rabeprazole sodium (20mg), Itopride
hydrochloride (150mg).
Preparation of mobile phase: Transfer 0.4825gm of
Sodium Dihydrogen Orthophosphate into 100ml of
beaker, dissolve and dilute up to the volume with
water. Then adjust its pH to 5.8. Now,The buffer
adjusted pH to 5.8:Acetonitrile were mixed to the ratio
(60:40 v/v) and filtered through 0.45µ membrane filter
and degassed by sonication.
Preparation of calibration standards: 75mg Itopride
and 10mg Rabeprazole was taken into a 100 ml of
volumetric flask, diluted to 50ml with mobile phase
and sonicated for 10 minutes and made up with
mobile phase. This is taken as a 100% concentration.
From the above, pipette out 0.6,0.8,1.0,1.2 and 1.4 ml
of solution and transfer each of them in to a 10ml
volumetric flask. Dilute with mobile phase to get
concentrations of 60,80,100,120 and 140 µg/mL
respectively. Linearity of the method was determined
by mean of calibration graph using an increasing
amount of each analyst. Linearity was evaluated by
visual inspection of a calibration graph.The calibration
curves were plotted over a concentration range of 6-14
µg/ml for Rabeprazole sodium and 25-125 µg/ml
Itopride. calibration curves were constructed by
plotting absorbance versus concentration and the
regression equations were calculated.
System suitability: System suitability are an integral
part of chromatographic system. To ascertain its
effectiveness, certain system suitability test
parameters were checked by repetitively injecting the
drug solutions at 100% concentration level for
Rabeprazole sodium and Itopride hydrochloride to
check the reproducibility of the system. At first the
HPLC system was stabilized for 40 min. One blank
followed by six replicate analysis of solution
containing 100% target concentration of Rabeprazole
sodium and Itopride hydrochloride were injected to
check the system suitability. To ascertain the system
suitability for the proposed method, a number of
parameters such as theoretical plates, peak
asymmetry, and retention time were taken and results
were presented in Table 1.
Recommended procedure:
Calibration curves for Rabeprazole sodium and
Itopride hydrochloride: Replicate analysis of
solution containing 6-14µg/mL, 25-125µg/mL of
Rabeprazole sodium and Itopride hydrochloride
sample solutions respectively were injected into
HPLC according to the procedure in a sequence and
chromatograms were recorded. Calibration curves
were constructed by plotting by taking concentrations
on X-axis and ratio of peak areas of standards on Y-
axis and regression equation were computed for both
drugs and represented in Table .6
Analysis of marketed formulation: The content of
ten capsules were weighed accurately. Their average
weights were determined. Powder of capsules
equivalent to 75mg of Itopride and 10mg of
Rabeprazole sodium were weighed and taken in a 50
ml volumetric flask, dissolved in Mobile phase,
shaken and sonicated for about 20 minutes then
filtered through 0.45µ membrane filter. The filtered
solution was further diluted (5 to 50ml) in the mobile
phase to make the final concentration of working
sample equivalent to 100% of target concentration.
The prepared sample and standard solutions were
injected into HPLC system according to the
procedure. from the peak areas of Rabeprazole sodium
and Itopride hydrochloride the amount of the drugs in
the sample were computed. The contents were
calculated as an average of six determinations and
experimental results were presented in Table 4. The
representive standard and sample chromatograms
were shown in fig.4 and fig.5.
Validation study of Rabeprazole sodium and
Itopride hydrochloride: An integral part of
analytical method development is validation. Method
validation is the process to confirm that the analytical
procedure employed for a specific test is suitable for
its intended use. The newly developed RP-HPLC
method was validated as per International Conference
on Harmonization (ICH) guidelines for parameters
like specificity, system suitability, accuracy, linearity,
precision (repeatability), limit of detection (LOD),
limit of Quantification (LOQ) and robustness.
Specificity: The effect of wide range of excipients
and other additives usually present in the formulation
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 830
of Rabeprazole sodium and Itopride hydrochloride in
the determination under optimum conditions were
investigated. The specificity of the RP-HPLC method
was established by injecting the mobile phase and
placebo solution in triplicate and recording the
chromatograms. The common excipients such as
lactose anhydrous, microcrystalline cellulose and
magnesium stearate have been added to the sample
solution injected and tested.
Precision: precision study of sample (Rabeprazole
and Itopride) was carried out by estimating
corresponding responses 6 times on the same day for
the 100% target concentration. The percent relative
standard deviation (%RSD) is calculated which is
within the acceptable criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range
of 6-14µg/ml and 25-125µg/mL Rabeprazole sodium
and Itopride hydrochloride respectively. Method of
least square analysis is carried out for getting the
slope, intercept and correlation coefficient, regression
data values and the results were presented in Table 6.
The representative chromatograms indicating the
sample were shown in fig.5. A calibration curve was
plotted between concentration and area response and
statistical analysis of the calibration curves were
shown in fig. 6&7.
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Rabeprazole sodium and Itopride hydrochloride by the
method of addition. Known amount of Rabeprazole
sodium and Itopride hydrochloride at 50%, 100%,
150% is added to a pre quantified sample solution.
The recovery studies were carried out in the tablet in
triplicate each in the presence of placebo. The mean
percentage recovery of Rabeprazole sodium and
Itopride hydrochloride at each level is not less than
99% and not more than 101%.
Robustness: The robustness is evaluated by the
analysis of Rabeprazole sodium and Itopride
hydrochloride under different experimental conditions
such as making small changes in flow rate (±0.2
ml/min), λmax (±5), column temperature (±5), mobile
phase composition (±5%), and pH of the buffer
solution.
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified. Under the stated experimental
conditions the limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy.
Limit of detection and limit of quantification were
calculated using following formula LOD=3.3(SD)/S
and LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of
the calibration curve.
RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred
for the determination of Rabeprazole sodium and
Itopride hydrochloride. Preliminary experiments were
carried out to achieve the best chromatographic
conditions for the simultaneous determination of the
drug substances. Several column types and lengths
were tried considering other chromatographic
parameters. C18 column with a 4.6 mm inner diameter
and 5µm particle size was chosen. The detection wave
length was selected as 209nm with UV detector.
Chromatographic conditions were optimized by
changing the mobile phase composition and buffers
used in mobile phase. Different experiments were
performed to optimize the mobile phase but adequate
separation of the drugs could not be achieved. By
altering the pH of buffer results a good separation.
Different proportions of solvents were tested.
Eventually the best separation was obtained by the
isocratic elution system using a mixture of Sodium
dihydrogen orthophosphate buffer (adjusted the pH to
2): Acetonitrile (60:40, v/v) at a flow rate of 1 ml/min.
a typical chromatogram for simultaneous estimation
of the two drugs obtained by using a above mentioned
mobile phase.Under these conditions Rabeprazole
sodium and Itopride hydrochloride were eluted at
5.027min and 1.950minutes respectively. The
representative chromatogram of this simultaneous
estimation shown in fig. 3, 4 & 5 and results were
summarized in Table 1.
The Sodium dihydrogen orthophosphate
buffer (NaH2PO4): ACN (60:40, v/v) was chosen as
the mobile phase. The run time of the HPLC
procedure was 6 minutes at flow rate of 1ml/min was
optimized which gave sharp peak, minimum tailing
factor. The system suitability parameters were shown
in Table 1 were in within limit, hence it was
concluded that the system was suitable to perform the
assay. The method shows linearity between the
concentration range of 6-14µg/ml for Rabeprazole and
25-125µg/ml for Itopride. The experimental results
were shown table 6 and fig.6&7. The % recovery of
Rabeprazole and Itopride was found to be in the range
of 100.99 to 101.87% & 98.10 to 101.35%
respectively. As there was no interference due to
excipients and mobile phase, the method was found to
be specific. As both compounds pass the peak purity,
the method was found to be specific. The method was
robust and rugged as observed from insignificant
variation in the results of analysis by changes in Flow
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 831
rate, column oven temperature, mobile phase
composition and wave length separately and analysis
being performed by different analysts. The results
were shown in Table 5. The LOD and LOQ values
were calculated based on the standard deviation of the
response and the slope of the calibration curve at
levels approximately the LOD and LOQ. The limit of
detection was obtained as 0.17µg/mL for Rabeprazole
and 4.74µg/mL for Itopride. The limit of quantitation
was obtained as 0.50µg/mL for Rabeprazole and
14.36µg/mL for Itopride which shows that the method
is very sensitive. The results were shown in Table. 7.
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed
method
Parameter Chromatographic conditions
Instrument Schimadzu HPLC with Spinchrome software
Column thermohypersil C18, (5μ, 250 x 4.6mm)
Detector UV Detector
Diluent Methanol
Mobile phase Sodium dihydrogen orthophosphate (adjusted pH 5.8): methanol
(60:40 v/v)
Flow rate 1ml/min
Detection wavelength 209nm
Temperature 25°c
Injection volume 20µl
Retention time Itopride hydrochloride:1.950; Rabeprazole sodium:5.027
Theoretical plate count Itopride hydrochloride:2810; Rabeprazole sodium:4659
Tailing factor Itopride hydrochloride:1.33; Rabeprazole sodium1.50
Table.2.Specificity study
Name of the solution Retention time in min
Blank No peaks
Itopride hydrochloride 1.950
Rabeprazole sodium 5.027
Table.3.Results of precision study
Sample Injection number Precision
RT Peak area
Itopride
hydrochloride
1 2.01 3652.679
2 1.99 3623.413
3 2.007 3604.924
4 1.950 3560.842
5 1.973 3582.141
6 1.950 3562.597
Mean 3597.766
%RSD(NMT 2.0) 1.35
Rabeprazole sodium 1 5.157 592.427
2 5.123 605.424
3 5.140 602.195
4 5.027 599.185
5 5.107 620.111
6 5.027 611.206
Mean 605.091
%RSD(NMT 2.0) 1.11
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 832
Table.4.Recovery data of the proposed Itopride hydrochloride and Rabeprazole sodium
Sample Spiked Amount
(µg/ml)
Recovered Amount
(µg/ml)
%Recovered %Average
recovery
Itopride
hydrochloride
75 73.98 98.64
99.36% 100 98.10 98.10
125 126.69 101.35
Rabeprazole
sodium
10 10.14 101.43
101.43% 12 12.22 101.87
14 14.14 100.99
Table.5.Robustness results of Itopride hydrochloride and Rabeprazole sodium
Sample Parameters Optimized Used Rt Tailing Plate count Itopride
hydrochloride
Flow rate
(±0.2)
1ml/min 0.8 2.583 1.62 2477
1 1.950 1.33 4659
1.2 1.683 2.65 1470
Wavelength
(±2 nm)
209 nm 207 2.050 2.07 2396
209 5.027 1.50 2560
211 2.047 2.32 2378
0.8 6.637 1.61 3802
Rabeprazole
sodium
Flow rate
(±0.2)
1ml/min 1 5.027 1.50 4659
1.2 4.323 1.60 1447
207 5.237 1.56 3557
Wavelength
(±2 nm)
209 nm 209 5.027 1.50 4659
211 5.220 2.57 3534
Table.6.Linearity data of the Itopride hydrochloride and Rabeprazole sodium sample Linearity level
(µg/ml)
Peak area Slope Y-intercept r²
Itopride
hydrochloride
25 2056.371 27.5 1336 0.995
50 2605.348
75 3483.719
100 4120.135
125 4739.482
Rabeprazole
sodium
6 394.802 62.71 16.84 0.999
8 512.594
10 647.862
12 772.627
14 891.9
Table.7.Limit of Detection and Limit of Quantification
Parameter Itopride hydrochloride Rabeprazole sodium
Limit of detection(LOD) 4.74µg/mL 0.17µg/mL
Limit of Quantification(LOQ) 14.36µg/mL 0.50µg/mL
Figure.1.Structure of Itopride hydrochloride Figure.2. Structure of Rabeprazole sodium
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 833
Figure.3.Typical chromatogram of blank solution
Figure.4.Typical chromatogram of standard Itopride and Rabeprazole
Figure.5.Typical chromatogram of Itopride hydrochloride and Rabeprazole sodium in marketed formulation
Figure.6.Linearity of Itopride hydrochloride
y = 62.711x + 16.843 R² = 0.9995
0
100
200
300
400
500
600
700
800
900
1000
0 2 4 6 8 10 12 14 16
Are
a
Conc
Linearity of Rabeprazole
Shaheda and Agarwal Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 834
Figure.7.Linearity of Rabeprazole sodium
CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Rabeprazole sodium and Itopride
hydrochloride in capsule dosage forms in bulk and
pharmaceutical dosage forms was established. The
method was completely validated shows satisfactory
results for all the method validation parameters tested
and method was free from interferences of the other
active ingredients and additives used in the
formulation. Infact results of the study indicate that
the developed method was found to be simple,
reliable, accurate, linear, sensitive, economical and
reproducible and have short run time which makes the
method rapid. Hence it can be concluded that the
proposed method was a good approach for obtaining
reliable results and found to be suitable for the routine
analysis of Rabeprazole hydrochloride and Itopride
hydrochloride in Bulk drug and Pharmaceutical
formulations.
ACKNOWLEDGEMENT
The authors would like to thank beloved
parents and all my well wishers, one and all who have
helped me directly and indirectly in completing this
project work.
REFERENCES
Akkamma H, Sai Kumar S, Sreedhar C, Rao S,
Kanagala S, Manogna K, Development and
Validation of New Analytical Method for
Simultaneous Estimation of Domperidone and
Rabeprazole in Pharmaceutical Dosage Forms,
Research Journal of Pharmaceutical, Biological and
Chemical Science, 3(3), 2010, 705.
Padmalatha M, Snehalatha T, Ramya S, Kanakadurga
M, A simple and validated RP-HPLC method for the
simultaneous estimation of Rabeprazole and
Levosulpiride in bulk and pharmaceutical dosage
forms, International Research Journal of
Pharmaceutical and Applied Sciences, Int. Res J
Pharm. App Sci, 2(2), 2010, 99-106
Patel AH, Patel JK, Patel KN, Rajput GC, Rajgor NB,
Development and Validation of derivative
Spectrophotometric method for Simultaneous
estimation Domperidone and Rabeprazole Sodium in
bulk and dosage forms, International Journal on
Pharmaceutical and Biological Research, 1(1),
2010:1-5.
Reddy M, Bodepudi C, Shanmugasundaram P,
Method Development and Validation of Rabeprazole
in Bulk and Tablet dosage form by RP-HPLC Method,
International Journal of ChemTech Research, 3(3),
2011, 1580-1588.
y = 62.711x + 16.843 R² = 0.9995
0
100
200
300
400
500
600
700
800
900
1000
0 2 4 6 8 10 12 14 16
Are
a
Conc
Linearity of Rabeprazole
Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 835
Formulation and evaluation of herbal anti-dandruff shampoo Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel
Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India
*Corresponding author: Email:[email protected]
ABSTRACT
Dandruff is a common disorder affecting the scalp condition caused by yeast Pityrosporum.
Dandruff cannot be completely eliminated but can only be managed and effectively controlled. A
shampoo is a preparation containing surfactant (i.e. surface active material) in a suitable form – liquid,
solid or powder – which when used under the specified conditions will remove surface grease, dirt, and
skin debris from the hair shaft and scalp without adversely affecting the user. Various anti-fungal agents
are employed in hair care preparations for the treatment dandruff. These products show many side effects
like loss of hair, increased scaling, itching, irritation, nausea, and headache. Hence an attempt was made
to formulate herbal anti-dandruff shampoo which is effective in terms of safety and treating the dandruff
condition better than the chemical based anti-dandruff shampoo. Herbal anti-dandruff shampoos were
formulated using herbal based ingredients like Lemon Grass Oil, Neem oil, Henna, Aloe Vera gel and
other ingredients for preparing base shampoo. The formulated shampoos were subjected to evaluation
parameters like visual inspection, pH, viscosity, Percentage of solids contents, Dirt dispersion, Surface
tension, Foaming ability and foam stability, anti-fungal activity test using Pityrosporum Ovale strain.
Formulation (F8) exhibited good antifungal activity i.e., maximum zone of inhibition. Hence it was
subjected to safety studies on animals, such as eye irritation test and skin sensitivity test. The (F8)
exhibited good safety without any irritation and sensitivity. Stability studies for a period of three months
were conducted for F8 formulation and showed negligible changes in their physicochemical properties.
Key words: Dandruff, herbal anti-dandruff shampoo, Pityrosporum ovale.
INTRODUCTION
Dandruff represents one of the most common
dermatological skin conditions and is a chronic, non
inflammatory condition of the scalp that is
characterized by excessive scaling of scalp tissue.
Dandruff is apparently caused by a fungus called
Malassezia restricta and M. globosa. Malassezia
formerly called Pityrosporum is a yeast causing
infection of skin and scalp. It often causes itching.
Warm and humid atmosphere, overcrowding and poor
personal hygiene are ideally suited for the growth of
Malassezia. Dandruff affects 5% of the population
and mostly occurs after puberty, between 20-30 years
and dandruff affects males more than females.
Dandruff occurs exclusively on skin in areas with high
levels of sebum. Symptoms of dandruff mainly
include itching, flakes; redness of scalp. Dandruff can
be treated in two ways, by using herbal based anti-
dandruff shampoo and by using chemical based anti-
dandruff shampoo. A shampoo is a preparation
containing surfactant (i.e. surface active material) in a
suitable form – liquid, solid or powder – which when
used under the specified conditions will remove
surface grease, dirt, and skin debris from the hair shaft
and scalp without adversely affecting the user. Most
shampoos contain water, a detergent (cleaning agent),
surfactant (lather making agent), salt, fragrance
(natural and artificial), preservative and food
coloring. With the exception of water and salt (sodium
chloride), different chemical compounds are used
depending on the desired result of the shampoo. Many
shampoos also contain vitamins and moisturizing
alcohols to prevent too much of the hair and scalp's
natural oils from being stripped away during
cleansing. Herbal Cosmetics, here in after referred as
Products, and are formulated, using various
permissible cosmetic ingredients to form the base in
which one or more herbal ingredients are used to
provide defined cosmetic benefits only, shall be called
as “Herbal Cosmetics”. Herbal drugs or their
formulations are viable alternative to synthetic drugs.
During the past few decades, there has been a
dramatic increase in the use of natural products in
cosmetics. Now-a-days, many herbal shampoos are
available in the market which contains herbal
ingredients such as plant extracts and essential oils.
There are large number of plants which are reported to
have beneficial effects on hair and are commonly used
in shampoos.many herbas such as Hibiscus rosa-
sinensis, Lawsonia inermis, Citrus aurantifolia,
Phyllanthus emblica, Ocimum sanctum, Zingiber
officinalis, Azadirecta indica, aloe vera have been
used as an anti dandruff agents in many shampoo
formulations.
MATERIALS AND METHODS
Lemon Grass Oil, Neem Oil, Aloe Vera Gel,
Henna was obtained as a gift samples from cavin care
pvt lmtd, Chennai, sodium lauryl sulfate was obtained
Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 836
from Cipla Ltd., Daund, glycerine was procured form
Signet, Mumbai and EDTA was obtained from Syned
Labs Limited, Medak, AP.
Preparation of anti-dandruff shampoo: Shampoo
was formulated using simple mixing process. Herbal
anti-dandruff shampoo was formulated by adding the
required amounts of herbal ingredients as given in the
formulation table no 1
Evaluation of prepared herbal shampoo: The
prepared herbal shampoo formulation should be
evaluated for its appearance, pH, viscosity, foaming
ability, surface tension, percentage solid content,
detergency ability, rheology, dirt dispersion and anti-
fungal activity against pityrosporum ovale.
Antifungal activity against Pityrosporum ovale: The
herbal anti-dandruff shampoo formulations (F5-F8)
were subjected to anti-fungal activity by adopting
disc-diffusion method. Potato Dextrose Agar (PDA)
medium was used for growing fungus. PDA was
prepared with addition of Butter. Dandruff was
dissolved in Potato dextrose broth for its further use as
inoculum. The inoculum obtained was serially diluted
to 10-6 and 10-7 dilutions and 100μl of inoculum was
inoculated onto the PDA plate which was spread using
an L-Shaped spreader. The Petri plates were then
sealed using a parafilm and incubated at 30 degree
Celsius for 48 hours to get plates with uniform growth
of fungus. Then different dilutions of shampoo as
prepared and poured into petriplates and incubated,
the growth of fungus were checked at regular
intervals. Disk diffusion method was used to check the
zone of inhibition for all the dilutions of shampoo.
Safety evaluation: Safety is an important aspect of a
shampoo; it should be tested by conducting animal
studies like eye irritation test and skin sensitization
test, using albino rabbits.
Stability studies: Stability studies were carried out by
placing glass tubes and in humidity chamber at
45°Cand 75% relative humidity. And their
appearance, physical stability were inspected for a
period of 3 months at interval of one month.
RESULTS AND DISCUSSION
Table.1.Formulation of herbal anti-dandruff shampoo Ingredients F1 F2 F3 F4 F5 F6 F7 F8
Neem oil(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0
Lemon Grass Oil (ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0
Aloe Vera gel(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0
Henna oil(ml) 0.5 1.0 1.5 2.0 0.5 1.0 1.5 2.0
Sodium lauryl
sulfate(gm)
6 3.0 1.5 0.75 15 10 5 -
Carbopol(gm) 2.0 1.0 1.0 1.0 - - - -
Glycerin(ml) - - - - 1 1 1 1
Guar gum(gm) 1.2 0.60 0.30 0.15 - - - -
Methyl paraben(gm) 0.180 0.180 0.180 0.180 - - - -
Propyl paraben(gm) 0.120 0.120 0.120 0.120 - - - -
EDTA(gm) - - - - 0.15 0.15 0.15 0.15
Sodium hydroxide To adjust
pH
To adjust
pH
To adjust
pH
To adjust
pH
To adjust
pH
To adjust
pH
To adjust
pH
To adjust
pH
Water q.s q.s q.s q.s q.s q.s q.s q.s
Perfume q.s q.s q.s q.s q.s q.s q.s q.s
Total 100ml 100ml 100ml 100ml 100ml 100ml 100ml 100ml
Table 2: Evaluation of Formulations for physical appearance, pH and %Solids Formulation Appearance pH %solids Surface tension
(dy/cm)
Cleansing action
(%)
Dirt dispersion
F5 Off white, good
foaming
4.9+0.02 21.10+0.01 30.12+0.02 22.12+0.05 Moderate
F6 Off white, good
foaming
5.1+0.07 23.01+0.05 31.25+0.01 25.02+0.01 Light
F7 Off white, good
foaming
5.2+0.02 26.02+0.02 33.17+0.01 27.52+0.03 Light
F8 Off white, good
foaming
5.5+0.01 28.05+0.04 34.20+0.01 32.06+0.04 None
Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 836
Table.3.Evaluation of formulations for viscosity
RPM Viscosity(cp
F5 F6 F7 F8
0.5 82150.00 60765.00 51516.67 17533.33
1.0 54150.00 42666.66 40450.00 14916.67
2.5 50916.67 33350.00 28851.66 11478.33
5 25425.00 14645.33 13651.66 9158.33
10 15775.00 8541.00 8041.66 7766.66
Table.4.Evaluation of Foam Stability of Herbal Shampoo formulations
Time in min Foam volume(ml)
F5 F6 F7 F8
1min 176 170 168 156
2min 173 168 166 152
3min 170 167 165 148
4min 169 166 164 142
5min 168 165 163 136
Table.5.Evaluation of Antifungal activity of Herbal Shampoos formulations
Zone of inhibition
Marketed product Formulation code
F5 F6 F7 F8
26.06mm 10.26mm 18.52mm 25.04mm 27.06mm
Table.6.Evaluation of Stability of Herbal Shampoo formulations
Evaluation parameter Stability
After 1month After 2 months after 3months
Appearance Off white, good foaming Off white, good foaming Off white, good foaming
pH 5.5+0.01 5.5+0.24 5.5+0.85
Viscosity(cp) 17533.33 17450.02 16477.36
% Solids 28.05+0.04 28.54+0.56 29.35+0.11
Surface tension
(dy/cm)
30.45+0.02 31.22+0.78 31.85+0.056
Dirt dispersion None None None
Foaming volume(ml) 136 134 130
Figure.1.Foam Stability of Herbal Shampoo Formulations (F5-F8)
0
50
100
150
200
1min 2min 3min 4min 5min
foam
vo
lum
e(m
l)
time (min)
Foam volume(ml) F5
Foam volume(ml) F6
Foam volume(ml) F7
Foam volume(ml) F8
837
Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 837
Figure.2.Initial Skin Condition of
Albino Rabbit
Figure.3.Skin Sensitivity for F8 after
1hr
Figure.4.Skin Sensitivity for F8 after
2hrs
Figure.5. Skin sensitivity for F8 after
3hrs
Figure.6. Skin sensitivity for F8 after
4hrs
Fig no 7 Initial Eye Condition of
Rabbit without Applying Shampoo
Figure.8.Eye Irritation after
30seconds for Formulation F5
Figure.9.Eye Irritation after
30seconds for Formulation F6
Figure.10.Eye Irritation after
30seconds
Figure.11. Eye Irritation after 30seconds for Formulation F8
Figure.12.Antifungal activity of marketed herbal anti-
dandruff shampoo (NIZORAL) against Pityrosporum
ovale
Figure.13.Antifungal activity of prepared herbal anti-
dandruff shampoo formulation F8 against Pityrosporum
ovale
838
Anusha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 835
Total 8 formulations were made. Out of 8
formulations F1, F2 F3, F4 showed consistency,
foaming and stability problems. Formulations F5,
F6, F7, F8 showed good consistency, foaming.
Hence the formulations F5, F6, F7, and F8 were
used for further study. The results of visual
inspection of formulations are listed in Table 2.
All formulations had the good characteristics with
respect to foaming. The pH of shampoos has been
shown to be important for improving and
enhancing the qualities of hair, minimizing
irritation to the eyes and stabilizing the ecological
balance of the scalp. As seen from Table 2, all the
shampoos were acid balanced and were
ranged4.9-5.5, which is near to the skin pH. If the
shampoo has too many solids it will be hard to
work into the hair or too hard to wash out. The
result of percent of solids contents is tabulated in
table 2, and was found between 21-28%. As a
result, they were easy to wash out. It has been
mentioned that a proper shampoo should be able
to decrease the surface tension of pure water to
about 40 dynes/cm12.
The reduction in surface tension of water
from 72.8 dynes/cm to 34.2 dynes/ cm by the
herbal shampoos is an indication of their good
detergent action. The results are shown in Table
2. Cleaning action was tested on wool yarn in
grease. As seen from the results, there is a
significant difference in the amount of sebum
removed by the different shampoos. The foam
stability of herbal shampoos is listed in table 4.
The results of antifungal activity are described in
table no 5 and zone of inhibition was shown in fig
no 12 and 13. The formulation F8 showed
maximum zone of inhibition. Therefore it is
concluded that as the concentration of the herbs
increased, the zone of inhibition was also
increased, hence the formulation F8 was the best
formulation for treating dandruff. The same was
compared with marketed product, Nizoral
antidandruff shampoo containing ketaconazole as
an active ingredient and found that the formulated
product shows better control over dandruff than
the marketed product. Eye irritation for F5
formulation is more compared to other
formulation and it is less for F6 and F7. F8
formulation was without any eye irritation. Hence
it is safe for use without any side effects. Hence
the formulation F8 was found to be best for
formulation for treating the dandruff as it exhibit
maximum zone of inhibition, and without any eye
irritation.
CONCLUSION
The formulation of Anti-dandruff hair
shampoo provides a method for treating a scalp
dandruff or seborrheic dermatitis. Herbal anti-
dandruff hair shampoo containing 2ml (F8) of
herbs concentration of neem oil, lemon grass oil,
henna, aloe vera gel with sodium lauryl sulfate
base could be used as an effective in treatment of
Dandruff on scalp. The formulated shampoos
were not only safer than the chemical dandruff
agents, but may also greatly reduce the hair loss
during combing as well as strengthen the hair
growth. The pH of the shampoos was adjusted to
5.5, to retain the acidic mantle of scalp. However,
the aesthetic attributes, such as lather and clarity,
of the laboratory shampoo are not comparable
with the marketed shampoos.
REFERENCES
Chandrani D, Lubaina SZ and Soosamma M, A
review of antifungal effect of plant extract vs.
chemical substances against malassezia spp., Int J
Pharm Bio Sci, 3(3), 2012, 773 – 780.
Mansuang Wuthi-udomlert, Ployphand
Chotipatoomwan, Sasikan Panyadee and Wandee
Gritsanapan, Inhibitory effect of formulated
lemongrass shampoo on Malassezia furfur: a
yeast Associated with dandruff, Southeast asian j
trop med public health, 42(2), 2011, 363-369.
Naveen S, Karthika S, Sentila R, Mahenthiran R,
Michael A, In-vitro evaluation of herbal and
chemical agents in the management of Dandruff,
J. Microbiol. Biotech. Res., 2 (6), 2012, 916-921.
Richa Madhu Sharma, Kinjal Shah, Janki Patel,
Evaluation of Prepared Herbal Shampoo
Formulations and To Compare Formulated
Shampoo with Marketed Shampoos, Int J Pharm
Pharm Sci, 3(4), 2011, 402-405.
Singla chhavi, Drabu sushma, Ali mohammed,
Potential of herbals as an antidandruff agents,
2(3), 2011, 16-18.
839
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 840
Analytical method development and validation for the simultaneous estimation of
Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage
forms V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy.
Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India
*Corresponding author: [email protected]; Phone no: 8985549686.
ABSTRACT
A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was
developed for the determination of Paracetamol and Tapentadol in bulk and pharmaceutical dosage forms.
The quantification was carried out using Thermo hypersil BDS C18 (100 X 4.6 mm, 5 µm) column run in
isocratic way using mobile phase comprising of Ammonium acetate buffer and methanol in the ratio of
50:50 w/v by adjusting the pH to 6.5(±0.5) with orthophosphoric acid and a detection wavelength of
280nm, and injection volume of 10µL, with a flow rate of 1.0ml/min. The retention times of Paracetamol
and Tapentadol was found to be 1.362 and 2.273. The linearity ranges of the proposed method lies
between 0.50 mg/mL to 0.150 mg/mL, which is equivalent to 50% to 150% and with correlation
coefficient of r2=1.0 and 0.999 for Paracetamol and Tapentadol . The assay of the proposed method was
found to be 101.0% and 98.0%. The recovery studies were also carried out and mean % Recovery was
and found to be 99.0% to 99.0%. LOD values for Paracetamol and Tapentadol was found to be 0.22 and
0.64 respectively and LOQ were found to be 0.68 and 1.96 respectively. The % RSD from
reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied
for routine quality control analysis of Paracetamol and Tapentadol in bulk and in Pharmaceutical dosage
form.
Key Words: Paracetamol,Tapentadol, RP-HPLC, Thermo hypersil BDS C18 (100 X 4.6 mm, 5 µm),
tablets, validation.
INTRODUCTION
Paracetamol is (4) N-(4-Hydroxyphenyl)
ethanamide /Para-acetylaminophenyl. The molecular
weight is 151.169, molecular formula is C8H9NO2. It
is used as Anti-pyretic and Analgesic.Tapentadol is 3-
[(1R, 2R)-3-(dimethylamino)1- ethyl-2-
methylpropyl]HCL. The molecular weight is221.339,
molecular formula is C14H23NO. Tapentadol is a
synthetic, centrally-acting analgesic that is effective
for the treatment of moderate to severe acute or
chronic pain. It has a unique dual mode of action as an
agonist at the µ-opioid receptor and as a
norepinephrine reuptake inhibitor. As a mu-opioid
agonist, it binds to and activates µ-opioid receptors in
the central nervous system. It modifies sensory and
affective aspects of pain, inhibits the transmission of
pain at the spinal cord and affects activity at parts of
the brain that control pain perception.
Literature review reveals very few methods
are reported for the assay of Paracetamol and
Tapentadol in Tablet dosage forms using RP-HPLC
method. The reported HPLC methods were having
disadvantages like high flow rate, more organic phase
and use of costly solvents. The proposed RP-HPLC
method utilizes economical solvent system and having
advantages like better retention time, less flow rate,
very sharp and symmetrical peak shapes. The aim of
the study was to develop a simple, precise, economic
and accurate RP-HPLC method for the estimation of
Paracetamol and Tapentadol in Tablet dosage forms.
MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV
win 5software UV-VISIBLE spectrophotometer with
1cm matched quartz cells. Schimadzu HPLC equipped
with SPD 20A UV-VIS detector and the column used
was THERMO HYPERSIL BDS C18
(100*4.6mm,5µ).The data acquisition was performed
by using LC solutions software.
Chemicals and reagents: Paracetamol and
Tapentadol pure samples were obtained from Laurus
laboratories, Hyderabad, India and dosage form
“Lazid-E” marketed by EMCURE was purchased
from local pharmacy. Other chemicals all are of
HPLC grade.
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 841
Figure.1.Structure of Paracetamol Figure.2.Structure of Tapentadol
Preparation of mobile phase: A suitable quantity of
degassed mixture of methanol and water in the ratio of
65:35 v/v was prepared and filtered through 0.45µ
filter under vacuum filtration.
Preparation of standard solution: Accurately
weighed and transfer about 32.50 mg of Paracetamol
and 5 mg of Tapentadol in 100 ml volumetric flask,
add to it about 50 ml of diluents and sonicate to
dissolve, dilute up to the mark with diluents and mix
well. Transfer above solution in to 5ml in to 50 ml of
volumetric flask dilute to volume with diluent.Filter
the solution through Nylon filter 0.45µ, The final
concentrations will be0.0325 mg/ml for Paracetamol,
0.005 mg/ml for Tapentadol.
Preparation of sample solution: A powder quantity
equivalent to 610mg was accurately weighed and
transferred to a 100ml volumetric flask and 50ml of
diluent was added to the same. The flask was
sonicated for 30 min and volume was made up to the
mark with diluent. Transferred 5ml of solution into a
50ml volumetric flask and dilute up to the mark with
diluent so as to obtain a concentration of 610 μg/mL
mixed well and injected. The amount present in each
tablet was calculated by comparing the area of
standard Paracetamol ,Tapentadol and tablet sample.
Method development:
Method optimization: The chromatographic
separation was performed using column Thermo
hypersil BDS C18 (100*4.6mm, 5µ). For selection of
mobile phase, various mobile phase compositions
were observed for efficient elution and good
resolution. The mobile phase consisting of
Ammonium acetate buffer:Methanol (50:50) by
adjusting the pH to 6.5(±0.5) with ortho phosporic
acid was found to be the optimum composition for
efficient elution of analyte. The mobile phase was
injected to the column at a flow rate of 1.0 ml/min for
4min. The column temperature was maintained at
35oC. The analyte was monitored at 280 nm using
UV-detector. The retention time of the drugs was
found to be 1.362 and 2.76. Mobile phase was used as
diluent during the standard and test samples
preparation.
RESULTS
Method validation:
System suitability: System suitability tests are an
integral part of method validation and are used to
ensure adequate performance of the chromatographic
system. Retention time (RT), number of theoretical
plates (N) or column efficiency and tailing factor (T)
were evaluated for five injections of standard solution
at a solution of 100µg/ml of paracetamol and
Tapentadol.
Specificity: Specificity is the ability of analytical
method to measure accurately and specifically the
analyte in the presence of components that may be
expected to be present in the sample. The specificity
of method was determined by spiking possible
impurities at specific level to standard drug solution
(100ppm). The diluent and placebo solutions were
also injected to observe any interference with the drug
peak.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given
range. The linearity of Paracetamol and Tapentadol
was in the concentration range of 50-150%.From the
linearity studies calibration curve was plotted and
concentrations were subjected to least square
regression analysis to calculate regression equation.
The regression coefficient was found to be 1for
Paracetamol and 0.999 for Tapentadol shows good
linearity for three drugs.
Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the
measure of exactness of the method. Accuracy of the
method was evaluated by standard addition method.
Recovery of the method was determined by spiking an
amount of the pure drug (50%,100% ,150%) at three
different concentration levels in its solution has been
added to the pre analyzed working standard solution
of the drug.
Precision: The precision of the analytical method was
studied by analysis of multiple sampling of
homogeneous sample. It is expressed as standard
deviation or relative standard deviation. Precision was
measured in terms of repeatability of application and
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 842
measurement. Study was carried out by injecting six
replicates of the same sample preparations at a
concentration of 0. 61mg/mL.
Method precision: Method precision was performed
by analyzing a sample solution of Paracetamol and
Tapentadol at working concentrations six times (Six
individual sample preparations).
Robustness: Robustness shows the reliability of an
analysis with respect to deliberate variations in
method parameters. If measurements are susceptible
to variations in analytical conditions, the analytical
conditions should be suitably controlled or a
precautionary statement should be included in the
procedure.
System suitability: From the system suitability
studies it was observed that retention time of
Paracetamol and Tapentadol was found to be 1.362
and 2.273min. % RSD of peak area was found to be
0.7 and 1.0. Theoretical plates were found to be more
than 4000. USP tailing factor was found to be 1.334
and 1.129 for Paracetamol and Tapentadol. All the
parameters were within the limit.
Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. Hence the proposed method was found to be
specific.
Linearity: From the Linearity data it was observed
that the method was showing linearity in the
concentration range of 50-150μg/ml for Paracetamol
and Tapentadol. Correlation coefficient was found to
be 1 and 0.999 for two compounds.
Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were in the range of
99.3%-101.6%, which shows that the method was
accurate.
Precision: The percentage relative standard deviation
(RSD) for the peak area of paracetamol and tapentadol
were 0.4 and 1.3.
Robustness: As the % RSD of retention time and
asymmetry were within limits for variation in flow
rate (± 0.1 ml). Hence the allowable flow rate should
be within 0.9 ml to 1.1 ml. As the % RSD of retention
time and asymmetry was within limits for variation (+
20C) in column oven temperature. Hence the
allowable variation in column oven temperature is +
20C. The results obtained were satisfactory and are in
good agreement as per the ICH guidelines.
Table.1.Optimized chromatogram conditions for Paracetamol and Tapentadol Column Thermo hypersil BDS C18 (100*4.6mm,5µ)
Mobile phase Ammonium acetate buffer: Methanol (50:50)
Flow rate 1 ml/ min
Wavelength 280 nm
Injection volume 10 l
Column temperature 35o C
Run time 4 min
Sample cooler 25o C
Table.2.System suitability Data for Paracetamol and Tapentadol S.No Paracetamol Peak area Tapentadol Peak area
1 2369806 206088
2 2352610 200880
3 2364950 204747
4 2396542 204226
5 2369554 205778
Average 2370692 204344
SD 16049 2078
%RSD 0.7 1.0
Theoretical plates 4428 4194
Tailing factor 1.334 1.129
Retention time 1.362 2.276
Table.3. Specificity Data for Paracetamol and Tapentadol Name of the solution Retention time in min
Blank No peaks
Paracetamol 1.36
Tapentadol 2.27
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 843
Table.4. Linearity Data for Paracetamol and Tapentadol
Paracetamol Tapentadol
Level Con. (mg/ml) Peak area Con. (mg/ml) Peak area
50% 16.25 1199804 2.5 106313
75% 24.37 1787490 3.75 153382
100% 32.5 2383485 5.0 201678
125% 40.62 2985724 6.25 251788
150% 48.75 3575403 7.5 302257
Slope 60155 55995
Intercept 23856 2023
Correlation coefficient 1.0 0.999
Table.5.Accuracy Data for Paracetamol and Tapentadol % Level Amount Added
( µg/ml) Area Amount Founded
( µg/ml) % recovery % Mean
50% 162.500 1197918 162.58 100 100
160.902 1191018 161.64 100
161.967 1195828 162.30 100
163.033 1191389 161.70 99
160.902 1196479 162.39 101
163.033 1198386 162.64 100
100 325.000 2395924 325.17 100 99
325.533 2353829 319.45 98
325.000 2364429 320.90 99
150 479.508 3572403 484.85 101 101
480.574 3579690 485.84 101
482.705 3574256 485.10 100
481.639 3573376 484.98 101
479.308 3564202 483.73 101
480.574 3573106 484.94 101
Table.6.Precision Data for Paracetamol and Tapentadol S.No Paracetamol Assay (%) RT Tapentadol Assay (%) RT
1 101.0 1.359 98.0 2.259
2 100.0 1.360 101.0 2.260
3 101.0 1.360 98.0 2.260
4 100.0 1.360 98.0 2.263
5 100.0 1.361 100.0 2.261
6 100.0 1.361 98.0 2.262
Average 100.0 - 99.0 -
SD 9409 - 2707 -
% RSD 0.54 - 1.36 -
Table.7.Variation in flow rate and temperature of Paracetamol Parameter Rt (Min) Peak Area Column Efficiency Tailing Factor
Increased flow rate 1.137 2029076 4255 1.268
Actual flow 1.362 2395429 4364 1.331
Decreased flow rate 1.693 3094749 4737 1.325
Increased temperature 1.361 2454401 4420 1.274
Actual temperature 1.359 2369554 4466 1.303
Decreased temperature 1.362 2424044 4384 1.291
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 844
Table.8.Variation in flow rate and temperature of Tapentadol Parameter Rt (Min) Peak Area Column Efficiency Tailing Factor
Increased flow rate 1.884 176068 4028 1.184
Actual flow 2.267 200880 4716 1.245
Decreased flow rate 2.806 270335 5302 1.143
Increased temperature 2.243 220414 4681 1.117
Actual temperature 2.273 206088 4194 1.129
Decreased temperature 2.255 209903 4721 1.127
Figure.3.Standard chromatogram Figure.4.Sample chromatogram
Figure.5.Chromatogram for Specificity Figure.6.Chromatogram for Systemsuitability
Figure.7.Linearity plot for Paracetamol Figure.8.Linearity plot for Tapentadol
CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of
ICH guidelines for method validation. The proposed
method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is validated
and can be used for routine sample analysis.
ACKNOWLEDGEMENT
The authors thankful to Mr. Satyanarayana
Goud (Research scientist-II), Mr. Murthy (G.M),
Laurus Laboratories for providing necessary facilities to
carry out the research work.
REFERENCES
Bhupendrasinh M Rao, Patel Bimal, Nurrudin Jivani,
Kumar Digbijay, Solanki Nitin, RP-HPLC method for
the simultaneous estimation of Paracetamol and
Tapentadol in tablet dosage form, Pharm Analysis &
Quality Assurance, 15(15), 2013, 1756-1763.
Dharmishtha N Bhakhar, Ashok R Parmar, Hitesh J
Vekaria, Chetana D Ribadiya, Chandani, RP-HPLC
method for the simultaneous estimation of
Paracetamol and Tapentadol in tablet dosage forms,
Pharm Analysis & Quality Assurance, 2(15), 2013,
353-362.
Praveen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 845
Samil D Desai, Bhavna A.Patel, Shraddha J Parmar,
Naitik N, Champaneri, Spectrophotometric method for
Simultaneous estimation of Paracetamol and
Tapentadol Hydrochloride by employing first order
derivative zero crossing method in 0.1 N Sodium
Hydroxide, International Journal of Pharmaceutical
sciences and Research, 5(4), 2013, 1777-1781.
Shailesh V. Malaviya, Dharmishtha N. Bhakhar,
Kavita N. Golakiya, Nehal H. Kothadiya, Hitesh J.
Vekaria, Ashok R. Parmar, Gunjan N. Pandya, Shruti
D. Dobariya, High performance thin layer
chromatographic method has been developed for the
simultaneous determination of Tapentadol
Hydrochloride (TAPE) and Paracetamol (PCM) in
pharmaceutical dosage form, Indo American Journal
of Pharmaceutical Research, 4(3), 2013, 117-122.
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 846
Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin
and Gentamycin induced nephrotoxicity in Albino rats Radha.B,
* Janarthan M, Durraivel S
Nimra College of Pharmacy,Vijayawada, Andhra Pradesh, India
*Corresponding author: [email protected], 9160508071
ABSTRACT The nephroprotectic effect of Methanolic extract of Polygonum glabrum willd was studied in
Cisplatin,Gentamycin induced Albino Rats. Oral administration of extract to albino rats [200mg/kg and
400mg/kg for 14, 8 days] produced significant (p<0.01) in animals treated with extract dependent manner,
when compared to control drugs(cis platin 12mg/kg andgentamycin 80mg/kg). Treatment with extract
200mg/kg and 400mg/kg showed significant (P<0.01) improvement in body weight and serum and urine
urea,uric acid,total protein,creatinine, when compared to nephroprotective control. Histopathological
studies also confirmed biochemical findings. Thus our study shows that Methanolic extract of polygonum
glabrum willd (200mg/kg and 400mg/kg) significantly improves the nephroprotectic activity
Key words: Polygonum glabrum willd, Methanolic extract, Cisplatin, Gentamycin.
INTRODUCTION
Nephrotoxicity is a poisonous effect of some
substances, both toxic chemicals and medication, on
the kidney. There are various forms of toxicity.
Nephrotoxicity should not be confused with the fact
that some medications have a predominantly renal
excretion and need their dose adjusted for the
decreased renal function (e.g. heparin). Several drugs
are nephrotoxic. Reactions to drugs and other
compounds are relatively common and have been
described for many substances. They are commonly
associated with renal dysfunction although the actual
incidence of drug-induced renal failure has not been
reported, since incidence is complicated by the
complexity of the causes of ARF in seriously ill
patients. Nephrotoxicity arises through several
mechanisms, including general and local vascular
effects, direct effects on renal tubules, tubular
obstruction and acute interstitial nephritis. Acute
glomerulonephritis can also occur although this less
common
MATERIALS AND METHODS
Materials: All chemicals were of analytical grade and
obtained locally. Serum urea,uric acid,creatinine,total
protein kit were procured from Robonik diagnostics,
Hyderabad, India.
Plant material: The fresh plant polygonum glabrum
willd was collected from Kolli hills and foot hill of
Yercaud, Tamilnadu, India. Identification of the plant
was done by Dr. K.Madhava Chetty assistant
professor, department of botany, Sri Venkateswara
University, Tirupati, A.P, India.
Animals: Albino rats weighing 180-250g were
selected and housed in polypropylene cages in a room
where the congenial temperature was 27°C ±1°C and
12 hrs light and dark cycles were maintained. Each of
these treatment groups consisted of six animals/group.
The protocol of this study was approved by the
Institutional Animal Ethics Committee (IAEC)
constituted under Committee for Purpose of Control
and Supervision of Experiments on Animals
(CPCSEA).
Preparation of the extract: The whole plant were
isolated, chopped into small pieces and dried under
shade at room temperature for seven days. The dried
plant were powdered and passed through the sieve
(coarse 10/44). This powder was used for the
preparation of methanolic extract.
Methanolic extract: Methanolic extract was prepared
by Heat Soxhlet extractor. The dried coarse
powdered of plant (250 gm) were transferred to a
round bottom flask, 75% of methanol was added to
the flask and soaked for 2 hours. This was then boiled
for 4 hours. The extract so obtained was decanted in a
beaker and then concentrated to 1/6th of the total
volume on a water bath. This was preserved by adding
a few drops of chloroform and kept in the refrigerator.
This extract was administered to the animals by
making the concentration required. By weighing the
water-evaporated extract (24.5% yield). The extract
was assigned a code name MEPG (methanolic extract
of polygonum glabrum)
Experimental protocol: In order to induce at
nephrotoxicity, the method was followed. The animals
were divided into four groups of six rats each
Group I: Normal animals
Group II: control animals (Cisplatin, Gentamycin)
Group III: control drugs+ extract (200mg/kg/day)
Group IV: control drugs+ extract (400 mg/kg/day).
At the end of the treatment the rats were sacrificed on
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 847
15 and 9 day. Serum was separated and stored in
refrigerator until assay
Experimental protocol: In order to induce at
nephrotoxicity, the method was followed. The animals
were divided into four groups of six rats each
Group I: Normal animals
Group II: control animals (Cisplatin, Gentamycin)
Group III: control drugs+ extract (200mg/kg/day)
Group IV: control drugs+ extract (400 mg/kg/day).
At the end of the treatment the rats were sacrificed on
15 and 9 day. Serum was separated and stored in
refrigerator until assay
Measurement of various Parameters:
Physical Parameters: The body weight was recorded
on the first day and then last day of the study period in
each group.
Biochemical Estimations: Serum urea, uric acid,
creatinine, total protein kit were procured from
Robonik diagnostics, animals were taken and blood
was collected from retro orbital plexus under light
ether anesthesia, centrifuged at 2500 rpm for 20
minutes. The serum obtained will be kept at 4oC until
used then sacrificed the rats and remove the kidneys
for histopatological evaluation.
RESULTS AND DISCUSSION Table.1. Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on serum creatinine, blood
urea and serum uric acid,total protien in treated rats for 14 days (serum parameters) Treatment groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl
Normal 0.333+0.309 7.313+3.118 3.223+1.469 40.52+16.69
Control 26.70+11.23a
3.495+1.590a
8.43+3.556a
65.06+26.86a
T1 2.09+0.878*** 5.316+2.27*** 5.58+2.496*** 28.58+12.04***
T2 1.205+0.509*** 4.065+1.750** 4.075+1.689*** 24.59+10.27***
All the values are mean+SEM,n=6,ns=not significant (ANOVA) one way analysis of variance followed by the multiple comparision
of the Dunnett’s test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
Table.2.Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on urine creatinine; urine
urea and urine uric acid,total protien in treated rats for 14 days (Urine parameters) Treatement groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl
Normal 0.886+0.395 8.85+3.73 22.285+9.21 25.18+10.38
Control 2.598+1.166a
18.23+7.47a
55.03+26.58a
61.21+25.07a
T1 1.383+0.594*** 11.228+4.605*** 32.23+13.32*** 35.05+14.43***
T2 1.088+0.454*** 9.2233+.789*** 29.23+11.95*** 30.07+12.47***
All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision
of the Dunnett’s test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
Table.3.Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on serum creatinine; blood
urea and serum uric acid,total protien in treated rats for 8 days (Blood parameters) Treatment Groups Creatinine mg/dl Total protein mg/dl Uric acid mg/dl Urea mg/dl
Normal 0.205+0.0093 6.44+0.224 3.77+0.168 45.305+0.130
Control 11.35+0.0981a
4.15+0.163a
7.5+0.116a
63.29+0.126a
Polygonum glabrum(T1) 0.215+0.0043*** 6.7+0.268*** 3.166+0.339*** 45.07+0.202***
Polygonum glabrum(T2) 3.23+0.2460*** 5.35+0.151* 5.19+0.278*** 57.12+1.458***
All the values aree mean+ SEM,n=6,ns=not significant,(ANOVA) one way analysis of variance followed by the multiple
comparision of the Dunnett’s test, p<0.005, p<0.001, and p<0.001 v/s control and ap<0.001,bp<0.001 and cp<0.05 v/s normal group
Table.4. Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on urine creatinine; urine
urea and urine uric acid,total protien in treated rats for 8days (Urine parameters (gentamycin)) Treatment groups Creatinine mg/dl Total protein mg/dl Urea mg/dl Uric acid md/dl
Normal 6.496+0.188 3.36+1.53 59.85+2.507 0.565+0.052
Control 2.315+0.325a
10.48+4.45a
95.06+38.85a
2.666+0.159a
T1 6.455+0.188*** 7.88+3.35*** 78.03+31.92*** 1.153+0.1485***
T2 7.243+0.2406*** 4.08+1.960*** 65.05+26.62*** 0.761+0.0576***
All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision
of the Dunnett’s test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 848
Effect of administration of Methanolic extract of
polygonum glabrum willd (200 and 400mg / kg
once daily for 14, 8days)/ Cisplatin (12mg /kg/day)
Gentamycin (80mg/kg/day) on Histopathological
changes in aorta of rats 14, 8 days:
Group1: Section studied shows renal parenchyma
with intact normal architecture. The glomerular and
tubular changes appear unremarkable. Some of the
blood vessels are dilated and congested within the
interstitium. Also few scattered mononuclear
inflammatory infiltration is seen within the
interstitium.
Important Highlights: Some blood vessels show
congestion
Group2: Section studied shows renal parenchyma
with intact architecture. There are seen diffuse
glomerular congestion, focal hydropic degeneration of
the tubular epithelial cells and peritubular congestion.
Some of the tubules show partial desquamation of the
epithelial cells. Also seen are blood vessel congestion
and scattered mononuclear inflammatory cell
infiltrations within the interstitium.
Important Highlights: Diffuse glomerular
congestion, Tubular casts.
Group3: Section studied shows renal parenchyma
with intact architecture. There is seen focal glomerular
congestion. Few the tubular epithelial cells show
hydropic degeneration and peritubular congestion.
Also seen are few scattered mononuclear
inflammatory cell infiltrations within the interstitium.
Important Highlights: Focal glomerular congestion,
Peritubular congestion
Group 4: High fatty die Section studied shows renal
parenchyma with intact architecture. The glomerular
and tubular changes appear unremarkable. Some of
the blood vessels are dilated and congested. Within
the interstitium, also seen are few scattered
mononuclear inflammatory infiltration is seen within
the interstitium.
Due to cisplatin administration,
platinumsulphydryl group complexes formed are
taken up by renal cells and stabilized by intracellular
GSH for several hours. In case of intracellular GSH
depletion, the complexes undergo rapid
transformation to reactive metabolites28. Thus GSH
depletion results in increased toxicity of cisplatin.The
use of gentamicin, an aminoglycoside antibiotic with a
wide spectrum of activities against Gram-positive and
Gram-negative bacterial infections but with high
preference for latter is equally associate with
nephrotoxicity as its side effect. Thus gentamicin
induced nephrotoxicity is well established
experimental model of drug induced renal injury.
Many animal experiments have demonstrated
overwhelmingly, the positive correlation between
oxidative stress and nephrotoxicity. Gentamicin
induced nephrotoxicity by causing renal
phospholipidosis through inhibition of lysosomal
hydrolases such as sphingomylinase and
phospholipases in addition to causing oxidative stess.
Nephrotoxic activity can be lowered significantly with
extract of polygonum glabrum.
CONCLUSION
In case of cis platin treated group there will be
rise in serum marker such as urea, uric acid and
creatinine and decrease in the level of protein. The
same is observed in kidney diseases in clinical
practice and hence are having diagnostic importance
in the assessment of kidney function. In the present
study, the stem extract of polygonum glabrum
significantly reduced the toxicant elevated levels of
above mentioned serum markers and increase in the
levels of protein. Hence, at this point it is concluded
that the extract of polygonum glabrum offers
nephroprotection.
In gentamicin treated animals there will be
found glomerular, peritubular and blood vessel
congestion and result in presence of inflammatory
cells in kidney sections. The same is observed in case
of humans who are suffering from major kidney
disorders. In the present study, the extract of
polygonum glabrum treated group animals were found
to reduce such changes in kidney histology induced by
gentamicin, indicating nephroprotection. Further
documented reports reveal that, plant material
containing phenols, flavonoids, alkaloids and saponins
offers organ protection by virtue of their free radical
scavenging activity
ACKNOWLEDGEMENT
Authors are grateful to Dr. Durivel, head of
the institution, Dr. Janardhan, head of the department,
Nimra College of pharmacy.
REFERENCES
George JK, Enrique PM, Aminoglycoside
nephrotoxicity, Kidney Int, 8, 1980, 571 -582.
Jones S and Janardhanan KK, Antioxidant and
antitumor activity of Ganoderma lucidum (Curt. Fr.)
P. Karst-Reishi (Aphyllophoromycetideae) from
South India, Int. J. Med. Mushr, 2000, 195–200.
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 849
Leelavathy, K. M. and Ganesh, P. N., Polypores of
Kerala, Daya Publishing House, Delhi, 2000, 166.
Shiao M, Lee K R, Lin L J and Wang C T, Natural
productsand biological activities of the Chinese
medicinal fungus Ganoderma lucidum in Food
Phytochemicals II. Teas, Spices and Herbs, American
Chemical Society, Washington DC, 1994, 342–354.
Vijay KK, Naidu MUR, Shifow AA, Ratnakar KS,
Nephroprotective and antioxidant activity of ehanolic
extract of the bark of Madhuca longifolia (koenig),
Indian J Pharmacol, 32, 2000, 108.
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 850
Analytical method development and validation for the simultaneous estimation of
Rosuvastatin and Finofibate in tablet dosage form by reverse phase high
performance liquid chromatography M. Sumalatha, K.Haritha Pavani
Nimra College of Pharmacy, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9494899371
ABSTRACT
A new, simple, precise, accurate and reproducible RP-HPLC method for Simultaneous estimation of
Rosuvastatin (ROS) and Fenofibrate (FEN) in bulk and pharmaceutical formulations was developed.
Separation of ROS and FEN was successfully achieved on a Hypersil C18 (4.6 x 250mm, 6.5 m,
Make: Waters) or equivalent in an isocratic mode utilizing OPA buffer (pH 3.0): Methanol (65:35%v/v)
at a flow rate of 1.2 mL/min and eluate was monitored at 238 nm, with a retention time of 1.950 and
3.858 minutes for ROS and FEN. The method was validated and the response was found to be linear
in the drug concentration range of 50 µg/mL to 150 µg/mL for ROS and 50 µg/mL to 150 µg/mL for
FEN. The values of the slope, intercept and the correlation coefficient were found to be 2 2 507,
7467 and 0.999 for ROS and 21157, 16980 and 0.999 for FEN respectively. The LOD and LOQ for
Rosuvastatine were found to be 0.0053, 0.017 respectivly. The LOD and LOQ for Fenofibrate were
found to be 0.00019, 0.00063 respectively. This method was found to be good percentage recovery for
Rosuvastatine and Fenofibrate were found to be 99.00 and 99.00 respectively indicates that the proposed
method is highly accurate. The specificity of the method shows good correlation between retention times
of standard with the sample so, the method specifically determines the analyte in the sample without
interference from excipients of tablet dosage forms. The method was extensively validated according to
ICH guidelines for Linearity, Range, Accuacy, Precesion, Specificity and Robustness.
Key words: Rosuvastatin, Fenofibrate, High performance liquid chromatography.
INTRODUCTION
Rosuvastatin (3R, 5S, 6E) – 7 - [4 - ( 4 –
fluorophenyl ) – 2 ( N - methylmethanesulfonamido )
– 6 - (proan-2-yl) pyrimidine-5-yl ] - 3, 5-
dihydoxyhept-6-enoic acid. Rosuvastatin is an
antilipidemic agent that competitively inhibits
hydroxymethylglutaryl-coenzyme A (HMG-CoA)
reductase.HMG-CoA reducuase catalyzes the
conversion of HMG-CoA to mevalonic acid, the rate-
limiting step in cholesterol biosynthesis. Rosuvastatin
belongs to a class of medications called Statins and is
used to reduce plasma cholesterol levels and prevent
cardiovascular disease.
Fenofibrate propan - 2 - yl2 - {4 - [(4-
chlorophenyl) carbonyl] phenoxy} -
2methylpropanoate is an antilipidemic agent which
reduces both cholesterol and triglycerides in the
blood. Fenofibrate exerts its therapeutic effects
through activation of peroxisome proliferator
activated receptor a (PPARa). This increases lipolysis
and elimination of triglyceride-rich particles from
plasma by activating lipoprotein lipase and reducing
production of apoprotein C-III. The resulting fall in
triglycerides produces an alteration in the size and
composition of LDL from small, dense particles, to
large buoyant particles. These larger particles have a
greater affinity for cholesterol receptors and are
catabolized rapidly.
Literature survey revealed that very few
methods have been reported for the analysis of
Rosuvastatin and Fenofibrate combinational dosage
forms which include UV spectroscopy, Reverse Phase
High performance Liquid Chromatography,
Densitometric method, HPTLC methods. The present
study illustrate development and validation of simple,
economical, selective, accurate, precise RP-HPLC
method for the determination of Rosuvastatin and
Fenofibrate in bulk and Pharmaceutical dosage forms
as per ICH guidelines. The goal of this study is to
develop rapid, economical HPLC method for the
analysis of Rosuvastatin and Fenofibrate in combined
dosage form using most commonly employed column
(C18) and simple mobile phase preparation. In the
present proposed work a successful attempt had been
made to develop a method for the simultaneous
estimation of Rosuvastatin and Fenofibrate
pharmaceutical dosage form and validate it. From the
economical point of view and for the purpose of
routine analysis, it was decided to develop a more
economical RP-HPLC method with simple mobile
phase preparation for the estimation of Rosuvastatin
and Fenofibrate combinational dosage form. The
method would help in estimate of drugs in single run
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 851
which reduces the time of analysis and does not
require separate method for each drug. Thus, the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage
forms.
MATERIALS AND METHODS
Quantitative HPLC was performed on a high
performance liquid chromatograph -Waters
e2695Alliance HPLC system connected with PDA
Detector 2998 and Empower2 Software. The drug
analysis data were acquired and processed using
Empower2 software running under Windows XP on a
Pentium PC and Hypersil ODS C18 column of
dimension 250 × 4.6, 5µm particle size. In addition an
analytical balance (DENVER 0.1mg sensitivity),
digital pH meter (Eutech pH 510), a sonicator
(Unichrome associates UCA 701) were used in this
study.
Standards and chemicals used: The reference
samples of Rosuvastatin and Fenofibrate standards
were kindly supplied as gift samples by Dr.Reddy’s.,
Hyderabad, Andhra Pradesh, India. All the chemicals
were analytical grade.ortho phosphoric acid from
Dr.Reddy’s., Hyderabad,Andhra Pradesh, India, while
Methanol (HPLC grade) and Water (HPLC grade)
from Merck Pharmaceuticals Private Ltd., Mumbai,
India. Rosuvastatin and Fenofibrate Tablets available
in the market as RosvasF (J.B. Chemicals &
Pharmaceuticals Ltd.) in composition of Rosuvastatin
(190mg), Fenofibrate (6mg).
Preparation of mobile phase: Transfer 1000ml water
into 1000ml of beaker.Then adjust its pH-3.0 with
Ortho phosphoric acid (OPA) and filtered through
0.45µ membrane filter and degassed by sonication.
Preparation of calibration standards:Rosuvastatin
6mg and 190mg Fenofibrate was taken into a 10, 25ml
of volumetric flask and add 10ml of Diluent and
sonicated for 10 minutes and made up with Diluent. It
was further diluted to get stock solution of
Rosuvastatin and Fenofibrate.This is taken as a 100%
concentration. Working standard solutions of
Rosuvastatin and Fenofibrate was prepared with
mobile phase. To a series of 10 ml volumetric flasks,
standard solutions of Rosuvastatin and Fenofibrate in
the concentration range of 50- 150µg/ml were
transferred respectively.
System suitability: System suitability is an integral
part of chromatographic system. To ascertain its
effectiveness, certain system suitability test
parameters were checked by repetitively injecting the
drug solutions at 100% concentration level for
Rosuvastatin and Fenofibrate to check the
reproducibility of the system. At first the HPLC
system was stabilized for 40 min. One blank followed
by six replicate analysis of solution containing 100%
target concentration of Rosuvastatin and Fenofibrate
were injected to check the system suitability. To
ascertain the system suitability for the proposed
method, a number of parameters such as theoretical
plates, peak asymmetry, and retention time were taken
and results were presented in Table 1.
Calibration curves for Rosuvastatin and
Fenofibrate: Replicate analysis of solution containing
50-150µg/mL of Rosuvastatin and Fenofibrate sample
solutions respectively were injected into HPLC
according to the procedure in a sequence and
chromatograms were recorded. Calibration curves
were constructed by plotting by taking concentrations
on X-axis and ratio of peak areas of standards on Y-
axis and regression equation were computed for both
drugs and represented in Table .6
Analysis of marketed formulation: The content of
ten tablets was weighed accurately. Their average
weights were determined. Powder of tablets
equivalent to one tablet weight (488mg) were weighed
and taken in a 50 ml volumetric flask, dissolved in
diluents, shaken and sonicated for about 20 minutes
then filtered through 0.45µ membrane filter. The
filtered solution was further diluted (5 to 50ml) in the
diluents to make the final concentration of working
sample equivalent to 100% of target concentration.
The prepared sample and standard solutions were
injected into HPLC system according to the
procedure. From the peak areas of Rosuvastatin and
Fenofibrate the amount of the drugs in the sample
were computed. The contents were calculated as an
average of six determinations and experimental results
were presented in Table 4. The representive standard
and sample chromatograms were shown in fig.2 and
fig.3.
Validation study of Rosuvastatin and Fenofibrate:
An integral part of analytical method development is
validation. Method validation is the process to
confirm that the analytical procedure employed for a
specific test is suitable for its intended use. The newly
developed RP-HPLC method was validated as per
International Conference on Harmonization (ICH)
guidelines for parameters like specificity, system
suitability, accuracy, linearity, precision
(repeatability), limit of detection (LOD), limit of
Quantification (LOQ) and robustness.
Specificity: The effect of wide range of excipients
and other additives usually present in the formulation
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 852
of Rosuvastatin and Fenofibrate in the determination
under optimum conditions were investigated. The
specificity of the RP-HPLC method was established
by injecting the mobile phase and placebo solution in
triplicate and recording the chromatograms.
Precision: precision study of sample (Rosuvastatin
and Fenofibrate) was carried out by estimating
corresponding responses 6 times on the same day for
the 100% target concentration. The percent relative
standard deviation (%RSD) is calculated which is
within the acceptable criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range
of 50-150µg/ml Rosuvastatin and Fenofibrate
respectively. Method of least square analysis is carried
out for getting the slope, intercept and correlation
coefficient, regression data values. The representative
chromatograms indicating the sample were shown in
fig.2&3. A calibration curve was plotted between
concentration and area response.
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Rosuvastatin and Fenofibrate by the method of
addition. Known amount of Rosuvastatin and
Fenofibrate at 50%, 100%, 150% is added to a pre
quantified sample solution. The recovery studies were
carried out in the tablet in triplicate each in the
presence of placebo. The mean percentage recovery of
Rosuvastatin and Fenofibrate at each level is not less
than 98% and not more than 102%.
Robustness: The robustness is evaluated by the
analysis of Rosuvastatin and Fenofibrate under
different experimental conditions such as making
small changes in flow rate (±0.2 ml/min), λmax (±5),
column temperature (±5), mobile phase composition
(±5%), and pH of the buffer solution.
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified. Under the stated experimental
conditions, the limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy.
Limit of detection and limit of quantification were
calculated using following formula LOD=3.3(SD)/S
and LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of
the calibration curve.
RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred
for the determination of Rosuvastatin and Fenofibrate.
Preliminary experiments were carried out to achieve
the best chromatographic conditions for the
simultaneous determination of the drug substances.
Several column types and lengths were tried
considering other chromatographic parameters. C18
column with a 4.6 mm inner diameter and 5µm
particle size was chosen. The detection wave length
was selected as 238nm with PDA detector.
Chromatographic conditions were optimized by
changing the mobile phase composition and buffers
used in mobile phase. Different experiments were
performed to optimize the mobile phase but adequate
separation of the drugs could not be achieved. By
altering the pH of buffer results a good separation.
Different proportions of solvents were tested.
Eventually the best separation was obtained by the
isocratic elution system using a mixture of OPA
buffer, Methanol in the ratio of (65:35) adjusted to
pH- 3.0 at a flow rate of 1.2 ml/min. A typical
chromatogram for simultaneous estimation of the two
drugs obtained by using a above mentioned mobile
phase. Under these conditions Rosuvastatin and
Fenofibrate were eluted at 1.950min and 2.858
minutes respectively with a run time of 6 minutes.
The OPA buffer, MeOH in the ratio of (65:35)
adjusted to pH- 3.0 was chosen as the mobile phase.
The run time of the HPLC procedure was 6 minutes at
flow rate of 1.2ml/min was optimized which gave
sharp peak, minimum tailing factor. The system
suitability parameters were shown in Table 1 were in
within limit, hence it was concluded that the system
was suitable to perform the assay. The method shows
linearity between the concentration range of 50-
150µg/ml for Rosuvastatin and Fenofibrate. The
experimental results were shown in table 6 and
fig.6&7.
The % recovery of Rosuvastatin and
Fenofibrate was found to be in the range of 98.00 to
101.00 % and 98.00to 101.00% respectively. As there
was no interference due to excipients and mobile
phase, the method was found to be specific. As both
compounds pass the peak purity, the method was
found to be specific. The method was robust and
rugged as observed from insignificant variation in the
results of analysis by changes in Flow rate, column
oven temperature, mobile phase composition and
wave length separately and analysis being performed
by different analysts. The results were shown in Table
5. The LOD and LOQ values were calculated based
on the standard deviation of the response and the slope
of the calibration curve at levels approximately the
LOD and LOQ. The limit of detection was obtained as
0.0053µg/mL for Rosuvastatin and 0.00019µg/mL for
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 853
Fenofibrate. The limit of quantitation was obtained as
0.017µg/mL for Rosuvastatin and 0.00063µg/mL for
Fenofibrate which shows that the method is very
sensitive.
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions
Instrument Waters e2695 Alliance HPLC with Empower2 software
Column C18 Hypersill ODS (250×4.6mm.5µ)
Detector PDA Detector 2998
Diluents Methanol
Mobile phase Methanol :OPA buffer pH 3.0(35:65)
Flow rate 1.2ml/min
Detection wavelength 238nm
Temperature 25°c
Injection volume 10µl
Retention time Rosuvastatin:1.950; Fenofibrate:30858
Theoretical plate count Rosuvastatin:4726; Fenofibrate:3170
Tailing factor Rosuvastatin:1.138; Fenofibrate:1.400
USP Resolution 10.310
Table.2.Specificity study
Name of the solution Retention time in min
Blank No peaks
Rosuvastatin 1.950
Fenofibrate 3.858
Table.3.Recovery data
Table.3a.Recovery data of the proposed Rosuvastatin
Spiked level Sample
weight
Sample area μg/ ml
added
μg/ ml found % Recovery % Mean
50% 732.00 1132260 29.400 29.71 101
100 100% 1464.00 2203343 57.800 57.81 98
150% 2196.00 3363910 88.200 88.25 100
Table.3b.Recovery data of the proposed Fenofibrate
Spiked level Sample
weight
Sample area μg/ ml
added
μg/ ml found % Recovery % Mean
50% 732.00 10666213 950.400 951.38 100
100 100% 1464.00 21488849 1900.800 1916.72 100
150% 2196.00 31569646 2851.00 2815.89 99
Table.4.Results of Precision study
Sample Injection number Precision
RT Peak area
Rosuvastatin
1 1.941 2255177
2 1.944 2252365
3 1.941 2223745
4 1.938 2223773
5 1.938 2252119
6 1.938 2252119
Mean 2243216
%RSD(NMT 2.0) 0.72
Fenofibrate
1 3.838 21070608
2 3.838 21107354
3 3.836 21246011
4 3.831 21284382
5 3.830 21532673
6 3.830 21532673
Mean 21295617
%RSD(NMT 2.0) 0.94
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 854
Table.5.Robustness studies
Table.5a.Robustness data for Rosuvastatin
Parameter RT Theoretical plates Asymmetry
Decreased flow rate 2.205 2670 1.474
Actual flow ate 1.950 3233 1.403
Increased flow rate 1.752 2473 1.502
Decreased temperature 2.358 2567 1.461
Actual temperature 1.950 3233 1.403
Incrased temperature 2.659 3045 1.486
Table.5b.Robustness data for Fenofibrate
Parameter RT Theoretical plates Asymmetry
Decreased flow rate 4.366 4011 1.218
Actual flow ate 3.858 4734 1.128
Increased flow rate 3.426 3658 1.244
Decreased temperature 4.874 3729 1.266
Actual temperature 3.858 4734 1.128
Incrased temperature 5.317 4770 1.313
Table.6.Linearity data
Table.6a.Linearity data of the Rosuvastatin
S.No Conc(μg/ml) RT Area
1 50 1.930 1136335
2 75 1.922 1691065
3 100 1.917 2259388
4 125 1.916 2817812
5 150 1.916 3386369
Std.dev 889685
Slope 22507
Intercept 7467
Correlation coefficient (r2) 0.999
Table.6b.Linearity data of the Fenofibrate
S.No Conc(μg/ml) RT Area
1. 50 3.801 10624304
2. 75 3.786 15847690
3. 100 3.784 21180479
4. 125 3.789 26450357
5. 150 3.798 31769938
Std.dev 8363306
Slope 21157
Intercept 16980
Correlation coefficient (r2) 0.999
Table.7.Limit of Detection and Limit of Quantification
Name LOD LOQ
Rosuvastatin 0.0053 0.017
Fenofibrate 0.00019 0.00063
Rosuvastatin Fenofibrate
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 855
Figure.1.Typical Chromatogram of standard Rosuvastatin and Fenofibrate
Figure.2.Typical chromatogram of Rosuvastatin and Fenofibrate tablets in marketed formulation
Figure.3.Linearity of Rosuvastatin
Figure.4.Linearity of Fenofibrate
CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Rosuvastatin and Fenofibrate in
tablet dosage forms in bulk and pharmaceutical
dosage forms was established. The method was
completely validated shows satisfactory results for all
the method validation parameters tested and method
was free from interferences of the other active
ingredients and additives used in the formulation.
Infact results of the study indicate that the developed
method was found to be simple, reliable, accurate,
linear, sensitive, economical and reproducible and
have short run time which makes the method rapid.
Hence it can be concluded that the proposed method
was a good approach for obtaining reliable results and
1136335
1691065
2259388
2817812
3386369 y = 21157x + 16980 R² = 0.99999
0
500000
1000000
1500000
2000000
2500000
3000000
3500000
4000000
0 50 100 150 200
Are
a
Axis Title
Linearity Of Fenofibrate
Radha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 856
found to be suitable for the routine analysis of
Rosuvastatin and Fenofibrate in Bulk drug and
Pharmaceutical formulations.
ACKNOWLEDGEMENT
The authors would like to thank beloved parents and
all my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
D A Skoog. J. Holler, T.A. Nieman, Principle of
Instrumental Analysis, 5th edition, Saunders College
Publishing, 1998, 778-787.
Gurdeep Chatwal, Sahm K. Anand, Instrumental
methods of Chemical Analysis, 5th edition, Himalaya
publishing house, New Delhi, 2002, 1.1-1.8, 2.566-
2.570
H.H. Willard, L.L. Merritt, J.A. Dean, F.A. Settle,
Instrumental Methods of Analysis, 7th edition, CBS
publishers and Distributors, New Delhi, 1986, 518-
521, 580-610.
Hiren N. Mistri, S, C.Seetman, C.Saravanan, Rajiv
Sharma, K.Mukkanti, Developed simultaneous
quantification of Rosuvastatin and Fenofibrate in
human plasma by Mass spectroscopy. International
Journal of Chem Tech Research, 2011, 3(1), 2011,
455-463.
John Adamovies, Chromatographic Analysis of
Pharmaceutical, Marcel Dekker Inc. New York, II Ed,
74, 5-15.
John Wiley, Mahesh
Duggamati,B.Dejaegher,Development and validation
of a LC–MS–MS method for simultaneous
determination of Rosuvastatin and Fenofibrate in
tablet dosage form, Acta pharmacutica Sinica B, 2(6),
2008, 345-355.
Sharma BK, Instrumental methods of chemical
analysis, Introduction to analytical chemistry, 23th
edition, Goel Publishing House Meerut, 2004, 12-23.
Skoog, Holler, Nieman,
Principals of Instrumental Analysis, 5thEdition,
Harcourt Publishers International Company, 2001,
543-554.
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 857
A new development and validated RP-HPLC method for the assay and related
substances of Itraconazole in capsule dosage form Sarvani Paruchuri*, Haritha Pavani K
Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India
*Corresponding author:Email:[email protected]
ABSTRACT
The present investigation reveals about a simple, economic, selective, precise and accurate reverse
phase high performance liquid chromatography method for analysis of Itraconazole and Related
Substances of Itraconazole was developed and validated according to ICH guidelines. Itraconazole was
well separated using ThermoHypersil BDS C18, 150mm Χ 4.6 mm, 5µm column for assay quantification
in isocratic mode with mobile phase comprising of buffer: Acetonitrile (65:35) with a flow rate of
1.5ml/min and ThermoHypersil BDS C18, 100 mm x 4.6 mm, 3 µm column for Related substances
quantification in gradient mode with mobile phase comprising of 0.08M tetra butyl ammonium hydrogen
sulphate: Acetonitrile with a flow rate of 1.5ml/min. the retention time was found to be 6.2min and %
assay was found to be 99.9%. The percentage recovery was found to be 99.6 to 101.2%. Proposed method
was validated for precision, accuracy, linearity, range, specificity and robustness. The drug was subjected
to forced degradation and stability studies. The drug was found to be stable for 4 days in Assay and for 3
days in Related compounds determination.
This method was appropriate for the purpose of quantitating Itraconazole in Drug Product and the
Related Substances of Itraconazole in the Finished Product and has been successfully validated.
Key words: Itraconazole, HPLC, Method development, Method validation, Analysis
INTRODUCTION
Itraconazole is a (1-(butan-2-yl)-4-{4-[4-(4-
{[2R,4S)-2-(2,4-dichlorophenyl)-2-(1H-1,2,4 triazole-
1- ylmethyl) 1, 3 – dioxolan – 4 -yl] methoxy}phenyl)
piperazin -1-yl ] phenyl} 4, 4-dihydro-1H-1,2,4-
triazole-5-one) is member of the drug class known as
anti-fungal. It is used for the inhibition of fungal
cytochrome p450 enzyme “lanosterol 4 demethylase”,
used in the conversion of lanosterol to ergosterol,
which is a main sterol in fungal cell membrane, thus
inhibits replication and promotes cell death in case of
the yeast cells transformation into hypothetically
invasive hyphae.
Literature survey revealed that very few
methods have been reported for the analysis of
Itraconazole which include UV spectroscopy, Reverse
Phase High Performance Liquid Chromatography,
Ultra Pressure Liquid Chromatography, LCMS,
HPTLC methods. The present study illustrate
development and validation of simple, economical,
selective, accurate, precise RP-HPLC method for the
determination of Itraconazole and Related Substances
of Itraconazole in pharmaceutical dosage forms as per
ICH guidelines. The goal of the present study is to
develop rapid, economical HPLC method for the
analysis of Itraconazole in pharmaceutical dosage
form using most commonly employed column (C18)
and simple mobile phase preparation. In the present
work a successful attempt had been made to develop a
method for the determination of Itraconazole in
pharmaceutical dosage form and validate it. The
method would help in estimation of the drug in single
run which reduces the time of analysis and does not
require separate method for the drug. Thus the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage
form.
MATERIALS AND METHODS
Quantitative HPLC was performed on
Schimadzu 2010 CHT system connected with UV
Visible detector and LC solution software. The drug
analysis data were acquired and processed using LC
solution software running under windows XP on a
Pentium PC and thermohypersil BDS C18 column of
dimension 150 Χ 4.6, 5µm particle size. In addition an
analytical balance (Mettler Toledo 0.1mg sensitivity),
digital pH meter (Polmon), and an ultra sonicator were
used in this study.
Standards and Chemicals used: Itraconazole pure
sample was taken as a gift sample from local labs and
dosage forms “Sporanox” marketed by Janssen
Pharmaceuticas was purchased from local pharmacy.
Other chemicals all are of HPLC grade.
Preparation of Mobile Phase: A suitable quantity of
degassed mixture of buffer and acetonitrile in the ratio
of 65:35 was prepared and filtered through 0.45µ filter
under vaccum filtration. (27.2gm of tetra butyl
ammonium hydrogen sulphate was prepared in
1000ml volumetric flask and is used as buffer)
Preparation of Diluent: Prepare 99:1 mixture of
Methanol and Hydrochloride (v/v)
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 858
Preparation of Standard stock solution: About
25mg of itraconazole working standard was taken into
a 50ml volumetric flask and add 30ml of diluent and
sonicate to dissolve. Make up the volume with diluent
to get a concentration of 500µg/ml. From this solution
5ml was taken in to 25ml volumetric flask and make
up the volume with diluent to get a concentration of
200 µg/ml.
Preparation of Sample Solution: The average fill
weight was determined for 20 capsules was added
weigh 25mg equivalent of itraconazole was taken and
transferred in to 50ml volumetric flask. Add 30ml of
diluent and sonicate to dissolve and make up the
volume with diluent. From this solution 5ml was taken
in to 25ml volumetric flask and make up the volume
with diluent to get a concentration of 200 µg/ml.
Method optimisation: The chromatographic
separation was performed using Hypersil BDS C18
(150×4.6mm, 5µm) column. For selection of mobile
phase, various mobile phase compositions were
observed for efficient elution and good resolution. The
mobile phase consisting of Tetra Butyl Ammonium
Hydrogen Sulphate and acetonitrile in the ratio of
65:35 was found to be the optimum composition for
efficient elution of analyte. The mobile phase was
injected to the column at a flow rate of 1.5 ml/min for
12min. The column temperature was maintained at 35
± 10C. The analyte was monitored at 225nmusing UV-
detector. The retention time of the drugs was found to
be 6.2min. 99:1% of methanol and HCl was used as
diluent.
Figure.1.Structure of Itraconazole
RESULTS AND DISCUSSION
Method validation:
System suitability:System suitability of the HPLC
was conducted to find out the system performance and
the results we are getting were accurate.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given
range. The linearity of Itraconazole was in the
concentration range of 10-200µg/ml. From the
linearity studies calibration curve was plotted and
concentrations were subjected to least square
regression analysis to calculate regression equation.
The regression coefficient was found to be 1.000 and
shows good linearity for the drug.
Precision: Precision is the degree of closeness of
agreement among individual test results when the
method is applied to multiple sampling of a
homogeneous sample. Study was carried out by
injecting six replicates of the same sample
preparations at a concentration of 200ppm/ml. The
results were tabulated in table No 3
Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the
measure of exactness of the method. Accuracy of the
method was evaluated by standard addition method.
Recovery of the method was determined by spiking an
amount of the pure drug (50%,100% ,150%) at three
different concentration levels in its solution has been
added to the pre analyzed working standard solution
of the drug.
Forced degradation of Itraconazole:
Acid/base hydrolysis: Weigh 25mg equivalent of
Itraconazole and transfer into 50ml volumetric flask.
To this add 2.5ml of 5N HCl/NaOH and place in a
water bath at about 600c for about 1hr with occasional
shaking. After 1hr, add about 2.5ml of 5N NaOH/HCl
to neutralize, to this add 10ml of Diluent. Sonicate for
30min and allow the solution to equilibrate to room
temperature and dilute with diluent and mix well.
Pipette 5.0ml of the above solution into a 25ml
volumetric flask, dilute to volume with diluent. The
results were tabulated in table No 4 and the
chromatogram was shown in fig no7,8
Oxidative degradation: Weigh 25mg equivalent of
Itraconazole and transfer into 50ml volumetric flask.
To this add 2.5ml of 1%H2O2 and place in dark for
about 1 day. After 1 day add about 10ml of diluent,
sonicate for 30min and allow the solution to
equilibrate to room temperature and then dilute with
Diluent and mix well. Pipette 5.0ml of the above
solution into a 25ml volumetric flask, dilute to volume
with diluent. The results were tabulated in table No 4
and the chromatogram was shown in fig no 9
Thermal degradation: Weigh 25mg equivalent of
Itraconazole and transfer into 50ml volumetric flask.
Place it in oven at 1050C and let stand for 24hrs. After
24hrs, add 30ml of diluent and sonicate with
occasional shaking for 30min and allow the solution
to equilibrate to room temperature and then dilute
with diluent and mix well. Pipette 5.0ml of the above
solution into a 25ml volumetric flask, dilute to volume
with diluent.
Photolytic degradtion: (UV/LUX): Itraconazole
samples were prepared and the solutions were exposed
to light to determine the irradiation of light on the
stability of the solution. Approximately 200mg of the
drug powder was taken and is spread as a thin layer
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 859
and is placed in a photo stability chamber at 200watt
hr/sq mt. After attaining 200 watt hours/sq
mt/1.2million LUX hrs, quantitatively transfer a
portion of the pellets equivalent to about 25mg of
itraconazole into a 50ml volumetric flask and add
30ml of diluent and sonicate, and then dilute to
volume with diluent and mix well. Pipette 5.0ml of the
above solution into a 25ml volumetric flask, dilute to
volume with diluent.
Stability: Analyse the stored samples and standards.
Evaluate the stability of the stored stability solutions
by quantitating the amount of itraconazole found in
the stored solutions against freshly prepared standard
after one to seven days of storage and test atleast 3
days.
Filter study: Make one injection of the filtered
diluent, the filtered standard fractions, the unfiltered
standards, the filtered sample fractions and the
centrifuged sample fractions. Calculate, as area
percentage of the average area from system suitability
working standard injections, any peaks found in the
retention time window of itraconazole from the
filtered diluent blank injections. The percentage
recovery for the filtered standards was calculated, the
unfiltered standards, and the filtered sample and
centrifuged samples.
Discussions: Several trials has made until getting
good peak resolution, acceptable plate count and
tailing factor. Method was optimized and the retention
time was reported as 6.12 minutes.
System suitability: For the system suitability studies
it was found that the %RSD was found to be 0.8%,
theoretical plates 5623, and tailing factor 1.1.
Linearity: From the linearity data it was observed
that linearity concentration range was 500µg/ml.
Correlation coefficient was found to be 1.000
Precision: The percentage RSD for sample was found
to be 0.2
Accuracy: The recovery of pure drug from the
analysed solution of formulation was found to be
100.2%.
Specificity: The chromatograms of standard and
sample are identical with nearly same Retention time.
No interference due to Placebo and Sample at the
retention time of analyte which shows that the method
was specific
Robustness: The %RSD of retention time was within
the limits for variation in flow rate (1.3ml and 1.7ml).
Hence the flow rate should be between 1.3ml to
1.7ml. The % RSD of retention time was within the
limits for variation in pH (1.3 and 1.7) hence the pH
should be with in 1.3 and 1.7. The %RSD of retention
time was within the limits for variation in Buffer
composition (63:37 and 67:33). The system suitability
requirements were met for the method specified
parameters. The % itraconazole found was between
97.0% and 103.0%.
Filter Study: The mean recovery from the filtered
standards was within of the mean from the
unfiltered standards. The mean recovery from the
filtered samples was with in of the mean from
the centrifuged samples
Methods for related substances validation:
Preparation of mobile phase: Mobile phase was
introduced in gradient mode.
Mobile phase A: 0.08M tetra butyl ammonium
hydrogen sulfate (27.2 g of tetra butyl ammonium
hydrogen sulfate per 1000 mL volume of preparation.
Add DI Water and stir to mix. No pH adjustment is
required.)
Mobile phase B: Acetonitrile
Gradient programme
Time
(min)
Mobile phase
A (%)
Mobile Phase
B (%)
0 80 20
20 50 50
25 50 50
30 80 20
35 80 20
Preparation of diluent: In a suitable flask, prepare a
1:1 mixture of methanol and tetrahydrofuran (v/v).
Preparation of Standard Solution: 50mg of
Itraconazole working standard was transferred into
25ml volumetric flask. From this take 5ml of the
solution and transferred to 100ml volumetric flask.
From the above solution transfer 10ml of the solution
in to 100ml volumetric flask to make a concentration
of 10µg/ml
Preparation of sample Solution: Determine the
average fill weight of 20 capsules and weigh 500mg
equivalent of itraconazole and transfer into 100ml
volumetric flask and add 70ml of diluent and sonicate
and dilute to volume with diluent and mix well
(Concentration: 5000µg/ml Itraconazole).
Method optimisation: The chromatographic
separation was performed using Hypersil BDS C18
(100×4.6mm, 3µm) column. For selection of mobile
phase, various mobile phase compositions were
observed for efficient elution and good resolution. The
mobile phase consisting of 0.08MTetra Butyl
Ammonium Hydrogen Sulphate and acetonitrile in
gradient phase was found to be the optimum
composition for efficient elution of analyte. The
mobile phase was injected to the column at a flow rate
of 1.5 ml/min for 35min. The column temperature was
maintained at 30 ± 10C. The analyte was monitored at
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 860
225nmusing UV-detector. The retention time of the
drugs was found to be 12.2min. 99:1% of methanol
and HCl was used as diluent. The optimised
chromatographic conditions were mentioned in Table
No 1 and the chromatograms were shown in Fig 10,
11 and 12
RESULTS AND DISCUSSION
Method validation:
RRT and RRF: (Relative retention time, relative
retention factor):
Impurity B and Impurity G Stock Standard
Solution: 25mg of itraconazole WRS was transferred
into 50ml volumetric flask. From this take 5ml of the
solution and transferred to 100ml volumetric flask.
Working Itraconazole standard solutions with
impurities: Prepared 50, 100, 200% of proposed
specification level concentration by preparing aliquot
solutions of 2.5, 5 and 10ml of impurity standard
stock solution into 100ml volumetric flask
individually and dilute to volume with diluent and mix
well.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given
range. The linearity of Itraconazole was in the
concentration range of 20-300µg/ml. From the
linearity studies calibration curve was plotted and
concentrations were subjected to least square
regression analysis to calculate regression equation.
The regression coefficient was found to be 1.000 and
shows good linearity for the drug.
Precision: Precision is the degree of closeness of
agreement among individual test results when the
method is applied to multiple sampling of a
homogeneous sample. Study was carried out by
injecting six replicates of the same sample
preparations at a concentration of 5000µg/ml.
Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the
measure of exactness of the method. Accuracy of the
method was evaluated by standard addition method.
Recovery of the method was determined by spiking an
amount of the pure drug (50%,100% ,200%) at three
different concentration levels in its solution has been
added to the pre analyzed working standard solution
of the drug.
Forced degradation of Itraconazole:
Acid/base hydrolysis: Weigh 500mg equivalent of
Itraconazole and transfer into 100ml volumetric flask.
To this add 2.5ml of 5N HCl/NAOH and place in a
water bath at about 600c for about 1hr with occasional
shaking. After 1hr, add about 2.5ml of 5N NAOH/HCl
to neutralize, to this add 10ml of diluent. Sonicate for
30min and allow the solution to equilibrate to room
temperature and dilute with diluent and mix well.
Pipette 5.0ml of the above solution into a 25ml
volumetric flask, dilute to volume with diluent.
Oxidative degradation: Weigh 500mg equivalent of
Itraconazole and transfer into 100ml volumetric flask.
To this add 10ml of 30%H2O2 and place in water bath
at 800c for 4 hrs. After 4hrs add about 60ml of diluent,
sonicate for 30min and allow the solution to
equilibrate to room temperature and then dilute with
Diluent and mix well. Pipette 5.0ml of the above
solution into a 25ml volumetric flask, dilute to volume
with diluent.
Thermal degradation: Weigh 500mg equivalent of
itraconazole and transfer into 100ml volumetric flask.
Place it in oven at 1050C and let stand for 24hrs. After
24hrs, add 70ml of diluent and sonicate with
occasional shaking for 30min and allow the solution
to equilibrate to room temperature and then dilute
with Diluent and mix well. Pipette 5.0ml of the above
solution into a 25ml volumetric flask, dilute to volume
with diluent. The results were tabulated in table No 4
and the chromatogram was shown in fig no16
Photolytic degradtion: (uv/lux): Itraconazole
samples were prepared and the solutions were exposed
to light to determine the irradiation of light on the
stability of the solution. Approximately 1000mg of the
drug powder was taken and is spread as a thin layer
and is placed in a photo stability chamber at 200watt
hr/sq mt. After attaining 200 watt hours/sq
mt/1.2million LUX hrs, quantitatively transfer a
portion of the pellets equivalent to about 25mg of
itraconazole into a 50ml volumetric flask and add
30ml of diluent and sonicate, and then dilute to
volume with diluent and mix well. Pipette 5.0ml of the
above solution into a 25ml volumetric flask, dilute to
volume with diluent.
Filter study: Three of the six 100% Accuracy
Samples prepared in Intermediate Precision were
used. Place an aliquot from the three preparations into
three 15-mL volumetric flasks and spin at high speed
for 5 minutes. Remove an aliquot of the supernatant
and place in an auto sampler vial for analysis. Remove
a second aliquot from each of the three preparations
and individually filter and analyse
Preparation of Filter Blanks: Filter the Diluent
through a 0.45 m Nylon (Millipore Brand) filter, fill
an auto sampler vial for analysis. Repeat this two
more times using a new 0.45 m Nylon (Millipore
Brand) filter each time.
Stability of standard and sample solutions:
Specificity – known impurities: The method was
shown to be specific with regards to the Known
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 861
Impurities of Itraconazole with a Resolution between
adjacent peaks of 14.1, 4.5, 4.2, 6.8, 4.6, 3.9 and 6.7.
The Acceptance Criteria for the determination of RRT
and RRF was met for all the Known Impurities.
Specificity – placebo: The method was shown to
have a 0.05% of Placebo interference, thus the method
was shown to be specific with regards to the Placebo.
Specificity – forced degradation: The method was
shown to be capable of resolving the Known and
Unknown peaks from each other and from the
Itraconazole peak. The Peak Purity data confirmed
that all peaks detected were pure.
Linearity and range: The method was shown to be
Linear (Correlation Coefficient of 1.0000) over a
Range of 20% to 300% of the Working Standard
Concentration which corresponds to the 2.00 µg/mL
to 30.00 µg/mL of the Test concentration.
Precision - injection repeatability: The method was
shown to have a 0.8% RSD for 10 replicate working
standard injections thus demonstrating acceptable
Injection Reproducibility.
Precision - analysis repeatability: The method was
shown to have a 0.8% RSD for Impurity-B, 0.7%
RSD for Impurity-G. Spiking/Recoveries at the
proposed specification limit for each known impurity
thus demonstrating acceptable analysis
reproducibility.
Intermediate precision – ruggedness: A second
Analyst on a different day, using a different HPLC
and a different column serial number was able to
reproduce Mean Recoveries and %RSD as the first
Analyst thus demonstrating method Ruggedness. The
difference in the mean recovery between analysts was
not greater than 10.0% for each Known Impurity. The
method was found to be Rugged.
Accuracy and recovery from placebo: The method
was shown to be Accurate and Precise by the
successful demonstration of spiking and recovering
the Known Impurities at 50%, 100% and 200% Levels
of the proposed specification limit concentrations. The
mean recovery of replicate preparations at each
spiking level was between 85.0% and 115.0%. The
%RSD at each level was not greater than 10.0%. The
Accuracy and Recovery of this Method was found to
be acceptable.
Robustness: The method was shown to be Robust
with regards to Flow Rate and Organic Phase
composition.
Filter Study: The use of 0.45 µm Nylon Membrane
Filters from Millipore was shown not to contribute
additional components or to absorb the Known
Impurities as long as at least 3-mL of filtrate was
discarded.
There were no new peaks found in the Filtered
Diluent.
Stability of standard and sample solutions: The
Standards and Sample Solutions were shown to be
stable for a period of 3 days at room temperature. Table.1.Optimised chromatographic conditions
Parameters Assay Related substances
Column Thermohypersil BDS C18
150Χ4.6mm, 5µm
Thermohypersil BDS C18 100Χ4.6mm, 3µm
Mobile phase Buffer: ACN (65:35) M.P A: 0.08M tetra butyl ammonium hydrogen
sulphate M.P B: ACN
Flow rate 1.5ml/min 1.5ml/min
Wave length UV at 225nm UV at 225nm
Injection volume 10µl 10µl
Column temperature 250 c 300 c
Run time 12min 35min
Table.2.Linearity data
Assay Related substances
Mcg/ml Area Rt Mcg/ml Area Rt
10 168080 6.14 20 36127 11.46
25 424817 6.13 50 92550 11.05
50 849375 6.13 100 180452 10.84
100 1675595 6.14 150 268940 10.69
150 2502949 6.13 200 359644 10.62
200 3339989 6.14 300 544138 10.58
Correlation coefficient = 1.000 Correlation coefficient – 1.000
Intercept = 8150 Intercept = -16
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 862
Table.3.Validation parameters
Parameters Assay Related substances
Linearity 10-200mcg/ml 20-300mcg/ml
Precision (%RSD) 0.2 0.8,1.5
Accuracy 100.2 101.2,101.0
Assay 99.9 101.0
Ruggedness(%RSD) 0.33 1.3,1.8
Table.4.Forced degradation studies
Parameter Assay Related substances
Stress Time Rt Time Rt
Imp B Imp G Drug
As such 24hrs 6.2 24hrs 8.49 16.43 12.42
Acid 2hrs 6.19 6hrs 8.53 16.47 12.49
Base 2hrs 6.20 2hrs 8.67 16.38 12.45
Oxidation 24hrs 6.21 4hrs 8.53 16.46 12.47
Photolysis Until attaining
of temperature
6.2(UV)
6.22(LUX)
Until attaining
of temperature
8.46(UV)
8.59 (LUX
16.6 (UV)
16.72 (LUX)
12.63 (UV)
12.74 (LUX)
Thermal 24hrs 6.22 24hrs 8.81 16.56 12.57
Table.5.Filter study
Parameter Name Assay Related substances
Area Rt Area Rt
Centrifuged Impurity B - - 566978 8.97
Impurity G - - 66778747 12.78
Itraconazole 1555452 6.23 357711 16.62
Filtered Impurity B - - 5566193 8.87
Impurity G - - 71257184 12.67
Itraconazole 1571516 6.23 358784 16.51
Table.6.Solution stability
parameter Assay Related substances
Area Rt Name Area Rt
Day 1
1710459
6.07 Impurity B 532302 8.18
Impurity g 366761 15.80
Itraconazole 57636383 11.92
Day 2
1703686
6.09 Impurity B 556700 8.16
Impurity G 385432 15.79
Itraconazole 62725307 11.91
Day 3
1710149
5.97 Impurity B 610776 8.16
Impurity G 415865 15.78
Itraconazole 67293568 11.90
Day 4
1761776
6.19 Impurity B - -
Impurity G - -
Itraconazole - -
Day 7
1943533
6.13 Impurity B 673402 8.48
Impurity G 422648 16.18
Itraconazole 65746332 12.28
Figure.1.Chromatogram of sample Figure.2.Chromatogram of standard
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 863
Figure.3.Linearity plot Figure.4. Photolytic degradation (UV)
Figure.5. Photolytic degradation(LUX) Figure.6. Thermal degradation
Figure.7. Acid degradation Figure.8. Base degradation
Figure.9.Oxidative degradation Figure.10.Chromatogram of blank
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 864
Figure.11.Chromatogram of std Figure.12. Chromatogram of sample
Figure.13. Linearity plot Figure. 14. Photolytic degradation (UV)
Figure.15. Photolytic degradation (LUX) Figure.16. Thermal degradation
Figure.17. Acid degradation Figure.18.Base degradation
CONCLUSION finally it concludes that all the parameters are within
the limits and meet the acceptance criteria of ICH
guidelines for method validation. The proposed
method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is
validated and can be used for routine and stability
sample analysis.
Sravani and Haritha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 865
REFERENCES
Beckett and Stenlake, Chromatography, Beckett A.H,
editor, Practical pharmaceutical chemistry, 4th ed,
New Delhi, CBS publishers; 2007, 157 – 161
Guru deep R. Chatwal, Sham K Anand, High
performance liquid chromatography, Arora M, editor,
Instrumental Methods of Chemical Analysis, 5th ed,
Mumbai, Himalaya Publishing House Pvt ltd, 2009,
624 – 638
Thirumala K et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 866
Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa
paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on
wistar rats Thirumala K
*, Janarthan M, Firasat Ali M
Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email: [email protected], Phone +91-9505483894
ABSTRACT
The anti-urolithiatic activity of the Aqueous extract of the stem core of Musa paradisiaca (family:
musaceae) was investigated on Ethylene glycol and ammonium chloride induced on albino rats. A
comparison was made between both plant extract and a known anti urolithiatic drug cystone (5mg/kg-1
).
The dried powder ofstemcore of Musa paradisiaca was subjected to extraction by continuous hot
extraction method using Distilled water as a solvent. Phytochemical estimation was done for the presence
of phytoconstituents. Dose selection was made on the basis of acute oral toxicity study (200mg/kg-1
,
400mg/kg-1
bodyweight) as per OECD guidelines. Oral administration of extract of Musa paradisiaca for
28days resulted in significant reduction in urine level. Ethylene glycol and Ammonium chloride induced
lithiatic rat model and oral urine tolerance test (OUTT) model was used for evaluation of anti lithiatic
activity. The biochemical parameters were analysed. All rats in the lithiatic groups had urine and serum
levels well within the lithiatic range, at the initial stage of the experiment but after four weeks of
treatment with extracts or cystone the urine, serum significantly dropped in dose-dependent manner. The
results suggest that the aqueous extracts of the Stem core of Musa paradisiaca restored the metabolic
changes in Ethylene glycol and ammonium chloride lithiatic rats.
Key words: Musa paradisiacal, cystone, ethylene glycol andammonium chloride, anti-urolithiatic
activity
INTRODUCTION
Urolithiasis also called Nephrolithiasis or
kidney stone. Urolithiasis is the presence of calculi in
the urinary tract. Renal stone disease affects up to
15% of men and 6% of women. Eighty percent of
calculi are composed of calcium (either oxalate or
phosphate), with others composed of struvite, uric
acid or cystine (Bihl G, Meyers A-2001)
approximately one million Americans develop a
kidney stone each year and an estimated 12% of the
population forms a stone some time during their life
(Gerstenbluth RE, Resnick ML-2004). Approximately
0.1–0.4% of the population is believed to have kidney
stones every year in the USA and Europe; about 2–5%
of the population in Asia, 8–15% in Europe and North
America, and 20% in Saudi Arabia develop renal
stones in their lifetime (Pak CYC-1998) Kidney
stones occur more frequently with increasing age and
among men. Within ten years, the disease usually
recurs in more than 50% of patients. Nowadays, about
80% of all kidney stones contain calcium salts
(calcium oxalate and/or calcium phosphate) as their
main crystalline components. Because human urine is
commonly supersaturated with respect to calcium salts
as well as to uric acid, crystalluria is very common,
i.e. healthy people excrete up to ten millions of
microcrystals every day. Recurrent stone formers
appear to excrete lower amounts or structurally
defective forms of crystallization inhibitors which
allows for the formation of large crystal aggregates as
precursors of stones. Alternatively, crystal adhesion to
urothelial surfaces may be enhanced in stone formers.
(Hess B.)
MATERIALS AND METHODS
Chemicals: Cystone (Himalaya Lab., India.), ethylene
glycol and ammonium chloride and all other reagents
used were of analytical grade
Plant material: The stem core of Musa paradisiaca
were collected from Sugguna lanka, near to
tenali,Guntur district (A.P). The plant material was
identified and authenticated by Dr.Madhava chetty
department of Botany, SV. University Tirupathi
Chitoor (dist).
Preparation of plant extraction: The collected stem
core was shade dried and powdered in mixer grinder
to get coarse powder. The powdered plant material
(100gms) was extracted with Distilled water by using
soxhlet apparatus. The extract was air dried to
evaporate solvent
Phytochemical screening: The preliminary
phytochemical screening of aqueous extract of Musa
paradisiaca was carried by using standard procedures.
Acute Toxicity Study: toxicity studies were
performed according to OECD-423guidelines.
Thirumala K et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 867
Experimental model: Ethylene glycol and
ammonium chloride was weighed individually for
each animal according to their body weight and
solubilised with saline just prior to injection. Lithiasis
was induced by injecting it at a dose of 200 mg/kg
body weight Orally. The animals were kept under
observation and after 24 hrs urine level level was
measured. The lithiatic rats (urine level 200-300
mg/dl) were separated and divided into five different
groups for experimental studies, with each group
containing six animals. Present study has confirmed
that the treatment of aqueous extract of Musa
paradisiaca for a period of 4weeks caused a
significant decreased in urine, serum levels) of
lithiatic rats 200&400 mg/kg of plant extract were
screened for anti lithiatic activity against ethylene
glycol and ammonium chloride induced lithiatic rats.
It produced significant anti lithiatic activity in a dose
dependent manner. The animals treated with ethylene
glycol and ammoniumchloride had low urine level.
The anti urolithiatic activity exhibited by extract was
compared with that of standard drug (cystone).
Experimental design:
The rats were divided into five groups each consist of
six rats. Significant lithiacis was achieved within 24
hrs after ethylene glycol and ammonium chloride (200
mg/kg body weight oral) injection.
Group I- Served as normal control and did not receive
any treatment
Group II- Served as lithiatic control and received
Inducer (ethylene glycol and ammonium chloride-
200mg/kg) and vehicle
Group III- Ethylene glycol and ammonium chloride +
cystone (5 mg/kg p.o.) and served as standard
Group IV- ethylene glycol and ammonium chloride +
AEMP extract (200 mg/kg, p.o.)
Group V- ethylene glycol and ammonium chloride +
AEMP extract (400 mg/kg, p.o.)
Statistical Analysis: The result of the study were
subjected to one way analysis of variance (ANOVA)
fallowed by Dunnet’s test for multiple comparisions.
Values with p<0.05 were consider significant.
RESULTS AND DISCUSSION
Phytochemical Screening: Phytochemical screening
of Aqueous extract of Musa paradisiaca showed the
presence of various chemical constituents mainly
alkaloids, Proteins, glycosides, and saponins. Extract
may be responsible for antilithiatic properties. The
results obtained were comparable and satisfied the
standard literature.
Acute oral toxicity studies: In the present study the
AEMP was subjected for toxicity studies. For the
LD50 dose determination was administered the dose
level of 1000 mg/kg and 2000 mg/kg body weight and
both doses did not produce any mortality. Hence one-
fifth of the dose tested i.e. 200mg/kg and 400mg/kg
body weight was selected for the study in order to
ascertain a scientific base for the useful of this plant in
the treatment of lithiasis. It was decided to evaluate
experimental design of an activity by Ethylene glycol
and ammonium chloride induced model.
Anti-urolithiatic activity:
Ethyleneglycol and ammonium chloride lithiatic
model: The anti-urolithiatic effect of AEMP in
ethylene glycol and ammoniumchloride induced
lithiatic animals is presented. The results showed that
after single dose treatment of the extract in individual
group of ethylene glycol and ammonium chloride
induced rats; there was a significant reduction in
serum, urine levels throughout the entire period of
study (28 days) as compared to lithiatic, control
group. Musa paradisiacal stem core extract were
screened for antilithiatic activity in rats where
ethylene glycol and ammoniumchloride (200 mg/kg,
i.p.) used as the lithiogenetic agent.
The results obtained from the present
investigation demonstrated that the stem core extract
of Musa paradisiaca constantly maintained significant
increase of the urine level in ethylene glycol the
experimental period suggesting the antilithiatic
property of the title plant. Urolithiasis is a chronic
pathological condition characterized by excessive
deposition of minerals in the kidney leading to
formation of large crystals thus obstructing the urine
flow. In the present study, it was observed that the
extract reversed the weight loss of the lithiatic rats.
Different chemicals used to induce Lithiasis in
experimental animals include ethylene glycol (EG),
and ammonium ammonium chloride (Malani M,
1995). To achieve a uniformly high rate of kidney
crystal deposition, the kidney is especially susceptible
to the action of induced ethylene glycol and
ammonium chloride. The dose of 200mg/kg of
ethylene glycol and ammonium chloride can induces
an autoimmune process that results in the destruction
of kidney; it also results in the toxicity.
Thirumala K et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 868
Table.1.Effect of Musa Paradisiaca on urinary parameters Groups Urinary volume Calcium Magnesium Phosphate Oxalate
Vehicle control 31 ± 1.73 1.25 ± 0.0115 1.30 ± 0.0117 3.54 ± 0.0150 0.49 ± 0.0128
Lithiatic control 15.66 ± 0.05 4.17 ± 0.0192 0.25 ± 0.0066 7.45 ± 0.0114 3.52 ± 0.0079
Standard 30 ± 1.50*** 1.50 ± 0.0076*** 1.23 ± 0.0154*** 3.87 ± 0.0265*** 1.23 ± 0.0076***
Test I 25 ± 0.035*** 3.11 ± 0.0071*** 0.43 ± 0.0031*** 5.37 ± 0.0183*** 2.87 ± 0.0095***
Test II 27 ± 2.14*** 1.97 ± 0.0047*** 1.12 ± 0.0054*** 4.14 ± 0.0182*** 1.76 ± 0.0070***
The values are expressed in Mean ± SEM value.
Statistical comparisons are made with Dunnett’s comparison test at significance value P<0.0001.
*** (P<0.0001) comparison made with Lithiatic control
Table.2.Effect of Musa paradisiaca on serum parameters
Groups BUN Creatinine Calcium
Vehicle control 36.57 ± 0.0057 0.85 ± 0.0060 6.53 ± 0.1358
Lithiatic control 48.55 ± 0.0135 2.61 ± 0.0453 21.64 ± 0.0060
Standard 37.41 ± 0.0113*** 0.94 ± 0.0095*** 7.85 ± 0.0118***
Test I 43.50 ± 0.0094*** 1.12 ± 0.0114*** 16.13 ± 0.0126*** Test II 38.93 ± 0.0192*** 1.05 ± 0.0136*** 9.23 ± 0.0067***
The values are expressed in Mean ± SEM value
Statistical comparisons are made with Dunnett’s comparison test at significance value P<0.0001.
*** (P<0.0001) comparison made with Li
Table.3.Effect of Musa paradisiaca on tissue parameters Groups SOD Catalase GSH MDA (LPO)
Vehicle control 7.27 ± 0.0048 33.55 ± 0.0113 17.14 ± 0.0117 175.30 ± 0.0076
Lithiatic control 3.13 ± 0.0105 18.13 ± 0.0169 10.63 ± 0.0067 340.20 ± 0.0058
Standard 6.33 ± 0.0049*** 29.55 ± 0.0127*** 16.27 ± 0.0054*** 147.32 ± 0.0088***
Test I 4.55 ± 0.018*** 21.64 ± 0.0043*** 12.35 ± 0.0094*** 220.34 ± 0.0099***
Test II 5.76 ± 0.0088*** 27.83 ± 0.0070*** 15.75 ± 0.0152*** 199.44 ± 0.0128***
The values are expressed in Mean ± SEM value
Statistical comparisons are made with Dunnett’s comparison test at significance value P<0.0001.
*** (P<0.0001) comparison made with Lithiatic control.
CONCLUSION
The results of the present study indicated that
Musa paradisiacal stem core extract
possessessignificant anti lithiatic activity against
ethylene glycol and ammonium chloride induced
lithiatic rats. Thus justifies the traditional use of this
plant in the treatment of diabetes mellitus. Bark
extract of the title plant possesses almost equipotent
anti lithiatic activity when compared with reference
standard Cystone
REFERENCES
Bihl G, Meyers A, Recurrent renal stone disease:
advances in pathogenesis and clinical management,
Lancet, 358, 2001, 651–56.
Gerstenbluth RE, Resnick ML, Medical management
of calcium oxalate urolithiasis, Med Clin North Am,
88, 2004, 431-42.
Hess B, Pathophysiology, diagnosis and conservative
therapy in calcium kidney calculi, Ther. Umsch,
60(2), 2003, 79-87.
Malani M M,Baskar R and Varalaxmi P, Effect of
lupol, a pentacyclic ,tri terpens on urinary enzymes in
hyperoxiluricrats, Jpn J Med Sci Biol, 48(5-6), 1995,
211-220.
Pak CYC, Kidney stones, Lancet, 351, 1998, 1797-
801.
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 869
Preparation and characterization of bioadhesive vaginal gel of Propranolol
hydrochloride Hardeep Singh Dhaliwal*, Dhruba Sankar Goswami,
Nidhi uppal, Mona Seth, Swati Kashyap, Kapil Sharma,
S.D. College of Pharmacy, Barnala, Punjab, India
*Corresponding author:Email id- [email protected]
ABSTRACT The objective of the present investigation was to prepare and characterize a contraceptive
vaginoadhesive Propranolol hydrochloride gel. To achieve this, various mucoadhesive polymers including
Na CMC (1-4% w/w) and tragacanth gum (1-4% w/w), were dispersed in an aqueous-based solution
containing the drug (0.5% w/w). The mucoadhesive properties of the gels were assessed on sheep vaginal
mucosa in citrate phosphate buffer pH 4 at 37°C. Formulations containing charged functional groups in
their polymeric structure, showed higher mucoadhesive strengths in comparison to those composed of
neutral polymers. In vitro drug release profiles of the gels were determined in citrate phosphate buffer pH
4. Results indicated that, formulation F4 (containing Na CMC 4% w/w), released the drug over 54 hrs,
with a burst release at the initial phase followed by a sustained release pattern. The formulation showed
good bioadhesive strength (24.6±0.05 gm). The %yield was found to be 95.3±0.02. In conclusion,
formulation F4 was considered as the most desirable formulation as it exhibited appropriate
mucoadhesive properties while having the potential of providing a prolonged drug release which is
assumed to render longer contraceptive efficacy.
Key words: Propranolol hydrochloride, Contraceptive gel, Vaginoadhesive, Na CMC, Tragacanth.
INTRODUCTION
Vaginal drug delivery system refers to the
system in which drug formulations are directly applied
in vaginal cavity for producing local action. It is an
important route of drug administration for both
systemic and local effect. The vagina has dense
network of blood vessels and rich blood supply, which
makes the drug absorption so effective. The drug
formulations contain bioadhesive polymers, due to
which drug formulations remain attached to the
vaginal mucosa for longer periods and release drug on
controlled rate. Thus vaginal route is used to treat
vaginal infections, to prevent the sexually transmitted
diseases or for contraception. The main advantages of
vaginal route are local effect, large surface area, rich
blood supply, avoidance of the first pass effect and
self-insertion. For this route semisolid and solid
dosage forms are preferred for good bioadhesion to
prolong the residence time in the vaginal cavity. The
most commonly used mucoadhesive polymers are
synthetic polyacrylates, polycarbophil, chitosan,
cellulose derivatives, hyaluronic acid derivatives,
pectin, tragacanth, carrageenan and sodium alginate.
(Alexander NJ, 2004)
Gels are the semisolid formulations, with
water base (hydrogels), or organic liquid base
(organogels). Hydrogels also possess a degree of
flexibility very similar to natural tissue, due to their
significant water content. These pseudohydrogels
swell infinitely and the component molecules dissolve
from the surface of the matrix. Drug molecules are
released through the spaces in the network and also by
the dissolution and/or disintegration of the matrix.
Mucoadhesive polymers of natural, semisynthetic or
synthetic origin are able to form hydrogels. In the
simplest case the drug is dispersed in a mucoadhesive
polymer, which swells in the presence of water and
exhibits bioadhesive properties. (Kumar L and Verma
R, 2010)
Vaginal gels are used for topical delivery of
contraceptives and anti-bacterial drugs. The desirable
properties of vaginally administered gel against
microbicides are acceptability and feasibility. They
must be easy to use, non-toxic and non-irritating to the
mucus membrane. (Patil SA, 2011)
Propranolol hydrochloride is a β-adrenergic
blocker that is used to treat tremors, angina,
hypertension, heart rhythm disorders etc. Its
bioavailability is very limited (30%) due to the hepatic
first pass effect. Its elimination half life is also
relatively short (3-4 hrs). This drug also possesses
local anesthetic activity of short latency and fairly
long duration and is a potent inhibitor of human sperm
motility in vitro and has a similar effect in vivo in rats.
The concentration of Propranolol hydrochloride,
which inhibits sperm motility by 50%, is 0.3 mM. The
local anesthetic properties of the drug are in fact, the
underlying mechanism which is responsible for
inhibition of sperm motility, rather than its β-blocking
potential. These characteristics give a potential to this
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 870
drug for use as a vaginal contraceptive or for
incorporation in an intrauterine contraceptive drug
delivery system, while being devoid of numerous
adverse effects reported from use of other types of
contraceptives. (Hussain A and Ahsan F, 2005)
MATERIALS AND METHODS
Propranolol hydrochloride was purchased
from Balaji Drugs, Gujarat. Na CMC, tragacanth,
methyl paraben, propyl paraben, citric acid and
disodium hydrogen phosphate were obtained from
Central Drug House Pvt. Ltd., New Delhi.
Preformulation studies of drug including organoleptic
properties, melting point and flow properties were
studied.
Preparation of bioadhesive vaginal gel: Propranolol
hydrochloride gel formulations were prepared using
sodium alginate and guar gum as gelling agents.
Table.1.Formulation chart of Propranolol bioadhesive gel
Formulation
code
Drug
(mg)
Na CMC
(gm)
Tragacanth
(gm)
Methyl
paraben (gm)
Propyl paraben
(gm)
F1
500
1 -----
0.4
0.6
F2 2 -----
F3 3 -----
F4 4 -----
F5 ----- 1
F6 ----- 2
F7 ----- 3
F8 ----- 4
Gelling agent was dispersed in small quantity of
citrate phosphate buffer [0.1(M), pH 4] and stored
overnight to ensure complete hydration. The drug was
initially dissolved in a mixture of PVP K30 and water
(5:3) and added to polymer dispersion. Methyl
paraben and propyl paraben were also added slowly
with continuous stirring. The final weight of the gel
was adjusted to 100 gm with citrate phosphate buffer
[0.1(M), pH 4]. Entrapped air bubbles were removed
by keeping the gels in vacuum desiccators.
Evaluation of bioadhesive vaginal gel:
Percentage yield: The percent yield was calculated as
the weight of the formulations recovered from each
batch divided by total weight of drug and other all
ingredients used to prepare Formulations multiplied
by 100. The percentage yield of each formulation was
replicated three times. The yield was calculated by the
following formula:
Y={Pm-Zg}/Tm[P+Ig]×100, Where Y = yield, Pm =
practical mass, ZG = vaginal gel, Tm = theoretical
mass, P = polymer and Ig = ingredients. (Chatterjee A,
2011)
Determination of pH: The pH of the gel was
determined by a digital pH meter. 1 gm of gel was
dissolved in 25 ml of distilled water and the electrode
was then dipped in to gel formulation and constant
reading was noted. The measurement of pH of each
formulation was replicated three times. (Nayak SB,
2010)
Syringibility: Syringibility study was carried out by
using a 22 gauze needle. (Yellanki SK, 2010)
Estimation of drug in vaginal gel: About 6 gm of gel
was weighed accurately and dissolved in citrate
phosphate buffer pH 4 of sodium lauryl sulphate (1%
w/v SLS). After appropriate dilutions, the drug
content was analyzed spectrophotometerically at 290
nm. (Nayak S, 2010)
Drug content uniformity: Initially, the formulations
were tested for homogeneity by visual inspection. To
ensure the homogeneity of drug content in the
formulation of the gel, six tubes were sampled from
the different locations of the mixer and assayed for the
drug content as stated above. Studies were performed
in triplicate for all the formulations. (Nayak SB, 2010)
Determination of spreadability: Spreadability study
was carried out by transferring the 6 gm of gel
formulation to the center of a glass plate and
compressed under several glass plates having wt
100±5 gm each after every 1 min and the spread
diameters recoded each time. (Yellanki SK, 2010)
Extrudability study: In conducting the test, a closed
collapsible tube containing above 20 gm of the gel
was pressed firmly at the crimped end and a clamp
was applied to prevent any rollback. The cap was
removed and the gel was allowed to extrude until the
pressure was dissipated. (Nayak SB, 2010)
Bioadhesion measurement: Isolated goat vaginal
tissue (Capra hircus, local breed, obtained
immediately after killing of animals at a slaughter
house) was cleaned and then separated from the
supporting muscular and connective tissues taking
care to maintain integrity of mucosa, and kept at 0°C
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 871
till further use. Before experiments, goat vaginal
tissue was thawed in normal saline. The bioadhesion
measurement was performed using a modified balance
method intact with freshly excised goat vaginal
mucosal membrane as an in vitro model. The
two pans of physical balance were removed. Right pan
was replaced with a 100 ml beaker and on left side, a
glass slide was hanged. For balancing the assembly, a
weight of 20 gm was hanged on left side. Another
glass slide was placed below the hanged slide.
Portions of vaginal membranes were attached with
both slides. The height of this setup was so adjusted,
in such a way that it leaves a space of about 0.2 cm
between two vaginal membrane faces. 1 gm of gel
was placed between two vaginal membrane faces.
Little pressure was applied to form bioadhesion bond,
and then slowly drop of water was added on right side
beaker, till the gel was separated from one face of
vaginal membranes attached. Volume of water added
was converted to mass. This gave the bioadhesive
strength of gel in gm. An initial investigation
examined the reproducibility of the system using three
same formulations. The study was carried out for all
formulations. (Yellanki SK, 2010)
Partition coefficient determination: An equal
volume from n-octanol and citrate phosphate buffer
pH 4 were saturated with each other for 24 hrs, the
two phases were separated. Certain weight of either
the drug or an equivalent weight of the gel was
dissolved in 10 ml of the aqueous phase to give the
concentration of 0.5 mg/ml. The final solution
transferred to a stoppered glass bottle. The final
solution transferred to a stoppered glass bottle
containing 10 ml of n-octanol. The systems were
agitated in a thermostated water bath at 37±1ºC for 24
hrs, the phases were then separated, the aqueous phase
was filtered and the concentration of the max drug
was determined spectrophotometrically at 290 nm
against a blank solution prepared in an analogous
manner. The concentration of the drug in octanol was
calculated from the difference between the initial and
final concentrations of the drug in the buffer phase.
The partition coefficient was calculated according to
Nernst equation.
K = Corg/Caqu.
Where: K = partition coefficient, Corg is the
concentration of the drug in organic phase, Caqu is the
concentration of the drug in buffer. (Ramadan AA,
2008)
In vitro drug release: The in vitro release of drug was
determined from different vaginal gel formulations
using a dialysis bag prepared by cellophane membrane
placed in the release medium. A cellophane
membrane cut to suitable size boiled in distilled water
for 1 hr, soaked in absolute alcohol for half an hour
and stored in citrate phosphate buffer pH 4 for 24 hrs
before use. 6 gm of gel formulations were packed into
the cellophane membrane bags (50 mm). The release
medium was 100 ml citrate phosphate buffer pH 4
containing 1% tween 80, providing sink conditions for
Propranolol hydrochloride. The medium was
maintained at 37ºC and stirred at 100 rpm. At various
time intervals (1 hr), 5 ml of dissolution fluid was
collected. Levels of drug in the samples were analyzed
with the UV spectrophotometer at 290 nm. (Chatterjee
A, 2011)
Accelerated stability study: Stability studies were
performed according to ICH guidelines. The
formulations were stored at room temperature and
accelerated storage conditions at 45±1°C for a period
of 3 months. The samples were analyzed for drug
content by UV spectrophotometer at 290 nm. (Nayak
SB, 2010)
RESULTS AND DISCUSSION
In this study bioadhesive vaginal gel of
Propranolol hydrochloride with different amounts of
Na CMC and tragacanth were prepared and prolonged
release of the drug was demonstrated. The
compatibility between the drug and polymers were
confirmed by IR spectrophotometer. The pH, %yield
and drug content of the gel formulations F1-F8 was
found to be in the range of 4.02±0.06 to 4.28±0.04,
91.9±0.13 to 95.3±0.02 and 25.37±0.05 to
27.78±0.1respectively (Table 3). The bioadhesion
strength of the gel formulations F1-F8 was found to be
in the range of 13.2±0.01 to 24.6±0.05 gm
respectively (Table 4). The optimum partition
coefficient of either Propranolol hydrochloride alone
or formulated into vaginal gel between n-octanol and
citrate phosphate buffer pH 4 was determined and
found to be 3.12±0.14 at 37ºC. It was also observed
that with increase in polymer concentration the
syringibility becomes difficult but the extrudability
improved.
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 872
Table.2.Preformulation parameters of Propranolol hydrochloride
Characters Inference
Nature Crystalline powder.
Colour White
Odour Odourless
Taste Slightly bitter taste
Melting point 165ºC
Solubility:
In water
In acetone
In methanol
In ethanol
In chloroform
Practically insoluble
Fully soluble
Soluble
Soluble
Soluble
Bulk density 0.65±0.03 gm/cc
Tapped density 0.55±0.02 gm/cc
Carr’s index 19.23±0.12
Hausner’s ratio 1.24±0.03 Good flow
Angle of repose 26.5º±0.05
Assay 99.1%
Table 3: Physical appearance, pH, %yield and drug content of Propranolol hydrochloride gel formulations (F1-F8) Formulation Physical appearance pH# %yield# Drug content#
F1 White emulsion 4.13±0.11 94.6±0.07 27.78±0.1
F2 Off white emulsion 4.02±0.06 92.1±0.03 27.42±0.07
F3 Off white lotion 4.16±0.07 94.5±0.08 26.97±0.09
F4 Off white lotion 4.21±0.05 95.3±0.02 26.4±0.11
F5 Dark gray cream 4.08±0.11 92.7±0.12 26.68±0.12
F6 Gray emulsion 4.28±0.04 93.5±0.11 26.19±0.03
F7 Blackish gray lotion 4.24±0.07 91.9±0.13 25.84±0.08
F8 Light brown 4.12±0.06 92.8±0.06 25.37±0.05 # Mean±SD (n=3)
Table.4.Bioadhesion strength, syringibility and extrudability study of Propranolol hydrochloride gel formulations F1-
F8 Formulation Bioadhesion strength# (gm) Syringibility Extrudability
F1 19.8±0.03 *** *
F2 21.2±0.07 *** *
F3 23.1±0.09 *** *
F4 24.6±0.05 *** *
F5 13.2±0.01 *** *
F6 14.7±0.04 *** *
F7 16.3±0.12 ** *
F8 18.1±0.13 ** * # Mean±SD (n=3), *-poor, ** good, *** very good, **** excellent
Figure.1.Spreadability of mucoadhesive vaginal gel formulations F1-F4
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 873
Figure.2.Spreadability of mucoadhesive vaginal gel formulations F5-F8
Figure 3: In vitro drug release profile of formulation F1–F4
Figure.4. In vitro drug release profile of formulation F5–F8
Table.2.Stability study of formulation 8
Time(months) pH#
Syringability Extrudability Drug content# (mg) %CDR
1 4.21±0.05 *** * 26.4±0.11 87.542613
2 4.45±0.05 ** ** 25.8±0.08 90.654467
3 5.23±0.05 ** ** 24.6±0.07 93.123223 # Mean±SD (n=3), *-poor, ** good, *** very good, **** excellent
CONCLUSION
In-vitro drug release of Propranolol
hydrochloride from the bioadhesive gel formulations
showed that the films containing higher concentration
of polymers released the drug slowly as compared to
the formulations with lower concentration. The
formulations maintained the sustained drug release for
a period of more than 54 hrs. The formulation F4
having 4% Na CMC concentration was selected as the
best formulation. The results of the study give a
rational guideline for formulating a sustained release
vaginal drug delivery system of Propranolol
hydrochloride for effective contraception.
REFERENCE
Alexander NJ, Baker E, Kaptein M and Miller L, Why
consider vaginal drug administration, Fertilization
Sterilization, 8(2), 2004, 1-12.
Chatterjee A, Bhowmik BB and Thakur YS;
Formulation, in vitro and in vivo pharmacokinetics of
anti HIV vaginal bioadhesive gel, Journal of Young
Pharmacists, 3(2), 2011, 83-89.
Hardeep and Sankar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 874
Hussain A and Ahsan F, The vagina as a route for
systemic drug delivery, Journal of Controlled Release,
103, 2005, 301-313.
Kumar L, Verma R, Advantages of intra-vaginal drug
delivery system: an overview, International Journal of
Pharmaceutical Research and Development, 2(6),
2010, 15-23.
Nayak SB, Rout PK, Nayak UK and Bhowmik BB,
Development and characterization of bioadhesive gel
of microencapsulated metronidazole for vaginal use,
Iranian Journal of Pharmacy Research, 9(3), 2010,
209-219.
Patil SA, Rane BR, Bakliwal SR and Pawar SP,
Pragmatic hydrogels, International Journal of
Research in Ayurveda and Pharmacy, 2(3), 2011 758-
766.
Ramadan AA, Formulation and evaluation of
bioadhesive gels containing miconazole nitrate,
Journal of Applied Science and Research, 4(9), 2008,
1052-1065.
Yellanki SK, Narella NK, Goranti S and Deb SK,
Development of metronidazole intravaginal gel for the
treatment of bacterial vaginosis, effect of
mucoadhesive natural polymers on the release of
Metronidazole, International Journal of
Pharmaceutical Research and Development, 2(3),
2010, 1-6.
Sadat Ali et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
Volume 1(4) July-August 2013 Page 875
Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment
of osteoarthritis of the knee: a randomized controlled trial Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali*, Ahmed A Tantawy
Department of Orthopaedic Surgery, College of Medicine, University of Dammam, Saudi Arabia.
King Fahd Hospital of the University, AlKhobar, 31952, Saudi Arabia.
*Corresponding author: Email: [email protected], Tel: +966505848281, Fax: +966138820887
ABSTRACT Osteoarthritis of the knee is common among Saudi Arabian men and women. Oral NSAIDS are
most commonly used, however, it often have serious adverse effects especially GI complications. This
study is designed to determine if this herbal topical cream (Max-Relief-MR a combination of menthol,
camphor and Bosweilla serrata) has beneficial, long-term effects on osteoarthritis (OA) comparable or
superior to the gold standard Diclofenac gel.
Key words: Osteoarthritis, Herbal topical cream, Bosweilla serrata, NSAIDS
1. INTRODUCTION
Osteoarthritis (OA) is the degenerative aging
process, which can affect any joint of the body but the
weight bearing joints like knee and the hip are most
commonly affected. It has been suggested that age, sex
and body weight influence the severity of the disease.
The prevalence of OA of the knee is unknown but
recently it was estimated that 12.5% of the general
population aged
45 years suffer from OA of the knee
(Jordan, 2005). Among the ethnic Saudi Arabian
population OA of the knee was reported to be between
1.19 to 3.5% (Sadat-Ali, 1996; Ahlberg, 1990), but in a
decade and half the prevalence of clinical OA of the
knee jumped to 13% (Al-Arfaj, 2003) and radiological
OA of knee to 53% in males and 60.9% in females (Al-
Arfaj, 2002). In the last decade the incidence of OA
among the Saudi Arabian population has increased
drastically (Sadat-Ali, 1996; Al-Arfaj, 2003), but still
our treatment modalities have not changed beyond
NSAIDs and physical therapy. Although majority of
patients show progression with increase of pain, joint
destruction and decrease in the quality life. The
severity of the disease varies among ethnic populations
and among the same populations groups.
Traditionally OA has been managed by
pharmacological treatments which include NSAIDS,
Opioid analgesics, topical applicants, intra-articular
injections and nutritional supplements (Jawad, 2007;
Brabant, 2005; Schuh, 2007; Bellamy, 2006; Bruyere,
2007; Sadat-Ali, 2006). NSAIDS often have serious
adverse effects especially GI complications, reno-
vascular and respiratory complications. Recent
research witnessed innovations in technology of drug
delivery to overcome the disadvantages of oral drug
therapy (Alarcon, 2002). As a result topical
applications of NSAIDs are formulated to penetrate the
skin, subcutaneous fatty tissue, and muscle in amounts
sufficient to exert local therapeutic effects, without
reaching higher plasma drug concentrations.
Recently herbal products have been used in the
management of early in OA and one, which stands out,
is Bosweilla Serrata (BS) (Frankincense). Frankincense
is the resin from the trees of the genus Boswellia,
native to Arabia and Asia. It has a long history of use
and its medicinal properties have been appreciated for
millennia. Several trials of the oral use of BS in the
treatment of osteoarthritis have been published
(Sander, 1998; Kimmatkar, 2003; Sontakke, 2007;
Schuh, 2007; Abdel-Tawab, 2011), but to date there is
no report of topical use of BS. Max-Relief is a
topical analgesic for use of arthritis, backache, sprains
etc was developed at King Fahd University Hospital of
the University of Dammam, University of Dammam.
Max-Relief is USFDA approved as over the counter
(OTC) use and sold in US market since 2008. We have
embarked on this study for use of Max-Relief in OA
of knee and its efficacy as an herbal topical agent and
to compare with topical diclofenac. The study will also
assess the safety of the herbal topical applicant NSAID
over a 12-week treatment course in symptomatic
primary OA of the knee.
2. MATERIALS AND METHODS
King Fahd Hospital of the University,
AlKhobar is a 480-bed tertiary care hospital of the
College of Medicine, Dammam University, Dammam.
The study was carried out at the Osteoarthritis and
Arthroplasty Unit of the Department of Orthopaedic
Surgery, between February 2012 and January 2013.
Two hundred and fifty consecutive patients with a
confirmed diagnosis of OA of the knee were included
in the study after informed consent was obtained. The
demographic data such age, sex weight and height,
duration of OA, known diseases, medications in use
were collected at the interview and from the medical
records. The physical function and pain were assessed
by mWOMAC score. After recruitment, the subjects
were randomly distributed into two groups. The
inclusion criteria included participants who were able
ISSN: 2321-5674(Print)
ISSN: 2320 – 3471(Online)
Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology
Volume 1(4) July-August 2013 Page 877
to understand risks and benefits of the protocol and be
able to give informed consent. Patients (both male and
female) between 40 to 70 years of age with
radiographically confirmed grade 1, 2 & 3 were
included the study.
Following Exclusion criteria will be strictly
adhered:
Secondary arthritis (inflammatory arthropathy,
rheumatoid arthritis, gouty arthritis)
Prior knee surgery
History of ligament instability of knee,
traumatic meniscal tear or traumatic cartilage
damage
Known or suspected pregnancy.
Hypersensitivity to nonsteroidal anti-
inflammatory drugs, abnormal liver or kidney
function tests, history of peptic ulceration and
upper gastrointestinal hemorrhage.
Severe OA requiring surgical intervention
(Grade-4)
Intra-articular corticosteroid or Hyaluronic
acid within the preceding 6 months.
After enrollment Subjects were helped to
complete baseline questionnaires, blood work and
radiological study was performed to assess grade of
osteoarthritis and rule out secondary causes. WOMAC
scoring was recorded before starting their treatment.
(Changes made because WOMAC scoring is a
functional scoring system). Patients were asked to
apply approximately 5 ml of the ointment three times a
day for 12 weeks. They were seen clinically at 0
weeks, 6 weeks and 12 weeks. Investigators
interviewed each subject on a preset questionnaire.
Various parameters of serum biochemistry,
hematology were carried out on each evaluation day (at
0, 6 and 12 weeks). Safety was monitored by clinical
and laboratory assessments during the study visits and
patient-reported adverse events during the treatment
will be recorded. The data was analyzed using SPSS
(Statistical Package for the Social Sciences), version
14.0, Chicago, Illinois. Data was expressed as mean ±
standard deviation (SD). Statistical significance
differences between groups were determined with
Student's t-test and p values of 0.05 using Confidence
Interval (CI) of 95% were considered as significant.
Two hundred and forty two men and women,
age 40–73 years, with radiologically confirmed
primary OA of the knee and who presented to the
Osteoarthritis and Arthroplasty Unit (OAU) of the
King Fahd Hospital of the University, AlKhobar for
pain relief were the study individuals. After informed
consent assessment of function was measured by the
modified Western Ontario and McMaster Universities
(mWOMAC) grading and pain assessment by VAS
(Visual Analouge Scale). Patients were randomized
into two groups, oral NSAIDs were discontinued and
they received either Max-Relief or Diclofenec gel.
Patients were allowed to take Paracetamol unto 1.5
gm/day along with the ointment if required. If patients
required more analgesia the case was excluded from
the study and it was considered failure of treatment.
Participants were instructed to apply either of the
treatment modality three times a day directly to the
painful knees for 12 weeks. The patients were
evaluated after a run-in period of one week (week 0)
and then at 6 weeks and 12 weeks. The clinical
assessments included visual analog scale (VAS) score
that assessed pain and stiffness and measured by the
(mWOMAC) LK3 , as well as physician's and patients'
overall opinions on improvement. Safety assessments
included any adverse events directly related to the
topical applications. Baseline demographic data and
clinical variables were analysed by Chi-square or
Student's t-Test. The incidence of adverse event will
be analyzed by Fisher's Exact Test. Continuous
variables (WOMAC dimensions, PGA and pain on
walking) were analyzed by ANCOVA with baseline
score as the covariate.
3. RESULTS AND DISCUSSION
Two hundred and forty-two patients (122 study
group and 120 control group) completed the stay for 12
weeks. There were no complications in both the groups
to stop the treatment protocol. All the parameters in the
demographic data was not statistically significant
except the weight for the study group was more than
the control group 79.4618.05 versus 75.3216.4
(p<0.006). The comparison of stiffness, pain during
day and pain at night showed that at 6 weeks pain
improved significantly during day P<0.01 and 12
weeks the three parameters improved significantly in
the study group patients at P<0.001. The fourth
parameters compared of daily activities; prayers, STS
(sit to stand), walking flat and climbing stairs. There
was no improvement at prayers at 12 weeks in both the
groups but walking on flat surface the improvement at
6 weeks (P<0.002) and 12 weeks of P<0.3, stairs
climbing was improved in the study group at 12 weeks
P<0.001. (Table.3).
In this randomized controlled trial, we tested
the Max-Relief (a combination of Bosweilla Serrata,
Camphor and Menthol) and were evaluated for its
clinical efficacy in patients suffering from OA of knee
876
ISSN: 2321-5674(Print)
ISSN: 2320 – 3471(Online)
Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology
Volume 1(4) July-August 2013 Page 877
(K/L grades mainly I–III). Our data supports the
efficacy of the of MR in the reduction of pain and
improvement in activities between 6 and 12 weeks of
the continuous use from the baseline compared to the
control group who were using diclofenac in patients
with OA of knee. This study suggests that MR was
effective in improving pain and some of the symptoms
associated with knee OA. However, one thing was
certain that the patients using MR was better than
diclofenac and MR did not significantly improve all
the parameters tested. In the recent past the gum resin
extracted from the ancient herb, Frankincense
(Boswellia serrata) has gained lot of attention as a
potent anti-inflammatory, anti-arthritic and analgesic
agent (Ethan, 2004; Singh, 1986). 3-O- acetyl-11-keto-
beta-boswellic acid (AKBA) is the most active
component of Boswellia extract and has been
demonstrated to be a potent inhibitor of 5-lipoxygenase
(5-LOX), which is a key enzyme in the biosynthesis of
leukotriene’s from arachidonic acid in the cellular
inflammatory cascade (Sailer, 1996). Sengupta, 2008,
showed that 5-Loxin® reduces pain and improves
physical function in patients with OA and it is safe for
human use. This study which used topical BS showed
that it could be used in the management of OA of knee.
Pharmacologic agents in the management of for OA
include, from oral analgesics to anti-inflammatory
agents, intra-articular corticosteroids, and hyaluronic
acid in mild-to-moderate OA-related pain (Zhang,
2008; Zhang, 2007; Zhang, 2005; Jordan, 2003).
Presently based on evidence it is recommended that the
use of topical NSAIDs and rubefacients (Walker-Bone,
2000; Altman, 2000) as a therapeutic option be
potentially with fewer gastrointestinal risks than oral
NSAIDs (Evans, 1995).
Reports indicate that topical NSAIDs are
comparable and alternative to oral NSAIDs with fewer
severe adverse events and provide good levels of pain
relief in knee osteoarthritis (Klinge, 2013). Camphor
and menthol are well known analgesics and the
addition of BS an anti-arthritic proved to be a better
combination in the relief of pain but also reduced
stiffness and increased the quality of daily life of the
men and women suffering with OA knee. Our clinical
study has some limitations. Firstly, we did not assess
the biomarkers for synovial inflammation and to detect
the articular changes and CII degradation biomarkers,
such as CTX-II, C1, 2C and C2C and secondly for a
condition like OA we should have more of patients, as
this is a pilot study the results and its implications are
justified. The strength of this pilot study is that this is
the first study randomized to test the topical BS and
was compared with a known NSAID. In conclusion our
study has shown that BS in combination of camphor
and menthol (Max-Relief) is a safe potent analgesic
and anti-arthritic ointment, which improves the pain,
stiffness and daily life activities in patients with OA of
knee. We believe the product should be further
investigated in large-scale patients.
4. CONCLUSION
This randomized control study shows that
Max-Relief a combination of camphor, menthol and
Bosweilla serrata is potentially a safe and effective
topical treatment in the management of OA and
produced comparative pain relief to the Diclofenac gel.
ACKNOWLEDGEMENT
The authors thank deanship of scientific
research, University of Dammam for awarding a grant
to complete this study vide # 2012099 of 2011.
Table.1. Demographic Data of the Study and the Control Groups
Parameter Study Group Control Group P Value
Number of Patients 122 120
Age in years 59.189.25 59.128.1 0.9
Males 45 50 0.3
Females 77 70 0.4
Duration of Symptoms months 43.49 58.1 42.739.1 0.8
Weight in KGs 79.4618.05 75.3216.4 0.006 (CI at 95% <7.05)
Height in centimeters 165.28.31 164.657.49 0.4
Kellegren and Lawrence Grading 2.481.20 2.460.96 0.8
ISSN: 2321-5674(Print)
ISSN: 2320 – 3471(Online)
Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology
Volume 1(4) July-August 2013 Page 877
Table.2. Pain and stiffness parameters
Parameter Study Group Control Group P Value
Stiffness 0 5.961.29 5.98 1.34 0.8
Stiffness 6 3.451.6 3.541.57 0.7
Stiffness 12 weeks 2.151.36 3.181.23 0.001 (CI at 95% <-0.8117)
Pain during day 0 4.681.26 4.781.43 0.4
Pain at 6 weeks 2.230.94 2.761.1 0.001 (CI at 95% <0.3348
Pain at 12 weeks 1.330.92 1.930.94 0.001 (CI at 95% <-0.4332)
Night Pain at 0 5.61.98 5.391.75 0.1
Night pain at 6 weeks 2.961.3 3.141.2 0.1
Night Pain at 12 weeks 1.631.32 2.841.27 0.001 (CI at 95% <-0.9840)
Table.3.Comparison of the daily activities
Parameter Study Group Control Group P Value
Prayers at 0 6.452.76 6.361.89 0.5
Prayers at 6 4.861.41 4.651.38 0.7
Prayers at 12 3.21.4 3.321.3 0.1
Sit to Stand 0 6.271.89 6.321.89 0.6
Sit to Stand 6 3.631.39 3.751.36 0.8
Sit to Stand 12 2.21.43 2.391.13 0.1
Walk Flat 0 4.630.9 4.650.9 0.7
Walk Flat 6 2.121.26 2.460.94 0.002 (CI at 95% <-0.1732)
Walk Flat 12 1.271.46 1.531.36 0.03 (CI at 95% <-0.0187
Stairs 0 6.121.07 6.151.07 0.8
Stairs at 6 3.60.96 3.720.97 0.1
Stairs at 12 2.51.11 2.971.1 0.001(CI at 95% <-0.2748)
REFERENCES Abdel-Tawab M, Werz O, Schubert-Zsilavecz M,
Boswellia serrata: an overall assessment of in vitro,
preclinical, pharmacokinetic and clinical data, Clin
Pharmacokinet, 50(6), 2011, 349-69. doi:
10.2165/11586800.
Ahlberg A, Linder B, Binhemd TA. Osteoarthritis of
the hip and knee in Saudi Arabia, Int Orth, 14(1), 1990,
29-30.
Alarcon L, Escnbano E, A comparative study of the
transdermal penetration of a series of nonsteroidal anti-
inflammatory drugs, Journal of Pharmaceutical
Sciences, 86 (24), 2002, 503-308.
Al-Arfaj A, Al-Boukai AA, Prevalence of radiographic
knee osteoarthritis in Saudi Arabia, Clin Rheumatol,
21(2), 2002, 142-5.
Al-Arfaj AS, Alballa SR, Al-Saleh SS, Al-Dalaan AM,
Bahabry SA, Mousa MA, Knee osteoarthritis in Al-
Qaseem, Saudi Arabia, Saudi Med J, 24(3), 2003, 291-
3.
Altman RD, Hochberg MC, Moskowitz RW, Schnitzer
TJ, Recommendations for the medical management of
osteoarthritis of the hip and knee: New OA practice
management guidelines from the ACR, Arthritis
Rheum, 43, 2000, 1905-1915.
Bellamy N, Campbell J, Robinson V, Gee T, Bourne
R, Wells G. Intra-articular corticosteroid for treatment
of osteoarthritis of the knee, Cochrane Database Syst
Rev, 19;(2), 2006, CD005328.
Brabant T, Stichtenoth D, Pharmacological treatment
of osteoarthritis in the elderly, Z Rheumatol, 64(7),
2005,
467-72.
Bruyere O, Reginster JY, Glucosamine and chondroitin
sulfate as therapeutic agents for knee and hip
osteoarthritis, Drugs Aging, 24(7), 2007, 573-80.
Ethan B, Heather B, Theresa DH, Ivo F, Sadaf H, Jens
H, David S, Catherine U, Boswellia: An evidence-
based systematic review by the natural standard
research collaboration, J Herbal Phar- macother, 4,
2004, 63-83.
878
ISSN: 2321-5674(Print)
ISSN: 2320 – 3471(Online)
Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology
Volume 1(4) July-August 2013 Page 877
Evans JM, McMahon AD, McGilchrist MM, White G,
Murray FE, McDevitt DG, MacDonald TM, Topical
non-steroidal anti- inflammatory drugs and admission
to hospital for upper gas- trointestinal bleeding and
perforation: a record linkage case- control study, BMJ,
311, 1995, 22-26.
Jawad AS, Irving K, Drug treatment modalities in
patients with chronic osteoarthritis of the hip or knee,
Saudi Med J, 28(3), 2007, 375-8.
Jordan K, Croft P, The prevalence and history of knee
osteoarthritis in general practice: a case–control study,
Family Practice, 22(1), 2005, 103-108.
Jordan KM, Arden NK, Doherty M, Bannwarth B,
Bijlsma JW, Dieppe P, EULAR Recommendations
2003: an evidence based approach to the management
of knee osteoarthritis: Report of a Task Force of the
Standing Committee for International Clinical Studies
Including Therapeutic Trials (ESCISIT). Ann Rheum
Dis, 62, 2003, 1145-1155. 5.
Kimmatkar N, Thawani V, Hingorani L, Khiyani R,
Efficacy and tolerability of Boswellia serrata extract in
treatment of osteoarthritis of knee—a randomized
double blind placebo controlled trial, Phytomedicine,
10, 2003, 3-7.
Klinge SA, Sawyer GA, Effectiveness and safety of
topical versus oral nonsteroidal anti-inflammatory
drugs: a comprehensive review, Phys Sportsmed,
41(2), 2013, 64-74.
Mazieres B, Rouanet S, Velicy J, Topical Ketoprofen
Patch (100 mg) for the treatment of Ankle Sprain, a
randomized, double-blind, placebo-controlled study,
American Journal of Sports Medicine, 33 (4), 2005,
515- 524
Sadat-Ali M, Al-Gindan Y, Al-Mousa M, Al-Rubaish
A, Al-Omari E, Osteoarthritis of the knee among Saudi
Arabian security forces personnel, Mil Med, 161(2),
1996, 105-7.
Sadat-Ali M, Al-Habdan I, El-Hassan AY, Is there an
alternative to NSAIDs and Cox-2 Inhibitors in the
Management of Osteoarthritis of Knee, Ostetoporosis
Inter, 17(1), 2006, 192.
Safayhi H, Mack T, Sabieraj J, Anazodo MI,
Subramanian LR, Ammon HPT: Boswellic acids:
novel, specific, nonredox inhibi- tors of 5-
lipoxygenase, J Pharmacol Exp Ther, 26, 1992, 1143-
1146.
Sailer ER, Subramanian LR, Rall B, Hoernlein RF,
Ammon HPT, Safayhi H: Acetyl-11-keto-β-boswellic
acid (AKBA): structure requirements or binding and 5-
lipoxygenase inhibitory activity, Br J Pharmacol, 117,
1996, 615-618.
Sander O, Herborn G, Rau R. Is H15 (resin extract of
Boswellia serrata, “incense”) a useful supplement to
established drug therapy of chronic polyarthritis?
Results of a double-blind pilot study. [German] Z
Rheumatol, 57, 1998, 11-16.
Schuh A, Jezussek D, Fabijani R, Honle W,
Conservative therapy of knee osteoarthritis, MMW
Fortschr, 149, 2007, 31-32.
Sengupta K, Alluri KV, Satish AR, Mishra S, Golakoti
T, Sarma KV, A double blind, randomized, placebo
controlled study of the efficacy and safety of 5-
Loxin(R) for treatment of osteoarthritis of the knee,
Arthritis Res Ther, 10, 2008, R85. doi:10.1186/ar2461.
Singh GB, Atal CK, Pharmacology of an extract of
salai guggal ex-Boswellia serrata, a new non-steroidal
anti-inflammatory agent, Agents Actions, 18, 1986,
407-412.
Sontakke S, Thawani V, Pimpalkhute P, Kabra P,
Babhulkar S, Hingorani H, Open, randomized,
controlled clinical trial of Boswellia serrata extract as
compared to valdecoxib in osteoarthritis of knee,
Indian J Pharmacol, 39, 2007, 27-9.
Walker-Bone K, Javaid K, Arden N, Cooper C,
Regular review:medical management of osteoarthritis,
BMJ, 321, 2000, 936-940. 6.
Zhang W, Doherty M, Arden N, et al. EULAR
evidence based recommendations for the management
of hip osteoarthritis: report of a Task Force of the
EULAR Standing Committee for International Clinical
Studies Including Therapeutics (ESCISIT), Ann
Rheum Dis, 64(5), 2005, 669-681.
878
879
ISSN: 2321-5674(Print)
ISSN: 2320 – 3471(Online)
Mir Sadat-Ali et.al Indian Journal of Research in Pharmacy and Biotechnology
Volume 1(4) July-August 2013 Page 877
Zhang W, Doherty M, Leeb BF, EULAR evidence
based recommendations for the management of hand
osteoarthritis: report of a Task Force of the EULAR
Standing Committee for International Clinical Studies
Including Therapeutics (ESCISIT), Ann Rheum Dis,
66(3), 2007, 377-388.
Zhang W, Moskowitz RW, Nuki G, OARSI
recommendations for the management of hip and knee
osteoarthritis, part II: OARSI evidence-based, expert
consensus guidelines, Osteoarthritis Cartilage, 16(2),
2008, 137-162.
880
Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 881
Analytical method development and validation for the estimation of Olmesartan
medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana Pattan
1, Haritha Pavani
1, Chandana N
1, Karimulla M
2
1.Department of pharmaceutical analysis, Nimra College of Pharmacy, Vijayawada
2.Department of pharmaceutical analysis, Krishna University, Machilipatnam
*Corresponding Author: E.mail:[email protected], Phone no: 8885818293
ABSTRACT
A simple rapid, accurate, precise and reproducible validated reverse phase UPLC method was
developed for the determination of Olmesartan medoxomil in bulk and pharmaceutical dosage forms. The
quantification was carried out using Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm) column run
in Isocratic way using pH 3.4 Buffer: Acetonitrile (60:40% v/v)] and a detection wavelength of 250nm,
and injection volume of 4µL, with a flow rate of 0.3mL/min. The retention times of Olmesartan
medoxomil was found to be 3.418. The method was validated in terms of linearity, precision, accuracy,
LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed
method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 10% to 150% and with
correlation coefficient of r2=0.9999.The assay of the proposed method was found to be 98.79%. The
recovery studies were also carried out and mean % Recovery was found to be 100.5%. The % RSD from
reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied
for routine quality control analysis of Olmesartan medoxomil in bulk and in Pharmaceutical dosage form.
Key Words: Olmesartan medoxomil, RP-UPLC, Waters acquity UPLC BEH C18, Tablets, Validation.
1. INTRODUCTION
Olmesartan medoxomil is (5-methyl-2-oxo-
2H-1,3-dioxol-4-yl)methyl 4-(2-hydroxypropan-2-yl)-
2-propyl-1-({4-[2-(2H-1,2,3,4-tetrazol-5-
yl)phenyl]phenyl}methyl)-1H-imidazole-5-
carboxylate.The molecular weight is 558.59,molecular
formula is C29H30N6O6. Olmesartan is a prodrug that
works by blocking the binding of angiotensin II to the
AT1 receptors in vascular muscle; it is therefore
independent of angiotensin II synthesis pathways,
unlike ACE inhibitors. By blocking the binding rather
than the synthesis of angiotensin II, olmesartan
inhibits the negative regulatory feedback
on renin secretion. As a result of this blockage,
olmesartan reduces vasoconstriction and the secretion
of aldosterone. This lowers blood pressure by
producing vasodilation, and decreasing peripheral
resistance and is used as antihypertensive.
Literature review reveals very few methods
are reported for the assay of Olmesartan medoxomil in
Tablet dosage forms using RP-HPLC method and no
method has been developed by RP-UPLC. The
proposed RP-UPLC method utilizes economical
solvent system and having advantages like less time
consuming, better retention time, less flow rate, very
sharp and symmetrical peak shapes. The aim of the
study was to develop a simple, precise, economic and
accurate RP-UPLC method for the estimation of
Olmesartan medoxomil in Tablet dosage forms.
Figure.1.Structure of olmesartan medoxomil
2. MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV
win 5software UV-VISIBLE spectrophotometer, with
1cm matched quartz cells. UPLC ACQUITY; 2996
PDA, Waters Acquity UPLC BEH column
Chemicals and reagents: Gifted sample of
Olmesartan medoxomil pure sample and dosage form
of marketed formulation was purchased from local
pharmacy. Other chemicals all are of HPLC grade and
GR grade.
Preparation of mobile phase: Preparation of pH
3.4 Buffer: Dissolve 2.04gm of monobasic
potassium phosphate in 1000mL of water, mix well
adjust to pH 3.4 with diluent OPA (1mL in 10mL of
water) and filtered through 0.22µm filter.and mix the
pH3.4Buffer and CAN in the ratio of(60:40%v/v)
Standard solution preparation: weighed and
transferred about 50mg of Olmesartan medoxomil
working standard in to a 100ml volumetric flak, added
60ml of acetonitrile and sonicated to dissolve, diluted
up to the volume with acetonitrile. Diluted 4ml of the
above solution to 50ml with diluents and filtered
through 0.22um filter.
Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 882
Preparation of sample solution: Five tablets were
weighed and finely powdered and a powder quantity
equivalent to 50mg of Olmesartan medoxomil were
accurately weighed and transferred to a 100ml
volumetric flask and 60ml of acetonitrile was added to
the same. The flask was sonicated and volume was
made up to the mark with acetonitrile. Diluted 4ml of
the above solution to 50ml with diluents and filtered
through 0.22um filter,mixed well and injected. The
amount present in each tablet was calculated by
comparing the area of standard Olmesartan
medoxomil and tablet sample.
Method optimization: The chromatographic
separation was performed using Waters Acquity
UPLC BEH C18 (100 mm X 2.1 mm, 1.7µm) column.
For selection of mobile phase, various mobile phase
compositions were observed for efficient elution and
good resolution. The mobile phase consisting of pH
3.4 Buffer: ACN (60:40% v/v)] was found to be the
optimum composition for efficient elution of analyte.
The mobile phase was injected to the column at a flow
rate of 0.3 ml/min for 6min. The column temperature
was maintained at 25oC, Injection volume was 4L.
The analyte was monitored at 250 nm using PDA-
detector. The retention time of the drugs was found to
be 3.418min. Water:ACN(50:50) was used as diluent
during the standard and test samples preparation. The
optimized chromatographic conditions are mentioned
in Table-1 and chromatogram for standard was shown
in the figure no: 2
3. RESULTS AND DISCUSSION
Method Validation
System suitability: System suitability tests are an
integral part of method validation and are used to
ensure adequate performance of the chromatographic
system. Retention time (RT), number of theoretical
plates (N) or column efficiency and tailing factor (T)
were evaluated for six injections of standard solution
at a solution of 40µg/ml of Olmesartan medoxomil.
Specificity: Specificity is the ability of analytical
method to measure accurately and specifically the
analyte in the presence of components that may be
expected to be present in the sample. The specificity
of method was determined by spiking possible
impurities at specific level to standard drug solution
(40ppm). The diluent and placebo solutions were also
injected to observe any interference with the drug
peak.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given
range. The linearity of Olmesartan medoxomil was in
the concentration range of 10-150%.From the linearity
studies calibration curve was plotted and
concentrations were subjected to least square
regression analysis to calculate regression equation.
The regression coefficient was found to be 0.9999
shows good linearity.
Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the
measure of exactness of the method. Accuracy of the
method was evaluated by standard addition method.
Recovery of the method was determined by spiking an
amount of the pure drug (50%,75%,100% ,150%) at
four different concentration levels in its solution has
been added to the pre analyzed working standard
solution of the drug.
Precision: The precision of the analytical method was
studied by analysis of multiple sampling of
homogeneous sample. The Precision expressed as
standard deviation or relative standard deviation.
System precision: System precision was performed
by injecting a standard solution of Olmesartan
medoxomil for six times.
Method precision: Method precision was performed
by analyzing a sample solution of Olmesartan
medoxomil by injecting six replicates of the same
sample preparations at a concentration of
44.8ppm/mL. Intermediate precision(Ruggedness):
Intermediate precision was performed by analyzing a
standard and sample solutions of Olmesartan
medoxomil by injecting six replicates of the same
standard and sample preparations at a concentration of
40ppm/mL
Robustness: Robustness shows the reliability of an
analysis with respect to deliberate variations in
method parameters. If measurements are susceptible
to variations in analytical conditions, the analytical
conditions should be suitably controlled or a
precautionary statement should be included in the
procedure.
LOD and LOQ:Calibration curve was repeated for
five times and the standard deviation (SD) of the
intercepts was calculated.The results shows,the limit
of detection with a signal to noise ratio of 3:1 was
found to be 0.010 µg/ml. the limit of quantification
with a signal to noise ratio of 10:1 was found to be
0.032 µg/ml.
System suitability: From the system suitability
studies it was observed that retention time of
Olmesartan medoxomil was found to be 3.418 min. %
RSD of peak area was found to be 0.08. Theoretical
Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 883
plates were found to be more than 40289. USP tailing
factor was found to be 1. All the parameters were
within the limit.
Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. Hence the proposed method was found to be
specific.
Linearity: From the Linearity data it was observed
that the method was showing linearity in the
concentration range of 10-150μg/ml. Correlation
coefficient was found to be 0.9999.
Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were in the range of
98%-102%, which shows that the method was
accurate.
Precision: System precision: The percentage relative standard
deviation (RSD) for the peak area 0.08.
Method precision: The percentage relative standard
deviation for the assay values found to be 1.06
Ruggedness: Comparison of both the results obtained
for two different Analysts shows that the method was
rugged for Analyst-Analyst variability. The %RSD for
intermediate precision was 0.09.
Robustness
As the % RSD of retention time and
asymmetry were within limits for variation in
flow rate (± 0.2 ml). Hence the allowable flow
rate should be within 0.1 ml to 0.5 ml.
As the % RSD of retention time and
asymmetry were within limits for variation (+
50C) in column oven temperature. Hence the
allowable variation in column oven
temperature is + 50C.
The results obtained were satisfactory and are in good
agreement as per the ICH guidelines.
Table.1.Optimized chromatogram conditions for Olmesartan medoxomil
Column Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm)
Mobile phase pH 3.4 Buffer: ACN (60 :40 % v/v)
Flow rate 0.5 ml/ min
Wavelength 250 nm
Injection volume 4 L
Column temperature Ambient
Run time 6 min
Table.2.System suitability data for Olmesartan medoxomil
System suitability parameters Results
% RSD 0.08
Tailing factor 1
Theoretical plates 40289
Table.3.Linearity Data for Olmesartan medoxomil
Level Con. (mg/ml) Peak area
10% 5 65673
50% 20 259905
75% 35 395268
100% 45 525796
150% 65 787084
Slope 11674.33
Intercept 826.20
Correlation coefficient (R2) 0.9999
Table.4.Accuracy Data for Olmesartan medoxomil
Level % Recovery % RSD
50% 100 65673
75% 100.6 259905
100% 100.8 525796
150% 100.6 787084
Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 884
Table.5. System precision of Olmesartan medoxomil
No of injections Area RT
1 524321 3.418
2 523789 3.417
3 523912 3.418
4 524832 3.418
5 524721 3.416
6 524198 3.416
Average 524297 -
SD 420.1 -
% RSD 0.08 -
Table.6.Method precision and intermediate precision Data for Olmesartan medoxomil
Sample no. Assay
Method precision Intermediate precision
1 98.79 98.76
2 98.74 98.66
3 98.94 98.86
4 98.76 98.76
5 98.94 98.86
6 98.9 98.66
Mean 98.81 98.76
%RSD 1.06 0.090
Table.7.Variation in flow rate, column temperature for Olmesartan medoxomil
Parameter Flow (mL/min) Temperature(oC)
Low
(0.1ml/min)
Actual
(0.3ml/min)
High
(0.5ml/min)
Low
(20 oC)
Actual
(25 oC)
High
(30 oC)
%RSD 0.16 0.08 0.11 0.15 0.089 0.1
Retention time 4.451 3.336 2.528 3.856 3.418 3.014
Plate count 51056 40289 38529 42106 40289 40562
Tailing factor 1 1 1 1 1 1
Figure.2.Standard chromatogram Figure.3.Sample chromatogram
Figure.4.Linearity plot Figure.5.Chromatogram for specificity
Farhana Pattan et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 885
4. CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of
ICH guidelines for method validation. The proposed
method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is
validated and can be used for routine sample analysis.
REFERENCES
Abdullah Al Masud, Md. Mahfuzur Rahman, Moynul
Hasan, Validated Spectrophotometric method for
estimation of Olmesartan medoxomil in
pharmaceutical formulation, International journal of
pharmaceutical and life sciences volume, 1 (11), 2012,
2305-0330.
Chaitanya Prasad MK, Vidyasagar G, Sambasiva Rao
KRS, developed RP-HPLC method for the estimation
of olmesatan medoxomil in tablet dosage form, Der
pharma chemica, 3(6), 2011, 208-212
Jain Pritam, Chaube Udit, Chaudhari Rakesh, UV-
Spectrophotometric method for determination of
Olmesartan medoxomil in bulk and in formulation,
Internationale pharmaceutica sciencia, 1(7), 2011,
2231-5896.
Lakshmi surekha M, Kumara swamy G, RP-HPLC
method for the estimation of olmesartan medoxomil in
bulk and tablet dosage form, Contemporary
Investigations and observations in pharmacy, 2(1),
2013, 3-6, 2278-7429.
Selvadurai Muralidharan, Kumar, developed Sensitive
estimation of olmesartan medoxomil tablets by RP-
HPLC method, International journal of pharmacy &
life sciences, 1(7), 2012, 0976-7126.
Sharma Ritesh, Pancholi Syam S, RP-HPLC-DAD
method for determination of Olmesartan medoxomil
in bulk and tablets exposed to forced conditions,
INIST-CNRS, 60, 2010, 1330-0075.
Suman.avula.K.Naveen babu, M.V.Ramana, RP-
HPLC method for the estimation of olmesatan
medoxomil in bulk and tablet dosage form, An
international journal of advances in pharmaceutical
sciences, 2(2-3), 2011, 0976-3090.
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 886
Modern hygienic industrial canteen amenity: A change factor for healthy physical
work environment of the work force in Indian industrial units TN Murty
1*, GV Chalam
2, Md Aasif Siddique Ahmed Khan
3, T Abhinov
3 and T Abhilash
3
1. Director, Nimra College of Business Management, Vijayawada- 512456.
2. Professor in Commerce & Business Administration, Acharya Nagarjuna University, Nagarjuna Nagar- 522 510
3. Shadan Institute of Medical Sciences, Hyderabad
*Corresponding author: Email: [email protected]
ABSTRACT
Physical Working environment influences to a greater extent of the health of the workers. Hygienic
environment is an important requisite for the maintenance of good health. The term ‘hygiene’ includes not
only the material environment but also personal hygiene. The importance of the personal hygiene should
continually be brought home to the industrial workers. The pre-employment interview with the doctor,
nurse or welfare officer gives an opportunity for hints on personal hygiene. All the employees in a
factory should become health-minded as Human Resources (HR) Capital plays a very crucial role in the
growth and prosperity of any industry. The fundamental conditions of a healthy working environment
must be maintained in every factory. In this connection good canteen assumes an importance, in keeping
the air fresh and free from germs. The main purpose of this study is to study work environment of the
workforce and its impact on the employees’ hygiene and to know the modern hygienic canteen facility as
welfare amenity being provided by selected Indian Industrial Units. The study may help to the policy
makers like management, trade unions, Government to improve the existing state of affairs mainly by
emphasizing on the amenities and welfare of the employees in corporate sectors.
Key words: Hygiene, Workforce, Work Environment, Motivation, Canteen.
INTRODUCTION
Human Resources (H R) Capital plays a very
crucial role in the growth and prosperity of any
industry. The workers can be motivated and their
productivity can be increased only when a conducive
and hygienic physical work environment is created
and adequate Canteen facility is provided by the
management irrespective of the sector. The subject of
Canteen facility is thus fairly wide and is not limited
to any one country, one region, on sector, one industry
or occupation. Its scope has been described by
different writers in different perspectives. But the
common objective of canteen facility is to provide
quality food stuff at reasonable price to the workers.
Canteen provision is neither philanthropy nor
charity. It is a method of creating more satisfactory
working conditions for men and women employed in
an industry. It is quoted that by Narayana Murty
(2000) in his work Labour Welfare Measures in
Indian Industrial Organizations that the welfare
measure would greatly reduce turnover and
absenteeism among workers and improves workers
efficiency to a greater extent and also create a
permanent settled labor force by making service
attractive to the labor. A canteen can help in
improving the morale of the workers further, the
availability of food stuff within the factory areas
reduces the botheration and saves time of the workers.
(Report of the Bombay Textiles Labor Enquiry
Committee, 1953, P: 166).
The high rate of absenteeism and turnover in
Indian Industries is indicative of the lack of
commitment on the part of the workers, for they want
to escape from their environment whenever possible.
Bigger undertakings like private and public sectors
have provided modern and hygienic canteens as
compared with co-operative sector. But in some
organizations the management passes on the
responsibility of running the canteens to the
contractors. Similarly the managements of public and
private sector units feel that the Labor Welfare is their
social responsibility. So, the representatives of the
both workers and management make the canteen
facility more attractive to the workers.
Objectives of the Study
1. To Study work environment of the workforce
and its impact on the employees’ hygiene,
2. To Know the modern hygienic canteen facility
as welfare amenity being provided by selected
Indian Industrial Units, and
3. To make appropriate suggestions to policy
makers for the improvement of hygienic canteen
facility in order to maintain healthy work
environment of workforce in selected Indian
Industrial Units.
REVIEW OF THE LITERATURE Canteen is a very important facility for the
workers through which a better standard of food and
refreshments can be obtained, when compare to the
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 887
make shift hotels that spring up around factories.
Moreover, through these canteens wholesome food
and refreshments can be provided to the workers at
reasonable prices so as to make available to them a
balanced sand hygienic food. This is likely to improve
their health and efficiency. Canteens also serve as
places where workers can meet informally and refresh
themselves by a relaxing conversation. The canteens
are also instruments of social change, as the workers
belonging to different religions and castes will have to
sit at the same tables and take their food. Thus, a
canteen can help in improving the morale of the
employees. Further, the availability of the food stuffs
within the factory area reduces botheration and saves
time of the workers; otherwise they will have to go
out of the factory. The review of the literature has
been done in order to assess the extent and quality of
Hygienic Canteen facility to employees provided by
various organizations in various industries. There
have been a number of studies conducted so far in this
area. However, a few studies of importance have been
presented here.
1. Rizwana Ansari (2011) found out in her study
physical environment and employee industrial
safety, a remarkable improvement of employee
performance. It is found that one fourth of the
employees in public sector units are dissatisfied
with the provision of safety, health amenities
and canteen facilities to the workforce.
2. Maja Dijkic (2008) in his study on physical
environment an expanded model of job
satisfaction concludes with positive correlation.
The purpose of the study was to examine the
effect of perceived physical work environment
on job satisfaction.
3. Kudchedkar (2008) differentiates between the
labour welfare activities and the personnel
functions and gives some suggestions for better
working and living standards.
4. Morris (2008) describes industrial history of
Bombay and gives the growth of labour force,
work regulation, wages, discipline, trade unions
and arbitration between 1854 to 1917 in the
Cotton Mills of Bombay (India). It is found that
the Bombay Mills Association Voluntarily
appointed personal officers to look into the
matters on safety, welfare, canteen, health and
other personnel functions.
5. Saxena (2000) gives socio-economic
background of workers in the five selected units
in Meerut district and discussed promotion
policies, training, transfers, welfare measures,
bonus, remuneration and the functioning of the
trade unions. It is found that the personnel
policies on promotion, training, internal
mobility, wage and welfare includes canteen are
created healthy work environment in the units in
Meerut ( India).
6. Narayana Murty (2000) has studied socio-
economic profile of the workforce and
employee welfare activities in Indian Industrial
Organizations. It is found that majority of the
Employees in Co-operate Sector Units are
satisfied with the existing welfare, canteen, and
health facilities.
All these studies help the management, unions and
governments to improve the existing state of affairs
mainly by emphasizing on functional areas of Human
Resources Management and existing welfare
amenities in a single unit or two units or more with a
comparative study in the same sector like private or
public or co-operative. There have been very few
comprehensive studies in the field of work
environment and less concentration on the provision
of welfare facilities and amenities provided by the
Government and the managements of the undertakings
as well. However, surprisingly, very few attempts
have been made by the researchers to study the extent
of Canteen facility to the employees of any unit. The
study shows the gap and also furnishes the reasons
between the practice and precept.
METHODOLOGY OF THE STUDY
The Coastal Districts of Andhra Pradesh,
India have been deliberately chosen in data collection
and also to obtain meaningful insights. The provision
of Canteen laid down in the Factories Act, 1948 are
common to all the public, private and co-operative
sectors. The public sector undertakings will think to
implement them seriously as they are bound by it.
The private sector seeks to implement the measures up
to the level as exactly how they are incorporated in
laws. They do not beyond what the enactment
provide for. Finally the co-operative sector seeks to
implement the provisions at a minimum level thinking
that the burden of implementation falls on both the
management and the workers. Keeping these in view,
some industrial units in Andhra Pradesh, India are
selected for field study.
The study is conducted by using both
analytical and descriptive type of methodology. The
study depends on primary and secondary data. By
using Pilot Study, the filled up Questionnaires are
collected from 290 (130 in Private Sector Unit and160
in Public Sector Unit) respondents. Based on the pilot
study, the questionnaire is modified suitably to elicit
response from the sample group. Primary data were
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 888
collected on the basis of stratified random sample
survey of employees. The views of the workers are
elicited by way of well-structured Questionnaire,
Interviews, Discussions, and Observations. The
Secondary data were collected from Journals,
Magazines, Publications, Reports, Books, Dailies,
Periodicals, Articles, Research Papers, Websites,
Company Publications, Manuals and Booklets. The
processing, classification, tabulation and interpretation
and analysis of data are done with the help of
Statistical and Mathematical Techniques. These have
been employed depending on the nature of the data
collected from the respondents.
Modern Hygienic Canteen Facility- An Analysis:
The canteens are also instruments of social change, as
the workers belonging to different religions and castes
will have to sit at the same tables and take their food.
In this context the Bombay Textiles Labor Enquiry
Committee observed. “Besides good lighting and
ventilation, adequate dining accommodation is also an
essential requirement for the workers. It is necessary
that such accommodation should be more ample for
night workers than for day workers because it is
usually not possible at night to go outside the
company premises for that purpose.”
The view of ILO in this connection is that the
“Canteen movement must be accepted by the State as
a definite changes and running of canteens must be
accepted by the employers as a national investment.
The object of the canteen was laid down very clearly
by the Labor Investigation Committee in its report
when it said “to introduce an element of nutritional
balance into the otherwise deficient unbalanced
dietary of the workers, to provide cheap and clean
food and an opportunity to relax in comfort near the
place of work, to save time and trouble to workers on
account of exhausting journey to end from work after
long hours in factory and to enable them to surmount
the difficulties experienced in obtaining meals of
foodstuffs are imperative of factory management.”
Section 46(1) of the Factories Act, 1948,
provides that the “The State Government may make
rules requiring that in any specified factory wherein
more than 250 workers are ordinarily employed, a
canteen or canteens will be provided and maintained
by the occupier for the use of the workers.” Sub
section (2) of the same section also empowers the
State Government to provide for the standards in
respect of construction, accommodation, furniture and
other equipment of the canteen and the food stuffs to
be served therein and the charges which may be made
thereof”.
DISCUSSIONS AND RESULTS
Public Sector Unit provided a full pledged
canteen with all modern facilities like proper
ventilation, adequate number of fans, neatness and
cleanliness. The canteen is run on ‘no profit no loss’
basis. The cost of power, fuel, furniture utensils are
borne by the management of Public Sector Unit. This
canteen will cater to the needs of the employees in
each shift. The canteen is working under the
supervision of Personnel Officer (Welfare- Canteen)
and a canteen committee comprising of the
representatives of workmen nominated by the
management of Public Sector Unit. The rates of the
items in the canteen have been fixed by the
management in consultation with the trade union
leaders. The Personnel officer (Welfare – Canteen)
sells the tokens to the workers from first to tenth of
every month and there is also a credit facility available
to the workers.
Price level of items in modern hygienic canteens:
The canteens are located in the midst at the yard of the
factory with an easy access to all workmen. And there
is a separated canteen also available to the
supervisors, officers and managers of Public Sector
Unit. It is observed that all the canteens in Public
Sector Unit look very neat at all times. Breakfast and
Lunch are served at the canteen for ‘A’ ( 6 am to 2
pm) and ‘G’ ( 8 am to 4 pm) shift employees, dinner
is served for ‘B’(2 pm to 10 pm) shift employees.
Tea is also served twice during the shift time at the
respective working spots. For ‘B’ shift employees
along with tea, snacks are also supplied at subsidized
price. The management of Private Sector Unit is
spending huge amount per year for the running of the
canteen. Canteen is supervised by an Assistant
Welfare Officer and Canteen Manager.
The list of items which are available in
canteen with price are placed in the canteen and have
been fixed by the management in consultation with
the office bearers of the recognized union. The
canteen also provides meal consist of cooked rice,
vegetable curry, sambar, rasam, pickles, (Chutney),
dall and curd. In addition to the canteen there is also
one tea stall, which works round the clock to supply
tea and snacks.
Besides, the various stated purposes of the
canteen provision, the objective of the industrial
canteen is to provide food to the employees at
minimum Price. The Indian worker still belongs to
the low income group and cannot afford to spend
much on his food in the canteen through his/her
position is gradually improving, and in not distant
future, the skilled worker at least would be classified
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 889
as belonging to middle class if not to the upper middle
class.
Frequency of visit to modern hygienic canteens by
the workers: Table 1 shows the data on the extent to
which the workers are utilizing the canteen facilities
available in the selected units. It is evident from the
information that in these units, about half of the
workers are frequent visitors to the canteen.
However, it is obvious that 44.14 percent of the
workers are not motivated to visit the canteen
frequently. They are going to the canteen only now
and then and only a small and negligible portion of the
workers (2.41 percent) never visited the canteen for
utilizing canteen facility in their organizations.
Table.1.Frequency of visits to canteen in selected units Opinion Frequently Sometimes Never Total
Public
Sector
Unit
Service Wise
( Years)
1-10 22 (44.00) 26 (52.00) 02 (4.00) 50 (100.00)
11-20 33 (44.00) 39 (52.00) 03 (4.00) 75 (100.00)
Above 20 14 (42.86) 18 (51.43) 02 (5.71) 35 (100.00)
Native
Background
Rural 39 (43.33) 47 (52.22) 04(4.45) 90 (100.00)
Urban 31 (44.28) 26 (37.14) 03 (4.28) 70 (100.00)
Type of
Employee
Skilled 49 (43.75) 58 (51.79) 05 (4.46) 112 (100.00)
Unskilled 21 (43.75) 25 (52.08) 02 (4.17) 48 (100.00)
Total 70 (43.75) 83 (51.88) 07 (4.37) 160 (100.00)
Private
Sector
Unit
Service Wise
( Years)
1-10 18 (66.67) 09 (33.33) - 27 (100.00)
11-20 45 (65.20) 24 (34.80) - 69 (100.00)
Above 20 22 (64.70) 12 (35.30) - 34 (100.00)
Native
Background
Rural 78 (65.00) 42 (35.00) - 120 (100.00)
Urban 07 (70.00) 03 (30.00) - 10 (100.00)
Type of
Employee
Skilled 39 (65.00) 21 (35.00) - 60 (100.00)
Unskilled 46 (65.70) 24 (34.30) - 70 (100.00)
Total 85 (65.38) 45 (34.62) - 130 (100.00)
Note: Figures in parentheses are Percentages
Unit wise analysis shows that in case of Public Sector
Unit, 43.75 percent of the workers are frequent
visitors to the canteen, about half of the workers are
not visit the canteen frequently. When we observe the
service wise and native background wise data, it is
clear from the table that the workers in the service
group of 1-20 years and urban background and
making best utilization of the canteen facility, while
the workers with more than 20 years of service and
rural background were making less utilization of the
canteen. And a negligible percentage of the workers
never visited the canteen in Public Sector Unit.
In Private Sector Unit, about two-third of the
workers are frequent visitors to the canteen and the
rest of the workers are not habituated to visit the
canteen frequently. They are going to the canteen
only now and then. When we make service-wise
analysis, it can be observed from the table that the
workers in the service-group of 11-20 years are
making best use of the canteen. It is also evident that
the urban workers are more frequent visitors of the
canteen in Private Sector Unit.
It is found from the foregoing discussion that
an overwhelming majority of the respondents are
frequent visitors to the canteen in Private Sector Unit
than that of the Public Sector Unit. It is interesting to
note that the workers in the service of 11-20 years are
making best utilization of the canteen facility, while
the workers with more than 20 years of service were
making less visits of the canteen and the urban
workers are more frequent visitors of the canteen in
the selected units of the study.
Quality of Items in the Modern Hygienic Canteens:
Table2 gives the information on the opinion of the
respondents on the quality of items in canteen in the
selected units. It is obvious from the information that
half of the workers in the selected units of the study
felt that the quality of the items in their canteen was
good and 42.90 percent of them in these units felt
satisfactory about the quality of the items in their
canteens.
Unit wise data shows that in case of in Public Sector
Unit 43.75 percent of the workers expressed good
opinion and 48.12 percent of the workers felt that the
quality of items in the canteen was satisfactory.
However, 4.38 percent of them did not say anything
and 3.57 percent of them expressed their opinion on
the quality of items in canteen was poor. When we
make service – wise analysis it is clear from the data
that 44 percent of the workers in the service group of
1-20 years and 42.86 percent of the workers in the
service group of above 20 years had expressed good
opinion on the quality of items of canteen.
In Private Sector Unit 57.69 percent of the
workers felt that the quality of the items in canteen
was good. It is obvious from the data that 36.15
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 890
percent of the workers felt that the quality of the items
in the canteen was satisfactory and the negligible
percentage of them had negative opinion on the
quality of items in modern Canteen in Private Sector
Unit. On the whole, it is found that the majority of the
workers in the service group of 1-10 years, 11-20
years and urban background had positive opinion on
the quality of items which are available in their
respective canteens. It is very interesting to note that
on the whole or individual unit-wise less than 4.83
percent of the workers felt that the quality of items in
their canteen was poor.
Table.2.Respondents’ opinion on quality of items in canteen in selected units Opinion Good Satisfactory Poor Not Aware Total
Public
Sector
Unit
Service Wise
( Years)
1-10 22 (44.00) 24(48.00) 02 (4.00) 02 (4.00) 50(100.00)
11-20 33 (44.00) 36 (48.00) 03 (4.00) 03 (4.00) 75 (100.00)
Above 20 14 (42.86) 17 (48.57) 01 (2.86) 02 (5.71) 35 (100.00)
Native
Background
Rural 39 (43.33) 43 (47.77) 04 (4.45) 04 (4.45) 90 (100.00)
Urban 31 (44.28) 34 (48.57) 02 (2.86) 03 (4.29) 70 (100.00)
Type of
Employee
Skilled 49 (43.75) 54 (48.21) 04 (3.57) 05 (4.47) 112 (100.00)
Unskilled 21 (43.75) 23 (47.91) 02 (4.17) 02 (4.17) 48 (100.00)
Total 70 (43.75) 77 (48.12) 06 (3.75) 07 (4.38) 160 (100.00)
Private
Sector
Unit
Service Wise
( Years)
1-10 16 (59.25) 10 (37.00) 01(3.75) - 27 (100.00)
11-20 40 (58.00) 25 (36.25) 04(5.75) - 69(100.00)
Above 20 19 (55.90) 12 (35.30) 03 (8.80) - 34(100.00)
Native
Background
Rural 69 (57.50) 43 (35.85) 08 (6.65) - 120 (100.00)
Urban 06 (60.00) 04 (40.00) - - 10 (100.00)
Type of
Employee
Skilled 35 (58.35) 22 (36.65) 03 (5.00) - 60 (100.00)
Unskilled 40 (57.15) 25 (35.70) 05 (7.15) - 70 (100.00)
Total 75 (57.69) 47 (36.15) 08 (06.16) - 130 (100.00)
Note: Figures in parentheses are Percentages
Quality of services in the modern hygienic
canteens: Quick supply refers to speediness of
service. The worker normally would like to take his
lunch in about 15 minutes and rest for some time
before he resumes work for the second half of his
shift. Speedy meal and service depend on the type of
the canteen services practiced, the number of staff in
the canteen, the equipment available and other
resources. Table3 shows the data on the workers’
opinion on the supply of items in the canteen of the
selected units for the study. It is evident from the
Table that on the whole about half-of the workers felt
that the service in the canteen was satisfactory.
However, it is also clear from the data that 4.83
percent of the workers felt that the service in their
canteens was poor.
Table 3: Respondents’ opinion on services in canteen in selected units Opinion Good Satisfactory Poor Not Aware Total
Public
Sector
Unit
Service Wise
( Years)
1-10 22 (44.00) 24 (48.00) 02 (4.00) 02 (4.00) 50 (100.00)
11-20 33 (44.00) 36 (48.00) 03 (4.00) 03 (4.00) 75 (100.00)
Above 20 14 (42.86) 17 (48.57) 01 (2.86) 02 (5.71) 35 (100.00)
Native
Background
Rural 39 (43.33) 43 (47.77) 04 (4.45) 04 (4.45) 90 (100.00)
Urban 31 (44.28) 34 (48.57) 02 (2.86) 03 (4.29) 70 (100.00)
Type of
Employee
Skilled 49 (43.75) 54 (48.21) 04 (3.57) 05 (4.47) 112 (100.00)
Unskilled 21 (43.75) 23 (47.91) 02 (4.17) 02 (4.17) 48 (100.00)
Total 70 (43.75) 77 (48.12) 06 (3.75) 07 (4.38) 160 (100.00)
Private
Sector
Unit
Service Wise
( Years)
1-10 11 (40.75) 15 (55.55) 01(03.70) - 27 (100.00)
11-20 27 (39.15) 37 (53.60) 05(07.25) - 69 (100.00)
Above 20 14 (41.20) 18 (52.95) 02(05.85) - 34 (100.00)
Native
Background
Rural 48 (40.00) 65 (54.15) 07(05.85) - 120(100.00)
Urban 04(40.00) 05(50.00) 01(10.00) - 10(100.00)
Type of
Employee
Skilled 24(40.00) 32(53.35) 04(06.65) - 60(100.00)
Unskilled 28(40.00) 38(54.30) 04(05.70) - 70(100.00)
Total 52 (40.00) 70(53.84) 08 (6.16) - 130(100.00)
Note: Figures in parentheses are Percentages
The analysis on unit-wise indicates that in case of
Public Sector Unit 43.75 percent of the workers had
good opinion, 48.12 percentage of them satisfied with
the service available in canteen and a very low percent
of the workers viewed on the services available in
canteen was poor and only 4.38 percent of them did
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 891
not say anything on the service in the Canteen. In
Private Sector Unit, about more than half-of the
workers felt that the service in the canteen was
satisfactory, whereas 6.16 percent of the workers felt
that the service in the canteen was poor.
It is found that more than 93 percent of the
workers in the Selected Industrial units were satisfied
with the quality of canteen services. It is observed
that the services in Private Sector Unit canteen as
controlled by canteen committee and labor officer,
and Public Sector Unit canteen was controlled by the
Canteen Committee and Senior Personnel officer.
Cleanliness in modern hygienic canteens: The
canteen should be installed in a clean and hygienic
place and its kitchen, counter as well as the dining
rooms. The canteen area should be maintained in
clean and health conditions, free from the files, dust
and dirt. The Computed Data shows the information
on workers’ opinion on the sanitation and cleanliness
in their respective canteens of the selected units. It is
evident from the data that 63.45 percent of the
workers on an average in the industrial units, felt that
the cleanliness in their canteens was good, about
30.68 percent of the workers opined that the
cleanliness in their canteens was satisfactory and only
less than 3.79 percent of them felt dissatisfied with the
cleanliness in the canteens of the selected units for the
study.
Unit-wise data reveals that in case of Public
Sector Unit 48.12 percent of the workers felt that the
cleanliness and sanitation in canteen was good, about
43.75 percent of them had expressed satisfactory
opinion and 3.75 percent of the workers in did not say
anything about the sanitation conditions in their
canteen. However, a very low percentage of the
workers felt dissatisfied with the cleanliness in the
Public Sector Unit canteen. In Private Sector Unit
about four fifths of the workers felt that the
cleanliness in Private Sector Unit canteen was good.
It is also interesting to note that only an insignificant
portion of the workers felt dissatisfied with the
cleanliness in the canteen.
Major Findings of the Study
1. It is found that the bigger organization in the
private sector and public sector units are
financially sound and they are able to provide
the clean and hygienic food items to their
worker at minimum price in the Canteens in
Indian Industrial Organizations.
2. It is found that the Indian workers in the
selected units expressed their satisfaction and
the prices are reasonably charged in the
hygienic canteens.
3. It is found that an overwhelming majority of
the respondents are frequent visitors to their
hygienic canteen in Private Sector Unit than
that of the Public Sector Unit.
4. It is found from the foregoing analysis that
half-of the workers in the selected unit felt
that the quality of items in the canteen was
good. It is also found that an insignificant
percentage of the respondents had poor
opinion on the quality of items in their
canteen.
5. It is found that an average earning in Indian
Industrial worker is not in a position to take
his/her food items with quality in his house as
compared with the items in their canteens at
their work spots.
6. It is found that more than 93 percent of the
Indian Industrial workers in were satisfied
with the service in the canteen.
7. It is also found that the majority of the Indian
Industrial workers were satisfied with the
cleanliness and sanitation in their canteens.
Suggestions for the improvement of Canteen for
Healthy Physical Work Environment of the
Workforce:
1. It is suggested that the management of private
and public sector units can provide the clean
and hygienic food items to their worker at
minimum price in their canteens and to
mitigate the dissatisfied workers in Indian
Industrial Units.
2. It is suggested that the management of private
and public sector units may maintain the same
price for food items in the Canteen in future
also through subsidy created by the
management of Industrial units.
3. It is suggested that the management of private
and public sector units may create the habit of
visits in the minds of employees to visit
canteen and to take their food in the canteen
in order to save their productivity time on the
work-spot and to get some relax.
4. It is suggested that the management of private
and public sector units may take steps to
improve the services in their canteen in
speedy and quick manner.
5. It is suggested that management of Public
Sector Unit should maintain cleanliness and to
establish good sanitation at the canteen as a
part of the welfare and health of workmen in
India.
T N Murthy et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 892
6. It is suggested that the managements of
Indian Industrial Units should maintain high
quality of items and to mitigate the rest of the
dissatisfied workers also.
Scope for Further Research
The study can be extended to the related
business Information Technology Export Services
(ITES) and Business Process Outsourcing industry
(BPO). Leadership and administration styles are to be
studied as the employees are lagging behind in these
qualities in India and similar studies can be conducted
on other type of industries. Society comprises of the
workers, management, Government and general
public. The present study is of much relevance from
the point of view of the society. The Central and State
Government are enabling several labor legislations
and adopted a policy to create better working of
industrial canteen to the workers.
CONCLUSION
On the basis of the results obtained in the
study, it is observed that the canteen in the units
prevailing have deep impact on workers psychology
and the presence of such factors always motivate the
workers towards their job in a laudable manner.
Hence, it is concluded that the workers employed are
satisfied with their job and their positive approach
towards the management has been responsible for the
overall growth of in the Indian corporate sector.
Besides, it has also been found that the concept of
canteen facility assumes immense importance in the
present business scenario which requires highly
skilled and competent human resources for the
transformation of traditional economies into the
modern and industrial economies.
ACKNOWLEDGEMENTS
We thank Smt. S. Tehniath Khan President of
Nimra and Shadan Group of Colleges, India, Dr.
Mohd Saqib Rasool Khan, Secretary, Nimra College
of Business Management, Vijayawada, India, Dr.
Mohd Sarib Rasool Khan, Managing Director, Shadan
Institute of Medical Sciences, Hyderabad, India, Dr. K
V Rao, Vice- Chancellor, Acharya Nagarjuna
University, India for their support and encouragement
during this study.
REFERENCES
Bhatia W.J, Principles and Practices of Personnel
Management and Human Resource Management,
Edition II, Deep & Deep Publication, New Delhi,
1994.
Bhattacharya S.K, Organizational Culture and Indian
Perspectives, 1988.
Dale S.Beach, Human Resource and Personnel
Management, Tata McGraw Hill, Ed.3, New Delhi,
2002.
Frederick Herzberg, B.Mausner and B. Synderman,
The Motivation to work, John Wiley and Sons, New
York, 1985.
Garry Steiner, Human Behavior, New York Harcourt,
Brace & World, 1964.
Gupta C.B, Human Resource Management, Sultan
Chand and Sons, V Edition, 2006.
Maslow A.H, Motivation and Personality, Harper &
Row, New York, 1954.
Memoria C.B, Personnel Management, Himalaya Pub.
House, Bombay, 1984.
Narayana Murty.T, Labour Welfare Measures in
Indian Industrial Organizations, Un- Published Thesis,
Nagarjuna University, Nagarjuna Nagar, India, 2000.
Rizwana Ansari, Physical work environment and
industrial safety of the employees in power sector, un-
published thesis, Vinayaka missions university,
Salem, India, 2011.
T. N. Murty and T Abhinov, Safety and Health
Environment of Workforce in Indian Public sector
Units- An Injection for Occupational Health Hazards,
ICME 2013Sri Lanka, ISBN 978-955-1507-23-7,
February 2013, Matara, Sri Lanka.
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 893
Design and development of Metformin hydrochloride Trilayered sustained release
tablets Venkateswara Rao T
1*, Bhadramma N
1, Raghukiran CVS
2 and Madubabu K
3
Bapatla College of Pharmacy, Bapatla, Guntur-522101
Tigala Krishna Reddy College of Pharmacy, Hyderabad.
Hetro Drugs Ltd, Hyderabad
Corresponding author: E-Mail: [email protected]
ABSTRACT
Diabetes is one of the major causes of death and disability in the world. Diabetes results from decreased
secretion of insulin, decreased insulin action or both. The main aims of the investigation was to design and
development of trilayer floating tablets of metformin hydrochloride and also study the influence of concentrations
of HPMCK 100 on various properties of tablet and tri-layer tablets were formulated by wet granulation method.
Drug - excipient compatibility studies were conducted by FTIR spectroscopy. The prepared granules, tablets were
evaluated. In-vitro release data revealed that F5 formulation sustained the release for 12 hours and the release
data was fitted into zero order, first order, Higuchi and Peppas equations. The drug release from the formulation
followed zero kinetics and exhibits Peppas mechanism. Release exponents ‘n’ was found less than 0.85 indicating
the release governed by non-fickian anomalous transport mechanism.
Key words: Tri ilayer floating tablets, Hydroxy propyl methyl cellulose (HPMCK100)
INTRODUCTION
Diabetes is one of the major causes of death
and disability in the world. Diabetes mellitus is a
group of metabolic diseases characterized by
hyperglycemia (fasting plasma glucose ≥ 7.0 mmol /
1 or 2 hours post 75 g oral glucose load plasma
glucose ≥ 11.1 mmol / on two or more occasions).
Diabetes results from deficient insulin secretion,
decreased insulin action, or both. The oral route of
drug administration was most convenient method for
controlled delivery of drug. It provides the continuous
oral delivery of a drug also the system that target the
delivery of a drug to a specific region within the GI
tract for either local / systemic action. One of the
most feasible approaches for affecting a prolonged
and predictable drug delivery in the GI tract is to
control the GRT.
Metformin hydrochloride is an anti-
hyperglycemic agent, which improves the glucose
tolerance in type 2 diabetes. People with type 2
diabetes are not able to make enough insulin or
respond normally to the insulin their bodies make.
This leads to serious medical problems including
kidney damage, amputations and blindness. The
absolute bioavailability of Metformin hydrochloride is
50-60% , biological half life is 1.5 - 3 hours and the
main site of absorption of metformin hydrochloride is
proximal end of small intestine. The HBS system was
planned for Metformin hydrochloride as such a system
when administered it remain buoyant on the gastric
fluids for a prolonged period of time and the drug it
remain buoyant on the gastric fluids for a prolonged
period of time and the drug would be available in the
dissolved format. This would leads to improvement in
the bioavailability of the drug, to increase its
bioavailability gastro retentive drug delivery systems
were choosen for development in the form of tablet. In
this way it stands as an advantage over conventional
dosage form, which needs to be administered twice or
thrice a day.
MATERIALS AND METHODS
Metformin hydrochloride was received from
Alkem laboratories ltd, Mumbai as gift sample,
HPMC, sodium bicarbonate, talc was procured from
S.D fine chem.All other chemicals and solvents used
in this study were LR grade
Preparation of tri-ilayer Metformin Hydrochloride
floating tablets: The preparation of tri layer tablet
involves three steps and the granules were prepared
by wet granulation method using water as binding
solution, lactose as diluent.
Formulation of the upper and bottom layer: The
granules for upper and bottom layer were prepared as
per the formulae shown in table no 1.1.The cohesive
mass were prepared passed through sieve no 12. The
granules were dried in an oven at 550 for 2 hrs. the
dried granules were passed through sieve no 16,
lubricated with talc and magnesium stearate for
compression into tablet.
Formulation of the middle layer: The granules were
prepared by wet granulation method as per the
formulae shown in table no 1.1.The dough mass was
prepared by the addition of water as binding a solution
into the mixture of drug, polymer and diluent . The
obtained dough mass was passed through sieve no 12 ,
granules were dried in an oven at 550 for 2hrs. The
dried granules were passed through sieve no 16. The
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 894
dried granules were mixed with talc and magnesium
stearate, then subjected to compression.
Compression of tri layer tablet: The compression of
the tablet involves three steps. The granules for
bottom layer were compressed slightly, then the
granules for middle layer were poured over the above
compact, again compressed with minimum force to
form a second layer and then top layer granules were
added over the above layer, then compressed into a
tablet by Cadmach Rotary tablet machine ie tri-
layered tablet by using a16 mm flat - faced punches.
Table.1.Composition of metformin hydrochloride trilayer floating tablets with HPMC K100M Ingredients
( mg/ tablet)
F1 F2 F3 F4 F5
Su
sta
ined
lay
er
Flo
ati
ng
up
per l
ay
er
Flo
ati
ng
bo
tto
m l
ayer
Su
sta
ined
lay
er
Flo
ati
ng
up
per l
ay
er
Flo
ati
ng
bo
tto
m l
ayer
Su
sta
ined
lay
er
Flo
ati
ng
up
per l
ay
er
Flo
ati
ng
bo
tto
m l
ayer
Su
sta
ined
lay
er
Flo
ati
ng
up
per l
ay
er
Flo
ati
ng
bo
tto
m l
ayer
Su
sta
ined
lay
er
Flo
ati
ng
up
per l
ay
er
Flo
ati
ng
bo
tto
m l
ayer
Metformin
hydrochloride
500 - 500 - 500 - 500 - 500 -
HPMC K 100
M
60 40 40 80 40 40 100 40 40 120 40 40 140 40 40
Sodium
bicarbonate
- 45 45 - 45 45 - 45 45 - 45 45 - 45 45
Lactose 80 - 60 - 40 - 20 - - -
Talc 7.5 - 7.5 - 7.5 - 7.5 - 7.5 -
Magnesium
stearate
7.5 - 7.5 - 7.5 - 7.5 - 7.5 -
Total weight 825 825 825 825 825
Characterization of granules: The prepared
granules were evaluated for the following
parameters[10,11].
Bulk density: The bulk density was determined by
measuring the volume occupied by the pre weighed
granules,It was calculated by the following equation.
Bulk density = Mass of Granules /Volume of packing
Tapped bulk density: The granules whose weight
was determined earlier was transferred in to 100ml of
graduated cylinder and subjected to 100 taps. Then the
volume occupied by the granules (Tapped volume)
were determined. Tapped density was calculated by
the following formula
Tapped density = Mass of granules/tapped volume
Carr'sindex: The percentage of compressibility of
granules was determined by Carr's/Compressibility
index.
Carr's index (%) = Tapped density- Bulk density
/tapped density× 100
Hausner’s ratio: Hausner’ratio of granules
determined by comparing the tapped density to the
bulk density by using the formulae
Hausner,s ratio = Tapped density/Bulk density
Angle of repose: The prepared granules were
assessed for its flow property by determining the
angle of repose by open tube method. The angle of
repose was determined by the following formula
h = height of heap
r = radius of the base.
Loss on drying: Granules (Igm) were kept in an oven
at 105° c and dried up to constant weight. Loss on
drying was calculated using the following formulae.
Loss on drying = (Initial weight - Final weight)/initial
weight ×100
Moisture content: Granules (1gm) were kept in an
oven at 105° c and dried up to constant weight.
Moisture content was calculated using the following
formulae.
Moisture content = (Initial weight - Final weight)/final
weight × 100
Evaluation of tablets: The formulated tablets were
evaluated for the following parameters.
Thickness: The thickness and diameter of the
formulated tablets were measured by using Vernier
calipers.
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 895
Weight variation: The formulated tablets were tested
for weight uniformity. 20 tablets were collectively and
individually. From the collective weight, average
weight was calculated. Each tablet weight was then
compared with average weight to ascertain whether it
is within permissible limits or not.
% Weight Variation = (Average weight-Individual
weight)/ average weight× 100
Hardness: The tablet crushing strength, which is the
force required to break the tablet by compression in
the diametric direction was measured in triplicate by
using Pfizer tablet hardness tester.
Friability: The Roche friability test apparatus was
used to determine the friability of the tablets. 20 pre
weighed tablets were placed in the apparatus, which
was subjected to 100 revolutions. Then the tablets
were reweighed. The percentage friability calculated
was using the formula.
% Friability = Initial weight- Final weight / initial
weight × 100
Floating characteristics: Floating characteristics
were determined by using USP dissolution XI
apparatus at 100 rpm using 900 ml of 0.1 N HCl and
temperature was maintained at 37°c.
Floating lag time: The tablet was placed in
dissolution apparatus and the time taken to float on the
dissolution medium was noted.
Floating time: The total duration of the time that the
tablets float on dissolution medium was noted.
Swelling index: Tablet was weighed (W0) and placed
in dissolution medium containing 0.1N
HClmaintained at 37°c. At predetermined time
intervals the tablet was and blotted to remove excess
water and weighed (Wt). The percentage of swelling
index calculated.
Swelling index = (Wt - Wo)/Wt x 100
Wt= final weight of the tablet
Wo = initial weight of the table
Drug content: Twenty tablets were weighed and
powdered. The quantity of powder equivalent to 100
mg of Metformin hydrochloride was dissolved in 0.1 N
HC1 diluted to 100ml with 0.1N HC1 then the
solution was filtered and suitably diluted. The drug
content was estimated spectrometrically at 233 nm.
In-vitro dissolution studies: In-Vitro dissolution
studies were conducted by using USP type II paddle
dissolution apparatus with 900ml of 0.1N
Hydrochloric acid as dissolution medium, maintained
the temperature of medium at 37±0.5° and stirrer speed
at 100 rpm. 5 ml of aliquots of dissolution medium
was withdrawn at regular time intervals and the same
volume of pre-warmed (37±0.5°) fresh dissolution
medium was replaced. The samples were filtered and
drug content of Metformin hydrochloride in each
sample was analyzed after suitable dilutions, filtered
and filtrates are analyzed by Shimadzu UV-
spectrophotometer at 233 nm.
RESULTS AND DISCUSSION
Drug- excipient compatibility studies were
conducted by FTIR spectroscopy, results revealed that no
chemical interactions were observed from the FTIR as
shown in fig 2, 3 and 4. The prepared granules for floating
layer and sustained release layer were evaluated found to
have free flow properties, results given in table 2 and also
the tablets were subjected to thickness, weight variation,
hardness, floating time, floating log time, swelling index,
drug content and in-vitro dissolution studies.The thickness
of the tablets was found in the range of 3.1+ 0.01mm to
3.8+0.05mm. The weight variation ranged between 4.2+
0.02 to 4.62+0.02, the hardness of the floating tablets were
ranged between 6.0 kg/cm2 to 7..3kgcm
2. The percent
friability of prepared tablets was well as within the
acceptable limit. The range between the formulations had
desired floating log time 3.0 + 0.01 to 4.0 + 0.04mg and
total floating time found between 6.5 -9hrs regardless of
concentrations of polymers incorporated, results given in
the table 3.
The swelling index result was observed in a range
between 28.17 ± 0.02 to 46.62 ± 0.03, that increase in
percent swelling was increasing with increasing
concentration of polymers. The drug content in all
formulations was within the range of 499.2mg ± 0.01 to
499.5mg ± 0.03, ensuring the uniformity of the drug content
in the formulation. The percentage of drug release for F1,
F2, F3, F4, F5 were found to be 98.44 ± 0.23, 98.42 ± 0.53,
99.32 ± 0.04, 98.33 ± 0.85 and 82.81 ± 0.357 at the end of
6.5, 7.5, 8.5, 9 and 11hours respectively, in vitro release
profiles as shown in fig 1. In vitro release data fitted into
the zero order, first order, matrix and peppas equations.
The formulations followed zero order kinetics and exhibited
peppas transport mechanism, release exponent found less
than 1, indicates non fickian diffusion mechanism. Results
revealed that as concentration of polymer increases, the
floating time was found to be increased and prolonged the
release of the drug due to the swelling of HPMC and high
uptake of medium, floating time influenced by the gas
generating agent and also it influences the drug release.
Among all prepared formulation F5 sustained the release
for prolonged time; hence it was suitable for the sustained
release for the patient in the treatment of diabetes and
enhances the bioavilabilty of the drug in the form of
floating delivery system. In trilayer tablet, the drug was
sustained for prolonged period of time due to the gelling
property of polymer and drug layer sand witched between
the two layers formulated with the HPMCK100M so drug
release was prolonged for more time.
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 896
Table.2.Characterization of Metformin hydrochloride trilateral floating granules formulated with HPMC
K100M Formulations
Bulk
density(g/ml)
Tapped
density(g/ml)
Carr’s index
(%)
Hausner’s
ratio
Angle of
repose (0)
Loss on
drying (%)
Moisture
content (%)
F1 0.237±00.6 0.262±0.01 5.90±0.02 1.074±0.04 21.61±0.05 6.9±0.01 7.5±0.01
F2 0.342±0.01 0.368±0.03 7.01±0.04 1.076±0.03 20.82±0.04 7.8±0.02 6.4±0.03
F3 0.249±0.02 0.277±0.03 6.4±0.03 1.080±0.01 22.91±0.03 5.4±0.03 7.7±0.02
F4 0.354±0.03 0.389±0.04 8.93±0.04 1.098±0.02 21.03±0.02 6.3±0.05 6.0±0.04
F5 0.251±0.06 0.397±0.02 7.21±0.03 1.099±0.02 24.17±0.03 5.9±0.01 5.8±0.01
Table.3.Characterization of Metformin hydrochloride trilayer floating tablets formulated with HPMC K
100 M Formulations
Thickness(mm) Weight
variation(%)
Hard
ness(kg/cm2)
Friability(
%)
Floating lag
time(min)
Floting time
(hr)
Swelling
index)(%)
Drug
content(mg)
F1 3.1±0.01 4.20±0.01 6.0±0.04 0.98±0.01 4±0.04 6.5 28.17±0.02 489.2±0.01
F2 3.5±0.02 4.42±0.04 6.2±0.03 0.97±0.02 4±0.02 7.5 31.01±0.03 479.3 ±0.03
F3 3.5±0.04 4.47±0.03 6.4±0.01 0.97±0.03 4±0.03 8.5 37.92± 0.01 499.2±0.01
F4 3.8±0.03 4.27±0.02 6.1±0.02 0.96±0.02 3±0.02 9 46.01±0.02 488.4±0.05
F5 3.8±0.05 4.62±0.02 7.3±0.03 0.94±0.04 3±0.03 9 46.62±0.03 499.5±0.03
Figure.1. Dissolution profiles of Metformin hydrochloride bilayer floating tablets formulated with HPMC k100m
Figure.2.IR spectrum of Metformin hydrochloride
Figure.3. IR Spectrum of HPMC K 100 M
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9 10
% D
rug
Rel
ease
d
Time(hrs)
F1
F2
F3
F4
F5
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 897
Figure.4. IR spectrum of best formulation
CONCLUSION
The objective of present study was design and
development of tri-layered floating tablet of
Metformin hydrochloride for sustained the release.
The HPMCK 100M as a polymer more reliable and
sustained the drug for a prolonged period of time by
increasing the concentration of it. More over the high
swelling property of the polymer helped in
maintaining the buoyancy with the minimal utilization
of gas evolving excipients such as sodium bicarbonate
which increased a marked impact on the gastro
intestinal fluids by its alkaline nature. The
formulations followed zero order kinetics and exhibits
the peppas transport mechanism and hence finally
concluded that tri layer formulations were found to be
suitable for the floating drug delivery systems.
REFERENCES
Atyabi F, Sharma HL, Mohammed HAH, Fell JT, In
vivo evaluation of a novel gastro retentive formulation
based on ion exchange resins, J. Control Release, 42,
1996, 105 -113.
Dave B.S, Amin A.F & Patel M.M , G astro retentive
drug delivery system of ranidine hydrochloride
formulation and in vitro evaluation, AAPS Pharm.
Sci. Tech, 5(2), 2004, 1-6.
Hwang J, H. Park, K. Park, Gastric retentive drug
delivery systems, Drug carrier Syst, 15, 1998, 243 –
284
Indian pharmacopoeia, The controller of publications,
New Delhi, 4th edition, vol II, 1996, 469.
Vantrappen GR., Peeters TL, Janssen SJ, The
secretary component of interdigestive migratory motor
complex in man: scan d J. Gastro enterol, 19, 1979,
663-667.
Yeole P.G, Khan S., Patel V.F, Floating drug delivery
systems: Need and development, Indian. J.
pharma.sci, 67(3), 2005, 265 -272.
Sivaranjani et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 898
Amlodipine: the upcoming threat to Periodontist Sivaranjani*, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K,
Dept of Periodontics, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Indira nagar, Gorimedu,
Pondicherry-6.
*Corresponding Author: Dr. Sivaranjani, E.Mail:[email protected].
ABSTRACT
Gingival hyperplasia is one of the side effects commonly caused by three major groups of drugs
such as a) anticonvulsants b) antihypertensives – calcium channel blockers c) immunosuppressants.
Previously among antihypertensives Nifedipine induced enlargements were commonly reported in
literature with prevalance rate of 10%. Amlodipine a second generation ca channel blocker was
considered as rare drug causing enlargement with a prevalence rate of about only 3.3%.This paper
discusses about a 60 yr old male hypertensive patient who received amlodipine at a dose of 5 mg /day
remained asymptomatic for 2 yrs later which he reported with massive enlargement of gingiva.
Key words: Amlodipine, gingival enlargement, after 2 yrs at low dose.
Key Messages: Among Ca channel blockers Amlodipine was considered as rare drug causing gingival
enlargement. Recently has become drug of concern since the prevalence of gingival enlargement among
patients under this drug is being reported widely. Regular follow of patients under Amlodipine by
Periodontists is being emphasised in this case report.
INTRODUCTION
Amlodipine induced gingival enlargements
occurs only in 3.3 % of cases under Amlodipine
therapy.(Jorgenson et al).It commonly occurs at a dose
of 10 mg /day and within two months of drug intake.
Earlier studies have reported that Amlodipine can’t
induce gingival enlargements at a dosage of 5 mg/day.
Our case was unique because patient was
receiving a daily dosage of only 5 mg. He was
asymptomatic for two years. After which he reported
with Drug induced gingival enlargement. Patient was
neither receiving 10 mg /day and the symptoms did
not appear in two months the occurrence such cases
were not reported in the recent literature. We
emphasise the regular follow up of patients under
Amlodipine therapy even at low doses and for long
term by the Periodontist.
CASE HISTORY
A 60 year old male patient reported to
Department of Periodontics, with the complaint
unaesthetic appearance of gingiva following gingival
overgrowth in maxillary and mandibular anteriors
&causing discomfort during speech and mastication.
His medical history revealed that he was hypertensive
since two years and was under Amlodipine 5mg/day.
He had no other significant medical or dental history.
On intra oral examination patient revealed massive
gingival overgrowth covering 2/3rd
of crown surface of
lower anterior teeth & in upper anterior teeth
involving interdental gingiva& marginal gingiva.
Supra gingival plaque was present in entire dentition
and there was generalised bleeding on probing (Figure
1: Preoperative view- showing combined gingival
enlargement (inflammatory& drug induced).
Based on medical history and clinical findings
drug induced gingival hyperplasia with concomitant
inflammatory enlargement was diagnosed. Patient
received a session supra and sub gingival scaling. Oral
hygiene measures were instructed & and was under
Chlorhexidine mouth wash for a period of four weeks.
On re-evaluation patient still revealed the presence of
gingival overgrowth which favoured our initial
diagnosis (Figure 2: One month post operative view
showing persistent gingival enlargement even after
removal of inflammatory component by oral
prophylaxis). Patient was referred to physician for
opinion regarding drug substitution and presently is
under regular follow up.
Figure 1: Preoperative view – showing combined gingival
enlargement (inflammatory& drug induced)
Figure 2: One month post operative view showing persistent
gingival enlargement even after removal of inflammatory
component by oral prophylaxis
Sivaranjani et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 899
DISCUSSION
An increasing number of medications are
associated with gingival enlargement. Currently, more
than 20 medications are associated with gingival
enlargement (Jimmy Jose, 2011). Amlodipine a newer
agent of dihydropyridine, used for treatment of
hypertension and angina, was first reported for
causing gingival overgrowth as side effect, by
Seymour et al in 1994.
Compared to conventional therapy (diuretics
&beta blockers) ca channel blockers have been found
to be more effective and hence these are more
frequently prescribed (Levine CB, 2003). The
dihydropyridines have been found to be associated
with enlargement of the gums with nifedipine having
the highest incidence of about 6 % (Ellis JS, 1999).
Amlodipine however is also being found to be
associated with gingival overgrowth and more& more
such cases are being reported. A recent study
comparing the effect of calcium channel blockers&
Renin angiotensin system drugs showed that gingival
enlargements are twofold greater in the former group
of drugs. This association was dose dependant& was
higher in dihydropyridine derivatives (KaurG, 2010).
The pathogenesis of this gingival overgrowth remains
to be fully understood still. These drugs affect
intracellular calcium metabolism or transport may
stimulate gingival fibroblasts to cause increased
deposition of extracellular matrix components such as
glyosaminoglycans in some patients (Dongari
Bagtzoglou A, 2004).
The other proposed non inflammatory
mechanisms include defective collagenase activity,
blockage of aldosterone synthesis in adrenal cortex
which is also calcium dependent& causes a
consequent feedback increase in ACTH levels
&
upregulation of keratinocyte growth factor (Das SJ,
2002).
Recent studies have demonstrated abnormally
high levels of specific cytokines such as IL-6, IL-1
beta, Platelet derived growth factor, Fibroblast growth
factor, Transforming growth factor beta & connective
tissue growth factor in gingival overgrowth tissue
(Trackman P.C, 2004).
Drug induced gingival enlargements are
usually associated with a superimposed inflammatory
component which has to be minimised as it is a major
contributor to the gingival overgrowth (Seymour RA,
2006). Meticulous oral hygiene measures should be
done by the dentist &patient maintenance of the same
plays a major role in decreasing the inflammatory
component. This helps in decreasing the degree of
gingival overgrowth present& improves overall
gingival health.
In cases of severe enlargements consideration
for substitution of amlodipine with isradipine,
lercanidipine or lacidipine which are newer fourth
generation dihydropyridines may be an option.
Substitution with other classes of antihypertensives
such as Beta blockers, A.C.E inhibitors or Thiazide
diuretics can also be considered (Rashi Chaturvedi,
2011). But in cases for drug substitution systemic
health should given prime importance. Discontinuing
the causative drug has been found to reduce the
gingival overgrowth but in cases where enlargement
causes esthetic& masticatory difficulties for the
patient periodontal surgical treatment should be
considered.
CONCLUSION
Though the incidence of Amlodipine induced
gingival enlargements are rare, presently many cases
are being reported even with a minimal dose and also
as late presentation as seen in our patient. The exact
mechanism by which drug causes gingival
enlargement is yet to be explored! Research in this
area would benefit large number of hypertensive
patients. Hence physians and Periodontistss should be
made aware of this fact & regular follow up to be
emphasised for all patients under Amlodipine therapy.
REFERENCES
Das SJ, Olsen I, Keratinocyte growth factor is
upregulated by hyperplasia- inducing drug Nifedipine,
Cytokine, 12, 2000, 1566-9.
Dongari Bagtzoglou A, Research, Science and
Therapy Committee, American Academy of
Periodontology, Drug associated gingival
enlargement, J Periodontol, 75, 2004, 1424-31.
Ellis JS, Seymour RA, Steele JG, Robertson P, Butler
TJ, Thomason JM, Prevalence of gingival overgrowth
induced by calcium channel blockers: A community
based study, J Periodontol, 70, 1999, 63-7.
Jimmy Jose, Santhosh Y, Naveen MR, Vijay kumar,
Asian J Pharm Clin Res, 4, 2011, 65-6.
KaurG, Verhamme K. M. C, Dieleman J.P,
Vanrolleghem A,Van Soest E. M., Stricker B.H.C.et
al. Association between calcium channel blockers and
gingival hyperplasia, J Clin Periodontol, 37, 2010,
625–30.
Sivaranjani et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 900
Levine CB, Fahrbach KR, Frame D, Connelly JE,
Estok RP, Stone LR et al. Effect of amlodipine on
systolic blood pressure, Clin Ther, 25, 2003, 35-57.
Nyska A, Shemesh M, Tal H, Dayan D. Gingival
hyperplasia induced by calcium channel blockers:
mode of action. Med Hypotheses, 43, 1994, 115-8.
Rashi Chaturvedi, Ashish Jain. Amlodipine induced
gingival enlargement - presentation of a clinical case
series, J Clin Exp Dent, 3, 2011, 390-4.
Seymour RA, Effects of medications on the
periodontal tissues in health and disease, Periodontol
2000, 40, 2006, 120-9.
Trackman P.C, Kantarci A, Connective tissue
metabolism and gingival overgrowth, Crit Rev Oral
Biol Med, 15, 2004, 165-75.
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 901
Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered
floating tablets of Diltiazem hydrochloride Venkateswara Rao T*, Bhadramma N, Raghukiran CVS2 and Madubabu K3
Department of pharmaceutics, Bapatla college of Pharmacy, Bapatla, India.
Tigala Krishna Reddy College of Pharmacy, Hyderabad.
Hetro Drugs Ltd, Hyderabad
*Corresponding author: Email: [email protected]
ABSTRACT
In the present study an attempt was made to study the effect of formulation variables on bi-
layered floating tablet of Diltiazem hydrochloride. Immediate release layer was formulated by using
various super disintegrants such as sodium starch glycolate, cross carmellose sodium, crospovidone and
sustained release layer was formulated with different grades of hydrophilic polymers like HPMCK4M,
HPMCE5 and HPMCK100M by wet granulation method. The influence of polymer and citric acid
concentrations were also investigated. The prepared tablets were characterized and rate of drug release
from an immediate release layer was 99.9% were found at the end of 20 minutes followed by sustained
the drug release for 12hrs from sustained release layer. The dissolution data were fitted into zero order,
first order, Higuchi and Peppas equations. Results revealed that the drug release from the formulation F20
followed zero order kinetics and exhibited Peppas transport mechanism.
Key words: Diltiazem hydrochloride, wet granulation method, first order kinetics, HPMC-Hydroxy
propyl methylcellulose.
INTRODUCTION
The oral route is considered as the most promising and
predominant route of drug delivery1. Effective oral
drug delivery may depend upon the factors such as GI
transit time of dosage form, gastric emptying process,
drug release from the dosage form and site of
absorption of drug. Most of the oral dosage forms
possess several physiological limitations such as
variable GI transit, because of variable gastric
emptying, leading to incomplete drug release, non-
uniform absorption profiles and shorter residence time
of the dosage form in the stomach. This leads to
incomplete absorption of drugs having absorption
window especially in the upper part of the small
intestine, as once the drug passes down the absorption
site, the remaining quantity goes unabsorbed.
To overcome these limitations, various
approaches have been proposed to increase gastric
residence of drug delivery systems in the upper part of
the GI tract. Dosage forms that can be retained in the
stomach are called gastro retentive drug delivery
systems (GRDDS). GRDDS can improve the
controlled delivery of drugs that have an absorption
window by continuously releasing the drug for a
prolonged period of time before it reaches its
absorption site, thus ensuring its optimal
bioavailability.
One of the novel approaches in the area of sustained
drug delivery was Gastro retentive drug delivery
systems (GRDDS).Several techniques have been
proposed to increases the Gastric residence time of
dosage forms such as floating systems, swelling
systems, hydro dynamically balanced systems and low
density systems etc. In the present investigation
Diltiazem Hydrochloride was selected as model drug
is a calcium channel blocker and it is widely used in
the treatment of hypertension. The drug has short
biological half life 3-4 hrs, low bioavailability and
narrow absorption window in upper part of GIT. Multi
layer concepts have been utilized in this present
investigation. The compatibility studies were
conducted by FT-IR spectroscopy, no compatibility
between drug and polymers were found. Bi-layered
floating tablets having immediate release layer and
sustained release layer, the drug was released within
20 minutes from the IR layer leads to a sudden raise in
blood concentration, blood level was maintained at
steady state as the drug was released from the
sustained release layer.
MATEARIALS AND METHODS
Diltiazem Hydrochloride, gift sample from
Medreich ltd Banglore, Sodium starch glycolate,
Croscarmellose sodium, Crospovidone,
HPMCK100M, HPMCK4M and HPMCE5 were
procured from (Medreich ltd Bangalore),PVPk-30 and
Lactose (SD Fine Chem., Mumbai, India),Talc and
Magnesiumstearate was obtained from (Qualigens
Fine Chem., Mumbai, India).
Drug- Excipient Compatibility Study by IR
spectroscopy: IR spectrums of pure drug of Diltiazem
Hydrochloride and its physical mixtures were carried
out by using FT-IR (Thermonickolat, USA)
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 902
employing the KBR pellet method. The spectra were
scanned over a wave range of 400-4000cm-1
Preparation of Diltiazem Hydrochloride Bilayer
Floating tablets: The preparation of Bilayer floating
tablets involved two steps prepared by wet granulation
method. The excipients used in the formulation are
superdisintegrants such as SSG, Croscarmellose
sodium, Crospovidone, PVP in isopropyl alcohol as
binding solution, HPMCK4M, HPMCE5 and
HPMCK100M as polymers, lactose as diluent, and
talc and magnesium stearate as glidant and lubricant.
The dose calculation for the loading dose and
maintenance are given below
Pharmacokinetic parameters of Diltiazem
hydrochloride: Fraction of drug absorbed (F) 0.44
Elimination half life (t1/2) 3.7 hrs
Elimination rate constant (Ke) 0.187hr-1
Clearance 12 ml/min/kg
Volume of distribution 3.1 lit/kg
Calculation of Loading dose (DL): Loading dose (Css avg × Vd)/F
But, Css avg (F×Dose/Ґ)/Clearance
Css avg (0.44×90mg/12hrs)÷12ml/min/kg
Css avg 6.54×10-8mg/ml
DL (6.54×10-8mg/ml×3.1lit)÷0.44
Loading
dose(DL)
34.57
Calculation of Maintainance dose (DM): Maintainance dose Ko (T-t1/2)
But, Ko Ke× loading dose
Maintainance dose Ke× loading dose×(T-t1/2)
Maintainance dose 0.187×34.57× (12-3.7)
So, DM 54.87 mg
Based on the above calculations, the immediate
release dose was considered as 35mg and the
maintenance dose was considered as 55mg.
Preparation of the immediate release layer: The
immediate release layer was prepared as per the
formula given in table 1. The damp mass was passed
through sieve no 12. The granules thus obtained were
dried in an oven at 50 OC. The dried granules were
sieved through sieve no16 and lubricated with talc and
magnesium stearate.
Preparation of the floating sustained release layer:
The SR layer was prepared as per the formula shown
in table2. The damp mass was passed through sieve no
12 to obtain granules. The granules thus obtained were
dried in an oven at 50 OC. The dried granules were
sieved through sieve no 16 and lubricated with talc
and magnesium stearate.
Compression of bilayer floating tablets: The
required quantity of granules for the SR layer was
compressed slightly by using a rotary punch tablet
machine with 9mm punches. Then the required
quantity of granules for the IR layer were placed over
the above compact ,both the layers were compressed
by 9 mm round shaped punches with Cadmach tablet
machine to obtained the tablets.
Evaluation of Diltiazem Hydrochloride bi-layered
floating tablets: All the prepared bi-layered floating
tablets were evaluated for following parameters.
Weight Variation: Formulated tablets were tested for
weight uniformity, in which 20 tablets were weighed
collectively and individually. From the collective
weight, average weight was calculated. The percent
weight variation was calculated by using the following
formula.
Hardness: The hardness of tablets was measured by
Monsanto hardness tester. The hardness was measured
in terms of kg/cm2.
Friability: The Roche friability test apparatus was
used to determine the friability of the tablets. Twenty
pre-weighed tablets were placed in the apparatus and
operated for 100 revolutions and then the tablets were
reweighed. The percentage friability was calculated
according to the following formula.
Drug content: Twenty tablets were weighed,
powdered and quantity of powder equivalent to 100
mg of Diltiazem hydrochloride was dissolved in 0.1 N
HC1 diluted to 100ml with 0.1N HC1 then the
solution was filtered and suitably diluted. The drug
content was estimated spectrometrically at 237 nm.
Swelling index: Tablet was weighed (W0) and placed
in 0.1N hydrogen chloride maintained at 37°c. At
predetermined time intervals the tablets were
reweighed and blotted to remove excess water and
weighed (Wt). The percentage of swelling index
calculated by the following formula
Wt = final weight of the tablet
Wo = initial weight of the table.
Floating characteristics: Floating characteristics
were determined using USP dissolution apparatus at
100rpm using 900 ml of 0.1 N HCl, temperature was
maintained at 37°c.
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 903
Floating lag time: The tablet was placed in
dissolution apparatus and the time taken to float on the
dissolution medium was noted.
Floating time: The total duration of the time that the
tablet float on dissolution medium was noted.
In-vitro dissolution studies: In-Vitro Dissolution rate
was studied by using USP type II paddle dissolution
apparatus in 900ml of 0.1N Hydrochloric acid at
37±0.5°at 50 rpm. 5ml of aliquot of dissolution
medium was withdrawn at regular time intervals, the
same volume of pre-warmed (37±0.5°) fresh
dissolution medium was replaced. The samples were
filtered and drug content of diltiazem hydrochloride
in each sample was analyzed after suitable dilution by
Shimadzu UV-spectrophotometer at 237 nm.
Results and discussion: The IR spectra of Diltiazem
Hydrochloride, crospovidone, HPMCK100M and its
physical mixtures were given in fig 1, fig 2 , Fig 3,
fig 4 and fig 5.. The following principle peaks were
observed in the IR spectra of Diclofenac sodium.
Amine stretching N-H (Stretching) 2386.15 cm-1
Acetate C=O (Stretching 1737.15 cm-1
O-Substituted aromatic
C-H out of plane deformation 832.80 cm-1
C-H (Stretching, aliphatic) 2964.58 cm-1
P-Substituted aromatic
C-H out of plane deformation 774.45 cm-1
C – N (amide) 1290 cm-1
C = O 1650 cm-1
The principle peaks of pure peaks were also
observed in the spectra of spectra of physical
mixtures, it was confirmed that no chemical or
physical interactions were exists between the drug and
the excipients employed in this investigation.
Micromeritic properties for formulations were
evaluated, the results revealed that IR layer and SR
layer granules exhibited good flow properties; it was
also further supported by Carr’s Index and Hausner’s
ratios values. The formulated tablets were subjected to
various quality control tests and the results were
shown in table 3. The obtained results were found to
be within limits of pharmacopoeia. The % drug
content in all bilayer formulaitons were observed in
the range of 98.6±0.03% to 99.±0.02%.The floating
lag time for the prepared formulations were found to
be decreased while increasing the concentration of
polymer and also total floating time of SR layer
formulations were increased by increasing the
concentration of polymer.
The formulations of immediate release layer
were shown in table1. In vitro release profiles were
shown in fig 6,7 and 8, in-vitro release data were
fitted into various kinetic models i.e. First order and
zero order, drug release from formulations exhibited
the first order kinetics, the order of drug release from
the formulations were in the following order
F12>F8>F11>F4>F7>F10>F3>F6>F2>F9>F1>F5 i.e.
increasing the concentrations of SSG, Croscarmellose
sodium and Crospovidone in formulations the drug
release rate was found to be increased. Finally F12
was optimized for development of the bi layer
Diltiazem hydrochloride tablets.
In vitro drug release profiles for bilayer
tablets were shown in fig 9,10,11 and 12, percentage
of drug release for the formulations F13, F14, F15,
F16, F17, F18, F19, F20, F21, F22, F23 and F24 are
95.602 ± 0.34, 92.98 ± 0.34, 98.30 ± 0.34,97. 10 ±
0.34, 98.61±0.34, 99.36±0.34, 98.88±0.34,
99.71±0.34, 86.21±0.34, 97.79±0.34, 99.81±0.34 and
99.23±0.34 observed at the end of 6, 8, 10, 4, 6, 8, 6,1
2, 12, 10, 8 and 6 hours respectively. Among all the
formulations F20 retarded the drug release for 12 hrs
where as F21 formulation prolonged the drug release
for more than 12 hrs. So tablets formulated with
HPMCK 100M (F20) was selected and studied the
influence of citric acid on drug release. By the
addition of citric acid into the formulations, floating
lag time and total floating time was decreased when
compared with the previous studies, that is due to
liberation of excess amount of corbondioxide and
hence the total amount of the drug was also released
within 10 hours when compared with the formulations
formulated without citric acid.
The In-vitro release data were fitted into
various kinetic models i.e. First order, zero order,
Higuchi and Peppas equations, drug release from
formulations exhibited zero order kinetics and
exhibited the Peppas transport mechanism. The
exponential coefficient from the Peppas plots was
found to be <0.5 indicating Fickian diffusion transport
mechanism, the order of release retardant was as
follows HPMCK100M>HPMCE5>HPMCK4M, from
the results it indicated that release rate was retarded
by increasing the concentration of the polymer.
In- vitro buoyancy studies revealed that
tablets of hardness 2-4 Kg/cm2 after immersion into
the floating media floated immediately, tablets with
hardness of 4-5 Kg/cm2 sank for 3-4minutes, and then
floated on to the surface. Tablets with different
hardness remained floating for 8-12 hrs. The
buoyancy of the tablets is governed by both the
swelling of the poly hydrocolloid particles in the
tablet surface when it the contacts the gastric fluids
and presence of the internal voids in the centre of the
tablet, hence altering a bulk density <1. The
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 904
formulation F20 formulated with HPMC K 100 M
sustained the release for 12 hrs, when compared with
formulations made with HPMC K4 M and HPMC E5
grade of polymers this may be due to the viscosity of
the polymer i.e formation of gel structure. The
concentration of citric acid in the formulations were
also investigated, by increasing the concentration of
citric acid per tablet from 10-20mg, the floating lag
time were found to be decreased due to its reaction
with sodium bicarbonate resulting in generation of
carbon dioxide gas of a faster rate i.e in presence of
excess carbon dioxide and also release rate were
observed very faster.
Finally concluded that, results of the studies
based on the in- vitro performance clearly suggested
that, sustained release floating matrix tablets can be
prepared by immediate release layer of drug with
crospovidone and SR layer comprises the sodium
bicarbonate, citric acid with HPMC K 100 M for
achieving the sustained action and restricted the drug
release in the stomach.
Table.1.Composition of Immediate release layer for bi-layered floating tablets of Diltiazem Hydrochloride formulated
with SSG, Croscarmellose sodium, Crospovidone
Ingredients
Quantity per single tablet(mg)
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
Diltiazem
hydrochloride
35 35 35 35 35 35 35 35 35 35 35 35
Sodium starch
glycolate
1.5 2.25 3 3.75 - - - - - - - -
Croscarmellose
sodium
- - - - 1.5 2.25 3 3.75 - - - -
Crospovidone - - - - - - - - 1.5 2.25 3 3.75
PVPk-30 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5
Lactose 35.5 34.75 34.75 33.25 35.5 34.75 34 33.25 35.5 34.75 34 33.25
Talc 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75
Magnesium
stearate
0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75
Total
weight(mg)
75 75 75 75 75 75 75 75 75 75 75 75
Table.2.Composition of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 4 M,
HPMCK E 5 and HPMCK100M Ingredients Quantity per tablet (mg)
F13 F14 F15 F16 F17 F18 F19 F20 F21 F22 F23 F24
Immediate release layer
Diltiazem
hydrochloride
35 35 35 35 35 35 35 35 35 35 35 35
Crospovidone 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75 3.75
PVPk-30 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5
Lactose 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25 33.25
Talc 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75
Magnesium stearate 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75 0.75
Sustained release layer
Diltiazem
hydrochloride
55 55 55 55 55 55 55 55 55 55 55 55
HPMCK 4 M 60 80 100 - - - - - - - - -
HPMCK E 5 - - - 60 80 100 - - - - - -
HPMCK100M - - - 60 80 100 - - -
HPMCK100M - - - - - - - - - 80 80 100
Citric acid - - - - - - - - - 10 20 20
Sodium bi
carbonate
30 30 30 30 30 30 30 30 30 30 30 30
Lactose 49 31 11 49 31 11 49 31 11 49 31 31
Talc 2 2 2 2 2 2 2 2 2 2 2 2
Magnesium stearate 2 2 2 2 2 2 2 2 2 2 2 2
Total weight(mg) 275 275 275 275 275 275 275 275 275 275 275 275
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 905
Table.3.Physico-chemical evaluation of the for bi-layered floating tablets of Diltiazem Hydrochloride
Formulation
Average
weight (mg)
Hardness
(kg/sq cm)
Friability
(%)
Drug content
(%)
Swelling
index (%)
Floating lag
time (sec)
Total floating
time (hrs)
F13 275±0.21 3.9±0.31 0.68 97.3±0.01 37.4±0.03 77 10
F14 275±0.23 4.5±0.22 0.66 97.8±0.04 52.5±0.03 60 12
F15 275±0.34 5.3±0.17 0.75 98.6±0.05 56.2±0.04 55 >12
F16 275±0.3 4.2±0.24 0.70 96.5±0.02 39.4±0.03 68 3
F17 275±0.12 5.4±0.18 0.67 97.4±0.03 46.1±0.02 60 6.5
F18 275±0.24 5.2±0.2 0.64 98.1±0.04 54.5±0.02 58 8.5
F19 275±0.3 4.6±0.15 0.73 99.1±0.05 45.9±0.03 71 5
F20 275±0.18 4.9±0.36 0.71 98.2±0.04 46.1±0.05 59 6.5
F21 275±0.19 3.6±0.24 0.68 97.6±0.02 48.2±0.04 55 8.5
F22 275±0.25 3.3±0.45 0.7 96.6±0.03 37.5±0.03 69 2.5
F23 275±0.12 3.5±0.36 0.72 96.2±0.05 45.1±0.03 60 4.5
F24 275±0.26 5.6±0.01 0.61 99.3±0.02 49.6±0.02 59 6
Figure.1. IR spectra of Diltiazem Hydrochloride
Figure.2.IR spectra of Crospovidone
Figure.3.IR spectra of HPMCK100M
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 906
Figure.4. IR spectra of optimized formulation
Figure.5.IR spectra of Diltiazem Hydrochloride, HPMCK100M and Crospovidone
Figure.6.In-vitro release profile of IR layer formulated
with SSG Figure.7.In- vitro release profile of IR layer formulated
with Croscarmellosesodium
Figure.8. In- vitro release profile of IR layer formulated
with Crospovidone Figure.9.In-vitro release profile of bi-layered floating tablets of
Diltiazem Hydrochloride formulated with HPMCK 4 M
Figure.10. In-vitro release profile of bi-layered floating tablets
of Diltiazem Hydrochloride formulated with HPMCK E 5 Figure.11.In-vitro release profile of bi-layered floating tablets of
Diltiazem Hydrochloride formulated with HPMCK 100M
Venkateswara Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 907
Figure.12.In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 100M
CONCLUSION
The drug and excipients were found to be
compatible, it can be confirmed by FTIR spectral
analysis.. The characteristics of the granules such as
angle of repose, bulk density, tapped density, carr’s
index, hausner’s ratio were studied, found to be good
flow properties. Evaluation parameters of the tablets
such as weight variation, hardness, friability, drug
content, swelling index, floating characteristics, was
found to be satisfactory. The buoyancy lag time was
found to be satisfactory. The swelling index was
found to be increased with increase in the amount of
the polymer employed. The formulations F20 was
found to be, sustained the drug release for 12hrs and
also investigated the effect of citric acid on release
rate of drug. The optimized tablet formulations
showed a satisfactory dissolution profile and floating
characteristics. The drug release from all formulations
followed zero order kinetics and Fickian diffusion.In
the present investigation, successfully developed the
bilayer floating tablets of Diltiazem Hydrochloride by
wet granulation method using super disintegrants
Crospovidone for IR layer and HPMCK100M for SR
layer.
ABBREVIATIONS
IRLayer=Immediate release layer,
SRLayer=Sustained release layer, HPMC=Hydroxy
propyl methyl cellulose, HCl=Hydrochloric acid,
hrs=Hours, rpm=Rotation per Minute. USP=United
States Pharmacopoeia and UV=Ultra-Violet.
ACKNOWLEDGEMENTS
The authors express their gratitude to
Medreich ltd. Banglore for providing gift sample of
Diltiazem Hydrochloride. The authors are thankful to
Bapatla Educational Society, Bapatla for providing
facilities to carry out research.
REFERENCES:
A.A.Shirwaikar and A. Srinath1, sustained release
Bilayered tablets of Diltiazem hydrochloride using
insoluble matrix system: Indian journal of
pharmaceutical science, 2004, 66(4):433-437.
Bharadia P.D, Patel M.M., Gayatri C.Patel, Girish
N.Patel, A primary investigation on sesbania
excipients, Int.J.Pharma.Excip, 2004, 99-102.
Leon lachman, Herbert A Liberman, Joseph L.Kang,
The theory and practice of industrial pharmacy,
Varghese publishing house, Mumbai, 1987, 3rd
edition,
52-53.
S.P.Vyas., Roop K. Khar., Gastrovetentive systems.
In: controlled drug delivery concepts &
Advances, vallabh prakashan, 2005, 96-199.
Shah S.H., Patel J.K., Patel N.V, Stomach specific
floating drug delivery system: A review: International
journal of pharmaTech Research, 1(3), 2009, 623-633.
Tejal Soni, Chirag Nagda, Tejal Gandhi, and N. P.
Chotai, Development of discriminating method for
dissolution of aceclofenac marketed formulations,
Dissolution Technologies, 2008, 31-35.
United States Pharmacopeia, Asian edition, US
Pharmacopieal convention, Rockville, 1995, 1980-
1982.
USP 27/NF 22, Asian edition, General test procedures,
U.S. Pharmacopoeial convention, Rockville MD,
2004, 1204.
Viniia V.Kale, Rahul Kasliwal, Subrat K. Pari da,
Jasmine G.Awari, Formulation and release
characteristics of guar gum tablet containing
Metformin hydrochloride, Int.J.Pharma.Excip, 2004,
75-80.
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 908
Development and optimization of Diltiazem hydrochloride loaded microspheres by
using different Eudragit polymers V. Kamalakkannan*
1, K.S.G.Arul Kumaran
2
1.Department of Biotechnology (Pharmacy) Periyar Maniammai University, Thanjayur, Tamil Nadu, India
2.Department of pharmaceutics, K.M.C.H College of Pharmacy, Coimbatore, Tamil Nadu, India
* Corresponding author: Email: [email protected]; Contact: +918973750397 ABSTRACT
The problems of frequent administration and variable low bioavailability (40-60%) after oral
administration of conventional dosage forms of Diltiazem hydrochloride can be attenuated by designing it
in the form of microspheres which would prolong the residence time at the absorption site to facilitate
intimate contact with the absorption surface and thereby improve and enhance the bioavailability.
Microspheres of Diltiazem hydrochloride were formulated using Eudragit S 100 and Eudragit L 100 alone
by solvent evaporation methods with an aim to prolong its release. Six formulations prepared by using
different drug to polymer ratios, were evaluated for relevant parameters. Depending upon the drug to
polymer ratio, the entrapment efficiency were found to range between 86.11 ± 0.37, 88.84 ± 0.28, 91.80 ±
0.29, 94.38 ± 0.26, 95.57 ± 0.39, 98.11 ± 0.29 respectively. The scanning electron microscopic study
indicated that the microspheres were spherical in shape and the drug remained dispersed in the polymer
matrix at amorphous state, In vitro studies were carried out at different pH for a period of 12 hours. Drug
polymer interaction was absent as evidenced by FT-IR.
Keywords: Diltiazem hydrochloride, mucoadhesive microspheres, solvent evaporation technique,
Eudragit S and L 100, in vitro evaluation.
INTRODUCTION
Diltiazem h y d r o c h l o r i d e are easily
absorbed from gastrointestinal tract (GIT) and
have a short half-life are eliminated q u i c k l y
f r o m blood c irculat ion . This drug undergoes
substantly hepatic first pass effect it shows to o r a l
b ioavai lab i l i t y 40%. So they require frequent
Dosing to avoid these drawback, the oral
sustained control release formulation have been
developed in an attempt to release the drug surely in
to the GIT and maintained an effective drug
concentration in the serum for longer period of
time Diltiazem hydrochloride an effective drug in
treatment of hypertension and angina pectoris is a
benzodiazepines derivative and Diltiazem
hydrochloride is a calcium channel blockers which
cases coronary and peripheral vasodilatation by
reducing calcium influx through the slow channel
of vascular smooth muscle and cardiac cell
membranes . Administration of conventional tablet
of Diltiazem Hydrochloride has been reported to
exhibit fluctuations in plasma drug level resulting
either in side effect of reduction in drug
concentration at receptor side, also the maintenance
of constant plasma concentration of cardiac
vascular drug is important in ensuring the
designed therapeutic response, again since the half
life of Diltiazem HCL is 3-4 hrs multiple dos e of
drug need to maintained constant plasma
concentration for good therapeutic response and
improve patients compliance. Hence the objective
of study was made to develop control release
microsphere system of Diltiazem Hcl using
polymer like Eudragit L/S 100 which controlled
the released of drug increase the
bioavailability of drug and dose decreasing the
dosing frequency of drug. For formulation of
microsphere formulation was preferred over
conventional tablet or capsule formulation has it
as several advantage like it control the release
pattern thus decreasing the dosing frequency.
MATERIALS AND METHODS
Diltiazem Hcl was received as a gift from M/s
Microlabs, Bangalore, India. Eudragit S-100, L-100
were obtained Gift sample from Dr.Reddy’s Lab,
Hyderabad, India. All other reagents and solvents used
were of pharmaceutical or analytical grade.
Preformulation Studies of Pure Drug:
Identification of pure drug: Identification of
Diltiazem Hydrochloride was carried out by
Infrared Absorption Spectroscopy.
Drug - Excipients Compatibility Studies:
Compatibility of Diltiazem Hydrochloride with the
respective polymers that is Eudragit L100 and S100,
and physical mixture of main formulation was
established by Infrared Absorption Spectral Analysis
FTIR. Any changes in the chemical composition after
combining with the excipients were investigated
with IR spectra.
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 909
Figure.1.IR Spectrum of Diltiazem Hydrochloride in KBr
Figure.2.IR spectrum of DTZ.HCl, FM1, PF1(Physical mixture corresponding to FM1)
Figure.3.IR spectrum of DTZ.HCl, FM2, PF2 (Physical mixture corresponding to FM2)
Table.1. Wave- number of different functional groups present in Diltiazem.HCl Code Composition Peak for Diltiazem hydrochloride
O-CH3C-H sretch
(cm-1
)
Aromatic C-
H Stretch (cm-
1
)
Amine HCl N-H
stretch (cm-1
)
Acetate
C=O stretch (cm-
1
)
Lactam
C=O stretch (cm-
1
) DTZ.HCl Diltiazem Hcl 3057.27 2837.38 2391.81 1743.71 1681.98
FM1PF1 Formulation
FM1
3055.35
3057.27
2847.03
2839.31
2391.81
2389.88
1743.71
1745.64
1681.98
1681.98
FM2 PF2 Formulation
FM2
3055.35
3057.27
2850.88
285088
2389.88
2389.88
1743.71
1745.64
1681.98
1681.98
2499.490 54.143
2380.215 272.180
1741.135 517.708
1677.176 506.127
1607.113 176.450
1582.429 98.353
1509.160 330.859
1474.152 227.1221443.181 31.995 1411.885 106.259
1321.062 38.426
1292.508 110.346
1253.174 156.567
1237.199 54.842
1215.336 547.746
1178.237 154.926
1159.107 46.164
1138.251 45.290
1111.860 75.176
1084.204 108.010
1056.239 168.260
1026.085 160.930
1007.890 70.993
975.073 227.949
911.019 164.217
863.236 123.200
839.163 149.179
781.477 195.473
755.708 65.550
736.893 58.922
691.144 120.615
665.573 150.053
635.236 102.545
568.653 120.071
531.706 118.491
479.737 218.088
435.884 91.363
415.794 82.985
DITIAZEM DRUG
3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400 200
90
80
70
60
50
40
30
Wavenumber
%T
ransm
itta
nce
2993.239 -4.318
2952.065 43.878
1719.726 171.523
1477.842 1.166
1437.891 58.917
1388.079 89.597
1244.796 822.435
1190.428 90.980
1147.625 839.850
964.392 57.718
840.039 158.695
751.211 256.837
484.899 12.503
DITIAZEM HCL + FM2+ PF2
3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400
100 95 90 85 80 75 70 65 60 55 50 45
Wavenumber
%Transmittance
Wavenumber
%Transmittance 3000.574 2.480
2950.942 214.033
2384.520 1.378
1719.488 -0.009
1607.417 37.041
1582.481 23.143 1508.695 50.904
1474.329 105.891
1442.975 38.038
1388.458 40.893
1252.041 105.720 1193.201 39.705
1150.889 313.281
1060.073 102.523
1026.203 42.485
974.385 74.696
911.107 44.021 839.169 50.642
781.231 48.056 754.878 49.822
665.278 33.312
479.740 99.855
DITIAZEM HCL + FM1+ PF1
3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400 200
100 95 90 85 80 75 70 65 60 55 50 45
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 910
Preparation of Diltiazem Hcl microspheres:
Diltiazem hydrochloride loaded microspheres were
prepared by solvent evaporation method. Diltiazem
hydrochloride and each polymer mixture were
dissolved completely in acetone-methanol mixture by
stirring at 500rpm with magnetic stirrer. Magnesium
stearate was added and the mixture was stirred with
magnetic stirrer at 500 rpm in ice-bath at 10o
C for 10
minute. Above mixture was poured into the liquid
paraffin previously cooled at 10oC, while it was being
stirred by mechanical stirrer at 1000 rpm. Resulting
emulsion was stirred at 35oC for 4 hours using
mechanical stirrer and the organic solvent, acetone-
methanol were removed completely by evaporation.
Solidified microspheres were filtered through
Whatmann filter paper (No.1), washed six times with
50 ml n-hexane. Dried under vacuum at room
temperature for 12 h and stored in desiccators
containing calcium chloride.
Table no-2 Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and
Polymer mixtures (Drug: Polymer =1:1) Contents of Formulations FM1 FM2 FM3
Diltiazem hydrochloride
(gm)
2.0 2.0 2.0
Eudragit L 100 (gm) 2.0 - 1.0
Eudragit S 100 (gm) - 2.0 1.0
Magnesium Stearate (gm)
(Dispersing Agent)
0.300 0.300 0.300
Methanol (ml) 3.0 3.0 3.0
Acetone (ml) 7.0 7.0 7.0
Liquid paraffin (ml) 100 100 100
Table.3. Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and
Polymer mixtures (Drug: Polymer =1:2 ) Contents of Formulations FM4 FM5 FM6
Diltiazem hydrochloride (gm) 2.0 2.0 2.0
Eudragit L 100 (gm) 4.0 - 2.0
Eudragit S 100 (gm) - 4.0 2.0
MMagnesium Stearate (gm) 0.600 0.600 0.600
Methanol (ml) 6.0 6.0 6.0
Acetone (ml) 14.0 14.0 14.0
Liquid paraffin (ml) 200 200 200
Evaluation of microspheres
Particle Size analysis: The particle size of
microspheres was determined by optical microscopy
method; approximately 100 microspheres were
counted for particle size using a calibrated optical
microscope. The microspheres were uniformly spread
on a slide. The particle size of the microsphere was
measured, along the longest axis and the shortest axis
(cross shaped measurement). Average of these two
readings was given as mean diameter of particles. The
diameter of a minimum number of 100 microspheres
in each batch was calculated.
SEM Photographs of Microspheres: Instrument
used Lieca stereomicroscope EZ4D and Magnified
10x 20x and 10x30x.
Micromeritic properties of microspheres: The
floating microspheres are characterized by their
micromeritic properties such as bulk density,
compressibility index, Hausner’s ratio and angle of
repose.
Determination of percentage yield: The prepared
microspheres were collected and weighed. The
measured weight was divided by the total amount of
all non-volatile components which were used for the
preparation of the microspheres
Determination of entrapment efficiency (%): 50 mg
of the microspheres were taken for evaluation. The
amount of drug entrapped was estimated by crushing
the microspheres and extracting with aliquots of 0.1N
Hcl repeatedly. The extract was transferred to a 100
ml volumetric flask and the volume was made up
using 0.1N HCL. The solution was filtered and the
absorbance measured after suitable dilution
spectrophotometrically (UV 1700, Shimadzu, Japan)
at 266 nm against appropriate blank. The entrapment
efficiency (%) was calculated according to the
following relationship
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 911
In-vitro Release Study of the microspheres: Dissolution studies were carried out by using USP
XXIII dissolution test apparatus (Basket) method.
Capsules were placed in a basket so that the
capsule should be immersed completely in
dissolution media but not float. In order to simulate
the pH changes along the GI tract, three dissolution
media with pH 1.2, 7.4 and 6.8 were sequentially
used referred to as sequential pH change method.
When performing experiments, the pH 1.2 medium
was first used for 2 hrs (since the average gastric
emptying time is 2 hrs) then removed and the fresh
pH 7.4 phosphate buffer saline (PBS) was added.
After 3 hrs (average small intestinal transit time
is 3 hrs) the medium was removed and fresh pH
6.8 dissolution medium was added for subsequent
hrs. 900ml of the dissolution medium was used at
each time. Rotation speed was 100 rpm and
temperature was maintained at 37±0.5 ◦C. 5ml of
dissolution media was withdrawn at predetermined
time intervals and fresh dissolution media was
replaced. The withdrawn samples were analyzed at
237 nm, by UV absorption spectroscopy.
RESULTS AND DISCUSSION
Particle Size analysis: It has been observed that the
particle size increases with increasing polymer
amount. The increase in the mean size with increasing
polymer concentration was attributed to the fact that
higher concentration of polymer in the sample leads to
increase in viscosity of the dispersed phase, which
results in formation of bigger droplets and also, fusion
of semi-formed particles and producing an overall
increase in the size of the microspheres. Eudragit L,-
type microspheres and Eudragit S-type microspheres
prepared with the same polymer concentration did not
show any significant variation in their mean size.
Table.4.Particle Size Distribution of Formulations FM1 to FM6 Particle Size Range FM1 FM2 FM3 FM4 FM5 FM6
0-50 0 0 0 0 0 0
50-100 0 0 0 0 0 0
100-150 10 9 8 0 0 3
150-200 41 60 44 8 11 10
200-250 55 71 71 9 28 14
250-300 56 43 41 12 45 26
300-350 23 10 22 28 58 38
350-400 10 3 8 49 28 51
400-450 5 2 4 47 12 25
450-500 0 2 2 22 9 22
500-550 0 0 0 17 6 7
550-600 0 0 0 8 3 4
600-650 0 0 0 0 0 0
Figure.4.Particle Size Distribution of Formulations FM1 to FM6
Particle Size Distribution of Formulations FM1 to FM6
0
1020
3040
50
6070
80
0-50 50-
100
100-
150
150-
200
200-
250
250-
300
300-
350
350-
400
400-
450
450-
500
500-
550
550-
600
600-
650
Particle Size Range
No
Of
Part
icle
s
FM1
FM2
FM3
FM4
FM5
FM6
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 912
SEM Photographs of Microspheres: It shows all microspheres were almost spherical in shape and No
aggregation of microspheres had taken place.
Figure.5. Formulation FM1 Figure.6.Formulation FM2
Figure.7. Formulation FM3
Table.5. Micromeritic properties of microspheres
Batch
Code
Bulk Density
(gm/ml)
Carr’s Index Hausner’s ratio Angle of
repose (θ)
Diltiazem Hcl 0.167 ±0.01 24.38±0.16 1.43 ±0.07
*** FM 1 0.287±0.01 7.12±0.13 1.07 ±0.06 22.92±0.21
FM 2 0.303±0.02 9.82±0.17 1.10 ±0.03 23.96 ±0.63
FM3 0.306±0.01 10.0 ±0.09 1.11 ±0.07 24.30 ±0.55
FM4 0.315 ±0.03 12.5±0.21 1.14 ±0.08 26.56 ±0.41
FM5 0.323±0.02 13.17±0.19 1.15±0.05 28.29 ±0.37
FM6 0.356±0.03 14.21±0.21 1.17±0.09 29.32 ±0.45
Percentage Yield Values and Entrapment
Efficiencies of Formulations: Diltiazem
hydrochloride loaded microspheres having a fairly
high yield (76.48 – 88.94%) were obtained. The
entrapment efficiencies ranged from 86.11 – 98.73%.
The incorporation efficiency of formulations, FM1 –
FM3 was less than formulations FM4 – FM6. The
highest incorporation efficiency of formulation having
drug: polymer ratio 1:2 can be explained through the
fact that the amount of polymer in per unit drug is
greater than that in other formulations.
Table.6. Percentage Yield Values and Entrapment Efficiencies of Formulations Formulation code Percentage Yield (%) Theoretical Drug
Content (%)
Actual Drug Content
(%)* ± S.D.
Entrapment Efficiencies
(%)* ± S.D.
FM 1 76.48 46.51 40.05 ± 0.17 86.11 ± 0.37
FM 2 77.21 46.51 41.32 ± 0.13 88.84 ± 0.28
FM3 77.00 46.51 42.70 ± 0.15 91.80 ± 0.29
FM4 85.07 30.30 28.60 ± 0.09 94.38 ± 0.26
FM5 87.73 30.30 28.96 ± 0.12 95.57 ± 0.39
FM6 88.94 30.30 29.73 ± 0.08 98.11 ± 0.29
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 913
Figure.8.Percentage yield values and entrapment efficiencies of formulations
In- vitro release study of the microspheres:
The release of Diltiazem hydrochloride from
different formulations depended on the type of
polymer and the ratio of the polymer in the
formulations. The release of Diltiazem
hydrochloride from microspheres of Eudragit L-
type was more as compared to Eudragit S-type.
This was due to the presence of more functional
quaternary ammonium groups (10%) in L-type
than S-type (5%).It is also observed that as the
amount of polymer in the formulation increased,
the drug release decreased. It can be explained
on the basis that as the polymer amount increases,
the matrix wall of microspheres become thicker.
A burst effect of drug release can be observed on
the various formulations.The burst effect can be
attributed to the presence of non-encapsulated
drug particles on the surface of the microspheres.
The burst effect of drug release also depended
upon the drug: polymer ratio. From the figure of
release profile, it can be observed that burst effect
of drug release is more in formulations having
drug: polymer ratio 1:1, while in the formulation
having drug: polymer ratio 1:2, burst effect is
less. Withdrawn at predetermined time intervals
and fresh dissolution media was replaced. The
withdrawn samples were analyzed at 237 nm, by
UV absorption spectroscopy.
Table.7. Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6 TIME(hrs) Formulation
FM1
(DTZ:EL100,1
:1)
Formulation
FM2 (DTZ
:ES100, 1:1)
Formulation FM3
(DTZ:EL100:
ES100, 1:0.5:0.5)
Formulation FM4
(DTZ:EL100, 1:2)
Formulation
FM5
(DTZ:ES100, 1:2)
Formulation FM6
(DTZ: EL100:
ERS100, 1:1:1)
1:1 1:2
0 0 0 0 0 0 0
1 41.63 18.95 18.07 23.03 15.82 11.29
2 61.18 26.68 34.12 41.58 19.66 17.96
3 74.47 33 46.12 53.58 22.95 23.26
4 82.37 37.04 55.14 60.42 25.68 25.89
5 86.18 39.09 63.63 65.55 29.42 30.94 6 88.16 42.16 70.5 71.04 34.77 35 7 92.33 45.2 75.9 77.07 38.96 39.12
8 98.53 49.32 80.99 81.72 42.74 47.28
9 99.24 52.96 85.09 85.03 46.06 52.14
10 99.28 57.97 88.56 87.11 49.02 58.53
11 99.34 61.99 91.77 89.2 52.23 64.95
12 99.37 65.03 93.85 90.8 54.42 72.75
Kamalkannan and Arul Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 914
Figure.13.Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6
CONCLUSION
The objective of this study was to develop and
evaluate stable microsphere of Diltiazem
Hydrochloride, an antihypertensive drug using
Polymethacrylates (Eudragit L/S 100) as polymer
which deliver the drug and at a control rate for
prolonged perod of time. Following conclusion have
been drawn from present study: The analytical method
used in present study was found to be suitable for the
estimation of Diltiazem Hcl in different media, which
was indicated by the high regression values obtained
in the standard plot. The DSC studies revealed that
there was no interaction between Diltiazem Hcl and
Eudragit L/S100 used in the formulation of
microsphere. The size of microsphere mainly affected
by stirring speed, as stirring speed increased the size
of microsphere was decreased. The encapsulation
efficiency was increased by increase in polymer conc.
decreased with increase in drug polymer ratio. SEM
studies of the formulation were carried out for the
confirmation of shape and surface morphology of
microsphere. SEM revealed that microsphere was
discrete and spherical in shape with porous outer
surface. On the basis of, particle size, drug content,
Scanning Electron Microscopy, IR-study, in-vitro
release studies FM3 was selected as an optimized
formulation. Hence, finally it was concluded that the
prepared microspheres be considered as one of the
promising formulation technique for deliver the drug
and at a control rate for prolonged period of time and
hence in management of angina pectoris.
REFERENCES
Awadhesh Kumar Maurya, Vishal Gupta, Naveen
Gupta and Vishal Shrivastav, Development and
evaluation of stable microsphere of Diltiazem
hydrochloride, an antihypertensive drug, int. J. of
pharm & life sci, 2(2), 2011, 583-589.
M Nappinnai, VS Kishore, Formulation and
evaluation of microspheres of Diltiazem
hydrochloride, Indian journal of pharmaceutics, 69(4),
2007, 511-514
Reddy MN, Shriwaikar AA, Rosin, Formulation and
evaluation of Diltiazem hcl microspheres, Indian J
Pharm Sci, 62, 2000, 308-10.
Utsav C Rathod, Anand K Kumar, K Patel, Dushyant
A Shah, Statistical evaluation and optimization of
influence of stirring speed and polymer concentration
on hollow microspheres of Diltiazem hcl, Scholars
Research Library, Der Pharmacia Lettre, 4 (3), 2012,
972-978.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 915
Formulation and characterization of Methotrexate loaded sodium alginate chitosan
Nanoparticles S.Daisy Chella Kumari
1*, C.B.Tharani
2, N.Narayanan
3, C.Senthil Kumar
4
1.College of Pharmacy, Madras Medical College, Chennai,India.
2.Department of Pharmacology, Saveetha Medical College, Chennai,India.
3.Jaya College of Pharmacy, Thiruninravur, Chennai,India.
4.Anna University, BIT Campus, Tiruchirappalli,India.
*Corresponding author: E.mail: gefann@ yahoo.co.in, Mobile: 9791173875
ABSTRACT
The aim of the present work was to formulate nanoparticles for Methotrexate drug. Methotrexate is an
anticancer, disease modifying anti rheumatic drug, and BCS Class – III drug having high solubility and
low permeability. Nanoparticles were prepared by ionotropic pregelation method using Box Behnen
Formula. The concentration of chitosan (X1),concentration of sodium alginate (X2) and concentration of
Methotrexate (X3) were chosen as independent variables while particle size, drug entrapment efficiency
and percentage drug release at 36th hour, was taken as dependent variables. The dissolution profile of
selected formulations was fitted to zero order, first order, Higuchi and Korsemayer Peppas models to
ascertain the kinetic modeling of drug release. The prepared formulations were further evaluated for
characterization like surface morphology, particle size distribution, zetapotential and drug excipient
interaction study by Fourier Transformer Infra Red Spectroscopy, Differential Scanning Calorimetry and
X-ray Diffraction. All independent variables were found to significantly influence the particle size,
entrapment efficiency and percentage of drug release. The in- vitro drug release profile showed that the
suitability of sodium alginate-chitosan loaded nanoparticles in controlled release of methotrexate for
prolonged time.
Key words: Methotrexate, Sodium alginate, Chitosan, Ionotropic pregelation method.
INTRODUCTION
The use of natural biopolymers specifically
polysaccharides in drug delivery has attracted
particular interest due to their desirable biocompatible,
biodegradable, hydrophilic and protective properties
(Barichello JM, 1999). The interaction between
biodegradable cationic and anionic biopolymers leads
to the formation of polyionic hydrogels, which have
demonstrated favorable characteristics for drug
entrapment and delivery (Chella F, 2000). Chitosan
and Alginate are two biopolymers that have received
much attention and have been shown to maintain their
structure and activity and protect them from
enzymatic degradation (Madan T, 1997). Moreover,
many of these polymers, particularly hydrogels, are
naturally hydrophilic, which is advantageous since
this property is thought to contribute to longer in vivo
circulation time and allow the highest encapsulation of
drug (Douglas KL,2005). Chitosan is a natural
cationic polysaccharide obtained by the N
deacetylation of chitin, a product found in the shells of
crustaceans (Mansouri S,2004). Alginate is an anionic
polysaccharide consisting of linear copolymers of a-L-
guluronate and b-D-mannuronate residues. Alginates
which are a group of hemocompatible polymers have
not been found to accumulate in any major organs and
have shown evidence of in vivo degradation (Mi FL,
2002). In the presence of Calcium ions, ionic
interactions between the divalent Calcium ions and the
guluronic acid residues cause Alginates to form gels.
The properties of Calcium–Alginate gel beads make
them one of the most widely used carriers for
controlled release systems
(Fundueanu G, 1999).
Coating of these beads with other polymers including
Chitosan has been shown to improve their stability
during (shelf-life) storage and their half life in
biological fluids.
Alginate–Chitosan polyionic complexes form
through ionic gelation via interactions between the
carboxyl groups of alginate and the amine groups of
chitosan. The complex protects the encapsulant, has
biocompatible and biodegradable characteristics, and
limits the release of encapsulated materials more
effectively than either Alginate or Chitosan alone
(Yan XL, 2001). A further advantage of this delivery
system is its non-toxicity, which permits its
administration to be repeated as a therapeutic agent.
Therefore, the purpose of this study was to optimize a
method for the preparation of Alginate-chitosan
nanoparticles by the use of Box–Behnken
methodology to design the most appropriate
preparation method.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 916
Rheumatoid arthritis is an autoimmune disease in
which inflammation of the cells lining the synovium
produces pain, swelling, and progressive erosion of
the synovial joints. Methotrexate (MTX), an
antiproliferative and immunosuppressive agent, is the
drug of choice in the treatment of the disease (Suarez-
Almazor ME, 2000). MTX is a folic acid antagonist
used alone or in association with other therapeutic
agents; however, MTX has an extensive toxicity
range, which is the main cause of therapy withdrawal.
MTX treatment is discontinued in 8%–19% of patients
due to adverse reactions that include gastrointestinal,
hepatic, renal, pulmonary, and hematological
disturbances, and may also affect the central nervous
system
(Varatharajan N, 2009).Overall, 26% of
patients discontinued MTX treatment due to poor
response, high toxicity, or both. Thus, in addition to
the relatively high toxicity, variability, and
unpredictability of the pharmacological action, there
are also drawbacks to the use of MTX treatment for
rheumatoid arthritis (Derviex T, 2004).
Unfortunately, progression of joint destruction
cannot be inhibited completely by MTX treatment in
most patients with RA. This lack of efficacy is due to
the fact that large amounts of the administered MTX
are rapidly eliminated by the kidneys, resulting in a
short plasma half life and low drug concentration in
the targeted tissue. To overcome these
disadvantageous and improve the pharmacokinetic
properties, recently introduced MTX-ALG-CS as a
polyelectrolytic complex nanoparticle has a
substantially prolonged half life in the circulation.
The nanoparticulate formulation of MTX was
optimized using design of experiments by employing
response surface methodology. Response surface
methodology determines the optimum level of each
factor by building a mathematical model.
Optimization of particle size and loading efficacy as
the responses were carried out by Box–Behnken
response surface methodology.
MATERIALS AND METHODS
The polymer Chitosan (CS) was received as a
gift sample from India Sea Foods, Cochin. Sodium
alginate (ALG) was purchased from Sigma Aldrich
and Pluronic F-68 from S.D fine chemicals.
Methotrexate was provided as gift sample by Aptuit
Pvt. Ltd., Hyderabad. Pluronic F-68 was purchased
from S.D fine chemicals. All other solvents and
materials used were of analytical grade.
Box- Behnken Formula: Formula combination
production was beginning with determination of
maximum and minimum concentration for each
component that being used. Combination formula of
chitosan, alginate, and MTX concentration was
conducted to determine the effect of each component
against nanoparticle characteristic. At early stage,
each component value was entered, including chitosan
0.02-0.06% (w/v), alginate 0.05-0.10% (w/v), and
MTX 0.01-0.07 (w/v) into Box-Behnken program.
This whole data concentration was processed using
Box-Behnken model with 3 level 3 factorial to gain
representative data spread. The analysis resulted 17
formulas as recommended optimum combination,
with some formula replication. The relationship
between independent variables and the response was
calculated by the second order polynomial Equation.
(1)
Y = βo + β1x1 + β2x2 + β3x3 + β12x1x2 + β13x1x3 + β23x2x3
+β11x12 + β22x2
2+ β33x3
2 ……… (1)
where Y was the predicted response; β was the model
constant; x1, x2 and x3 were independent variables; β1,
β2 and β3 are linear coefficients; β12, β13 and β23 are
cross-product coefficients; and β11, β22 and β33 are the
quadratic coefficients. The quality of fit of the
polynomial model equation was expressed by the
coefficient of determination R2.
Nanoparticle preparation: Nanoparticles of ALG
were obtained by counter‐ion induced gelification
method (Rajaonarivony M,1993 , Gupta Jitendra
,2011) .Calcium chloride (0.5ml, 18mM), a cross
linking agent, was added to 9.5 ml of sodium alginate
solution (0.08%w/v) containing MTX under stirring
condition. 2 ml of 0.5% w/v of Pluronic F-68 was
added. Chitosan solution (2ml, 0.05% w/v) was added
followed by sonication at 25 W for 7min and the
mixture was kept at room temperature overnight. Drug
loaded nanoparticles were recovered by centrifuging
at 19,000 rpm for 30‐45 min and washed thrice with
distilled water to obtain the final nanoparticles.
Characterization of nanoparticles
Transmission Electron Microscopy: The
morphological observation of drug-loaded
nanoparticles was performed by transmission electron
microscopy (TEM) (JEM 1200 EX, Japan), using a
negative staining method. A drop of nanoparticle
suspension was spread on a 200-mesh copper grid
coating and the excess droplets were removed with
filter paper. After 5 min, a drop of 4% (w/v)
phosphotungstic acid solution was then dropped onto
the grids. After being negatively stained and air-dried
under room temperature, the samples were subjected
to the TEM investigation.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 917
Measurement of Particle Size: The mean particle
size was obtained by Photon correlation spectroscopy
(PCS) (3000SH, Malvern Instruments Ltd., UK). The
MTX loaded Alg-CS nanoparticle formulations were
diluted with de-mineralized filtered water to an
appropriate scattering intensity. Data was analyzed by
the cumulate method assuming spherical particles.
Accordingly, the results are given as the effective
diameter and the poly dispersity index (PDI) as a
measure for the relative width of the particle size
distribution.
Measurement of Zeta Potential: The zeta potential
value of optimized MTX loaded Alg-CS nanoparticle
formulation was measured with the Zetasizer
(3000SH, Malvern Instruments Ltd., UK).To
determine the zeta potential, optimized formulation
was diluted with double-distilled water and placed in
an electrophoretic cell.
Fourier Transform Infra-Red Spectroscopy
(FTIR): MTX-ALG-CS nanoparticles separated from
nanoparticulate suspensions were dried by a freeze
dryer, and their FTIR transmission spectra were
obtained using a FTIR-8300 spectrophotometer
(Shimadzu, Japan). A total of 2% (w/w) of sample,
with respect to the potassium bromide (KBr; S.D. Fine
Chem Ltd., Mumbai, India) disc, was mixed with dry
KBr. The mixture was ground into fine powder using
an agate mortar before compressing into KBr disc
under a hydraulic press at 10,000 psi. Each KBr disc
was scanned at 4 mm/s at a resolution of 2 cm over a
wave number region of 400–4000 cm1
. The
characteristic peaks were recorded for pure drug and
nanoparticle samples.
Differential scanning calorimetry: Differential
scanning calorimetric (DSC) analysis was used to
characterize the thermal behavior of the drug
methotrexate, blank and methotrexate loaded
nanoparticles. DSC thermograms were obtained using
an automatic thermal analyzer system (Pyris 6 DSC,
Perkin-Elmer, USA). Temperature calibration was
performed using Indium Calibration Reference
Standard (transition point: 156.60 ˚C) as a standard.
Samples were crimped in standard aluminum pans and
heated from 40 to 400˚ C at a heating rate of 10˚C/min
under constant nitrogen at 30 ml/min. An empty pan,
sealed in the same way as the sample, was used as a
reference.
X-ray Diffraction: The X-ray diffraction (XRD)
patterns were determined for the drug methotrexate,
blank and methotrexate loaded nanoparticles. Samples
were exposed to a monochromatic nickel-filtered
copper radiation (45 kV, 40 mA) in a wide-angle X-
ray diffractometer (advanced diffraction system,
Sci.008/ntag Inc., USA) with 2θangle.
Determination of Encapsulation Efficiency: The
encapsulation efficiency of nanoparticles was
determined by the separation of drug-loaded
nanoparticles from the aqueous medium containing
non-associated MTX by ultracentrifugation (REMI
high speed, cooling centrifuge, REMI Corporation,
India) at 18,000 rpm at 4 ˚C for 30 min. The amount
of MTX loaded into the nanoparticles was calculated
as the difference between the total amount used to
prepare the nanoparticles and the amount that was
found in the supernatant. The amount of free MTX in
the supernatant was measured by spectrophotometer at
305 nm in suitable dilution with 0.1N HCl. The MTX
encapsulation efficiency of the nanoparticles was
determined in triplicate and calculated as follows:
Equation—(2)
In-vitro release studies: In-vitro release of drug from
MTX nanoparticle formulation is determined by
dialysis bag method in phosphate buffer saline pH 7.4.
The freeze dried MTX nanoparticles (equivalent to 5.0
mg of drug) was taken in a dialysis bag (molecular cut
off 12,000, pore size 0.2 µm) and placed in 100 ml of
dissolution medium which was continuously stirred at
100 rpm at 37°C using shaker incubator. Definite
aliquots of the dissolution medium were withdrawn at
specific time intervals and the same volume of fresh
dissolution medium was added to the flask to maintain
a sink condition. The samples withdrawn were
analyzed for drug content spectrophotometrically at
303 nm.
RESULTS AND DISCUSSION
TEM Analysis: TEM analysis confirmed that
particles with target size and narrower size
distributions could be prepared using a ionotropic
pregelation method. Fig (1) showed that MTX-NaAlg-
CS nanoparticles had spherical shape with size
ranging 100 nm. This was achieved by adapting the
optimized parameters for the preparation of
nanoparticles.
Particle Size Determination: The particle size of
optimized MTX-NaAlg-CS nanoparticle formulation
was showed in Figure (2).The mean particle size of
the optimised formulation was found to be 188.6 nm
and the PDI was found to be 0.265.The low PDI value
indicates the uniform particle size distribution which
may due to the adoption of optimised formulation
parameters.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 918
Zeta potential: The zeta potentials of about -22.4
mV showed in Figure (3) indicate good stability of
formulation. This might be attributed to surfactant
which decreases the electrostatic repulsion between
the particles and sterically stabilizes the nanoparticles
by forming a coat around their surface.
FTIR Analysis: The characteristic peaks of MTX
was showed (Fig.4a) at 3464 cm1
(-NH stretching),
16483.4 cm1
(COOH), 1653 cm1
(CONH) and
853.88 (aromatic stretch). In the spectrum of MTX-
NaAlg-CS nanoparticles formulation, significant
peaks were obtained at 3437 cm1
, 1679 cm1
, 1639.1
cm1
and 819.49. Because of the presence of polymer,
some additional peaks were present. Fig.(4b). This
indicates that there is no interaction between the drug
and polymers in the formulation.
Differential scanning calorimetry: DSC studies
were performed to investigate the physical state of the
drug in the nanoparticles, because this aspect could
influence the in vitro and in vivo release of drug from
the system. DSC thermogram of MTX and MTX-
NaAlg-CS nanoparticles were showed in Fig (5a, 5b)
The thermogram of the drug showed a sharp melting
peak at 115.82°C. MTX-NaAlg-CS nanoparticles did
not show the melting peak for the MTX at
115.82°C.The endothermic peak of MTX in MTX-
NaAlg-CS nanoparticles was depressed, broadened
and shifted to lower temperature. These thermal
characteristics of MTX corroborate with the reference
value reported by (Renu Sigh, 2006). These results
could indicate that MTX was not in crystalline state,
but is in amorphous state after entrapment with the
polymer because drug crystals completely dissolve
inside the polymer matrix during the scanning of
temperatures up to the melting value or because the
drug remained dispersed at molecular level inside the
solid dispersion after the formation of MTX-NaAlg-
CS nanoparticles (Adamo, 2010).
X-ray diffraction: X-ray diffraction has been used for
the study of molecular structure and polymorphism of
polymeric nanoparticles (Westesen, 1993 and Bunjes,
1996). XRD pattern of pure MTX, Blank, MTX-
NaAlg-CS nanoparticles formulation are illustrated in
Fig 6. The XRD pattern of pure Methotrexate from 2-
70˚ 2θ showed distinctive peaks approximately at
13.7, 14.1, 19.6, 27.8 and 29 degrees obtained were
comparable with XRD pattern of crystalline MTX
reported in literature (Rama, 2012). Blank
nanoparticles do not show any high intensity peak
revealing the amorpous nature of the polymer and
stabilizer respectively. The characteristic peaks of the
methotrexate was absent in MTX-NaAlg-CS
nanoparticle. This indicates that MTX was molecular
dispersed in to the polymeric nanoparticles and there
could be less or no free drug in crystalline form on the
surface of the nanoparticles. From this, it is evident
that an XRD signal of encapsulated drug is very
difficult to detect, which showed that the drug is
dispersed at a molecular level in the polymeric
matrix.(Liu,et al., 2006).
Drug release and Release Kinetics: The in vitro
release pattern of MTX-NaAlg-CS nanoparticle
shown the initial burst release followed by the
sustained release was observed in optimized
formulation (data not shown). During initial hours
minimum burst release of the drug from the polymeric
nanoparticles was observed followed by prolonged
release (68.99%) up to 36 h. The initial burst release
may be probably caused by the drug adsorbed on the
surface of nanoparticles or precipitation of drug from
the nanoparticles. Sustained release was obtained due
to slow diffusion of the drug from the polymeric
matrix.
To determine the release model that best
described the drug release, the in vitro release data
was substituted in equations of zero order, first order
and Higuchi model and the results are noted. Among
them the zero order model showed a high R2 value
0.93443, indicating that the release of the drug
followed zero order release kinetics.( Fig 7a) To
understand the mechanism of drug release,
Korsmeyer–Peppas equation was applied and it
showed a good linearity. The release exponent ‘n’ was
found to be 0.79307. (Fig 7b). According to this
model, if the value of ‘n’ was between >0.43 and
<0.85, it indicated that drug release followed
anomalous transport (Non-Fickian) (Chouhan and
Bajpai, 2009 b) and was controlled by more than one
process (the coupling of Fickian diffusion and
polymer matrix relaxation).
Optimization and validation: The experimental
results were fitted into second-order response surface
model. The composition of optimized formulation was
achieved with 0.05%w/v chitosan, 0.08%w/v of
sodium alginate and 0.04%w/v of MTX, which fulfill
the requirements of optimization. The optimized
formulation has particle size 183.69 nm, entrapment
efficiency of about 93.59% and 68.9 % drug release,
which were in good agreement with the predicted
values. These figures also indicate that the developed
models are adequate and predicted results are in good
agreement with the measured data.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 919
Fig 1 : TEM image of MTX-NaAlg-CS nanoparticles Fig 2: Particle size distribution of optimized MTX-
NaAlg-CS nanoparticle
Fig 3: Zeta potential of MTX-NaAlg-CS nanoparticle
Fig 4a: FTIR spectra of pure Methotrexate Fig 4b : FTIR spectra of MTX-NaAlg-CS nanoparticle
Fig 5a : DSC curve of pure methotrexate Fig 5b: DSC curve of MTX-NaAlg-CS nanoparticle
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 920
Fig 6 : X-ray diffraction pattern of A) Pure Methotrexate B) Blank nanoparticle
C) MTX-NaAlg-CS nanoparticle
Fig 7a: Zero order release of MTX-NaAlg-CS nanoparticle
Fig 7b : Korsmeyer-Peppas drug release kinetics of MTX-NaAlg-CS nanoparticle.
Daisy Chella et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 921
CONCLUSION
Methotrexate loaded nanoparticles were
prepared by the ionotropic pregelation method. The
FTIR, DSC, XRD pattern study did not detect any
crystalline drug material in the freshly prepared freeze
dried nanoparticles. The application of factorial design
gave a statistically systematic approach for the
formulation of nanoparticles with desired particle size,
high entrapment efficiency and % drug release.
Concentration of Drug , Polymers were found to
influence the particle size, Entrapment efficiency and
% drug release of MTX loaded NaAlg-CS
nanoparticles. The release was found to follow with
non-Fickian diffusion mechanism for optimized batch.
These results indicate that MTX loaded NaAlg-CS
nanoparticles could be effective in controlled drug
release for a prolonged period would serve the
purpose for long term treatment of Rheumatoid
Arthritis.
ACKNOWLEDGEMENT The authors are thankful to Aptuit Pvt.Ltd,
Hyderabad for providing gift sample of Methotrexate
and India sea food , Cochin for Chitosan. REFERENCES
Adamo F, Cristina C, Giancarlo C, Antonio MR, Bimodal
release of Olanzapine from lipid Microspheres, J Pharm
Sci. 99, 2010, 4251-4260.
Barichello JM, Morishita M, Takayama K, Nagai T,
Encapsulation of hydrophilic and lipophilic drugs in PLGA
nanoparticle by the nano-precipitation method, Drug Dev
Ind Pharm, 25,1999, 471.
Bunjes H, Lipid nanoparticles for the delivery of poorly
water soluble drugs, J Pharm Pharmacol, 62, 1996, 1637–
1645.
Chellat F, Tabrizian M , Dumitriu S , Chornet E, Magny
P, Rivard CH, et al. In vitro and in vivo biocompatibility
of chitosan–xanthan polyionic complex, J Biomed Mat
Res, 51,2000,107–113.
Chouhan, R., Bajpai, A.K, An in vitro release study of 5-
fluoro-uracil from swellable poly-(2-hydroxyethyl
methacrylate) (PHEMA) nanoparticles, J Mater Sci Mater.
Med. 20, 2009b, 1103–1114.
Dervieux T, Furst D, Lein DO, Polyglutamation of
methotrexate with common polymorphisms in reduced
folate carrier, aminoimidazole carboxamide ribonucleotide
transformylase, and thymidylate synthase are associated
with methotrexate effects in rheumatoid arthritis, Arthritis
Rheum ,50(9), 2004, 2766–2774.
Douglas KL,Tabrizian M, Effect of experimental
parameters on the formation of alginate–chitosan
nanoparticles and evaluation of their potential application
as DNA carrier, J Biomat Sci, Polymer Edition, 1, 2005,
43–56.
Fundueanu G, Nastruzzi C, Carpov A, Desbrieres J,
Rinaudo M, Physico-chemical characterization of Ca-
alginate microparticles produced with different methods.
Biomaterials, 20,1999, 1427.
Gupta Jitendra, Prabakaran L, Gupta Reena, Govind
Mohan, Nanoparticle formulation using counter-ion
induced gellification Technique: In-vitro Chloramphenicol
release, Int J Pharm Pharm Sci , 3 (3), 2011, 66-70.
Madan T, Munshi N, De TK, Maitra A, Sarma PU,
Aggarwal SS, Biodegradable nanoparticles as a sustained
release system for the antigens/allergens of Aspergillus
fumigates, Preparation and characterization, Int J Pharm,
159, 1997,135.
Mansouri S, Lavigne P, Corsi K , Benderdour M,
Beaumont E , Fernandes JC ,Chitosan–DNA nanoparticles
as non-viral vectors in gene therapy: Strategies to improve
transfection efficacy, Eur J Phar Biopharm, 57,2004, 12.
Mi FL , Sung W, Shyu SS, Drug release from chitosan–
alginate complex beads reinforced by a naturally occurring
cross-linking agent, Carbohydr Polym, 48, 2002, 61.
Rajaonarivony M, Vouthier C, Couarrze G, Puisieux F,
Couvreur P, Development of a new drug carrier made from
alginate, J Pharm Sci, 82, 1993, 912‐917.
Rama B, Shantha A, Optimization of Methotrexate
Transdermal Patches: Effect of variables on In-Vitro, Ex
Vivo permeation and Flux, Int J Pharm Sci Lett ,2 (2),2012,
53-59.
Renu Singh Dhanikula, Patrice Hildgen, Influence of
molecular architecture of polyether-co- Polyester
dendrimers on the encapsulation and release of
Methotrexate, Biomaterials, 28, 2007, 3140-3152.
Suarez-Almazor ME, Belseck E, Shea B, Wells G, Tugwell
P. Methotrexate for rheumatoid arthritis, Cochrane
Database Syst Rev, 2, 2000, CD000957.
Varatharajan N, Lim IG, Ananda coomarasamy A,
Methotrexate: long-term safety and efficacy in an
Australian consultant rheumatology practice, Intern Med J,
39(4), 2009, 228–236.
Yan XL , Khor E, Lim LY, Chitosan–alginate films
prepared with chitosans of different molecular weights. J
Biomed Mat Res, 58, 2001, 358.
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 922
Strategies in Dendritic architecture for drug delivery – An over review Pandurangan Dinesh Kumar*
1, Palanirajan Vijayaraj Kumar
2, Govindaraj Saravanan
3
1.Department of Biotechnology, Acharya Nagarjuna University, Guntur - 522510, Andhra Pradesh, India.
2. Faculty of Pharmaceutical Sciences, UCSI (University College Sadaya International) University, Jalan
Menara Gading, 56000-Cheras, Kuala Lumpur, Malaysia.
3.Bapatla College of Pharmacy, Bapatla - 522 101, Guntur (Dt), Andhra Pradesh, India.
E-mail: [email protected], [email protected], Mobile: 99666 39425
ABSTRACT
Dendrimers represent a novel class of structurally controlled macromolecules derived from a
braches upon branches structural motif. These consist of highly branched moieties that radiate from a
central core and synthesizes through a stepwise repetitive reaction sequence. In the field of
pharmaceutical nanotechnology and medicinal chemistry dendrimers play a vital role based on the
structural advantage such as size, shape, surface and interior chemistry flexibility and topology.
Dendrimers have emerged as highly gifted drug delivery molecule because of their exceptional
structure and properties. Solubility enhancement is an important aspect of dendrimers and this is a
synergy with site specific drug delivery. Solubilisations of hydrophobic drug molecule are easily
achieved by the dendrimers because they were entrapped in hydrophobic channels. Extracellular
matrix of tissue particularly vascular tissue it contains a high concentration of negatively charged
glycosaminoglycans which are involved in regulation of cell motility cell proliferation in the
regulation of enzyme activity. Extra cellular matrix can be used as a substrate for binding and
retention of drug delivered intra vascularly. Recently dendrimers have caused an explosion in
biomedical science and created interest in the discovery of the drugs by virtue of their therapeutic
value. The dendrimer polymer suggest that they are promising drugs wound healing ,bone
mineralization cartilage formation, tissue repairing topical treatment for AIDS to prevent HIV
transmission. It also acts as an anti prion, anti Alzheimer, anti coagulants, anti dots, anti inflammatory
and anti cancer agents.
Key Words: Dendrimer, Nano-composites, Dendrimer conjugation, Dendrimer applications.
INTRODUCTION
Dendrimer the name comes from the Greek
“ɗevɗpov”/dendron meaning “tree” synonymous
terms are arborols and cascade molecule (Buhleirier
et al., 1978). Dendrimers are repeatedly branched
molecules that are characterized by structural
perfection. This is based on the evolution of both
symmetry and polydispersity the field of dendritic
molecule can roughly be divided into
1. Low molecular weight
2. Molecular weight species
The first category includes dendrimers and
dendrons and the second includes dendronized
polymers hyper branched polymers and brush
polymers (called as bottle brushes) tailored forms
and function ever realized outside of nature.
Structurally dendrimers posses 3 distinct parts
1. A core
2. Branching units
3. Branches
It is usually produced in an interactive
sequence of reaction steps, in each added lerative
lead to a higher generation material. The size of
dendrimer can be described as a function of
generation (Gn where n is 0, 0.5, 1.0, and 1.5) G is
number of repetition cycles. The molecular weight
of the dendrimer nearly doubles with each additional
generation (Tomalia et al., 2005). Furthermore,
terminal groups can be modified to obtain both
hydrophilic or lipophilic function for the desired
biological and drug delivery application (Bai et al.,
2006). Following properties of dendrimer made
them ideal molecule for drug delivery applications
(Tomalia et al., 2007):
a. Nanoscale sizes that have similar dimensions
to significant bio-building blocks,
b. Numbers of terminal surface groups (Z)
appropriate for bioconjugation of drugs,
signalling groups, targeting moieties or
biocompatibility groups.
c. Functional groups on the surfaces were
designed to augment or resist trans-cellular,
epithelial cell or vascular permeability.
d. An interior void space was used to
encapsulate drug molecule, metals, or
imaging moieties and also reduces the drug
toxicity and facilitates controlled release.
e. Positive biocompatibility patterns that are
coupled with lower generation anionic or
neutral polar terminal surface groups.
f. Low-immunogenicity with modified
dendrimer surfaces by small functional
groups or polyethylene glycol (PEG).
Dendrimers a nano particle based drug
delivery system have numerous applications in
many fields such as supramolecular chemistry or
host–guest chemistry (Elemans et al., 2002 and Al-
Jamal et al., 2005), electrochemistry (Credi et al.,
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 923
2004), and photochemistry (Momotake et al., 2004),
nanoparticle synthesis (Wu et al., 2006, Love et al.,
2006 and Yan et al., 2006), pollution management
(Xu et al., 2005, Diallo et al., 2005 and Arkas et al.,
2006), dye decolorization (Cheng et al., 2005 and
Cheng et al., 2005), preparation of monomolecular
membranes (Karthaus et al., 1996, Sayed-Sweet et
al., 1997 and Vladimir, 1998), curing of epoxy
resins (Cheng et al., 2007), catalysis (Lee et al.,
1994, Fujita et al., 1995, Bhyrappa et al., 1996 and
Mak et al., 19970, drug delivery (Patri et al., 2002,
Aulenta et al., 2003, D’Emanuele et al., 2004,
Svenson et al., 2005 and Florence et al., 2005), and
gene transfection (Dufes et al., 2005, Kim et al.,
2006 and Bayele et al., 2006). In recent, dendrimers
usage in drug delivery had attain great development
and different types of dendritic macromolecules
have been synthesized and investigated as a carrier
for drug delivery (Patri et al., 2002), gene delivery
(Schatzlein et al., 2005), targeting (Patri et al.,
2005), solubilization (Gupta et al., 2006), diagnosis
(Wiener et al., 1994), chemical catalysis (Wu et al.,
2006) and as multivalent ligand for interesting
biological applications (Heldt et al., 2004 and
Svenson and Tomalia, 2005).This review article
intends to provide the reader with a glimpse into the
synthesis, types and important applications of
dendrimers.
SYNTHESIS OF DENDRIMERS
The first synthetic procedure towards well
defined branched structures was reported by Vogel’s
in 1978, who named this procedure a “cascade
synthesis” .In the early 1980’s, Denkewalter
patented the synthesis of L-lysrine-based dendrimers
(Denkewalter et al., 1981). The first dendritic
structures that were exhaustively investigated and
that received widespread attention were Tomalia’s
PAMAM (polyamidoamine) dendrimers (Tomalia et
al., 1990) and newkome’s “arborol” systems
(Newkome
et al., 1985). In the synthesis of
dendrimers, monomers lead to a mono disperse
polymer, tree like generational structure. There are 2
methods of dendrimer synthesis they are,
1. Divergent synthesis
2. Convergent synthesis
Divergent synthesis: The dendrimer is prepared
from the core as the starting point and built up
generation by generation. In the divergent reaction
because of the incomplete reaction by end group
will create structural defects which further prevent
formation of next generation. Divergent name is
derived from the manner in which dendrimer grows
outward from the core. The higher generations of
divergently constructed dendrimers always contain
certain structural defects. To prevent side reaction
and to force reactions to completion a large excess
of reagent is required.
Convergent synthesis: The convergent synthesis
starts from the surface and ends up at the core,
where the dendrimer segments (dendron) are
coupled together. Two of these end tips are attached
to a branched monomer to form a dendron and the
process is repeated until a desired size is reached. To
the core molecule the interconnected branches are
attached. To synthesize dendrimers is difficult
because a repeated reaction which consists of many
steps is needed to protect the active site even in both
methods. That why these are obstacles to the
synthesis of large quantities of dendrimers (Hawker
et al., 1990).
Other alternative preparation methods have
been developed that aim to reduce the number of
synthetic and purification steps and increase yields,
such as the double-stage convergent growth
approach (Labbe et al., 1996 and Ihre et al., 1998),
double-exponential dendrimer growth approach
(Kawaguchi
et al., 1995), and orthogonal coupling
(Zeng et al., 1996).
TYPES OF DENDRIMERS Now days, dendrimers with different
designed functionalities have become objects of
particular academic and practical interest because of
their unique superbranched structural, symmetrical
shapes, good monodispersity and peripheral
functionalities,. Here, some of the dendrimers
having different functionalities are briefly described.
PAMAM dendrimer: The PAMAM
(polyamidoamine) dendrimers are synthesized up to
generation 10 (G10) by the divergent method
starting from ammonia or ethylene diamine
initiation cone reagents (fig. 1). They are
constructed using a reiterative sequence consisting
of a double Michael addition of methyl acrylate to a
primary amino group followed by amidation of the
resulting carbomethoxy intermediate with a large
excess of ethylene diamine. Many surface modified
PAMAM dendrimers are non-immunogenic, high
water solubility and modified terminal-arms amine
functional groups for binding various targeting or
guest molecules. PAMAM dendrimers generally
display concentration-dependent toxicity and
haemolysis. PAMAM dendrimers with their amide
backbones undergo hydrolytically degradation at
physiological temperatures only on harsh conditions
(Lee et al., 2005). The internal cavities of PAMAM
dendrimers with tertiary amines and amide linkages
can host metals or guest molecules to produce a
unique functional architecture. PAMAM dendrimers
are the most extensively reported moiety for almost
all existing applications of dendrimers.
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 924
Fig. 1: PAMAM dendrimers
PPI dendrimers: PPI (polypropyleneimines)
dendrimers (fig. 2) were created by Meijer at DSM
of the Netherlands (DeBrabander-vandenBerg et al.,
1993). PPI dendrimers up to generation 5 are
synthesized by the divergent method starting from 1,
4. diamino butane. They grow by a reiterative
sequence consisting of (A) a double Michael
addition of acryloritrile to the primary amino groups
followed by (B) Hydrogenation under pressure in
the presence of Raney cobalt. Today, these PPI
dendrimers are synthesized in large quantities by
DSM and are commercially available. DSM uses its
own designation to describe its dendrimers, where
the core is diaminobutane, dendrindictes the interior
dendritic branch cell; and n is the number of end
groups.
Fig. 2: PPI dendrimers
Liquid crystalline dendrimers: These are
mesogenic (liquid crystalline) monomers e.g.
mesogen functionalized carbosilane dendrimers.
Functionalization of end group of carbosilane
dendrimers with 36 mesogenic units, attached
through a C-5 spacer, leads to liquid crystalline
dendrimers that form broad smetic A phase in the
temperature range of 17–130C (Lorenz et al., 1996).
Boiko et al.,. had synthesized first photosensitive
liquid crystalline dendrimer with terminal
cinnamoyl groups (Boiko et al., 1996). They have
confirmed the structure and purity of this LC
dendrimer by 1H NMR and GPC methods.
Dendrimers under UV irradiation, can undergo E-Z
isomerisation of the cinnamoyl groups and [2 + 2]
photocycloaddition leading to the formation of a
three-dimensional network.
Tecto dendrimers: Tecto-dendrimers are composed
of a core dendrimer, which may or may not contain
the therapeutic agent, surrounded by dendrimers of
different types, each type designed to perform a
function necessary to a smart therapeutic nanodevice
(Betley et al., 2002). The Michigan Nanotechnology
Institute for Medicine and Biological Sciences (M-
NIMBS) are developing a tecto dendrimers which
are used to perform the functions like diseased cell
recognition, drug delivery, diagnosis of disease
state, reporting location and outcome of therapy.
The future planning was to produce a smart
therapeutic nanodevice for the diseased cell like a
cancer cell or a cell infected with a virus.
Chiral dendrimers: In chiral dendrimers the
construction of core was based on different
constitution but with similar chemical branches.
Asymmetric catalysis and chiral molecular
recognition are the main applications of chiral,
nonracemic dendrimers (Ritzén and Frejd, 1999).
PAMAMOS dendrimers: PAMAMOS (poly
amidoamine-organosilicon) are radially layered,
inverted unimolecular micelles that consist of
hydrophilic, nucleophilic polyamidoamine
(PAMAM) interiors and hydrophobic organosilicon
(OS) exteriors. These are exclusively useful for the
preparation of honeycomb like networks with
nanoscopic PAMAM and OS domains (Dvornic et
al., 2000).
Hybrid dendrimers: Hybrid dendrimers are
combination of dendritic and linear polymers in
hybrid block or graft copolymer forms. The small
dendrimer segment coupled to multiple reactive
chain ends provides an opportunity to use them as
surface active agents, compatibilizers or adhesives,
e.g. hybrid dendritic linear polymers (Jain and
Khopade, 2001).
Peptide dendrimers: Peptide dendrimers are
defined as dendrimer containing peptides on the
surface of the dendrimer frame work with amino
acids as a branching (or) core unit. Peptide
dendrimers with their peptide molecule had
excellent compatibility in biological and
therapeutical levels make them a potential candidate
for various drug delivery systems. The main
applications of the peptide dendrimers includes
cancer, antimicrobials, antiviral, central nervous
system, analgesia, asthma, allergy, Ca+2
metabolism,
magnetic resonance imaging (MRI), magnetic
resonance angiography (MRA), fluorogenic imaging
and serodiagnosis (Bruckdorfer et al., 2004 and
Crespo et al., 2005).
Glycodendrimers: Dendrimers that incorporate
carbohydrates into their structures are termed as
glycodendrimers. Glycodendrimers are three types
(i) carbohydrate-coated; (ii) carbohydrate centered;
and (iii) fully carbohydrate-based. Glycodendrimers
have been used to study the protein–carbohydrate
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 925
interactions that are in many intercellular
recognition events. The main applications of
glycodendrimers are study of protein–carbohydrate
interactions, incorporation into analytical devices,
gel formulation, MRI contrast agents, and gene
delivery systems (Colinger, 2002 and Turnbull and
Stoddart, 2002).
APPLICATIONS OF DENDRIMERS
Dendrimers have attracted the most
attention as potential drug delivery scaffolds due to
their unique characteristics. Dendrimers have
narrow polydispersity; nanometer size range of
dendrimers can allow easier passage across
biological barriers. Dendrimers can be used to
deliver drugs either by encapsulating the drug in the
dendrimer interior void spaces or by conjugation to
surface functionalities. All these properties make
dendrimers as suitable carrier for drug delivery.
Dendrimers in transdermal drug delivery: Now
day’s dendrimers had key role for the improvement
transdermal drug delivery system. In transdermal
dosages drug delivery is difficult because of the
hydrophobic nature and inefficient cell entry. Highly
water soluble dendrimer are designed which
improve the drug solubility, plasma circulation, and
entry to cells make efficiently delivery drug from
transdermal formulation.
Non-steroidal anti-inflammatory drug
(NSAIDs) used for acute and chronic rheumatoid
and osteoarthritis are limited there clinical usage by
adverse events such as dyspepsia, gastrointestinal
bleeding and renal side effects when give orally.
Transdermal formulation will overcome adverse
events and also provide good therapeutic blood level
maintains for longer time. But poor rate of
transcutaneous delivery pulls down transdermal
delivery system. Drug permeation through the skin
was enhanced by PAMAM dendrimer complex with
NSAIDs (Ketoprofen, Diflunisal) as skin penetration
enhancers. Permeation studies on rat skin were
carried out for ketoprofen and diflunisal drug. High
permeation was achieved by drug dendrimer
complex (ketoprofen 3.4times and diflunisal
3.2times) when compared to drug. Antinociception
effect of ketoprofen shows that dendrimer complex
reduced writhing for period 1-8hr but drug reduced
writhing up to 4-6hr.
In another study indomethacin and
PAMAM dendrimer investigated (Chauhan et al.,
2003). In-vitro and in-vivo studies were carried out
for PAMAM dendrimer complex. In-vivo
pharmacokinetic and pharmacodynamic studies in
Wistar rats showed that significant higher
concentration and effective concentration could be
maintain for 24h in blood by G4 dendrimer
indomethacin transdermal formulation.
Various transdermal penetration enhancers
based on chemical and physical approach were
carried out chemical penetration enhancers such as
sulfoxide, oxazolidionesis, fatty acids essential oil,
pyrrllidoions, terpenes and terpenoirds were used.
Inotophoresis, electrophoresis, ultrasound, gel and
patch are physical penetrates which used to
exchange absorption of drug (Pathan and Setty,
2009, Santander-Ortega et al., 2010 and Shembale et
al., 2012).
Recently Zhao et al., conjugated PEGylated
PAMAM dendrimers for transdermal delivery of
bioactive molecules delivery of bioactive by pre-
treatment or co treatment technique using different
vehicle lime water, chloroform isopropyal myristal
chloroform water mixture and octanal water mixture
emulsion. Further he reviewed the three different
mechanisms which use to deliver the bioactives
(Sun et al., 2012).
In another study Welowie et al., used that
PAMAM dendrimers to conjugate 8-methoy psiralae
(a photo sentizier for puva therapy). Here solubility
of 8-methoxypsiralane PAMAM conjugate
increased. Moreover in another study solubility of
riboflavin was enhanced with increase in generation
of PAMAM dendrimers. Moreover diffusion of
riboflavin in pig ear skin was enhancing with
increase in generation (Borowska et al., 2010).
Moghmin et al., show that furful permeation
enhances through rat skin model using pamam
dendrimers (G5) in water vehicle by pretreatment
(Moghimi et al., 2010).
Yang et al., reported that smaller G2 pamam
dendrimers penetrate the skin layers more efficiently
than the larger ones (G4). Increased skin absorption
and retention were produced by G2 dendrimeric olic
acid conjugates because of their increase in partition
coefficient. Here permeation across skin layers is
directly based on the size, surface charge and
hydrophobicity of PAMAM dendrimers (Yang et
al., 2012).
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 926
Fig. 3: Schematic representation of the internalization mode of PAMAM dendrimers with different
surface attachments (Yang et al., 2012).
In transdermal applications nanoparticles
(polysacchird and dendrimers) are used to increase
the potential of transdermal drug delivery system.
Permal and co had extensive research work on
dendrimer application in transdermal system they
reveal that physico chemical properties of
dendrimers play a vital role in delivery of drug by
increase the penetration (Venuganti et al., 2009).
Therefore data suggested that dendrimer drug
complex make transdermal delivery system was
effective and might be a safe and efficacy method
for treating different diseases (Cheng et al., 2007).
Dendrimers in oral drug delivery: Traditional
Oral drug-delivery system has been the dominant
route for many years because of its significant
advantages. A major challenge for drugs is the
possibility of oral delivery, but main drawback was
the limited drug transport across the intestitinal
epithelium due to their large size relative to the tight
epithelial barrier of the gastrointestinal tract.
Duncan’s and his research group showed that
macromolecules of 3nm diameters could penetrate
through the rat’s intestinal membranes, which
allows G2.5-G3.5-PAMAM dendrimers to transport
across the intestine (Duncan and Izzo, 2005).
Moreover the acidic nature of the GI-tract enzymes
and stomach can affect the drug and the nanocarrier.
D’Emanuele group investigated effect of dendrimer
generation and conjugation on the cytotoxicity,
permeation and transport mechanism of surface-
modified cationic G3-PAMAM propranolol
dendrimer conjugation across Caco-2 cell
monolayers (D’Emanuele et al., 2004). They
suggested that the route of propranolol transport was
initially transcellular, while the conjugate was able
to bypass the P-gp efflux transporter, and they
arrived as the same inference as above concerning
the penetration pathway of the intestinal membrane.
Najlah investigated transepithelial permeability of
naproxen, a low solubility drug (Najlah et al., 2007).
Stability studies of G0 PAMAM conjugates in 50%
liver homogenate was compared to that in 80%
human plasma showed the lactate ester linker gave
prodrug of elevated stability in plasma with sluggish
hydrolysis in liver homogenate. So, these
conjugations exhibit potential nanocarriers for the
enrichment of oral bioavailability. The Cheng and
Xu group, reviewed that a PAMAM dendrimer
complex of the anti-inflammatory drug ketoprofen
sustained antinoninceptive activity (inhibit rate >
50%) until 8 h of oral administration to Kunming
mice, whereas this activity was absent with the free
drug after 3 h (Na et al., 2006). Increase in
permeability and cellular uptake was produced by
G4- PAMAM 7-ethyl-10-hydroxycamphtothecin
complexation with respect to free 7-ethyl-10-
hydroxycamphtothecin. They reported that complex
has the potential to improve the oral bioavailability
of drug.
Lin et al., carried out study on effects of
PAMAM dendrimer in intestinal absorption of
poorly absorble drug such as 5(6)- carboxyfluorsin
isothicynate dextran, calctitonin and insulin in rat
(Lin et al., 2011). Drug carboxylorescin and
calcitonin showed increase in absorption in rats
small intestine for 0.5%w/v G2 PAMAM dendrimer
complex. But fluorescine isothiocynate dextran and
insulin had not produced any desirable effects.
Moreover absorption in small intestine is mainly
base on molecular weight of drug ie the molecular
weight of drug increase absorption of drug
decreases.
Recently Kolhatkar et al., explored oral
delivery of SN – 38 (a potent topisomers –I inhibtor)
and active metabolize of irinotecan hydrochloride
(cpt-11) was improved by conjugation with G4
PAMAM dendrimer.10 fold increase in caco3 cell
monolayer and 100 fold increase in cellular uptake
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 927
by SN-38 and G4 PAMAM dendrimer than plain
drug (Kolhatkar et al., 2008) .
Dendrimers in targeted drug delivery: Targeted
drug delivery system had fetched great importance
in the pharmaceutical field mainly because it create
wide scope in utilization of existing drug and
reduced in draw backs. In treatment of cancer and
tumour existing drug molecules are ineffective
because of the cytotoxicity nature. The main reason
for cytotoxicity is low molecule weight and high
pharmacokinetic volume of distribution, quick
elimination, so high dose of drug is required for the
desired therapeutic effect which ultimately leads to
high toxicity and unwanted harmful effects,
moreover when these drug administered alone will
develop high resistance and lack of specification
will produce toxicity effect on the other healthy
cells. Further these chemopathetic drugs had poor
solubility and low bioavailability. Moreover these
drug formulations are formulated with toxic solvents
to produce effect dosage forms.
Above mentioned problems are overcome
by the usage dendrimers as a carrier for delivery the
drug in targeted manner. Dendrimers are able to
produced specific targeting of drug to cells and
thereby improving efficacy minimising side effects.
Various research works are carried to prove that
dendrimers can able to deliver the drug to the
targeted tissue in controlled manner. Cisplatine was
conjugate with pamam dendrimer by Malik et al
(Malik et al., 2000). The conjugate shows increased
solubility, reduced toxicity and EPR properties. It
was observed that this formulation showed superior
activity over cisplatin when injected into mice
bearing B16F10 tumor cells.
Doxorubicin is complexed with 2-3-bis (hydro
methyl) proxamic acid dendrimers and characterise
for in-vitro and in-vivo studies. The complexation of
drug with dendrimer mainly by covalently bond
through hydrazone linkage to high molecule weight
3-arm polyethylene oxide, exhibits reduced
cytotoxicity in-vitro. But in-vivo studied shows
minimum accumulation in vital organs and increase
half life for conjugate drug compared to free drug.
Jesus and group had concluded that dendrimer
formulation increase half life of the drug and there
reduced the amount of drug administered (De Jesus
et al., 2002).
The in-vivo characterize in the mice of
dendrimer conjugate should increased solubility,
reduced toxicity and EPR properties when compared
with free drug. Dendrimer conjugate of Cisplatine
produced superior activity in targeted manner when
compared with free drug. Poly amide amine
dendrimers was conjugated with 1-bromoacetyl-5-
flurouracil to produce dendrimer 5Fu-conjugates.
Zhou et.al demonstrated that release of the drug
from the dendrimer was base on generation and
further indicates that dendrimer are promising drug
for targeted drug delivery (Zhuo et al., 1999).
Dendrimer conjugates showed good
elimination compared with drug in in-vitro studies
carried out in the mice by Lee group. Doxurubin
model drug was conjugated with polyester based
dendrimer. Dendrimer-PEO-doxorubine conjugate
inhibit the growth of C-26 tumor which was
implanted subcutaneously in mice (Lee et al., 2006).
Anti-cancer drugs 5-Flurouracil was
conjugated with pamam dendrimer to measure its
activity through blood level studies in the mice.
Dendrimer formulation had increase drug loading
capacity and stability with reduction hemolytic
toxicity (Bhadre et.al 2003). In another study by
Asthan in 2005 had confirmed that pamam
dendrimer had increase residence time, good
stability and increase the half life of drug. They
perform in-vivo studies in rat with flurbiprofan
loaded pamam dendrimer conjugates which reveals
that drug release from dendrimer is rapid in initial
and slow release in latter stage (Asthana et al.,
2005). In the same year imaging and targeting of
tumor cells by using pamam dendrimer was carried
out by the choi groups. They formulated pamam
dendrimer conjugated with folic acid as targeted
drug fluorescein isothiocyanate as imaging agent by
oligonucleotides linkage. They conform that
dendrimers can be used as imagine and drug
targeting simultaneously (Choi et al., 2005).
The galactose linked PPI dendrimer was
conjugated with primaquine phosphate and
subjected for in-vivo testing to find out
accumulation in the rat liver. Galactose linked PPI
dendrimer with primaque phosphate showed less
accumulation in the liver which compared the free
drug and uncoated PPI dendrimer. These results had
showed that coating of PPI dendrimer can improve
the effective delivery of drug and reduced toxicity
there by increasing the stability (Bhadra et al.,
2005). Kukowska-Lattalo et al synthesis the
dendrimers conjugated with folic acid and
methotrexate. An in-vivo study in mice was carried
out to conclude that dendrimer conjugated are more
effective then free drug. In confocal microscopic
image showed consider numbers of cells are
targeted by dendrimeric conjugate and this results
where further confirmed by analysis of isolated
tumour cells (Kukowska-Latallo et al., 2005).
Doxorubicin was taken as model drug and
conjugated with 6th generation cationic poly-L-
lysine dendrimers. The dendrimer conjugate had a
increase penetration and delay in growth of prostate
3D multicellular tumor spheroids (MTS) compared
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 928
with free drug (Khuloud et al., 2013). Xiangyang
Shi et al., had synthesis conjugate of pamam
dendrimer with anti cancer drug 2-methoxyestradiol.
The dendrimer conjugated release drug in sustained
manner and specifically targeted the cancer cells in
MTT assay. This study makes dendrimer as one of
the novel carrier for anticancer drug (Yin et al.,
2011).
Umesh Gupta et al., explore potential
delivery activity PPI dendrimer and folated
conjugated PPI dendrimer. Doxorubine was used as
model drug. The folate conjugated PPI shows faster
drug release in acidic environment and high cell
uptake in MCFT cancer cell line compared with PPI
dendrimer. So it had been conclude that folic acid
conjugated PPI dendrimer are better carrier agents
(Gupta et al., 2010). Garcia-vallejo et al., synthesis
pamam dendrimer conjugated with leb. The
characterisation of dendrimer conjugated showed
enhanced binding, optimal internalisation, increase
lysosomal delivery, increase antigen presentation
and cytokine response. It had been conclude that
dendrimer can be used for targeting peptide antigen
cancer immunotherapy, auto immunity and
infectious disease (García-Vallejo et al., 2013).
Pamam dendrimer of generation 5th was
conjugated with N-acetylgalactosamine via peptide
and thiourea linkage. Hepatic cell line studies
showed that dendrimer conjugated had increase
cellular uptake by ASGPR mediated endocytosis.
Moreover increase in concentration of dendrimer
produced more effective cell targeting. The
dendrimer conjugated produced Michaelis menten
kinetics. It had concluded that dendrimer conjugate
are effectively used as targeted carrier for hepatic
targeting (Scott et al., 2011).
Fig. 4: A schematic drawing showing the composition of a drug-loaded G5-NAcGal conjugate binding to the ASGPR expressed
on the surface of hepatic cancer cells (e.g. HepG2), which triggers receptor-mediated endocytosis of these G5-NAcGal
conjugates followed by endosomal escape and release of the therapeutic cargo into the cytoplasm while the ASGPR recycles
back to the cell surface (Scott et al., 2011).
Anupama et al., synthesized 4.0 G PAMAM
dendrimer and conjugated with Gallic acid [GA] for
cancer targeted drug delivery system (Anupama et
al., 2011). The Cytotoxicity study in MCF-7 cell
line showed dendrimer conjugates had showed
increase activity on cells.
Dendrimers in gene delivery: Gene therapy is one
novel approach to cure the chronic disease. In this
therapy the defective gene which is responsible for
the over expression or under expression corrected.
The gene therapy is mainly based on vector used
because it will decide the success of gene therapy.
Dendrimers are ideal vector in the gene delivery.
Dendrimer are more stable, monodispersity,
generation, modification in terminal and size of the
dendrimer are controlled. Above mention properties
made the dendrimer as one the vital carrier for the
gene delivery.
Pamam starburst dendrimers were complexed
with DNA through ethidium bromide. As the
generation of the dendrimers increase the DNA
regions also increase (Kukowska-Latallo et al.,
2000). Kukowska-catallo et al synthesised G9
pamam dendrimer pCF1CAT plasmid complex.
Intravenous administration of dendrimer complex in
rat show high level of expressions in lung tissues. In
another study a cyclodextrin surfaced G5 pamam
dendrimer conjugate were produced by Kihara et al
(Kihara et al., 2003). High level transgene
expression was reported in intravenous
administration in rat. In the same manner Wade et al
developed manner coated pamam dendrimers as new
transgene vector (Wada et al., 2005). In vitro studies
should that mannose coated dendrimer conjugates
showed high transfection dendrimer. Mamede et al.,
used 111In-oligo/G4100 and 111In-oligo/G4-bt-
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 929
Av100 as gene transfer vectors and in vivo
biodistribution evaluation showed more
accumulation in kidney and lung when compare to
liver (Mamede et al., 2004). Furthers authors
summarized that the positively charged
DNA/dendrimer complexes condensed to form
complexes of several nanometres and resulted in
uptake by lung tissues.
A study by Schatzlein et al., showed surface
treatment of PPI dendrimers with methylated
quaternary amines improved the DNA complexation
and decreased cytotoxicity (Schatzlein et al., 2005).
PPI dendrimers of various generation acts as
transfection agents and target gene efficiently
expressed in the liver were studied by Dufes and
groups (Dufes et al., 2005). They demonstrated that
intravenous administration of a gene medicine and
G3 PPI dendrimer complex could result in
intratumoural transgene expression and regression
of the established tumours in all animals.
Arginine peptide dendrimer of 5th and 6
th
generation was developed by Zhongwei group.
Further characterization of dendrimer conjugates
showed high transfection and high biosafety
compared branched polyetherimide (PEI) on all cells
in breast tumor models (Kui et al., 2012). Another
study by Bing and co synthesized β-cyclodextrin
complexed PAMAM dendrimer with human
neuroblastoma SH-SY5Y cells. Dendrimer
conjugates showed low cytotoxicity and high
transgene activity compared with PAMAM (G
4)/pDNA complex (Bing et al., 2013).
A comparative study was carried out by
Ajay and co between PAMAM G4 dendrimers and
the surface modified dendrimers was conducted in
HEK 293T, GM7373 and NCI H157G cell lines in
gene transfer (Ajay et al., 2010). Effect of excess of
ornithine (100µM) on transfection efficiency of the
ornithine-conjugated PAMAMG4 dendrimers was
investigated in separate experiment. Transfection
efficiency of PAMAMG4-ORN60 dendrimer
complex was slightly higher in cancer cells (NCI
H157G) as compared to HEK 293T cells.
Transfection efficiency of the PAMAMG4-ORN60
dendrimers decreased in presence of excess of
ornithine while there was no effect on the parent
PAMAMG4 dendrimers. Jose et al., produced
conjugates of plasmid DNA and PAMAM
dendrimer G5 for gene delivery (Jose et al., 2010).
Further characterization of dendrimer conjugates
showed high efficiency in the gene expression.
Kui et al., synthesis different generations of
dendritic poly(L-lysine) vectors for in vitro gene
transfection (Kui et al., 2011). The higher
generations tended to produce the greater positive
potentials, indicating a stronger potency of the
complexes to interact with negatively charged cell
membranes. Dendrimer conjugates of 5th generation
showed good biocompatibility and higher efficiency
transfection compared with other generation
dendrimer complex.
Based on these results, we concluded that
dendrimers were one of promising gene vectors
which might be able to deliver gene into liver,
spleen, lung, kidney, and even the tumor at
therapeutic levels.
Dendrimers in pulmonary drug delivery: Bai and
groups investigated Enoxaparin PAMAM
dendrimers complex for pulmonary drug delivery
(Bai
et al., 2006). In this research enoxparin-
PAMAM dendrimer complex were formulated and
evaluated for the drug enachment. The dendrimer
formulation was administered into lungs of
anaesthetized rats and drug absorption was observed
by measuring plasma anti-factor Xa activity, and by
observing prevention efficacy of deep vein
thrombosis in a rodent model. Bioavailability of
enoxaparin was increased to 40% in G2 and G3
PAMAM dendrimers which are positively charged.
They reported that positively charged dendrimers
are suitable carrier for pulmonary delivery of
Enoxaparin.
Seabrook and coworkers described the
boosting effect with intranasal dendrimeric Aβ1-15
(16 copies of Aβ1-15 on a lysine tree) but not Aβ1-
15 peptide affording immune response following a
single injection of Aβ1-40/42 in heterozygous APP-
tg mice (Seabrook et al., 2006).
Inapagolla et al., carried study on in-vivo
efficacy of methylprednisolon conjugate G4
PAMAM dendrimers showed good lung anti
inflammation potency (Inapagolla et al., 2010).
Further methylprednisolon-G4-PAMAM dendrimers
conjugate at the dose of 5mg/kg improved the
airway delivery in pulmonary inflammatory model
based on a 11 fold enchament of eosinophil lung
accumulation following five daily inhalation
exposure of sensitized mice to allergen and albumin.
Here allergen induced inflammation reduced by
drug loaded dendrimer conjugate was mainly base
on improved drug residence time in the lung.
Dong et al., carried out invivo pulmonary
absorption on for G0-G3 PAMAM dendrimers
conjugates of insulin and calction. Here absorption
of insulin and calction was increased by PAMAM
dendrimers conjugates. Moreover absorption rate
was increased as generation of PAMAM increases
(Dong et al., 2010).
To target regional lung deposition
dendrimers emerged has very powerful carries in
nano size. Review paper by carvalho et al., and choi
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 930
et al., has explained the important and influence of
particle size, charge, and coating on lung deposition
(Carvalho et al., 2011 and Choi et al., 2010).
Dendrimers did posses characteristic to emerge as
nanocarrier for delivery bioactives through
inhalation route.
CONCLUSION
The application of dendrimers to drug
delivery system has experienced rapid growth.
Dendrimers are expected to play key role in
pharmaceutical field as drug carriers. Dendrimers
role in the biomedical applications is widely
expanded. The supramolecular properties of the
dendrimers made them major agent to delivery
drugs and other function. As per reviewed in this
article dendrimers are widely used in encapsulation
various drugs and to deliver the drug to the targeted
site. More over high level of controllable features of
dendrimers such as size, shape, branching length
and surface modifications make them an ideal drug
carrier. Further dendrimers offer generation number
and terminal groups and the chance to introduce two
or more functional group types at the periphery are
mammoth advantages of dendrimers over polymers.
Few drawbacks like toxicity, localization, bio-
distribution and costly synthesis step pull them
down. In spite of above drawbacks, several
dendrimers have already been commercialized, and
some are in clinical trials. To make dendrimers
commercial successful tool for drug delivery more
research work has to be done on cost effective
synthesis, toxicity reduction and drug conjugation.
As reviewed in this article dendrimer moiety hold
great promise and potential tool for drug delivery
system.
REFERENCE
Ajay K, Venkata KY, Gareth ED, Strychar KB,
Srinath P, Enhanced gene transfection efficiency by
polyamidoamine (PAMAM) dendrimers modified
with ornithine residues, Int J Pharm, 392, 2010,
294–303.
Al-Jamal KT, Ramaswamy C, Florence AT,
Supramolecular structures from dendrons and
dendrimers, Adv Drug Deliv Rev, 57, 2005, 2238–
2270.
Anupama S, Surya PG, Arun KG, Surface modified
dendrimers: Synthesis and characterization for
cancer targeted drug delivery, Bioorganic &
Medicinal Chemistry, 19, 2011, 3341–3346.
Arkas M, Allabashi R, Tsiourvas D, Mattausch EM,
Perfler R, Organic/Inorganic Hybrid Filters Based
on Dendritic and Cyclodextrin ‘‘Nanosponges’’ for
the Removal of Organic Pollutants from Water,
Environ Sci Technol, 40, 2006, 2771– 2777.
Asthana A, Chauhan AS, Diwan PV, Jain NK,
Poly(amidoamine) (pamam) dendritic
nanostructures for controlled site specific delivery of
acidic anti-inflammatory active ingredient, AAPS
Pharm Sci Tech, 6, 2005, E536–E542.
Aulenta F, Hayes W, Rannard S, Dendrimers: A
new class of nanoscopic containers and delivery
devices, Eur Polym J, 39, 2003, 1741–1771.
Bai S, Thomas C, Rawat A, Ahsan F, Recent
progress in dendrimer-based nanocarriers, Crit Rev
Ther Drug Carrier Syst, 23, 2006, 437–495.
Bai S, Thomas C, Rawat A, Ahsan F, Recent
progress in dendrimer-based nanocarriers, Crit Rev
Ther Drug Carrier Syst, 23, 2006, 437–495.
Bayele HK, Ramaswamy C, Wilderspin AF, Srai
KS, Toth I, Florence AT, Protein transduction by
lipidic peptide dendrimers, J Pharm Sci, 95, 2006,
1227–1237.
Betley TA, Hessler JA, Mecke A, Banaszak Holl,
MM, Orr BG, Uppuluri S, Tomalia, DA, Baker JR,
Tapping mode atomic force microscopy
investigation of poly(amidoamine) core–shell
tecto(dendrimers) using carbon nanoprobes,
Langmuir, 18, 2002, 3127–3133.
Bhadra D, Bhadra S, Jain S, Jain NK, A PEGylated
dendritic nanoparticulate carrier of fluorouracil, Int J
Pharm, 257, 2003,111–124.
Bhadra D, Yadav AK, Bhadra S, Jain NK,
Glycodendrimeric nanoparticulate carriers of
primaquine phosphate for liver targeting, Int J
Pharm, 295, 2005, 221-233.
Bhyrappa P, Young JK, Moore JS, Suslick KS,
Dendrimer-metalloporphyrins: Synthesis and
catalysis, J Am Chem Soc, 118, 1996, 5708–5711.
Bing L, Jun JD, Fang Y, Ning Y, Wei L, Jian RY,
Shu Xiang Pu, Long CX, Cong G, Li MZ, Efficient
gene transfection in the neurotypic cells by star-
shaped polymer consisting of β-cyclodextrin core
and poly(amidoamine) dendron arms, Carbohydrate
Polymers, 94, 2013, 185–192.
Boiko N, Zhu X, Bobrovsky A, Shibaev V, First
photosensitive liquid crystalline dendrimer:
synthesis, phase behavior, and photochemical
properties, Chem Mater, 13, 1996, 1447–1452.
Borowska K, Laskowska B, Magon AM, Pyda M,
Wolowiec S, PAMAM dendrimers as solubilizers
and hosts for 8-methoxypsoralene enabling
transdermal diffusion guest, Int J Pharm, 398, 2010,
185–189.
Bruckdorfer T, Marder O, Albericio F, From
production of peptides in milligram amounts for
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 931
research to multi-tons quantities for drugs of the
future, Curr Pharm Biotechnol, 5, 2004, 29–43.
Buhleirier E, Wehner W, Vogtle F, Cascade and
non-skid – chain like” synthesis of molecule cavity
topologies, Synthesis, 2, 1978, 155-158.
Carvalho TC, Peters JI, Ill ROW, Influence of
particle size on regional lung deposition — what
evidence is there?, Int J Pharm, 406, 2011, 1–10.
Chauhan AS, Sridevi S, Chalasani KB, Jain AK,
Jain SK, Jain NK, Diwan PV, Dendrimer-mediated
transdermal delivery: enhanced bioavailability of
indomethacin, J Control Release, 90, 2003, 335–
343.
Chen W, Turro NJ, Tomalia DA, Using ethidium
bromide to probe the interactions between DNA and
dendrimers, Langmuir, 16, 2000, 15-19.
Cheng Y, Man N, Xu T, Fu R, Wang X, Wang X,
Wen L, Transdermal delivery of nonsteroidal anti-
inflammatory drugs mediated by polyamidoamine
(PAMAM) dendrimers, J Pharm Sci, 96, 2007, 595–
602.
Cheng YY, Chen DZ, Fu RQ, He PS, Behavior of
polyamidoamine dendrimers as curing agents in bis-
phenol a epoxy resin systems, Polym Int, 54, 2005,
495–499.
Cheng YY, Xu TW, Fu RQ, Polyamidoamine
dendrimers used as solubility enhancers of
ketoprofen, Eur J Med Chem, 40, 2005, 1390–1393.
Cheng YY, Xu TW, He PS, Polyamidoamine
(PAMAM) dendrimers as curing agents: The
optimum PAMAM concentration selected by
dynamic torsional vibration method and
thermogravimetric analyses, J Appl Polym Sci, 103,
2007, 1430– 1434.
Choi HS, Ashitate Y, Lee JH, Kim SH, Matsui A,
Insin N, Bawendi MG, Semmler-Behnke M,
Frangioni J, Tsuda A, Rapid translocation of
Nanoparticles from lung airspaces to the body, Nat
Biotechnol, 28, 2010, 1300–1304.
Choi Y, Thomas T, Kotlyar A, Islam MT, Baker JR,
Synthesis and functional Evaluation of DNA-
assembled polyamidoamine dendrimer clusters for
cancer cell-specific targeting, Chem Biol, 12, 2005,
35–43.
Colinger M, Biological applications of dendrimers,
Curr Opin Chem Biol, 6, 2002, 742–748.
Credi A, Ribera BF, Venturi M, From
supramolecular electrochemistry to molecular-level
devices, Electrochim Acta, 49, 2004, 3865–3872.
Crespo L, Sanclimens G, Pons M, Giralt E, Royo M,
Albericio F, Peptide and amide bond-containing
dendrimers, Chem Rev, 105, 2005, 1663–1681.
D’Emanuele A, Jevprasesphant R, Penny J, Attwood
D, The use of a dendrimer–propranolol prodrug to
bypass efflux transporters and enhance oral
bioavailability, J Control Release, 95, 2004, 447–
453.
D’Emanuele A, Jevprasesphant R, Penny J, Attwood
D, The use of a dendrimer–propranolol prodrug to
bypass efflux transporters and enhance oral
bioavailability, J Control Release, 95, 2004, 447–
453.
De Jesus OLP, Ihre HR, Gagne L, Frechet JMJ,
Szoka FC, Polyester dendritic systems for drug
delivery applications: In vitro and in vivo
evaluation, Bioconjug Chem, 13, 2002, 453–461.
DeBrabander-VandenBerg EMM, Meijer EW,
Poly(propyleneimine) Dendrimers: Large scale
synthesis by hetereogeneously catalyzed
hydrogenations. Angew Chem Int Ed Engl, 32,
1993, 1308–1311.
Denkewalter RG, Kolc J, Lukasavage WJ,
Macromolecular highly branched homogeneous
compound based on lysine units, Untied states
patent, US Patent 4289872, 1981.
Diallo MS, Christie S, Swaminathan P, Johnson JH,
Goddard WA, Dendrimer enhanced ultrafiltration.
Recovery of Cu(II) from aqueous solutions using
PAMAM dendrimers with ethylene diamine core
and terminal NH2 groups, Environ Sci Technol, 39,
2005, 1366–1377.
Dong Z, Katsumi H, Sakane T, Yamamoto A,
Effects of polyamidoamine (PAMAM) dendrimers
on the nasal absorption of poorly absorbable drugs
in rats, Int J Pharm, 30, 2010, 244–252.
Dufes C, Keith WN, Bilsland A, Proutski I,
Uchegbu IF, Schatzlein AG, Synthetic anticancer
gene medicine exploits intrinsic antitumor activity
of cationic vector to cure established tumors, Cancer
Res, 65, 2005, 8079–8084.
Dufes C, Uchegbu IF, Schatzlein AG, Dendrimers in
gene delivery, Adv Drug Deliv Rev, 57, 2005,
2177–2202.
Duncan R, Izzo L, Dendrimer biocompatibility and
toxicity, Adv Drug Deliv Rev, 57, 2005, 2215–2237.
Dvornic PR, De-Leuze-Jallouli AM, Owen MJ, Perz
SV, Radially layered poly(amidoamine-
organosilicon) dendrimers, Macromolecules, 33,
2000, 53–66.
Elemans JAAW, Boerakker MJ, Holder SJ, Rowan
AE, Cho W-D, Percec V, Nolte RJM,
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 932
Supramolecular chemistry and self-assembly special
feature: Plastic- and liquid-crystalline architectures
from dendritic receptor molecules, PNAS, 99, 2002,
5093–5098.
Florence AT, Preface — Dendrimers: A versatile
targeting platform, Adv Drug Deliv Rev, 57, 2005,
2104–2105.
Fujita M, Oguro D, Miyazawa M, Oka H,
Yamaguchi K, Ogura K, Self-assembly of ten
molecules into nanometre-sized organic host
frameworks, Nature, 378, 1995, 469–471.
García-Vallejo JJ, Ambrosini A, Overbeek A, van
Riel H, Bloem K, Unger WWJ, Chiodo F, Bolscher
JG, Nazmi K, Kalay H, van Kooyk Y, Multivalent
glycopeptide dendrimers for the targeted delivery of
antigens to dendritic cells, Mol Immunol, 53, 2013,
387-397.
Gupta U, Agashe HB, Asthana A, Jain NK,
Dendrimers: Novel Polymeric Nanoarchitecture for
Solubility Enhancement, Bio macromolecules, 7,
2006, 649-658.
Gupta U, Dwivedi SK, Bid HK, Konwar R, Jain
NK, Ligand anchored dendrimers based
nanoconstructs for effective targeting to cancer
cells, Int J Pharm, 393, 2010, 185–196.
Hawker CJ, Fréchet JMJ, Preparation of polymers
with controlled molecular architecture. A new
convergent approach to dendritic macromolecules, J
Am Chem Soc, 112, 1990, 7638–7647.
Heldt JM, Durand NF, Salmain M, Vessieres A,
Jaouen G, Prepration and charactyerization of
poly(amidoamine) dendrimers functionalized with a
rhenium carbonyl complex and PEG as new IR
probes for carbonyl metallo immunoassay, J
Organometallic chem, 689, 2004, 4775-4782.
Ihre H, Hult A, Fréchet JMJ, Gitsov I, Double-stage
convergent approach for the synthesis of
functionalized dendritic aliphatic polyesters based
on 2,2-bis(hydroxymethyl)propionic acid,
Macromolecules, 31, 1998, 4061–4068.
Inapagolla R, Guru BR, Kurtoglu YE, Gao X, Lieh-
Lai M, Bassett DJP, Kannan RM, In vivo efficacy of
dendrimer-methylprednisolone conjugate formation
for the treatment of lung inflammation, Int J Pharm,
339, 2010, 140–147.
Jain NK, Khopade AJ, Dendrimers as potential
delivery systems for bioactives. in: Jain, N.K. (Ed.),
Advances in controlled and novel drug delivery.
New Delhi: CBS Publishers & Distributors; 2001, p.
361–380.
Jose LS, Hugo O, Deepti P, Joao R, Ana PP, Pedro
LG, Helena T, Functionalization of
poly(amidoamine) dendrimers with hydrophobic
chains for improved gene delivery in mesenchymal
stem cells, J Control Release, 144, 2010, 55–64.
Karthaus O, Ijoro K, Shimomura M, Hellmann J,
Irie M, Monomolecular layers of diarylethene-
containing dendrimers, Langmuir, 12, 1996, 6714–
6716.
Kawaguchi T, Walker KL, Wilkins CL, Moore JS,
Double exponential dendrimer growth, J Am Chem
Soc, 117, 1995, 2159–2165.
Khuloud TA, Wafa TA, Julie TW, Wang, Noelia R,
Joanna B, David G, Mire Z, Kostas K, Cationic
poly-L-lysine dendrimer complexes doxorubicin and
delays tumor growth in vitro and in vivo, ACS
Nano, 7, 2013, 1905-1917.
Kihara F, Arima H, Tsutsumi T, Hirayama F,
Uekama K, In vitro and in vivo gene transfer by an
optimized α-cyclodextrin conjugate with
polyamidoamine dendrimer, Bioconjug Chem, 14,
2003, 342–350.
Kim J, Choi J, Nam K, Lee M, Park J, Lee J,
Enhanced transfection of primary cortical cultures
using arginine-grafted PAMAM dendrimer,
PAMAM-Arg, J Control Release, 114, 2006, 110–
117.
Kolhatkar RB, Swaan P, Ghandehari H, Potential
oral delivery of 7-ethyl-10- hydroxy-camptothecin
(SN-38) using poly(amidoamine) dendrimers,
Pharm Res, 25, 2008, 1723–1729.
Kui L, Caixia L, Gang W, Yu N, Bin H, Yao W,
Zhongwei G, Peptide dendrimers as efficient and
biocompatible gene delivery vectors: Synthesis and
in vitro characterization, J Control Release, 155,
2011,77–87.
Kui L, Caixia L, Li L, Wenchuan S, Gang W,
Zhongwei G, Arginine functionalized peptide
dendrimers as potential gene delivery vehicles,
Biomaterials, 33, 2012, 4917-4927.
Kukowska-Latallo JF, Candido KA, Cao Z,
Nigavekar SS, Majoros IJ, Thomas TP, Balogh LP,
Khan MK, Baker JR, Nanoparticle targeting of
anticancer drug improves therapeutic response in
animal model of human epithelial cancer, Cancer
Res, 65, 2005, 5318–5324.
Kukowska-Latallo JF, Raczka E, Quintana A, Chen
C, Rymaszewski M, Baker JR, Intravascular and
endobronchial DNA delivery to murine lung tissue
using a novel, nonviral vector, Hum Gene Ther, 11,
2000, 1385–1395.
Labbe G, Forier B, Dehaen W, A fast double-stage
convergent synthesis of dendritic polyethers, Chem
Commun, 18, 1996, 2143–2144.
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 933
Lee CC, MacKay JA, Fréchet JMJ, Szoka FC,
Designing dendrimers for biological applications,
Nat Biotechnol, 23, 2005, 1517-1526.
Lee CC, Gillies ER, Fox ME, Guillaudeu
SJ, Fréchet JM, Dy EE, Szoka FC, A single dose of
doxorubicin-functionalized bow-tie dendrimer cures
mice bearing C-26 colon carcinomas, Proc Natl
Acad Sci, 103, 2006, 16649-16654.
Lee JJ, Ford WT, Reactivity of organic anions
promoted by a quaternary ammonium ion
dendrimer, Macromolecules, 27, 1994, 4632–4634.
Lin Y, Fujimari T, Kawaguchi N, Tsujimoto Y,
Nishimi M, Dong Z, Katsumi H, Sakane T,
Yamamoto A, Polyamidoamine dendrimers as novel
potential absorption enhancers for improving the
small intestinal absorption of poorly absorbable
drugs in rats, J Control Release, 149, 2011, 21–28.
Lorenz K, Holter D, Stuhn B, Mulhaupt R, Frey H,
Amesogen-functionized carbosilane dendrimer: A
dendritic liquid crystalline polymer, Adv Mater, 8,
1996, 414–416.
Love CS, Ashworth I, Brennan C, Chechik V, Smith
DK, Dendron-protected Au nanoparticles — Effect
of dendritic structure on chemical stability, J Colloid
Interface Sci, 302, 2006, 178–186.
Mak CC, Cow HF, Dendritic catalysts: Reactivity
and mechanism of the dendritic bis(oxazoline) metal
co1228–1230mplex catalyzed Diels- Alder reaction,
Macromolecules, 30, 1997, 1228–1230.
Malik N, Wiwattanapatapee R, Klopsch R, Lorenz
K, Frey H, Weener JW, Meijer EW, Paulus W,
Duncan R, Dendrimers: relationship between
structure and biocompatibility in vitro, and
preliminary studies on the biodistribution of 125I-
labelled polyamidoamine dendrimers in vivo, J
Control Release, 65, 2000, 133–148.
Mamede M, Saga T, Ishimori T, Higashi T, Sato N,
Kobayashi H, Brechbiel MW, Konishi J, Hepatocyte
targeting of 111In-labeled oligo-DNA with avidin or
avidin-dendrimer complex, J Control Release, 95,
2004, 133-141.
Moghimi HR, Varshochian R, Kobarfard F, Erfan
M, Reduction of percutaneous absorption of toxic
chemicals by dendrimers, Cutan Ocul Toxicol, 29,
2010, 34–40.
Momotake A, Arai T, Photochemistry and
photophysics of stilbene dendrimers and related
compounds, J Photochem Photobiol C Photochem
Rev, 5, 2004, 1–25.
Na M, Yiyun C, Tongwen X, Yang D, Xiaomin W,
Zhenwei L, et al., Dendrimers as potential drug
carriers, Part II: Prolonged delivery of ketoprofen
by in vitro and in vivo studies, Eur J Med Chem, 41,
2006, 670–674.
Najlah M, Freeman S, Attwood D, D’Emanuele A,
In vitro evaluation of dendrimer prodrug for oral
drug delivery, Int J Pharm, 336, 2007, 183–190.
Newkome GR, Yao Z, Baker GR, Gupta VK.
Micelles, Part 1. Cascade molecules: A new
approach to micelles. A [27]-arborol, J Org Chem,
50, 1985, 2003–2004.
Pathan IB, Setty CM, Chemical penetration
enhancers for transdermal drug delivery systems,
Trop J Pharm Res, 8, 2009, 173–179.
Patri AK, kukowska lotallo JF, Baker JR, Targeted
drug delivery with dendrimers comparison of the
release kinetics of covalently conjugated drug and
non covalent drug inclusion complex, Adv Drug Del
Rev, 57, 2005, 2203-2214.
Patri AK, Majoros IJ, Baker J, Dendritic polymer
macromolecular carriers for drug delivery, Curr
Opin Chem Biol, 6, 2002, 466–471.
Ritzén A, Frejd T, Synthesis of a chiral dendrimer
based on polyfunctional amino acids, Chem
Commun, 2, 1999, 207–208.
Santander-Ortega MJ, Stauner T, Loretz B, Ortega-
Vinuesa JL, Bastos-Gonzalez D, Wenz G, Schaefer
UF, Lehr CM, Nanoparticles made from novel
starch derivatives for transdermal drug delivery, J
Control Release, 141, 2010, 85–92.
Sayed-Sweet Y, Hedstrand DM, Spinder R, Tomalia
DA, Hydrophobically modified poly(amidoamine)
(PAMAM) dendrimers: Their properties at the air–
water interface and use as nanoscopic container
molecules, J Mater Chem, 7, 1997, 1199–1205.
Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C,
Chim YT, Roberts CJ, Davies MC, Munro A, Gray
AI, Uchegbu IF, Preferential liver gene expression
with polypropylenimine dendrimers, J Control
Release, 101, 2005, 247-258.
Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C,
Chim YT, Roberts CJ, Davies MC, Munro A, Gray
AI, Uchegbu IF, Preferential liver gene expression
with polypropylenimine dendrimers, J Control
Release, 101, 2005, 247-258.
Scott HM, Venkatesh T, Maxim VC, Donna SS,
William DE, Mohamed EH El-Sayed, N-
acetylgalactosamine-functionalized dendrimers as
hepatic cancer cell-targeted carriers, Biomaterials,
32, 2011, 4118-4129.
Seabrook TJ, Jiang L, Thomas K, Lemere CA,
Boosting with intranasal dendrimeric Aβ1–15 but
not Aβ1–15 peptide leads to an effective immune
response following a single injection of Aβ1–40/42
Dinesh et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(6) www.ijrpb.com November – December 2013 Page 934
in APP-tg mice, J Neuroinflammation, 3, 2006, 1–
10.
Shembale AI, Borole DK, Lohiya RT, Useful
permeation enhancers for transdermal drug delivery:
A review, Int J Pharm Res Dev, 2, 2012, 1–6.
Sun M, Fan A, Wang Z, Zhao Y, Dendrimer-
mediated drug delivery to the skin, Soft Matter, 8,
2012, 4301–4305.
Svenson S, Tomalia DA, Dendrimers in biomedical
applications reflection on the field, Adv Drug Deli
Rev, 57, 2005, 2106 -2129.
Tomalia DA, Birth of a new macromolecular
architecture:dendrimers as quantized building blocks
for nanoscale synthetic polymer chemistry, Prog
Polym Sci, 30, 2005, 294–324.
Tomalia DA, Naylor AM, Goddard III WA,
Starburst Dendrimers: Molecular-level control of
size, shape, surface chemistry, topology and
flexibility from atoms to macroscopic matter,
Angew Chem Int Ed Engl, 29, 1990, 138-175.
Tomalia DA, Reyna LA, Svenson S, Dendrimers as
multi-purpose nanodevices for oncology drug
delivery and diagnostic imaging, Biochem Soc
Trans, 35, 2007, 61–67.
Turnbull WB, Stoddart JF, Design and synthesis of
glycodendrimers, Rev Mol Biotechnol, 90, 2002,
231–255.
Venuganti VVK, Perumal OP, Poly(amidoamine)
dendrimers as skin penetration enhancers: influence
of charge, generation and concentration, J Pharm
Sci, 98, 2009, 2345–2356.
Vladimir VT, Dendritic macromolecules at
interfaces, Adv Mater, 10, 1998, 253–257.
Wada K, Arima H, Tsutsumi T, Hirayama F,
Uekama K, Enhancing effects of galactosylated
dendrimer-β-cyclodextrin conjugates on gene
transfer efficiency, Biol Pharm Bull, 28, 2005, 500–
505.
Wiener EC, Brechbiel MW, Brothers H, Magin RL,
Gansow OA, Tomalia DA, Lauterbur PC,
Dendrimer based metal chelates: A new class of
magnetic resonance imaging contrast agents, Magn
Reson Med, 31, 1994, 1-8.
Wu H, Liu Z, Wang X, Zhao B, Zhang J, Li C,
Preparation of hollow capsule-stabilized gold
Nanoparticles through the encapsulation of the
dendrimer, J Colloid Interface Sci, 302, 2006, 142–
148.
Wu L, Li BL, Haung YY, Zhou HF, He YM, Fan
QH, Phosphine dendrimer stabilized palladium
Nanoparticles, a highly active and recyclable
catalyst for the Suzuki miyaura reaction and
hydrogenation, Org Lett, 3(8), 2006, 3605-3608.
Xu Y, Zhao D, Removal of copper from
contaminated soil by use of poly(amidoamine)
dendrimers, Environ Sci Technol, 39, 2005, 2369–
2375.
Yan S, Zhou Z, Zhang F, Yang S, Yang L, Yu X,
Effect of anionic PAMAM with amido groups
starburst dendrimers on the crystallization of
Ca10(PO4)6(OH)2 by hydrothermal method, Mater
Chem Phys, 99, 2006, 164–169.
Yang Y, Sunoqrot S, Stowell C, Ji J, Lee CW, Kim
JW, Khan SA, Hong S, Effect of size, surface
charge and hydrophobicity of poly(amidoamine)
dendrimers on their skin penetration,
Biomacromelecules, 13, 2012, 2154–2162.
Yin W, Rui G, Xueyan C, Mingwu S, Xiangyang S,
Encapsulation of 2-methoxyestradiol within
multifunctional poly(amidoamine) dendrimers for
targeted cancer therapy, Biomaterials, 32, 2011,
3322-3329.
Zeng F, Zimmerman SC, Rapid synthesis of
dendrimers by an orthogonal coupling strategy, J
Am Chem Soc, 118, 1996, 5326–5327.
Zhuo RX, Du B, Lu ZR, In vitro release of 5-
fluorouracil with cyclic core dendritic polymer, J
Control Release, 57, 1999, 249-257.