Upload
debjit-bhowmik
View
3.994
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Indian Journal of Research in Pharmacy and Biotechnology (IJRPB) is a peer review journal available in online and in printed formats. This journal publishes original research work that contributes significantly to advance the scientific knowledge in various aspects of pharmacy and biotechnology. We are pleased to introduce ourselves as the novel, imminent and sovereign pharmacy information service in India. The foundation aims to support every effort to empower pharmacy education and research, and more importantly young research scholars in pharmacy and biotechnology.
Citation preview
IJRPB 1(5) www.ijrpb.com September – October 2013
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Editor B.Pragati Kumar, M.Pharm, Assistant Professor,
Nimra College of Pharmacy
Consulting editor
Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy
Associate Editors
Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy
Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy
Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy
Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy
Editorial Advisory Board
Dr.Y.Narasimaha Reddy, M. Pharm., Ph D.
Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal.
Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy),
Kerala
Dr.V.Gopal, M. Pharm., Ph D.
Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6
Dr. M.Umadevi, M.Sc. (Agri), Phd Research Associate, Tamil Nadu Agricultural
University, Coimbatore
Dr. J.Balasubramanium, M. Pharm., Ph D. General Manager, FR&D
R A Chem Pharma Ltd., Hyderabad
Dr. V.Prabhakar Reddy, M. Pharm., Ph D.
Principal, Chaitanya College of Pharmacy Education & Research, Warangal
Dr.P.Ram Reddy, M. Pharm., Ph D.
General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad
Dr. S.D.Rajendran, M. Pharm., Ph D.
Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad
IJRPB 1(5) www.ijrpb.com September – October 2013
INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY
Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication
provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the
review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t
copy and paste the article content from internet or other sources like e-books etc. Authors are the sole
responsible persons for the article, article content; results of the research conducted and copy right issues
if any. The editor and the editorial board are not entitled to change the article content, results and
diagrammatic representations which are given by authors. The article will be published only after getting
the approved galley proof from the authors.
Kindly follow the below guidelines for preparing the manuscript:
1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any
decorative borders anywhere in the text including the title page.
2. Don’t leave any space between the paragraphs.
3. Divide the research article into
a. Abstract
b. Introduction
c. Materials and Methods
d. Results
e. Discussion
f. conclusion
g. References
4. References should include the following in the same order given below
a) Author name followed by initials
b) Title of the book/ if the reference is an article then title of the article
c) Edition of the book/ if the reference is an article then Journal name
d) Volume followed by issue of the journal
e) Year of publication followed by page numbers
5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it
after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post
or scanned attachment to [email protected].
6. Keep in touch with the editor through mail or through phone for further clarifications as well as
for timely publication of your article.
Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna
District, Andhra Pradesh, India-521456 Printed at:
F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456
Visit us at www.ijrpb.com
Contact us/ send your articles to: Email: [email protected]
Phone no: 9490717845; 9704660406
ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)
Indian Journal of Research in Pharmacy and Biotechnology
Information regarding Indexing/ abstracting of our journal IJRPB The following is the list of organizations confirmed Indexing/ abstracting of our journal IJRPB
Index Copernicus Value (ICV) is 5.43 given by Index Copernicus
International, Poland
CHUNG YUAN CHRISTIAN UNIVERSITY, CHINA
ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)
Indian Journal of Research in Pharmacy and Biotechnology
Electronic Journals Library
SCIENCE NET, CHINA
PUBHUB, USA Advanced Science Index Saarbrücken, Germany
OCLC, Worldcat Knowledge Base, Canada
NEWJOUR, USA
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Volume 1 Issue 5 www.ijrpb.com September – October 2013
S.No. Contents Page No.
1 Evaluation of the association of rs8052394 of metalothionein-1a gene with type 2 diabetes mellitus in
Nepalese population
Surya Prasad Sharma, Bishal Khatiwada, Binita Dhakal, Uddhav Timilsina
570-575
2 a novel RP- HPLC method development and validation of atorvastatin and fenofibrate in bulk and
pharmaceutical dosage forms
Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna
576-582
3 Analytical method development and validation for the simultaneous estimation of Lamivudine,
Zidovudine and Efavirenz by RP-HPLC in bulk and pharmaceutical dosage forms
Sindhura D, Nanda Kishore Agarwal
583-588
4 Novel RP-HPLC method development and validation of Losartan potassium and Amlodipine drugs in
pure and pharmaceutical dosage forms
Kumari Jyothsna, Chandana N, Vinjam Swathi
589-596
5 Formulation and In-Vitro evaluation of Ornidazole gastroretentive tablets by using low density swellable
polymers
Abeda Aqther, B. Pragati kumar, Peer Basha
597-601
6 Formulation and evaluation of Fenofibrate tablets prepared by employing bioavailability enhancement
technique
Siva kothapally, Pragati Kumar Bada, Harish G
602-608
7 Formulation and e valuation of famotidine fast dissolving tablets by direct compression method
B.Venkateswarlu, B.Pragati Kumar, Debjit Bowmik 609-613
8 Formulation and evaluation of matrix floating tablets of Ofloxacin and Tinidazole combination
Syed Peer Basha, Pragati Kumar B, Duraivel S, Abeda Aqther 614-620
9 Formulation and In-Vitro evaluation of Terbutaline sulphate sustained release tablets
Rajeswari Kola, Deepa Ramani N, Pragati Kumar B 621-624
10 Evaluation of antidiabetic activity of Methanolic extract of flowers of Cassia siamea in Alloxan induced
diabetic rats of basal diet and maida mixed diet
Pushpavathi P, Janarthan M, Firasat Ali
625-628
11 Formulation and evaluation of transdermal patches of anti-hypertensive drug metoprolol succinate
Koteswararao P, Duraivel S, Sampath Kumar KP, Debjit Bhowmik 629-634
12 Neuropharmacological screening of ethanolic extract of Nelumbo nucifera gaertner seeds
Sirisha Chowdary G 635-642
13 A review on use of genetically engineered microorganisms for bioremediation of environmental
pollutants and heavy metals
Mariz Sintaha
643-648
14 Hepatoprotective effect of hydroalcoholic extract of Ocimum gratissimum leaves on Rifampicin-Isoniazid
induced rats
Sreenu Thalla,Venkata Ramana K, Delhiraj N
649-654
15 Analytical method development and validation of Amitriptyline hydrochloride and Chlordiazepoxide in
tablet by RP-HPLC
Neeli Sujatha, K Haritha Pavani
655-659
16 Evaluation of hepatoprotective activity of Sapindus emarginatus vahl pericarp extract against anti
tubercular drugs induced liver damage in rats
Shoba Rani J, Janarthan M, Firasat Ali
660-663
17 Evaluation of anti-diabetic and hepato protective activity of 95% methanolic extract of Terminalia
tomentosa bark by using albino rats
Srilakshmi P, Janarthan M, Zuber Ali M
664-667
18 Formulation of mouth dissolving tablets of Naproxen
Rajesh Reddy K, Nagamahesh Nandru, Desam Asha Latha, Srinivasa Rao Chekuri 668-671
19 Preparation of immediate release Atorvastatin and sustained release matrix tablets of Gliclazide using
retardant hydroxypropyl methyl cellulose
Vinod Raghuvanshi, Jayakar B, Debjit Bhowmik, Harish G, Dureivel S
672-675
20 Phytochemical sreening and antidiabetic antioxidant effect of Ecbolium ligustrinum flowers extracts
Ranjitsingh B Rathor, Rama Rao D, Prasad Rao 676-678
21 Development and validation of assay method for meloxicam tablets by RP-HPLC
K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy
679-681
22 RP-HPLC development and validation of assay and uniformity of dosage units by content uniformity
for in house lamivudine and abacavir combined tablet
K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy
682-685
23 Validation of a simple and rapid HPLC method for the determination of Metronidazole and Norfloxacin
in combined dosage form
SK Asma Parveen, Chandana Nalla
686-691
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Volume 1 Issue 5 www.ijrpb.com September – October 2013
24 Analytical method development and validation for the estimation of olmesartan medoxomil by RP-UPLC
in bulk and pharmaceutical dosage forms
Farhana pattan, K.Haritha Pavani, A.Kiran Kumar, N.Sunny Babu, K.V.Kalyan Kumar, Chandana N
692-696
25 Formulation development and evaluation of Gliclazide gel using water soluble Sodium carboxy methyl
cellulose polymer
Vaibhav Kumar Mishra, Shashi Shekhar Tripathi
697-700
26 Analytical method development and validation of Gemifloxacin and Ambroxol in solid dosage form by
reverse phase high performance liquid chromatography
Md Haseena Begum, Nanda Kishore Agarwal and Duraivel S
701-706
27 Evaluation of the anti hyperglycemic activity of methanolic extract of root of heliotropium indicum in
streptozotocin and alloxan induced diebetic rats
Aqheel MA , Janardhan M, Durrai vel S
707-710
28 Novel RP-HPLC method development and validation of Metformin and Pioglitazone drugs in pure and
pharmaceutical dosage forms
Alekhya Pallapolu, Aneesha A
711-716
29 Carbon nano tube: a review
K.Shailaja, Tahseen Sameena, S.P.Sethy, Prathima Patil, Md. Owais Ashraf 717-719
30 Stability indicating RP-HPLC method for the simultaneous determination of Candesartan cilexetil and
hydrochlorothiazide in bulk and dosage forms
Veeranjaneyulu D, Aneesha A, Nandakishore Agarwal
720-724
31 A review on enhancement of solubility and disolution rate of bcs class-ii drug by solid dispersion and
nonaqeous granulation technique
Chakravarthi V, Duraivel S
725-728
32 Evaluation of anti-infl ammatory activity of Canthium parviflorum by In-Vitro method
Kandikattu Karthik, Bharath Rathna Kumar P, Venu Priya R, Sunil Kumar K , Ranjith Singh.B.Rathore 729-731
33 Evaluation of nephro protectiveactivity of methanolic extract of seeds of Vitis vinifera against Rifampicin
and Carbontetra chloride induced nephro toxicity in wistar rats
Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Durraivel S
732-735
34 Analytical method development and validation of estimation method for Sotalol hydrochloride tablets
by using RP-HPLC
G Abirami, K Anand Kumar, T.Veterichelvan, Arunateja Muvva
736-740
35 A study on role of demographic factors in small investors’ savings in stock market
Durga Rao P V, Chalam G V and Murty T N 741-743
36 Morbidity pattern among the elderly population in a south Indian tertiary care institution: analysis of a
retrospective study
Narayan V, Chandrashekar R
744-747
37 Testicular gene expression profiling of Phenytoin treated albino rats using cdna microarray
Rajkumar R, Vathsala Venkatesan, Sriram Thanigai 748-753
38 Formulation and in-vitro evaluation of Lornoxicam immediate release and Diclofenac sodium sustained
release bilayered tablets
B. Manikanta Anil, K. Narendra Kumar reddy
754-757
39 Formulation and evaluation of cefpodoxime proxetil sustained release matrix tablets
Divya Palparthi, K. Narendra Kumar Reddy
758-760
40 Formulation and development of sustained release matrix tablet using natural polymers
L. P. Hingmire, D. M. Sakarkar 761-764
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 570
EVALUATION OF THE ASSOCIATION OF rs8052394 OF METALOTHIONEIN-1A
GENE WITH TYPE 2 DIABETES MELLITUS IN NEPALESE POPULATION
Surya Prasad Sharma1,2*
,Bishal Khatiwada1,2
, Binita Dhakal1,2
, Uddhav Timilsina1
1. Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal
2. Department of Biotechnology, Sikkim Manip al University, Gangtok, Sikkim
*Corresponding author: [email protected]
ABSTRACT
Polymorphisms in metallothionein-1A gene associated with the risk of type 2 diabetes mellitus and its
complications. Metallothioneine (MT) as a potent antioxidant can affect energy metabolism. The present study
was undertaken to investigate the association between MT gene polymorphism and type 2 diabetes mellitus.
Polymorphism in rs8052394 of Metallothioneine 1A gene at lys51Arg is the most prevalent mutation in T2DM.
Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) has been found to be a
reliable and effective tool to identify the specific gene alteration that is responsible for the development of T2DM
and its complication. The aim of study was to identify the mutation in specific part of rs8052394 of MT1A gene
(lys51Arg substitution) in diabetic population by PCR-RFLP technique. All together 62 diabetic samples were
collected and DNA extraction was performed according to protocol of D.K. Lahari et al. Amplification of
fragment with MT1A gene at 51th position of amino acid performed in a XP Thermocycler using primers
Forward: 5’-ACTAAGTGTCCTCTGGGGCTG 3’ and Reverse: 5’-AATGGGTCACGGTTGTATGG 3’ of
MT1A gene cleaved by pstI enzyme. The restriction fragments obtained were electrophoreses in a 2% agarose gel
and were visualized using transilluminator. Mutation of MT1A gene was present in 40.32% of 62 patients, out of
which 19.35%was of ≤50 yrs of age group. On comparing the mean age of two category of genotype (AA and
AG/GG, correlation is statistically significant with p=0.044 (CI=95%).This is the first time that the mutation
positions in MT1A gene Lys51Arg substitution have been studied in Nepalese population with Type II diabetic.
Since Nepal is geographically located between two countries (India and China) with around 30% of world’s total
diabetic cases, researches in this subject seems to be of a rationale work.
Keywords: Diabetes Mellitus type II, SNP, rs8052394, Metallothioneine 1A, PCR-RFLP
INTRODUCTION
Diabetes mellitus is a metabolic disorder in which
person is characterized by the high blood sugar either
because the body does not produce enough insulin, or
because cells do not use the insulin that is produced
(World Health Organisatio, 1999). The classical
symptoms of diabetes are polyuria (frequent urination),
polydipsia (increased thirst) and polyphagia (increased
hunger) (Cooke, 2008). Almost one in 10 of the world
population already has this condition, or can be expected
to develop it during their lifetime, with prevalence rates
forecast to double within the next 15 years (Florence,
2003). According to WHO (2000A.D.), at least 171
million people worldwide suffer from diabetes, or 2.8% of
the population (Wild, 2004).
Metallothionein 1A (MT1A), mRNA: Metallothionein
(MT) is a sulfhydryl- and cysteine-rich protein found in
microorganisms, plants and all invertebrate and vertebrate
animals. Metallothioneins are a group of ubiquitous low-
molecular-weight proteins that have functional roles in
cell growth, repair and differentiation. These are those
family of proteins with low molecular mass and high
affinity to certain metal ions (Cai, 2007). They are
implicated primarily in metal ion detoxification, in that
they are essential for the protection of cells against the
toxicity of cadmium, mercury and copper (Higashimoto,
2009). In general the MT is known to modulate three
fundamental processes:
1) The release of gaseous mediators such as hydroxyl
radical or nitric oxide;
2) Apoptosis, and
3) The binding and exchange of heavy metals such as
zinc, cadmium or copper.
Metallothionein and Its Relationship with Diabetes:
Metallothioneins (MTs) are a group of intracellular metal-
binding and cysteine-enriched proteins and are highly
inducible in many tissues in response to various types of
stress. Although it mainly acts as a regulator of metal
homeostasis such as zinc and copper in tissues, MT also
acts as a potent antioxidant and adaptive (or stress) protein
to protect cells and tissues from oxidative stress. Diabetes
affects many Americans and other populations, and its
development and toxic effect on various organs have been
attributed to increased oxidative stress. Studies showed
that zinc-induced or genetically enhanced pancreatic MT
synthesis prevented diabetes induced by chemicals such as
streptozotocin and alloxan, and zinc pretreatment also
prevented spontaneously developed diabetes. Since
diabetic complications are the consequences of organ
damage caused by diabetic hyperglycemia and
hyperlipidemia through oxidative stress, whether MT in
nonpancreatic organs also provides a preventive effect on
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 571
diabetic toxicity has been recently investigated. It has
been demonstrated that overexpression of cardiac MT
significantly prevented diabetes-induced cardiomyopathy.
Likewise, over expression of renal MT also prevented
diabetes-induced renal toxicity. In addition, it was found
that MT as an adaptive protein is over expressed in several
organs in response to diabetes. Therefore, the biological
importance of diabetes-induced MT in diabetic
complications and subsequent other pathogenesis was
further explored. This polymorphism is the result of a
nucleotide change A to G at position 55231329 of
chromosome 16. Similarly 225 number position of mRNA
sequence, and it results in the substitution of Lysine (k) by
Arginine (r) at 51 position of the MET1A protein. In the
wild type, codon AAA codes for Lysine but in mutated
type, codon AAA changes to AGA hence it codes for
different amino acid Arginine.
After analysis by MUpro we found that protein
structure stability was decrease due to this polymorphism.
Among the seven identified SNPs: rs8052394,
rs11076161, rs8052334, rs964372, rs7191779, rs708274
and rs10636. Significant associations of MT1A rs8052394
(G alteration) with T2DM and decreased serum SOD
activity were established. The other six SNPs were not
significantly associated with T2DM. However, SNPs
rs964372 and rs10636 were found to be significantly
associated with increased serum triglyceride and
neuropathy among T2DM individuals. It is a restriction
enzyme isolated from an E. coli strain that carries the PstI
gene from Providencia stuartii 164 (ATCC 49762).
According to Nepal Diabetic Association, the number of
people suffering from diabetes above 40 years in urban
areas has climbed up to 19% of special note is that there
will be a 67% increase in prevalence of diabetes in
developing countries from 2010-2030 (Shaw, 2010).
According to UN, 246 million people in the world
are suffering from diabetes and approximately half of that
fall in Nepal, India, China and other Asian countries.
Increase in the incidence of diabetes mellitus is the 4th
leading cause of death in world. Each year 3.8 million
people die from diabetes and its related complication like
cardiomyopathy, stroke, nephropathy, neuropathy, eye
disease etc and the gene metallothionein 1A may be
responsible for such complications. It has also been found
that polymorphism in metallothionein 1A gene may be
responsible for even inducing diabetes not only its
complications. Polymorphism in single nucleotide in
metallothionein 1A leads for to decrease in level of SOD
which may be due to the death of pancreatic β cells
(Grarup, 2007). Metallothionein (MT) isoforms I and II
are polypeptides with potent antioxidative and anti-
inflammatory properties (Lina, 2008) and once occur
polymorphism; it causes in the alteration in the normal
function of the protein and causes different complications
like aging, neuropathy, retinopathy, stroke etc. Since
diabetes and its complications are the 4th leading cause of
death, it needs to be diagnosed soon. The most rapid
results could be achieved by using molecular methods
including real-time PCR, single-strand-conformation
polymorphism analysis (SSCP) (Lina, 2008) multiplex-
allele-specific PCR (MAS- PCR), mass
spectrophotometry, Allele-Specific Hybridization etc. But
the PCR-RFLP approach has several advantages of being
cheap, robust and simple to both perform and interpret,
basically requiring PCR and electrophoresis set up. Genes
significantly associated with developing type 2 diabetes,
include TCF7L2, PPARG, FTO, KCNJ11, NOTCH2,
WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and
HHEX (Lina, 2008; Shoelson, 2006). Within all these
family, Metallothionine and its different isoforms have a
relationship with T2DM and other disease like
neuropathy, hyperlipidemia etc. Among different MT, the
isoform MT 1A with SNP rs8052394 is found to have a
significant relationship with T2DM (Lina, 2008). The
magnitude and trends in diabetes and the polymorphism in
MT1A gene at rs8052394 are epidemiologically important
to monitor, the estimation of the burden of disease is
programmatically relevant in shaping policies for
screening and treatment.
METHODS
Study Population: 63 diabetic subjects (Male: 30 Female:
32) were randomly selected within Kathmandu Valley
Population. Samples collected were reported as T2DM
from Kathmandu Model Hospital, Bhrikutimandap
Samjhana Laboratory, Mangalbazzar.
Study Design: A cross sectional study was designed to
explore the polymorphism in rs8052394 of MT 1A gene in
T2DM patients.
Study Site: Department of Biotechnology, College for
Professional Studies, Kathmandu, Nepal.
Selection of Sample: Samples reported as T2DM
according to WHO criteria 2006
Criteria to Confirm T2DM
1) Age above 40 years
2) Fasting Blood Glucose: >110mg%
3) Post-prandial Glucose: >140mg%
Data Processing and Analysis: Data will be analyzed
manually as well as using SPSS and interpreted according
to frequency distribution and percentage. The statistical
tool chi-square and t test will be applied to analyze the
data. Data will be presented in tables and figures.
Clinically and epidemiologically relevant information
from each patient including, age, sex, dietry habits was
obtained.
DNA extraction from T2DM samples:
D.K Lahiri et.al method: 1% Agarose Gel
Electrophoresis of Extracted DNA: 1% agarose gel was
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 572
prepared with 0.5 µg/ml if Ethidium Bromide (EtBr) in it.
6 µl if each extracted DNA sample and the loading dye
mixed in the ratio 5:1 was loaded on the wells and run for
an hour at 80-90 Volt on Tris Acetate EDTA (TAE)
buffer. The DNA bands were observed under UV trans-
illuminator.
PCR Amplification of rs8052394 Specific Exon
Fragment of MT1A Gene: The primary task for
performing the PCR is to standardize the reaction mixture
and to optimize the PCR conditions for the reaction to
occur accurately so that the DNA is amplified efficiently.
The reaction and the PCR programme were standardize to
precisely amplify the rs8052394 specific Exon fragment
of MT1A gene in the DNA sample by PCR using the
primers to get a 283 bp amplified product.
Forward: 5’ACTAAGTGTCCTCTGGGGCTG 3’
Reverse: 5’AATGGGTCACGGTTGTATG3’
2% Agarose gel electrophoresis of PCR amplified
products: To check if the specific DNA segments have
been amplified or not, the PCR products were
electrophoresed on 2% agarose gel(0.8gm of
agarose+40ml of 1X TAE buffer+0.5µg/ml of EtBr) in 1X
TAE buffer along with 100bp DNA ladder(Fermentas) for
1 hour at 90 volt.
Since the specific PCR primers amplified a 283bp PCR
product, single DNA band was observed lying in between
200 and 300bp as indicated by DNA marker when viewed
on UV transilluminator. The PCR amplified products were
stored at 4°C.
Restriction Digestion of PCR amplified
Products
Steps:
Incubation at 37°C for 3 hours
Heat Inactivation at 65°C for 20 minutes
Holding at 4°C forever.
RESULTS
Genomic DNA was extracted from blood cells.
The extracted DNA was run through 1% agarose gel
electrophoresis. PCR product was run through 2% agarose
gel electrophoresis. Finally digested product was run
through 3% agarose gel electrophoresis. Further the
incubation of the reaction mixture was carried out in the
thermocycler and the following program was used; Then
the digested product was analyzed by agarose gel
electrophoresis.
3%Agarose gel Electrophoresis of digested products:
After digestion of the 283bp fragment obtained by PCR, to
check for three possible genotypes, 15µl of digested
products were mixed with 3µl of loading dye and loaded
on the wells of 3%agarose gel in 1XTAE buffer along
with 100bp DNA ladder for 1 hour at 90 volts. The result
was viewed under UV transilluminator for number of
DNA fragments obtained. The amplified product was
subjected to digestion by PstI restriction enzyme. After
digestion of the 283 bp fragment by PCR, 165bp, 283bp
the restriction enzyme digested fragment was run on 3%
agarose gel electrophoresis. The gel picture below depicts
the band pattern for genotypes. Genotypic distribution was
in accordance with Hardy-Weinberg Equilibrium when
analysed by PopGene.S2
software with χ2=1.7494, df=1
and P>0.05.
Table.1. PCR reaction mixture with component and volume
Reagent Stock Final Concentration Volume/ Reaction
10XPCR buffer 2.5µl
25mM Mgcl2 1.5mM 2.0µl
10 µM (Each) dNTPs 200 µM 0.5µl
100 µM Reserve primer 0.4 µM 1.0µl
5 units/ µl.Taq polymerase 0.4 µM 0.2µl
Nuclease free D/W 1 Units/ µl 12.8µl
Total Master Mix 20 µl
DNA extract 5 µl
Total 25 µl
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 573
Table.2.The following program was standardized for the amplification reaction
Step Temperaure (oC) Time
Initial Denaturation 95 5 Minutes
Denaturation 95 1 minutes
Primer Annealing 55.7 45 seconds
Extension 72 45 seconds
Cycle repeat from step 2 (35 cycles)
Final extension 72 7 minutes
Holding 4 Forever
End
Table.3.The reaction mixture for restriction digestion
Master Mix for Restriction Digestion
Pst I 0.5 µl
10X Buffer ‘O’ 1.5 µl
Nuclease free distilled water 3.0 µl
PCR product 10 µl
Table.4.Genotype Distribution in Nepalese Population
Table.5. Distribution of genotypic frequency of SNP rs8052394
SNP Group CASE no
62
Genotype X2 P
Rs8052394 Case GG GA AA 1.7494 0.79035
1 24 37
Table6: Agewise distribution in accordance to mutation
Figure.1.WHO distributions of diabetic people Figure.2.Outline of mechanisms by which MT
coordinate with Zn prevents diabetes development and
diabetic complications rs8052394 of MET1A gene
Allotypes GG GA AA
Band Patterns 118 118 -
165 165 -
- 283 283
Frequency 1 24 37
Total sample (a) 62
Age < 50 51-60 61
Percentage 33.87 22.58 43.55
Total Number 21 14 27
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 574
Figure.3.Gender wise distribution of patients
Figure.6. 3% Agarose Gel Electrophoresis of digested product by PSTL restriction enzymes
DISCUSSION
The present study revealed an association of MT
genes with T2DM. SNP rs8052394 detected in this study
was highly polymorphic. The χ2 goodness-of-fit test
showed that the genotypic distribution of rs8052394 SNP
was not deviated from the Hardy- Weinberg equilibrium
(P >0.05), suggesting the suitability of this sample pool
for genetic analysis. The allelic frequency distribution
analysed by PopGene software showed that ‘G’ allele
(p=0.79035) is high in Nepalese Population whereas ‘A’
allele (q=0.20965) is less in frequency. The gender wise
distribution of rs8052394 of MT1A gene mutated and wild
type or differently mutated strains. Among male subjects
30 (48.39%) weresuffering from diabetes and 32(51.61%)
were from female subjects. This shows no any significant
relationship between the prevalence of diabetes mellitus
and gender.
Agewise distribution of the T2DM patient: Agewise
distribution of the patient shows that 33.87% people were
less than 50 years, 22.58 were between 51-60 and 43.55
%were >61. In a given diabetic population, the chance of
alteration on different genes are possible which are
responsible for the induction of T2DM (Shoelson, 2006;
Lyssenko, 2008). But the role of MT1A is most widely
studied due to the importance of this gene. The mutation
in MT1A gene is a major mechanism for the
development of diabetes and its complications. The most
common mutation is the Lys51Arg substitution in MT1A
gene, which is present in approximately 36.13% of the
diabetic population and is associated with relatively high
level induction of the diabetes and its complication (Lina,
2008). But however it should be remembered that at
normal condition MTIA gene acts as antioxidant therefore
prevents diabetes (Papouli, 2000). The most frequent
mutation patterns of diabetic patient of MT1A gene occurs
at rs8052394 fragment at aminoacid51 (36.13%) of
MT1Agene. But mutation in MT1A gene occurs in a
higher frequency than any other gene and is regarded as to
be most important in diagnosing diabetes (Lina Yang,
2008).
CONCLUSION
The study of genotype frequency distribution for
the MT1A polymorphism in rs8052394 in Nepalese
population from Nepal for the first time will definitely
serve as a major achievement in understanding the
molecular level of mechanism and effects of the gene
mutation which varies in different geographical region of
world. We found that rs8052394 of MT1A gene mutation
at amino acid 51 accounted 40.3% among which the
mutation is more commonly found on the age group less
Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 575
than 50years. To the best of our knowledge frequency of
the MT1Agene lys51arg mutation has not been previously
determined in Nepalese diabetic population. The higher
percentage (40.3%) of common mutation in MT1A
definitely highlights the importance of the 51st amino acid
for development of diabetes and its complication.
BIBLIOGRAPHY
American diabetes association, Report: Type 2 diabetes in
children and adolescents. Diabetes care 2000, 23:381-9
Cai L, Diabetic cardiomyopathy and its prevention by
metallothionein: experimental evidence, possible
mechanisms and clinical implications, Curr Med Chem,
14, 2007, 2193–2203.
Cooke DW, Plotnick L, Type 1 diabetes mellitus in
pediatrics, Pediatr Rev Nov, 29 (11), 2008, 374–384.
Florence Demenais, Timo Kanninen, Cecilia M. Lindgren,
A meta-analysis of four European genome screens (GIFT
Consortium) shows evidence for a novel region on
chromosome 17p11.2–q22 linked to type 2 diabetes,
Human Molecular Genetics, 12(15), 2003, 1865–1873.
Grarup N, Andersen G, Gene-environment interactions in
the pathogenesis of type 2 diabetes and metabolism.
Current Opinion in Clinical Nutrition & Metabolic Care,
10, 2007, 420–426.
Higashimoto Minoru, Isoyama Naohiro, Ishibashi Satoshi,
Inoue Masahisa, Takiguchi Masufumi, Suzuki Shinya,
Ohnishi Yoshinari, Sato Masao:Tissue dependent
preventive effect of metallothionein against DNA damage
in dyslipidemic mice under repeated stresses of fasting or
restraint, Life Sciences, 84, 2009, 569-575
J. E. Shaw, R. A. Sicree, and P. Z. Zimmet, Global
estimates of the prevalence of diabetes for 2010 and 2030.
Diabetes Research and Clinical Practice, 87(1), 2010, 4–
14.
Lahari D. K., Steve Bye, Nurenberger Jr J. J., Mario E.,
Hondes D. and Crisp M, A non organic and non enzymatic
extraction methods gives high yields of genomic DNA
from whole blood samples than do nine other methods
tested, J. Biochem. Biophys Methods, 25, 1992, 193–205
Li X, Cai L, Feng W, Diabetes and Metallothionein, Mini
Rev Med Chem, 7, 2007, 761–768.
Lina yang, Polymorphisms in metallothionein-1 and -2
genes associated with the risk of type 2 diabetes mellitus
and its complications, Am J Physiol Endocrinol Metab,
294, 2008, 987-992.
Lyssenko V, Jonsson A, Almgren P, Clinical risk factors,
DNA variants, and the development of type 2 diabetes,
The New England Journal of Medicine, 359 (21), 2008,
2220–2232.
Mikkel Faurschou1, Milena Penkowa, Claus Bøgelund
Andersen, Henrik Starklint4 and Søren Jacobsen: The
renal metallothionein expression profile is altered in
human lupus nephritis. Arthritis Research & Therapy, 10,
2008, 761.
Papouli E, Defais M, Larminat F, Over expression of
metallothionein-II sensitizes rodent cells to apoptosis
induced by DNA cross-linking agent through inhibition of
NF-kappaβ activation, J Biol Chem, 277, 2000, 4764-
4769.
Shoelson SE, Lee J, Goldfine AB, Inflammation and
insulin resistance, J Clin Invest, 116 (7), 2006, 1793–801
Wild S, Roglic G, Green A, Sicree R, King H, Global
prevalence of diabetes: estimates for 2000 and projections
for 2030, Diabetes Care, 2004, 27(5), 1047–1053.
World Health Organisation & Department of Non
communicable Disease Surveillance (1999). Definition,
Diagnosis and Classification of Diabetes Mellitus and its
Complications.
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 576
A NOVEL RP- HPLC METHOD DEVELOPMENT AND VALIDATION OF ATORVASTATIN AND
FENOFIBRATE IN BULK AND PHARMACEUTICAL DOSAGE FORMS
Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna
Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9490776192
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise reverse phase high
performance liquid chromatographic method for the simultaneous estimation of Atorvastatin and Fenofibrate in
pure and pharmaceutical dosage forms. Atorvastatin and Fenofibrate were well separated using a Thermohypersil
BDS C18 column of dimension 100 × 4.6, 5µm and Mobile phase consisting of Methanol: Water (Adjusted with
orthophosphoric acid to pH-2) in the ratio of 40:60v/v at the flow rate 1 ml/min and the detection was carried out
at 274nm with PDA detector. The Retention time for Atorvastatin and Fenofibrate were found to be 1.438, 2.949
respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity
according to ICH guidelines. The method was successfully applied to Atorvastatin and Fenofibrate combination
pharmaceutical dosage form.
KEY WORDS: RP-HPLC, Atorvastatin, Fenofibrate, Accuracy, Precision.
1. INTRODUCTION
Atorvastatin ((3R, 5R)-7-[2-(4-
fluorophenyl)-3-phenyl-4-(phenylcarbamoyl)-5-propan-2-
ylpyrrol-1-yl]-3, 5-dihydroxyheptanoic acid) is a member
of the drug class known as statins. It is used for lowering
cholesterol. Atorvastatin is a competitive inhibitor of
hydroxymethylglutaryl-coenzyme-A (HMG-CoA)
reductase, the rate-determining enzyme in cholesterol
biosynthesis via the mevalonate pathway. HMG-CoA
reductase catalyzes the conversion of HMG-CoA to
mevalonate. It acts primarily in the liver. Decreased
hepatic cholesterol levels increases hepatic uptake of
cholesterol and reduces plasma cholesterol levels.
Fenofibrate (propan-2-yl 2-{4-[(4-
chlorophenyl) carbonyl] phenoxy}-2 methyl propanoate)
is a drug of the fibrate class. It is mainly used to reduce
cholesterol levels in patients at risk of cardiovascular
disease. Like other fibrates, it reduces low-density
lipoprotein (LDL) and very low density lipoprotein
(VLDL) levels, as well as increasing high-density
lipoprotein (HDL) levels and reducing triglycerides level.
It is used alone or in conjunction with statins in the
treatment of hypercholesterolemia and
hypertriglyceridemia. It lowers lipid levels by activating
peroxisome proliferator-activated receptor alpha (PPARα).
PPARα activates lipoprotein lipase and reduces apoprotein
CIII, which increases lipolysis and elimination of
triglyceride-rich particles from plasma.
Literature survey revealed that very few methods
have been reported for the analysis of Atorvastatin and
Fenofibrate combinational dosage forms which include
UV spectroscopy, Reverse Phase High performance
Liquid Chromatography, Densitometric method, HPTLC
methods. The present study illustrate development and
validation of simple, economical, selective, accurate,
precise RP-HPLC method for the determination of
Atorvastatin and Fenofibrate in bulk and Pharmaceutical
dosage forms as per ICH guidelines.
The goal of this study is to develop rapid, economical
HPLC method for the analysis of Atorvastatin and
Fenofibrate in combined dosage form using most
commonly employed column (C18) and simple mobile
phase preparation.
In the present proposed work a successful attempt
had been made to develop a method for the simultaneous
estimation of Atorvastatin and Fenofibrate pharmaceutical
dosage form and validate it. From the economical point of
view and for the purpose of routine analysis, it was
decided to develop a more economical RP-HPLC method
with simple mobile phase preparation for the estimation of
Atorvastatin and Fenofibrate combinational dosage form.
The method would help in estimate of drugs in single run
which reduces the time of analysis and does not require
separate method for each drug. Thus, the paper reports an
economical, simple and accurate RP-HPLC method for the
above said pharmaceutical dosage forms.
2. MATERIALS AND METHODS
Quantitative HPLC was performed on a high
performance liquid chromatograph -Waters e2695Alliance
HPLC system connected with PDA Detector 2998 and
Empower2 Software. The drug analysis data were
acquired and processed using Empower2 software running
under Windows XP on a Pentium PC and Thermohypersil
BDS C18 column of dimension 100 × 4.6, 5µm particle
size. In addition an analytical balance (DENVER 0.1mg
sensitivity), digital pH meter (Eutech pH 510), a sonicator
(Unichrome associates UCA 701) were used in this study.
Standards and chemicals used: Pharmaceutical grade
Atorvastatin and Fenofibrate were kindly supplied as a gift
sample by Dr.Reddy’s Laboratory, Hyderabad, and
Andhra Pradesh, India. Methanol was of HPLC grade and
Purchased from E. Merck, Darmstadt, Germany. Ortho
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 577
Phosphoric Acid was analytical reagent grade supplied by
Fischer Scientific Chemicals. Water HPLC grade was
obtained from a Milli-QRO water purification system.
Atorvastatin and Fenofibrate Tablets available in the
market as Lipicure-TG (intas pharmaceuticals, Sikkim,
India.) in composition of Atorvastatin (10mg),
Fenofibrate (150mg).
Preparation of mobile phase: Transfer water into
1000ml of beaker dissolve and diluted volume with water.
Then adjust its pH to 2 with Ortho Phosphoric Acid
(OPA). The Water adjusted pH to 2 with OPA: Methanol
(60:40 v/v) and filtered through 0.45µ membrane filter
and degassed by sonication.
Preparation of calibration standards: 10mg
Atorvastatin and 16mg Fenofibrate was taken into a 10, 50
ml of volumetric flask and add 10ml of Diluent and
sonicated for 10 minutes and made up with Diluent. It was
further diluted to get stock solution of Atorvastatin and
Fenofibrate (To get 0.02 ppm and 0.32 ppm solution
respectively). This is taken as a 100% concentration.
Working standard solutions of Atorvastatin and
Fenofibrate was prepared with mobile phase. To a series
of 10 ml volumetric flasks, standard solutions of
Atorvastatin and Fenofibrate in the concentration range of
0.01-0.03µg/ml and 0.16-0.48µg/ml were transferred
respectively.
System suitability: System suitability are an integral part
of chromatographic system. To ascertain its effectiveness,
certain system suitability test parameters were checked by
repetitively injecting the drug solutions at 100%
concentration level for Atorvastatin and Fenofibrate to
check the reproducibility of the system. At first the HPLC
system was stabilized for 40 min. One blank followed by
six replicate analysis of solution containing 100% target
concentration of Atorvastatin and Fenofibrate were
injected to check the system suitability. To ascertain the
system suitability for the proposed method, a number of
parameters such as theoretical plates, peak asymmetry,
and retention time were taken and results were presented
in Table 1.
Recommended procedure:
Calibration curves for Atorvastatin and Fenofibrate: Replicate analysis of solution containing 0.01-0.03µg/mL,
0.16-0.48µg/mL of Atorvastatin and Fenofibrate sample
solutions respectively were injected into HPLC according
to the procedure in a sequence and chromatograms were
recorded. Calibration curves were constructed by plotting
by taking concentrations on X-axis and ratio of peak areas
of standards on Y-axis and regression equation were
computed for both drugs and represented in Table .6
Analysis of marketed formulation: The content of ten
tablets was weighed accurately. Their average weights
were determined. Powder of tablets equivalent to one
tablet weight (521.1mg) were weighed and taken in a 50
ml volumetric flask, dissolved in diluents, shaken and
sonicated for about 20 minutes then filtered through 0.45µ
membrane filter. The filtered solution was further diluted
(5 to 50ml) in the diluents to make the final concentration
of working sample equivalent to 100% of target
concentration. The prepared sample and standard solutions
were injected into HPLC system according to the
procedure. from the peak areas of Atorvastatin and
Fenofibrate the amount of the drugs in the sample were
computed. The contents were calculated as an average of
six determinations and experimental results were
presented in Table 4. The representive standard and
sample chromatograms were shown in fig.2 and fig.3.
Validation study of Atorvastatin and Fenofibrate: An
integral part of analytical method development is
validation. Method validation is the process to confirm
that the analytical procedure employed for a specific test
is suitable for its intended use. The newly developed RP-
HPLC method was validated as per International
Conference on Harmonization (ICH) guidelines for
parameters like specificity, system suitability, accuracy,
linearity, precision (repeatability), limit of detection
(LOD), limit of Quantification (LOQ) and robustness.
Specificity: The effect of wide range of excipients and
other additives usually present in the formulation of
Atorvastatin and Fenofibrate in the determination under
optimum conditions were investigated. The specificity of
the RP-HPLC method was established by injecting the
mobile phase and placebo solution in triplicate and
recording the chromatograms. The common excipients
such as lactose anhydrous, microcrystalline cellulose and
magnesium state have been added to the sample solution
injected and tested.
Precision: precision study of sample (Losartan potassium
and Amlodipine) was carried out by estimating
corresponding responses 6 times on the same day for the
100% target concentration. The percent relative standard
deviation (%RSD) is calculated which is within the
acceptable criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range of
0.01-0.03µg/ml and 0.16-0.48µg/ml (50-150%)
Atorvastatin and Fenofibrate respectively. Method of least
square analysis is carried out for getting the slope,
intercept and correlation coefficient, regression data
values and the results were presented in Table 2. The
representative chromatograms indicating the sample were
shown in fig.2&3. A calibration curve was plotted
between concentration and area response and statistical
analysis of the calibration curves were shown in fig. 6&7.
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 578
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Atorvastatin and Fenofibrate by the method of addition.
Known amount of Atorvastatin and Fenofibrate at 50%,
100%, 150% is added to a pre quantified sample solution.
The recovery studies were carried out in the tablet in
triplicate each in the presence of placebo. The mean
percentage recovery of Atorvastatin and Fenofibrate at
each level is not less than 99% and not more than 101%.
Robustness: The robustness is evaluated by the analysis
of Atorvastatin and Fenofibrate under different
experimental conditions such as making small changes in
flow rate (±0.2 ml/min), λmax (±5), column temperature
(±5), mobile phase composition (±5%), and pH of the
buffer solution.
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified. Under the stated experimental
conditions. The limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy. Limit
of detection and limit of quantification were calculated
using following formula LOD=3.3(SD)/S and
LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of the
calibration curve.
Table 1: optimized chromatographic conditions and system suitability parameters for proposed method
S.NO Parameter Chromatographic conditions
1. Instrument Waters e2695 Alliance HPLC with Empower2 software
2. Column thermohypersil C18, (5μ, 150 x 4.6mm)
3. Detector PDA Detector 2998
4. Diluents Methanol
5. Mobile phase Water(adjusted pH 2.0 with OPA): methanolo (60:40 v/v)
6. Flow rate 1ml/min
7. Detection wavelength 274nm
8. Temperature 35°c
9. Injection volume 5µl
10. Retention time
Atorvastatin 1.438
Fenofibrate 2.949
11. Theoretical plate count
Atorvastatin 2552
Fenofibrate 3000
12. Tailing factor
Atorvastatin 1.17
Fenofibrate 1.59
13. Resolution factor 9.38
Table 2: Specificity study
S.NO. Name of the solution Retention time in min
1. Blank No peaks
2. Atorvastatin 1.438
3. Fenofibrate 2.949
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 579
Table 3: results of precision study
S.NO Sample Injection number Precission
RT Peak area
1.
Atorvastatin
1 1.443 2054782
2 1.438 2054809
3 1.442 2065165
4 1.382 2060368
5 1.441 2041300
6 1.444 2043795
Mean 2053370
%RSD(NMT 2.0) 0.50
2.
Fenofibrate
1 2.977 3515822
2 2.961 3503597
3 2.973 3509064
4 2.970 3507668
5 2.973 3511717
6 2.877 3513906
Mean 3510296
%RSD(NMT 2.0) 0.1
Table 4: Recovery data of the proposed Atorvastatin and Fenofibrate
S.NO Sample Spiked Amount
(µg/ml)
Recovered Amount
(µg/ml)
%Recovered %Average
recovery
1.
Atorvastatin
10.04 10.02 100.16
100% 19.983 19.94 100
29.937 29.85 99.3
2.
Fenofibrate
158.47 158.82 100.33
100.33% 316.538 317.59 100.33
474.20 476.32 100.33
Table 5: Robustness results of Atorvastatin and Fenofibrate
S.NO sample parameters Optimized Used RT Peak area Plate count
1.
Atorvastatin
Flow rate
(±0.2)
1ml/min
0.8 1.799 2187263 3021
1 1.436 6100287 2723
1.2 1.209 1639328 2856
Temperature
(±5°C)
35°C
30 1.357 1565593 2943
35 1.438 2043083 2552
40 1.211 1639328 2734
2.
Fenofibrate
Flow rate
(±0.2)
1ml/min
0.8 2.508 3198139 3037
1 2.940 3507208 3234
1.2 2.495 2378287 2810
Temperature
(±5°C)
35°C
30 2.488 2519528 2853
35 2.949 3527161 3222
40 3.684 2643655 2958
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 580
Table 6: linearity data of the Atorvastatin and Fenofibrate
Table.7: Limit of Detection and Limit of Quantification
Parameter Atorvastatin Fenofibrate
Limit of detection(LOD) 0.00013µg/mL 0.00210µg/mL
Limit of Quantification(LOQ) 0.00046µg/mL 0.0070µg/mL
Fig.3: Chromatogram of Blank solution Fig. 4: Typical Chromatogram of standard
Fig. 5: Typical chromatogram of Atorvastatin and Fenofibrate in marketed formulation
S.NO sample Linearity level
(µg/ml)
Peak area Slope Y-intercept r²
1.
Atorvastatin
0.1 1024859
20379
1640.2
0.999 0.15 1530720
0.2 2028343
0.25 2552721
0.3 3061292
2.
Fenofibrate
0.01 1756257
34837
15635
0.999 0.015 2634474
0.02 3501613
0.025 4352056
0.03 5252030
Fig.1: Structure of Atorvastatin Fig.2 Structure of Fenofibrate
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 581
Fig. 6: Linearity of Atorvastatin Fig. 7: Linearity of Fenofibrate
3. RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Atorvastatin and Fenofibrate.
Preliminary experiments were carried out to achieve the
best chromatographic conditions for the simultaneous
determination of the drug substances. Several column
types and lengths were tried considering other
chromatographic parameters. C18 column with a 4.6 mm
inner diameter and 5µm particle size was chosen. The
detection wave length was selected as 274nm with PDA
detector. Chromatographic conditions were optimized by
changing the mobile phase composition and buffers used
in mobile phase.
Different experiments were performed to optimize
the mobile phase but adequate separation of the drugs
could not be achieved. By altering the pH of buffer results
a good separation. Different proportions of solvents were
tested. Eventually the best separation was obtained by the
isocratic elution system using a mixture of water (adjusted
the pH to 2 with OPA): methanol (60:40, v/v) at a flow
rate of 1 ml/min. a typical chromatogram for simultaneous
estimation of the two drugs obtained by using a above
mentioned mobile phase. Under these conditions
Atorvastatin and Fenofibrate were eluted at 1.438min and
2.949minutes respectively with a run time of 5 minutes.
The representative chromatogram of this simultaneous
estimation shown in fig. 3 & 4 and results were
summarized in Table 1.
The Methanol and water (pH 2 with OPA) (40:60,
v/v) was chosen as the mobile phase. The run time of the
HPLC procedure was 5 minutes at flow rate of 1ml/min
was optimized which gave sharp peak, minimum tailing
factor. The system suitability parameters were shown in
Table 1 were in within limit, hence it was concluded that
the system was suitable to perform the assay. The method
shows linearity between the concentration range of 0.01-
0.03µg/ml for Atorvastatin and 0.16-0.48µg/ml for
Fenofibrate.
The experimental results were shown in table 6
and fig.6&7. The % recovery of Atorvastatin and
Fenofibrate was found to be in the range of 99.5 to 100 %
& 99 to 100.33% respectively. As there was no
interference due to excipients and mobile phase, the
method was found to be specific. As both compounds
pass the peak purity, the method was found to be specific.
The method was robust and rugged as observed from
insignificant variation in the results of analysis by
changes in Flow rate, column oven temperature, mobile
phase composition and wave length separately and
analysis being performed by different analysts.
The results were shown in Table 5. The LOD and
LOQ values were calculated based on the standard
deviation of the response and the slope of the calibration
curve at levels approximately the LOD and LOQ. The
limit of detection was obtained as 0.00013µg/mL for
Atorvastatin and 0.00210µg/mL for Fenofibrate. The limit
of quantitation was obtained as 0.00046µg/mL for
Atorvastatin and 0.0070µg/mL for Fenofibrate which
shows that the method is very sensitive. The results were
shown in Table. 7.
4. CONCLUSION
A new validated RP-HPLC method has been developed
for the quantitative and Qualitative determination of
Atorvastatin and Fenofibrate in tablet dosage forms in
bulk and pharmaceutical dosage forms was established.
The method was completely validated shows satisfactory
results for all the method validation parameters tested and
method was free from interferences of the other active
ingredients and additives used in the formulation. Infact
results of the study indicate that the developed method
was found to be simple, reliable, accurate, linear,
sensitive, economical and reproducible and have short run
time which makes the method rapid. Hence it can be
concluded that the proposed method was a good approach
y = 20379x + 1640.2
r² = 0.999
0
1000000
2000000
3000000
4000000
0 100 200
AR
EA
CONC.
ATORVASTATIN
Area
Linear (Area)
y = 34837x + 15635
r² = 0.999
0
2000000
4000000
6000000
0 100 200
AR
EA
CONC.
FENOFIBRATE
Area
Linear (Area)
Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 582
for obtaining reliable results and found to be suitable for
the routine analysis of Atorvastatin and Fenofibrate in
Bulk drug and Pharmaceutical formulations.
5. ACKNOWLEDGEMENT
The authors would like to thank beloved parents
and all my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
D A Shah, KK Bhatt, RS Mehtha, MB Shankar, TR
Gandhi, Development and validation of a RP-HPLC
method for determination of Atorvastatin calcium and
Aspirin in a capsule dosage form, Indian Journal of
Pharmaceutical Sciences, 69(4), 2007, 546-549.
Deepti Jain, N Jain, R Raghuwanshi,Development and
validation of RP-HPLC method for simultaneous
estimation of Atorvastatin calcium and Fenofibrate in
tablet dosage forms, Indian Journal of Pharmaceutical
Sciences,70(2), 2008, 263-265.
Gadewar CK, Mundik MB, Chandekar NA, Mahajan NM,
Telgoti PD,RP-HPLC Method for Simultaneous
Estimation of Atorvastatin Calcium Ezetimibe in
Pharmaceutical Formulation, Asian Journal of Research in
Chemistry, 3(2), 2010, 485-490.
Hirave Rupali. V, Bendgude Ravindra.D, Maniyar
Mithun.G, Kondavar Manish.S, Patil Sandeep.B,
Spectrophotometric method for Simultaneous estimation
of Atorvastatin Calcium & Fenofibrate in tablet Dosage
Form, International Journal of Drug Development &
Research, 5(1), 2013, 38-42.
ICH-Q2A, Text on Validation of Analytical Procedures,
ICH Harmonized Tripartite Guideline, Geneva, 1995, 2-3.
ICH-Q2B, Validation of Analytical Procedures:
Methodology, ICH Harmonized Tripartite Guideline,
Geneva, 1996, 1-8.
Krishna R. Gupta, Sonali S.Askarkar, Prashanth R.Rathod,
Sudhir G.wadodkar, Validated spectrophotometric
determination of Fenofibrate in Formulation, Der
Pharmacia Sinica, pelagia research library, UK, 1(1),
2010, 173-178.
Linda LN: Reviewer guidance-Validation of
chromatographic methods, Center for drug evaluation and
research, 1994, 1-30.
Lloyd R.Synder, Joseph J.Kirkland, Joseph L.Glajeh,
Practical HPLC method development, 2nd
Edition. 1997,1-
14.
Nagavalli D, Balipaka Srinivas, Kalyan Chakravarthy C,
A validation analytical method development for the
simultaneous estimation of Metformin hydrochloride and
Fenofibrate in pure and in tablet dosage form,
International research journal of pharmacy, 2(12), 2011,
146-149.
Onkar S. Havele, Shweta S.Havele, Simultaneous
Determination of Atorvastatin calcium and Pioglitazone
hydrochloride in Its Multicomponent Dosage Forms by
UV Spectrophotometry, International Journal of Pharmacy
and Pharmaceutical Science Research, 1(2), 2011, 75-79.
P. N. Dhabale, D.S.Gharge, Simultaneous
spectrophotometric estimation of Atorvastatin and
Fenofibrate in bulk drug and dosage form by using
simultaneous equation method. International Journal of
ChemTech Research, 2 (1), 2010, 325-328.
R.J.Hamilton and Swell, Introduction to HPLC, 2nd
Edition, 2-94.
Rajasekaran A, Sasikumar R, Dharuman J, Simultaneous
RP-HPLC method for the stress degradation studies of
Atorvastatin calcium and Ezetimibe in multicomponent
dosage form, Ars Pharmaceutica, Spain,US.52(3), 2011,
12-18.
Rupali Hirave, S.D.Bhinge, S.M.Malipatil, A.S.Savali,
RP-HPLC method for simultaneous estimation of
Atorvastatin Calcium and Fenofibrate in tablet dosage
forms, Journal of PharmacyResearch, 3 (10), 2010, 2400.
T.Depan, K Paul Ambethkar, G.Vijaya Lakshmi,
M.D.Dhanaraju, Analytical Method Development And
Validation of RP-HPLC For Estimation of Atorvastatin
Calcium And Fenofibrate in Bulk Drug and Tablet Dosage
forms, European Journal of Applied sciences, 3 (2), 2011,
35-39.
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
ANALYTICAL METHOD DEVELOPMENT AND VALIDATION FOR THE
SIMULTANEOUS ESTIMATION OF LAMIVUDINE, ZIDOVUDINE AND
EFAVIRENZ BY RP-HPLC IN BULK AND PHARMACEUTICAL DOSAGE FORMS
Sindhura D*, Nanda Kishore Agarwal
Department of pharmaceutical analysis, Nimra College of Pharmacy
*Corresponding Author: [email protected], Phone no: 9951089007
ABSTRACT
A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was developed for
the determination of Lamivudine, Zidovudine and Efavirenz in bulk and pharmaceutical dosage forms. The
quantification was carried out using Symmetry C18 (250 X 4.6 mm, 5 µm) column run in isocratic way using
mobile phase comprising of methanol and water in the ratio of 65:35 v/v and a detection wavelength of 250nm,
and injection volume of 20µL, with a flow rate of 1.0mL/min. The retention times of Lamivudine, Zidovudine and
Efavirenz was found to be 2.519, 3.015 and 24.103. The method was validated in terms of linearity, precision,
accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed
method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 80% to 120% and with correlation
coefficient of r2=0.9995,0.9994 and 0.9993 for Lamivudine, Zidovudine and Efavirenz. The assay of the proposed
method was found to be 99.98%, 99.96% and 100.14%. The recovery studies were also carried out and mean %
Recovery was found to be 100.7%, 100.28%, 100.45%. The % RSD from reproducibility was found to be <2%.
The proposed method was statistically evaluated and can be applied for routine quality control analysis of
Lamivudine, Zidovudine and Efavirenz in bulk and in Pharmaceutical dosage form.
Key Words: Lamivudine, Zidovudine, Efavirenz, RP-HPLC, Symmetry C18, Tablets, Validation.
1. INTRODUCTION
Lamivudine is 4-amino-1-[(2R, 5S)-2-
(hydroxymethy1)1, 3- oxathiolan-5-yl]-1, 2- dihydro
pyramidine-2-one.The molecular weight is 229.26,
molecular formula is C8H11N3O3S. It is an enantiomer of
dideoxy analogue of cytidine. Zidovudine is 3' azido-3'-
deoxythymidine. The molecular weight is 267.24,
molecular formula is C10H13N5O4.It is a thymidine
analogue. Both Lamivudine and Zidovudine inhibits the
HIV reverse transcriptase enzyme competitively and acts
as a chain terminator of DNA synthesis and is used in the
treatment of both types of HIV I and HIV II virus and
chronic hepatitis B.Efavirenz is chemically (S)-6-chloro-
4-(cyclopropylethynyl)-1,4-dihydro4-(trifluoromethyl)-
2H-3,1- benzoxazin-2-one. The molecular weight is
315.67, molecular formula is C14H9ClF3NO2.It diffuses
into the cell where it binds adjacent to the active site of
reverse transcriptase. This produces a conformational
change in the enzyme that inhibits function.
Literature review reveals very few methods are
reported for the assay of Lamivudine, Zidovudine and
Efavirenz in Tablet dosage forms using RP-HPLC
method. The reported HPLC methods were having
disadvantages like high flow rate, more organic phase and
use of costly solvents. The proposed RP-HPLC method
utilizes economical solvent system and having advantages
like better retention time, less flow rate, very sharp and
symmetrical peak shapes. The aim of the study was to
develop a simple, precise, economic and accurate RP-
HPLC method for the estimation of Lamivudine,
Zidovudine and Efavirenz in Tablet dosage forms.
Figure.1.Structure of
Lamivudine
Figure.2. Structure of Zidovudine Figure.3.Structure of
Efavirenz
Page 583
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
2. MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV win
5software UV-VISIBLE spectrophotometer with 1cm
matched quartz cells. Schimadzu HPLC equipped with
SPD 20A UV-VIS detector and the column used was
SYMMETRY C18 (250*4.6mm, 5µ). The data acquisition
was performed by using LC solutions software.
2.1. Chemicals and reagents: Lamivudine, Zidovudine
and Efavirenz pure samples were obtained from Mylan
Laboatories, Hyderabad, India and dosage form “Duovir-
E” marketed by CIPLA was purchased from local
pharmacy. Other chemicals all are of HPLC grade.
2.2. Preparation of mobile phase: A suitable quantity of
degassed mixture of methanol and water in the ratio of
65:35 v/v was prepared and filtered through 0.45µ filter
under vacuum filtration.
2.3. Preparation of standard solution: Standard
solution of Lamivudine, Zidovudine and Efavirenz
(600μg/ml, 150 μg/ml,300μg/ml) was prepared by
dissolving 60mg of Efavirenz, 15mg of Lamivudine and
30mg of Zidovudine working standard in 50ml of diluent
with sonication and made up to 100ml with the same
diluent.
2.4. Preparation of sample solution: Five tablets were
weighed and finely powdered and a powder quantity
equivalent to 150mg Lamivudine, 300mg of Zidovudine
and 600mg of Efavirenz were accurately weighed and
transferred to a 100ml volumetric flask and 50ml of
diluent was added to the same. The flask was sonicated for
30 min and volume was made up to the mark with diluent.
Transferred 5ml of solution into a 50ml volumetric flask
and dilute up to the mark with diluent so as to obtain a
concentration of 150,300,600 μg/mL mixed well and
injected. The amount present in each tablet was calculated
by comparing the area of standard Efavirenz, Lamivudine,
Zidovudine and tablet sample.
2.5. Method optimization: The chromatographic
separation was performed using Symmetry C18
(250×4.6mm, 5µm) column. For selection of mobile
phase, various mobile phase compositions were
observed for efficient elution and good resolution.
The mobile phase consisting of methanol and water
in the ratio of 65:35v/v was found to be the optimum
composition for efficient elution of analyte. The
mobile phase was injected to the column at a flow
rate of 1.0 ml/min for 35min. The column
temperature was maintained at 30oC. The analyte was
monitored at 250 nm using UV-detector. The
retention time of the drugs was found to be 2.519,
3.015 and 24.103min. Mobile phase was used as
diluent during the standard and test samples
preparation.
3. RESULTS
3.1. Method Validation
3.1.1. System suitability: System suitability tests are an
integral part of method validation and are used to ensure
adequate performance of the chromatographic system.
Retention time (RT), number of theoretical plates (N) or
column efficiency and tailing factor (T) were evaluated for
five injections of standard solution at a solution of
100µg/ml of Lamivudine, Zidovudine and Efavirenz. The
results are tabulated in the table no-2 and the
chromatogram was shown in the figure no- 4.
3.1.2. Specificity: Specificity is the ability of analytical
method to measure accurately and specifically the analyte
in the presence of components that may be expected to be
present in the sample. The specificity of method was
determined by spiking possible impurities at specific level
to standard drug solution (100ppm). The diluent and
placebo solutions were also injected to observe any
interference with the drug peak. The results are tabulated
in the table no-3 and the chromatogram was shown in the
figure no- 5, 6.
3.1.3. Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given range.
The linearity of Lamivudine, Zidovudine and Efavirenz
was in the concentration range of 80-120%.From the
linearity studies calibration curve was plotted and
concentrations were subjected to least square regression
analysis to calculate regression equation. The regression
coefficient was found to be 0.9995 for Lamivudine,
0.9994 for Zidovudine and 0.9993 for Efavirenz and
shows good linearity for three drugs. The results are
tabulated in the table no-4 and the chromatogram was
shown in the figure no- 7, 8, 9.
3.1.4. Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the measure of
exactness of the method. Accuracy of the method was
evaluated by standard addition method. Recovery of the
method was determined by spiking an amount of the pure
drug (80%,100% ,120%) at three different concentration
levels in its solution has been added to the pre analyzed
working standard solution of the drug. The results are
tabulated in the table no-5, 6, 7.
3.1.5. Precision: The precision of the analytical method
was studied by analysis of multiple sampling of
homogeneous sample. The Precision expressed as
standard deviation or relative standard deviation.
Page 584
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
3.1.6. System precision: System precision was performed
by injecting a standard solution of Lamivudine,
Zidovudine and Efavirenz at working concentrations five
times. The results are tabulated in the table no-8.
3.1.7. Method precision: Method precision was
performed by analyzing a sample solution of Lamivudine,
Zidovudine and Efavirenz by injecting six replicates of the
same sample preparations at a concentration of
100ppm/mL. The results are tabulated in the table no-9.
3.1.8. Robustness: Robustness shows the reliability
of an analysis with respect to deliberate variations in
method parameters. If measurements are susceptible
to variations in analytical conditions, the analytical
conditions should be suitably controlled or a
precautionary statement should be included in the
procedure.
Table.1.Optimized chromatogram conditions for Lamivudine, Zidovudine and Efavirenz
Column Symmetry C18 (250*4.6mm,5µ)
Mobile phase Methanol: Water(65:35)
Flow rate 1.0 ml/ min
Wavelength 250 nm
Injection volume 20 l
Column temperature 30o C
Run time 35 min
Table.2. System suitability Data for Lamivudine, Zidovudine and Efavirenz
S.No Lamivudine
Peak area
Zidovudine
Peak area
Efavirenz
Peak area
1 2027423 1501204 3138895
2 2025853 1500977 3142519
3 2026576 1501113 3150529
4 2025030 1501308 3154259
5 2027292 1502391 3158911
Average 2026435 1501399 3149023
SD 1005 568 8251
%RSD 0.05 0.04 0.26
Theoretical plates 6615 7512 4500
Tailing factor 1.25 1.32 1.12
Retention time 2.519 3.015 24.103
Table.3.Specificity Data for Lamivudine, Zidovudine and Efavirenz
Peak Name Retention Time (Minutes) RT ratio
Lamivudine 2.541 1.00
Zidovudine 3.001 1.18
Efavirenz 22.403 8.82
Table.4. Linearity Data for Lamivudine, Zidovudine and Efavirenz
Lamivudine Zidovudine Efavirenz
Level Con. (mg/ml) Peak area Con.(mg/ml) Peak area Con.(mg/ml) Peak area
80% 0.07959 1576950 0.08005 1169205 0.08095 2521629
90% 0.08855 1761010 0.09010 1299358 0.08846 2753981
100% 0.10350 2040551 0.10360 1504208 0.10290 3198155
110% 0.10810 2121575 0.10850 1565537 0.10853 3342493
120% 0.11950 2357552 0.12015 1735081 0.11925 3701006
Slope 19338642.0219 14201079.1883 30526500.1606
Intercept 40602.8714 27753.3632 50253.3069
Correlation coefficient 0.9997 0.9997 0.9997
R square 0.9995 0.9994 0.9993
Page 585
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
Table.5. System precision of Lamivudine, Zidovudine and Efavirenz (8)
S.No Lamivudine Zidovudine Efavirenz
Area RT Area RT Area RT
1 2027423 2.540 1501204 3.044 3138895 25.192
2 2025853 2.540 1500977 3.043 3142519 25.100
3 2026576 2.544 1501113 3.045 3150529 25.061
4 2025030 2.541 1501308 3.043 3154259 24.954
5 2027292 2.542 1502391 3.042 3158911 24.559
Average 2026435 - 1501399 - 3149023 -
SD 1005 - 568 - 8251 -
% RSD 0.05 - 0.04 - 0.26 -
Table.6. Method precision of Lamivudine, Zidovudine and Efavirenz(9)
S.No Lamivudine Assay
(%)
RT
Zidovudine
Assay (%)
RT
Efavirenz
Assay (%)
RT
1 99.5 2.539 99.3 3.019 99.3 22.841
2 100.5 2.539 99.6 3.019 100.4 22.869
3 99.5 2.541 99.4 3.024 99.3 22.940
4 99.6 2.539 99.8 3.020 99.8 22.941
5 99.8 2.537 99.5 3.020 99.9 22.889
6 100.0 2.540 99.9 3.021 99.9 22.941
Average 99.8 - 99.6 - 99.8 -
SD 0.4 - 0.2 - 0.4 -
% RSD 0.4 - 0.2 - 0.4 -
Table.7. Variation in flow rate, column temperature and buffer for Lamivudine (10)
Parameter
Lamivudine
Flow (mL/min) Temperature(oC) Buffer
Low High Low High Low High
%RSD 0.05 0.12 0.30 0.03 0.05 0.25
Retention time 3.094 2.556 2.814 2.808 2.809 2.821
Plate count 5.54 6.10 5124 5029 5954 4054
Tailing factor 1.20 1.21 1.20 1.26 1.32 1.22
Table.8.Variation in flow rate, column temperature and buffer for Zidovudine (11)
Parameter
Zidovudine
Flow (mL/min) Temperature(oC) Buffer
Low High Low High Low High
%RSD 0.14 0.17 0.19 0.06 0.04 0.18
Retention time 3.598 3.000 3.316 3.310 3.291 3.351
Plate count 4818 6010 4523 6842 4898 5818
Tailing factor 1.14 1.21 1.18 1.18 1.27 1.25
Table.9.Variation in flow rate, column temperature and buffer for Efavirenz(12)
Parameter
Efavirenz
Flow (mL/min) Temperature(oC) Buffer
Low High Low High Low High
%RSD 0.43 0.17 0.23 0.15 0.31 0.23
Retention time 25.251 20.889 23.399 23.677 21.621 26.840
Plate count 4558 5518 5326 5692 5558 4558
Tailing factor 1.32 1.18 1.23 1.32 1.31 1.31
Page 586
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
Figure.4.Standard chromatogram Figure.5.Sample chromatogram
Figure.6.Chromatogram for Specificity Figure.7. Linearity plot for Lamivudine
Figure.8.Linearity plot for Zidovudine Figure.9.Linearity plot for Efavirenz
4. DISSCUSSION
4.1. System suitability: From the system suitability
studies it was observed that retention time of Lamivudine,
Zidovudine and Efavirenz was found to be 2.519, 3.015
and 24.103 min. % RSD of peak area was found to be
0.05.0.04 and 0.26. Theoretical plates were found to be
more than 4000. USP tailing factor was found to be 1.25,
1.32 and 1.12 for Lamivudine, Zidovudine and Efavirenz.
All the parameters were within the limit.
4.2. Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. Hence the proposed method was found to be
specific. 4.3. Linearity: From the Linearity data it was
observed that the method was showing linearity in the
concentration range of 80-120μg/ml for Lamivudine,
Zidovudine and Efavirenz. Correlation coefficient was
found to be 0.9995, 0.9994 and 0.9993 for three
compounds.
Page 587
Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013
4.4. Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were in the range of
99.3%-101.6%, which shows that the method was
accurate.
4.5. Precision
4.5.1. System precision: The percentage relative standard
deviation (RSD) for the peak area of Lamivudine,
Zidovudine and Efavirenz were 0.05, 0.04 and 0.26.
4.5.2. Method precision: The percentage relative
standard deviation for the assay values of Lamivudine,
Zidovudine and Efavirenz were 0.4, 0.2 and 0.4.
4.6. Ruggedness: Comparison of both the results obtained
for two different Analysts shows that the method was
rugged for Analyst-Analyst variability. The %RSD for
intermediate precision for Lamivudine, Zidovudine and
Efavirenz was found to be 0.4, 0.2 and 0.4.
4.7. Robustness
As the % RSD of retention time and asymmetry
were within limits for variation in flow rate (± 0.1
ml). Hence the allowable flow rate should be
within 0.9 ml to 1.1 ml.
As the % RSD of retention time and asymmetry
were within limits for variation (+ 20C) in column
oven temperature. Hence the allowable variation
in column oven temperature is + 20C.
As the % RSD of retention time and asymmetry
were within limits for variation (+ 2 %) in
composition of mobile phase. Hence the allowable
variation in mobile phase composition is ± 2 %.
All the system suitability parameters are within
limits for variation (±2nm) in wavelength. Hence
the allowable variation in wavelength is ± 2nm.
The results obtained were satisfactory and are in
good agreement as per the ICH guidelines.
4.8. Acknowledgement: The authors thankful to Mr. K.
Srinivasa Rao (AGM), Mr. Jyothibasu Director, Mylan
Laboratories for providing necessary facilities to carry out
the research work.
5. CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of ICH
guidelines for method validation. The proposed method
was simple, accurate, specific, precise, robust, rugged and
economical. Hence this method is validated and can be
used for routine sample analysis
REFERENCES
Balamuralikrishna K, Mahendra K. And B. Syama
Sundar, RP-HPLC method for the simultaneous estimation
of Efavirenz, Lamivudine and Zidovudine in tablet dosage
forms, Journal of Pharmacy Research, 4(10), 2011, 3766-
3768.
Pishawikar SA, Jadhav SD, Bhatia M.s and Thamake SL,
UV spectrophotometric method for the estimation of
Lamivudine, Zidovudine and Nevirapine in pure and tablet
formulation, Asian Journal of Research in Chemistry
Issue, 4(3), 2010, 1-3.
M. Kumar, B. Jayakar, C. Saravanan and M. V.
Kumudhavalli, RP-HPLC method for simultaneous
estimation of Lamivudine and Zidovudine in pure and
tablet formulation, J. Chem. Pharm. Res, 1(2), 2010, 478-
481.
Palani Venkatesh, M.Ruthu and Y.Padmanabha Reddy,
Normal phase HPTLC method for the simultaneous
analysis of Lamivudine and Zidovudine in fixed dose
combination tablets, Journal of Pharmaceutical Analysis,
2(2), 2012, 152-155.
Sigonda, Yogendra Singh and Rajiv Sharma, Normal
phase HPTLC method for the simultaneous analysis of
Lamivudine, Stavudine and Nevirapine in fixed dose
combination tablets, Journal of Pharmaceutical and
Biomedical Analysis, 54(3), 2010, 445-450.
Hemanth Kumar and Anil Bhandari, Reverse-phase high
performance liquid chromatographic method for
simultaneous determination of plasma zidovudine and
nevirapine with UV detection at 260 nm, Journal of
Pharmaceutical and Biomedical Analysis, 29(6), 2002,
1081-1088.
Sindhuri and Versha Parcha, High performance liquid
chromatographic method was developed for the
simultaneous estimation of lamivudine, zidovudine and
nevirapine in pharmaceutical dosage forms, Journal of
Chromatography, 7(2) 2013, 353-362.
Jacqueline De Souza, Eunice Kazue Kano, Eunice Emiko
Mori Koono, Simone Grigoleto Schramm, Valentina Porta
and Sílvia Storpirtis, LC–UV Methodology for
Simultaneous Determination of Lamivudine and
Zidovudine in Plasma by Liquid–Liquid Extraction,
Chromatographia, 2(69), 2009, 231-235.
Ashok Peepliwal, Sagar D. Vyawahare and Chandrakant
G. Bonde, Quantitative analysis of Zidovudine containing
formulation by FT-IR and UV spectroscopy, Anal.
Methods, 11, 2010, 1756-1763.
Beckett AH, Stenlake JB, Practical pharmaceutical
chemistry. Vol. II. New Delhi: CBS Publisher and
Distributors, 1986, 13-17.
Skoog, DA Holler, FJ Nieman, T.A. Principles of
instrumental analysis, Thomson Brooks/Cole, Fifth
edition. 1998, 329-335.
Page 588
Page 589
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 589
NOVEL RP-HPLC METHOD DEVELOPMENT AND VALIDATION OF LOSARTAN
POTASSIUM AND AMLODIPINE DRUGS IN PURE AND PHARMACEUTICAL
DOSAGE FORMS Kumari Jyothsna, Chandana N, Vinjam Swathi
Nimra College of Pharmacy, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9492940598
ABSTRACT
A fast, robust and accurate RP-HPLC method was developed and validated for simultaneous determination of
Losartan potassium and Amlodipine in tablets. The mobile phase was mixture of aqueous Tri ethyl amine with pH
2.0 and Acetonitrile(70:30), effluent flow rate monitored at 1.0 ml/min. the stationary phase was C18 column,
3µm(4.6×250mm). The solutions of standard and the sample were prepared in methanol. The retention times was
found to be 2.916min and 5.214min for Losartan potassium and Amlodipine respectively at 246nm. Calibration
graphs constructed at their wavelengths of determination were linear in the concentration range of 50-150µg/ml.
The percentage assay for Losartan potassium and Amlodipine were found to be 101% and 100%respectively. The
method was validated and it was found to be accurate, precise, linear and reproducible as per ICH guidelines.
Keywords: RP-HPLC, Losartan potassium, Amlodipine, Accuracy, Precision, Linearity.
1. INTRODUCTION
Losartan potassium is a [2-butyl-4-chloro-1-({4-
[2-(2H-1,2,3,4-tetrazol-5-yl)phenyl]phenyl}methyl)-1H-
imidazol-5-yl]methanol monopotassium salt. It
competitively inhibits the binding of angiotensin II to AT1
in many tissues including vascular smooth muscle and the
adrenal glands. Inhibition of angiotensin II binding to AT1
inhibits its AT1-mediated vasoconstrictive and
aldosterone-secreting effects and results in decreased
vascular resistance and blood pressure. Losartan
potassium is 1,000 times more selective for AT1 than
AT2. Inhibition of aldosterone secretion may increase
sodium and water excretion while decreasing potassium
excretion. It is effective for reducing blood pressure and
may be used to treat left ventricular hypertrophy and
diabetic nephropathy.
Amlodipine (3-ethyl 5-methyl 2-[(2-
aminoethoxy)methyl]-4-(2-chlorophenyl)-6-methyl-1,4-
dihydropyridine-3,5-dicarboxylate) decreases arterial
smooth muscle contractility and subsequent
vasoconstriction by inhibiting the influx of calcium ions
through L-type calcium channels. Calcium ions entering
the cell through these channels bind to calmodulin.
Calcium-bound calmodulin then binds to and activates
myosin light chain kinase (MLCK). Activated MLCK
catalyzes the phosphorylation of the regulatory light chain
subunit of myosin, Inhibition of the initial influx of
calcium decreases the contractile activity of arterial
smooth muscle cells and results in vasodilation. The
vasodilatory effects of amlodipine result in an overall
decrease in blood pressure. Another possible mechanism
is that amlodipine inhibits vascular smooth muscle
carbonic anhydrase I activity causing cellular pH increases
which may be involved in regulating intracelluar calcium
influx through calcium channels.
Literature survey revealed that very few methods
have been reported for the analysis of Losartan potassium
and Amlodipine combinational dosage forms which
include UV spectroscopy, High performance Liquid
Chromatography, HPTLC methods. The present study
illustrate development and validation of simple, selective,
accurate, economical precise RP-HPLC method for the
determination of Losartan potassium and Amlodipine in
bulk and Pharmaceutical dosage forms as per ICH
guidelines.
The aim of this study is to develop rapid,
economical HPLC method for the analysis of Losartan
potassium and Amlodipine in combined dosage form
using most commonly employed column (C18) and simple
mobile phase preparation. In the present work a successful
attempt had been made to develop a method for the
simultaneous estimation of Losartan potassium and
Amlodipine pharmaceutical dosage form and validate it.
The method would help in estimation of drugs in single
run which reduces the time of analysis and does not
require separate method for each drug. Thus, the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage forms.
2. MATERIALS AND METHODS
Equipments used: Quantitative HPLC was performed on
a high performance liquid chromatography -Waters
e2695Alliance HPLC system connected with PDA
Detector 2998 and Empower2 Software. The drug analysis
data were acquired and processed using Empower2
software running under Windows XP on a Pentium PC
and Agilent Zorbax C18, (3μ, 250 x 4.6mm). In addition
an analytical balance (DENVER 0.1mg sensitivity), digital
pH meter (Eutech pH 510), a sonicator (Unichrome
associates UCA 701) were used.
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 590
Standards and chemicals used: Pharmaceutical grade
Losartan potassium and Amlodipine were kindly supplied
as a gift sample by Dr.Reddy’s Laboratory, Hyderabad,
India. Acetonitrile and methanol was of HPLC grade,
Purchased from E. Merck, Darmstadt, Germany.
Triethylamine was analytical reagent grade supplied by
Fischer Scientific Chemicals. Water HPLC grade was
obtained from a Milli-QRO water purification system.
Losartan potassium and Amlodipine Tablets available in
the market as Losar-A (Unichem pharmaceuticals,
Himachal pradesh, India.) in composition of Losartan
potassium (50mg) Amlodipine (5mg).
Preparation of mobile phase: Transfer water into
1000ml of beaker dissolve and diluted volume with water.
Then adjust its pH to 2.0 with Trithylamine. The Water
adjusted pH to 2 with Triethylamine: acetonitrile (70:30
v/v) and filtered through 0.45µ membrane filter and
degassed by sonication.
Preparation of calibration standards: 10mg Losartan
potassium and 10mg Amlodipine was taken into a 50, 10
ml of Volumetric flask and add 10ml of Diluent and
sonicated for 10 minutes and made up with Diluent.It was
further diluted to get stock solution of Losartan potassium
and Amlodipine (To get 0.2 ppm and 0.02 ppm solution
Respectively). This is taken as a 100% concentration.
Working standard solutions of Losartan potassium and
Amlodipine was prepared with mobile phase. To a series
of 10 ml volumetric flasks, standard solutions of Losartan
potassium and Amlodipine in the concentration range of
0.1-0.3µg/ml and 0.01-0.03µg/ml were transferred
respectively.
System suitability: System suitability is an integral part
of chromatographic system. At first the HPLC system was
stabilized for 40 min. One blank followed by six replicate
analysis of solution containing 100% target concentration
of Losartan potassium and Amlodipine were injected to
check the system suitability. To ascertain the system
suitability for the proposed method, a number of
parameters such as theoretical plates, retention time were
taken and results along with optimized chromatographic
conditions were presented in Table 1.
Recommended procedure:
Calibration curves for Losartan potassium and
Amlodipine: Replicate analysis of solution containing
0.1-0.3µg/ml and 0.01-0.03µg/ml of Losartan potassium
and Amlodipine sample solutions respectively were
injected into HPLC according to the procedure in a
sequence and chromatograms were recorded. Calibration
curves were constructed by plotting by taking
concentrations on X-axis and ratio of peak areas of
standards on Y-axis and regression equation were
computed for both drugs and represented in Table 2.
Analysis of marketed formulation: The content of Ten
tablets were weighed accurately. Their average weights
were determined. Powder of tablets equivalent to two
tablets weight(600.04mg) were weighed and taken in a 50
ml volumetric flask, dissolved in diluents, shaken and
sonicated for about 20 minutes then filtered through
0.45µ membrane filter. The filtered solution was further
diluted (5 to 50ml) in the diluent to make the final
concentration of working sample equivalent to 100% of
target concentration. The prepared sample and standard
solutions were injected into HPLC system according to the
procedure. From the peak areas of Losartan potassium and
Amlodipine the amount of the drugs in the sample were
computed. The contents were calculated as an average of
six determinations and experimental results were
presented in Table 3. The representive standarad and
sample chromatograms were shown in fig. 4and fig.5.
Validation study of Losartan potassium and
Amlodipine: An integral part of analytical method
development is validation. Method validation is the
process to confirm that the analytical procedure employed
for a specific test is suitable for its intended use. The
newly developed RP-HPLC method was validated as per
International Conference on Harmonization (ICH)
guidelines for parameters like specificity, system
suitability, accuracy, linearity, precision (repeatability),
limit of detection(LOD), limit of Quantification(LOQ)
and robustness.
Specificity: The effect of wide range of excipients and
other additives usually present in the formulation of
Losartan potassium and Amlodipine in the determination
under optimum conditions were investigated. The
specificity of the RP-HPLC method was established by
injecting the mobile phase and placebo solution in
triplicate and recording the chromatograms. The common
excipients such as lactose anhydrous, microcrystalline
cellulose and magnesium state have been added to the
sample solution injected and tested.
Precision: precision study of sample (Losartan potassium
and Amlodipine) was carried out by estimating
corresponding responses 6 times on the same day for the
100% target concentration. The percent relative standard
deviation (%RSD) is calculated which is within the
acceptable criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range of
0.1-0.3µg/ml and 0.01-0.03µg/ml (50-150%) Losartan
potassium and Amlodipine respectively. Method of least
square analysis is carried out for getting the slope,
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 591
intercept and correlation coefficient, and the results were
presented in Table 2. A calibration curve was plotted
between concentration and area response and statistical
analysis of the calibration curves were shown in fig 6,7.
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of Losartan
potassium and Amlodipine by the method of addition.
Known amount of Losartan potassium and Amlodipine at
50%, 100%, 150% is added to a pre quantified sample
solution. The recovery studies were carried out in the
tablet in triplicate each in the presence of placebo. The
mean percentage recovery of Losartan potassium and
Amlodipine at each level is not less than 99% and not
more than 101%.
Robustness: The robustness is evaluated by the analysis
of Losartan potassium and Amlodipine under different
experimental conditions such as making small changes in
flow rate (±0.2 ml/min), column temperature (±5).
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified, under the stated experimental
conditions. The limit of quantification is the lowest
concentration of analyte in asample that can be determined
with acceptable precision and accuracy. Limit of detection
and limit of quantification were calculated using following
formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD=
standard deviation of response (peak area) and S= average
of the slope of the calibration curve.
3. RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Losartan potassium and Amlodipine.
Preliminary experiments were carried out by changing the
mobile phase composition and buffers used in mobile
phase. Different experiments were performed to optimize
the mobile phase. By altering the pH of buffer results a
good separation. Different proportions of solvents were
tested. Eventually the best separation was obtained by the
isocratic elution system using a mixture of water (adjusted
the pH to 2 with Triethyl amine): acetonitrile (70:30, v/v)
at a flow rate of 1 ml/min. Several column types and
lengths were tried considering other chromatographic
parameters. C18 column with 250 x 4.6mm length, inner
diameter and 3µm particle size was chosen. The detection
wave length was selected as 246nm with PDA detector. A
typical chromatogram for simultaneous estimation of the
two drugs obtained by using a above mentioned mobile
phase. Under these conditions Losartan potassium and
Amlodipine were eluted at 2.916min and 5.216min
respectively with a run time of 6 minutes. The
representative chromatogram of this simultaneous
estimation shown in fig. 3,4,5 and system suitability
results along with optimized chromatographic conditions
were summarized in Table 1.
The method shows linearity between the
concentration range of 0.1-0.3µg/ml for Losartan
potassium and 0.01-0.03µg/ml for Amlodipine. The
experimental results were shown in table 6 and fig 6, 7.
The % recovery of Losartan potassium and Amlodipine
was found to be in the range of 99.5 to 100 % & 99 to
100.33% respectively, the results wer shown in Table 4.
As there was no interference due to excipients and mobile
phase, the method was found to be specificresults were
shown inTable 2 and fig 3,4,5. The precssion obtained
was within the limits i.e., RSD<2 which would indicate
that the proposed method was quite precise and
reproducible and results were shown in Table 3. The
method was robust and rugged as observed from
insignificant variation in the results of analysis by
changes in Flow rate, column oven temperature. The
results were shown in Table 5. The LOD and LOQ values
were calculated based on the standard deviation of the
response and the slope of the calibration curve at levels
approximately the LOD and LOQ. The limit of detection
was obtained as 0.000633µg/mL for Losartan potassium
and 0.000069µg/mL for Amlodipine. The limit of
quantitation was obtained as 0.0021µg/mL for Losartan
potassium and 0.00023µg/mL for Amlodipine which
shows the method is very sensitive.
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 592
Table.1. Optimized chromatographic conditions and system suitability parameters for proposed method
Parameter Chromatographic conditions
Instrument Waters e2695 Alliance HPLC with Empower2 software
Column Agilent Zorbax C18, (3μ, 250 x 4.6mm)
Detector PDA Detector 2998
Diluents Methanol
Mobile phase Aqueous triethylamine(Ph 2.0): acetonitrile (70:30 v/v)
Flow rate 1ml/min
Detection wavelength 246nm
Temperature Ambient(35°c)
Injection volume 5µl
Retention time
Losartan potassium 2.91
Amlodipine 5.21
Theoretical plate count
Losartan potassium 8216
Amlodipine 8081
Tailing factor
Losartan potassium 1.59
Amlodipine 1.43
Resolution factor 12.25
Table.2. Specificity study
Name of the solution Retention time in min
Blank No peaks
Losartan potassium 2.91
Amlodipine 5.21
Table.3. Results of precision study
Sample Injection number Precision
RT Peak area
Losartan potassium
1 2.920 6126639
2 2.919 6167905
3 2.916 6160774
4 2.919 6188024
5 2.915 6138705
6 2.917 6127062
Mean 6156494
%RSD(NMT 2.0) 0.40
Amlodipine
1 5.216 9971154
2 5.214 9966863
3 5.212 9970936
4 5.214 9990844
5 5.207 9954087
6 5.207 9963155
Mean 9969177
%RSD(NMT 2.0) 0.12
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 593
Table.4. Recovery data of the proposed Losartan potassium and Amlodipine
Sample SpikedAmount
(µg/ml)
RecoveredAmount
(µg/ml)
%Recovered %Average
recovery
Losartan
potassium
49.5 49.95 101
101% 99 100.26 101
148.5 149.56 101
Amlodipine
4.95 4.94 100
100.33% 9.9 9.93 101
14.85 14.96 100
Table 5: Robustness results of Losartan potassium and Amlodipine
Table.6.Linearity data of the Losartan potassium and Amlodipine
Table.7.Limit of Detection and Limit of Quantification
S.NO Sample LOD LOQ
1. Losartan potassium 0.000633µg/ml 0.0021µg/ml
2. Amlodipine 0.000069µg/ml 0.00023µg/ml
sample parameters Optimized used RT Peak area Plate count
Losartan
potassium
Flow rate
(±0.2)
1ml/min
0.8 3.408 5159863 7861
1 2.916 6100287 7868
1.2 2.910 6134592 7958
Temperature
(±5°C)
35°C
30 3.408 5159863 7794
35 2.916 6100287 7868
40 2.908 6141851 7862
Amlodipine
Flow rate
(±0.2)
1ml/min
0.8 5.933 8217887 7746
1 5.214 9833918 7660
1.2 5.166 9942019 7764
Temperature
(±5°C)
35°C
30 5.953 8217887 7751
35 5.214 9833918 7660
40 5.167 9954276 7765
S.NO sample Linearity level
(µg/ml)
Peak area Slope Y-intercept r²
1.
Losartan
potassium
0.1 3053242
19288
99780.88
0.9999 0.15 4539421
0.2 6105323
0.25 7616656
0.3 9188085
2.
Amlodipine
0.01 4913960
16616
61387.68
0.9999 0.015 7471465
0.02 9978009
0.025 12408307
0.03 19972978
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 594
Fig 1: Structure of Losartan potassium Fig 2: Structure of Amlodipine
Fig.3: Chromatogram of Blank solution
Fig 4: Chromatogram of standard solution
Fig 5: Chromatogram of marketed formulation
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 595
Fig. 6: Linearity of Losartan potassium
Fig. 7: Linearity of Amlodipine
4. CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Losartan potassium and Amlodipine in
tablet dosage forms in bulk and pharmaceutical dosage
forms was established. The developed HPLC technique is
precise, specific, robust and accurate. Results of analysis
of pharmaceutical formulations reveal that the proposed
methods are suitable for their analysis with virtually no
interference of the usual additives presented in
pharmaceutical formulations. This method is simple,
reliable, accurate, linear, sensitive, economical and
reproducible. Hence it can be concluded that the proposed
method was a good approach for obtaining reliable results
and found to be suitable for the routine analysis of
Losartan potassium and Amlodipine in Bulk drug and
Pharmaceutical formulations.
5. ACKNOWLEDGEMENT
The authors would like to thank beloved parents
and all my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
AV Kasture and Madhuri Ramteke, Simultaneous UV-
spectrophotometric method for the estimation of atenolol
and amlodipine besylate in combined dosage form, Indian
J Pharm Sci, 68, 2006, 394-6
Chaudhari BG, Patel NM and Shah PB, Stability
indicating RP-HPLC method for simultaneous
determination of atorvastatin and amlodipine from their
combination drug products, Chem Pharm Bull (Tokyo),
55(2), 2007, 241-6.
D. N. Vora and A. A. Kadav, Development and validation
of a simultaneous HPLC method for estimation of
Bisoprolol Fumarate and Amlodipine besylate from
tablets, Indian J Pharm Sci, 70(4), 2008, 542–546
0
2000000
4000000
6000000
8000000
10000000
12000000
14000000
16000000
0 50 100 150 200
AR
EA
CONC%
AMLODIPINE
LINEAR
r²=0.9999
Y=16616X+61387.68
0
2000000
4000000
6000000
8000000
10000000
0 50 100 150 200
AR
EA
CONC%
LOSARTAN POTASSIUM
LINEAR
Y=19288X+99780.8
r²=0.9999
Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 596
ICH, Q2A validation of analytical procedure:
Methodology International Conference on Harmonization,
Geneva, October 1994.
ICH, Q2B Validation of analytical procedure:
Methodology International Conference on Harmonization,
Geneva, March 1996.
Loyd R. Snyder, Practical HPLC Method Development,
4th ed, A-Wiley-inter Science publication, 1997, 234-
265.
R. Sharma, S. Khanna and G. P. Mishra, RP-HPLC
method for simultaneous estimation of atenolol,
hydrochlorothiazide and losarton in tablet dosage form
Chem Sci Trans., 2013, 2(S1), S1-S6.
Ramya Gavini, S. B. Puranik, G. V. S. Kumar and K. A.
Sridhar, Simultaneous estimation of Amlodipine and
Losartan by UV-method in bulk drug and tablet dosage
formulation, Archives of Applied Science Research, 4 (5),
2012, 2206-2212.
Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 597
FORMULATION AND IN-VITRO EVALUATION OF ORNIDAZOLE GASTRORETENTIVE
TABLETS BY USING LOW DENSITY SWELLABLE POLYMERS Abeda Aqther
*, B. Pragati kumar, Peer Basha
Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email:[email protected]
ABSTRACT
Gastro retentive drug delivery systems have shown to be of better significance in controlling release rate for
drugs having site specific absorption. The present study was an attempt to develop floating tablets of ornidazole
which on oral administration prolongs its gastric residence time there by increasing bioavailability. Ornidazole an
oral antiprotozoal having narrow absorption window in the upper and lower part of gastrointestinal tract, floating
matrix tablet using gas generating agent sodium bicarbonate and hydrophilic polymer Hydroxy propyl methyl
cellulose by wet granulation technique. Preformulation studies were carried out to optimize the required quantity
for HPMC K4M(10%), Eudragit(8%) was used. formulations were prepared using either HPMC k50, HPMC
k100, HPMC k4, Xanthan gum, Ethyl cellulose with carbopol 934P. For F1 to F8 formulation HPMC
concentration was increased to control the release of drug from the dosage form and for F11 formulation Eudragit
concentration was increased to obtain viscosity. Fourier transform Infrared spectroscopy confirmed the absence of
any drug/polymers/excipients interactions. F11 Formulations showed in-vitro buoyancy 9 hrs. The concentration
of HPMC K4 was increased to control the release of drug from the dosage form for F11 , the concentration was
increased for Eudragit to increase the binding nature . The cumulative % drug release of F11 formulation was
found to be Ornidazole (92.8%) at the end of 9th hr. The formulation containing HPMC k4m and Eudragit showed
better results compared to other formulated batches. Further Stability studies studies can be performed to ensure
the efficacy of the formulated floating tabets.
KEYWORDS: Ornidazole, HPMC, Floating lag time, swelling index, in-vitro buoyancy, Hrdro dynamically
balanced systems, Gastro intestinal tract.
INTRODUCTION
The idea of gastro retention systems from the need
to localize drugs at specific region of Gastro intestinal
tract such as stomach in the body. Often, the extent of
drug absorption is limited by the residence time of the
drug at absorption site (Bardonn et al.2006). The
therapeutic window of many drugs is limited by their short
circulating half-life and absorption via a defined segment
of the intestine. Such pharmacokinetic limitations lead in
many cases to frequent dosing of these medications to
achieve the required therapeutic effect. The phenomenon
of absorption via a limited part of the Gastro intestinal
tract has been termed the "narrow absorption window”;
once the dosage form passes the absorption window, the
drug will be neither bioavailable nor effective (Streubel et
al.2006). A rational approach to enhance bioavailability
and improve pharmacokinetic and pharmacodynamic
profiles is to retain the drug reservoir above its absorption
area, i.e., in the stomach and to release the drug in a
controlled manner, so as to achieve a zero order kinetics
(i.e., "oral infusion") for a prolonged period of time
(Stithit et al.1988).
MATERIALS AND METHODS
Marerials : Ornidazole, Indian Drugs, HYD. HPMC K4,
Qualikens, Vadodara. Eudragit, SD Fine Chem .Ltd.
Mumbai. sodium bicarbonate, Merck, Mumbai. citric acid
Finar reagents, Ahmedabad.
Method of Preparation of Ornidazole Gasro retentive
tablets: Granules were prepared by using wet granulation
technique. Drug and Eudragit were weighed and taken in
to motor. Finally the active ingredient was mixed
homogeneously according to geometric proportions. (2%)
HPMC 5CPS solution acts as granulating agent.The
coherent mass was thoroughly sieved through 16 mesh
and then dried in hot air oven at 50ºC for 45 min. The
dried granules were passed through sieve no 20 to get
uniform granules.To this calculated amount of Magnesium
Stearate (1%) and Talc (1%) were added as a lubricant.
Citric acid and sodium bicarbonate were incorporated as a
gas-generating agent.
Evaluation of floating tablets: Pre-formulation studies
were performed on the drug and excipients which includes
bulk density, tapped density, corr’s index, Hausner’s ratio
and compatability studies.The formulated tablets were
evaluated for its Thickness, hardness, friability, weight
variation,in-vitro buoyancy, swelling index, floating lag
time, in-vitro dissolution studies (Ramesh Bomma et al.
2009).
Evaluation of floating tablets: Pre-formulation studies
were performed on the drug and excipients which includes
bulk density, tapped density, corr’s index, Hausner’s ratio
and compatability studies.The formulated tablets were
evaluated for its Thickness, hardness, friability, weight
variation,in-vitro buoyancy, swelling index, floating lag
time, in-vitro dissolution studies (Ramesh Bomma et al.
2009).
Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 598
Table.1.Composition of Floating Tablets Containing Ornidazole
Ingredients (Mg) F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
Ornidazole 500 500 500 500 500 500 500 500 500 500 500 500
Hpmc5cps -- -- -- 60 60 60 30 60 50 40 40 40
HPMCK4 -- -- -- -- -- -- -- -- -- -- 40 --
HPMCK15 50 50 70 70 70 -- -- -- -- -- -- 40
HPMCK100 50 -- -- -- --- --- --- -- 50 50 30 --
Ethyl Cellulose 30 60 60 80 -- -- -- 60 -- -- -- --
Eudragit -- -- -- -- -- -- -- -- -- -- -- --
Xanthungum -- -- -- -- -- -- -- -- 50 70 -- 80
Carbopol934 50 70 50 -- -- -- -- -- -- -- -- --
Sod..Bicarbonate 40 40 40 30 20 70 50 60 50 50 50 50
Citricacid 30 30 30 20 10 30 50 50 30 30 30 30
TOTAL (Mg) 750 750 750 750 750 750 750 750 750 750 750 750
RESULTS AND DISCUSSION
Construction of calibration curve of Ornidazole: The
standard calibration curve yields a straight line, which
shows that the drug follows Beer’s law in the
concentration range of 5- 25 μg. The solutions were
scanned in U.V/Visible double beam spectro photometer
against ethanol as a blank.at 302 nm a standard graph was
plotted by keeping the known concentration on X – axis
and obtained absorbance on Y – axis.
Drug –Polymer Compatibility Studies By FTIR: Drug
polymer compatibility studies were performed by FTIR
(Fourier transform infrared spectroscopy). FTIR
absorption spectra of Ornidazole, HPMCK4,
HPMC5cps,Eudragit, xanthan gum and the combination of
drugs, polymers and excipients showed no significant
interaction between Ornidazole and polymer.
Pre-formulation studies: The formulated batches were
evaluated for Preformulation studies that are Angle of
repose, Carr’s index and Hausner’s ratio, the values
obtained for that studies are tabulated in Table no 2.The
values were found to be in the range from 25.64˚±0.01 to
31.3˚±0.05, 9.37±0.01 to12.5±0.01, 1.07±0.01
to1.14±0.01% respectively. This indicates good flow
property of the granules for compression.
Physical properties: The formulations were evaluated for
physicochemical parameters like hardness, thickness,
weight variation, friability, floating lag time and swelling
index. The values obtained for that studies are tabulated in
Table no 3. Floating properties from the evaluation results
it was observed that the tablets containing Eudragit and
HPMC K4M, F11 showed greater in vitro buoyancy time
and when compared to other prepared formulation.
Swelling index of floating tablets showed significant
differences in their swelling index due to the presence of
low density swellable polymers.
In-vitro drug release studies of Ornidzole: Formulations
F1, F2, F3 and F4 containing HPMC alone and
Combination of HPMC and Carbopol. The Formulations
F1 has shown release 83.6% at the end of 9th
h,
Formulations F2 has shown release 74.9% at the end of 9th
h, Formulations F3 has shown release 82.4% at the end of
9th
h, Formulations F4 has shown release 69.7% at the end
of 9th
h.
Formulations F5, F6, F7, F8, F10, and F12
containing Combination of HPMC5cps and HPMC K50
were prepared. The Formulations F5 has shown release
85.2% at the end of 9th
h, Formulations F6 has shown
release 80.6% at the end of 9th
h, Formulations F7 has
shown release 83.2% at the end of 9th
h, F8 has shown
release 77.1% at the end of 9th h, Formulations F9 has
shown release 82.4% at the end of 9th h, Formulations F12
has shown release 88.7% at the end of 9th h. Formulations
F10 and F11 containing Combination of HPMC and
Xanthan gum, Eudragit. The Formulations F10 and F11
have shown release 92.6% and 95.3% respectively at the
end of 9thh. the values obtained for that studies are
tabulated in Table no 4.
In-Vitro Buoyancy: In-vitro buoyancy which was greater
than 9 hrs, for formulation F11. In vitro Buoyancy of the
formulations F10, 11 is increased, which may be due to
high concentration of HPMC. The values of In vitro
Buoyancy for All formulations were given in Table no.5.
Kinetics of drug release: Based on mathematical models, it was concluded that for
mulation F11,the regression(r=0.99) value was found to
be 0.99 fitted into zero order release kinetics.The slope
value for peppas model was found to be with in 0.45-0.89
hence it is folllows non fickens diffussion. Non fickens
diffision refers to combination of both diffusion and
erossion controlled.
Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 599
Figure.1. FTIR Spectra Data for Pure Ornidazole Figure.2.FTIR Spectra of Drug+ Polymers +Excipients
Figure.3. FTIR Spectra of Polymers+ Excipients Figure.4. Standard Curve of Ornidazole.
Table.2. Results for Derived and Flow properties
Formulation
code
Derived Properties Flow Properties
Bulk density
(mean±SD) g/ml
Tapped density
(mean±SD) g\ml
Angle of repose
(mean±SD)
Carr’s index
(mean±SD)
Hausner’s ratio
(mean±SD)
F1 0.29±0.01 0.33±0.04 26.5±0.01 12.1±0.01 1.137±0.01
F2 0.29±0.03 0.32±0.03 28.8±0.03 9.37±0.01 1.103±0.02
F3 0.35±0.01 0.39±0.01 27.02±0.04 10.2±0.02 1.114±0.03
F4 0.42±0.02 0.45±0.03 27.02±0.01 10.6±0.01 1.071±0.01
F5 0.35±0.01 0.39±0.01 27.1±0.05 10.2±0.01 1.114±0.02
F6 0.28±0.04 0.32±0.02 25.64±0.02 12.5±0.01 1.142±0.01
F7 0.34±0.03 0.37±0.02 27.2±0.04 12.4±0.01 1.088±0.04
F8 0.30±0.01 0.33±0.01 31.3±0.01 9.7±0.03 1.1±0.01
F9 0.37±0.02 0.42±0.04 29.2±0.03 11.9±0.02 1.135±0.02
F10 0.38±0.01 0.41±0.03 27.4±0.01 10.3±0.01 1.078±0.01
F11 0.35±0.04 0.39±0.01 27.02±0.05 10.4±0.01 1.114±0.01
F12 0.28±0.01 0.32±0.04 25.64±0.01 12.5±0.02 1.142±0.02
Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 600
Table.3. Physico chemical parameters of all formulations
Formulations Thickness
(mm)
Hardness
(Kg/cm2)
Friability
(%)
Weight
variation (mg)
Floating lag
time (Sec)
Swelling index (%)
F1 3.4 2.9 0.93 958 - 207.5
F2 3.4 3.7 0.86 964 - 192.8
F3 3.8 2.9 0.78 943 - 279.2
F4 3.2 3.4 0.92 947 - 348.6
F5 3.4 2.8 0.81 739 - 316.8
F6 3.2 2.8 0.72 742 - 184.3
F7 3.4 3.1 0.67 756 - 175.4
F8 3.5 2.6 0.91 763 - 262.5
F9 3.7 3.1 0.75 749 - 300.4
F10 3.4 2.9 0.89 743 29 324.3
F11 3.8 2.9 0.78 742 37 279.2
F12 3.2 2.8 0.72 768 26 184.3
Table.4. In-Vitro Drug Release Profile of F1 – F12
Time
(hrs)
Cumulative % drug release (%)
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
0 0 0 0 0 0 0 0 0 0 0 0 0
1 19.6 18.9 15 12.9 23 21.2 23.7 17.2 15.8 19.2 18.1 15.3
2 28.2 26.4 22.2 20.2 30.3 28.7 33.8 23.7 21.6 28.6 29.8 27.1
3 38.4 33.4 29.2 27.1 38.3 35.8 41.5 29.9 33.8 39.4 37.1 38.6
4 45.6 39.9 35.4 33.3 45.4 42.2 52.1 37.2 41.8 51.7 48.3 49.8
5 56.4 46.9 42.6 40.4 52.6 49.8 58.6 44.2 49.7 63.9 59.8 57.4
6 67.2 54.6 49.6 47.1 59.9 57.2 64.9 51.4 57.8 74.3 67.4 64.8
7 76.1 61.1 55.8 53.2 68.1 64.3 71.7 58.7 64.7 82.7 81.9 74.4
8 79.2 66.6 62.8 60.2 76.5 71.4 79.2 65.3 73.7 86.3 88.3 81.1
9 83.6 74.9 86.4 69.7 85.2 80.6 83.8 77.1 82.4 92.6 95.3 88.7
Figure.5.Cumulative % Drug Releae Profile of F1-F12.
Table.5. In-Vitro buoyancy
Formulations In vitro buoyancy(hrs) Formulations In vitro buoyancy(hrs)
F1 - F7 -
F2 - F8 -
F3 - F9 -
F4 - F10 08
F5 - F11 09
F6 - F12 <6
0
20
40
60
80
100
120
0 5 10
Cu
mu
lati
ve
% d
rug
rele
ase
Time(hrs)
Cumulative % drug release of
F1-F12
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11
Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 601
Figure.6.Ornidazole Drug Releae Profile of F11 Showing
Zero Order Kinetics
Figure.7.Ornidazole Drug Releae Profile of F11 Showing First
Order Kinetics
CONCLUSSION
The present study was aimed at developing an oral
floating system for Ornidazole using combination of
polymers like HPMCK4 and Xanthan gum and Eudragit
the floating tablets were prepared by using wet granulation
technique. Granules were evaluated for Preformulation
studies that are Angle of repose, Carr’s index and
Hausner’s ratio This indicate good flow property of the
granules for compression. The floating tablets of
Ornidazole were evaluated for physicochemical
characteristics like thickness, hardness, weight variation,
friability, floating lag time and swelling index. The in-
vitro buoyancy studies, in-vitro drug release studies,
results were found that the optimized formulation F11
(9hrs) has better in vitro release profiles due to the
presence of low density swellable polymers in the
formulation and these polymers were also control the drug
release rate for long period of time .
REFERENCES
Bardonn P.L, Faivre, Pugh, Piffaretti Falson,
Gastroretentive dosage forms: Overview and special case
of Helicobacter pylori, J.Control. Re, 111, 2006, 1-18.
Shweta Arora, Javed Ali, Alka Ahuja, Roop K. Khar
and Sanjula Baboota, Floating Drug Delivery Systems: A
Review, AAPS Pharm Sci Tech, 6, 2005, 372-390.
Streubel A, Siepmann J, Bodmeier R, Drug delivery to the
upper small intestine window using Gastroretentive
technologies, Curr Opin Pharmacol, 6, 2006, 501-508.
Sasak.K, Nageswara Rao, Manavalan.R, and Rama Rao.P,
Development and in vitro Evaluation of an oral floating
matrix tablet formultion of ciprofloxacin, Indian J. Pharm.
Sci, 66, 2004, 313-316
Streubel A, Siepmann J, Floating matrix tablets based on
low density foam powder: effects of formulation and
processing parameters on drug release, European Journal
of Pharmaceutical Sciences, 18, 2003, 37–45.
Ramesh R, Putheti, Mahesh C, Patil, Pharmaceutical
Formulation and development of Floating and Swellable
sustained drug delivery systems: a review. e-Journal of
Science & Technology, 4 (2), 2009, 1-12.
Mayavanshi S.S, Gajjar, Floating drug delivery systems to
increase gastric retention of drugs: A Review. Research J.
Pharm. and Tech, 1(4), 2008, 345-348.
Stithit .S, Chen .W, Price J. C, Development and
characterization buoyant theophylline microspheres with
near zero order release kinetics, Microencapsulation, 15,
1988, 725-737.
Ramesh Bomma, Rongala Appala, Swamy Naidu,
Development and evaluation of gastro retentive
norfloxacin floating tablets, Acta Pharm, 59, 2009, 211–
221.
Indian Pharmacopoeia, The Controller of Publications:
Delhi, 2, 1996, 734-36.
Talukder and Fassihi R, Gastroretentive Delivery Systems
A Mini Review. Drug Development and Industrial
Pharmacy, 30 (10), 2004, 1019–1028.
Fell J. T, Whitehead L, Collet H, Prolonged
Gastricretention using floating dosage forms, Pharm
Technol, 2000; 24(3), 2000, 82-90.
Sauzet C. Claeys-Bruno M, An innovative floating gastro
retentive dosage system: Formulation and in vitro
evaluation, International Journal of Pharmaceutics, 378,
2009, 23–29.
y = 10.361x + 5.9273
R² = 0.9913
0
20
40
60
80
100
120
0 1 2 3 4 5 6 7 8 9 10
% C
um
ula
tive
Dru
g
Rel
ease
Time (hr)
Zero Order
y = -83.042x + 92.951
R² = 0.9174
0
10
20
30
40
50
60
70
80
90
100
0 0.2 0.4 0.6 0.8 1 1.2 % D
rug R
elea
se
Rem
ain
ing
Log Time
First Order
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 602
FORMULATION AND EVALUATION OF FENOFIBRATE TABLETS PREPARED BY
EMPLOYING BIOAVAILABILITY ENHANCEMENT TECHNIQUE Siva kothapally, Pragati Kumar Bada, Harish G
Nimra College of Pharmacy, Jupudi, Ibrahimpatnam, Vijaywada, India
*Corresponding author:[email protected]
ABSTRACT
Developing novel methods to increase the bioavailability of drugs that inherently have poor aqueous
solubility is a great challenge to solid dosage form formulators. Although numerous methods are available to
improve the solubility and/or dissolution rate of poorly soluble drugs, the most promising method for promoting
dissolution is the formation of solid dispersions. The aim of the present study was to prepare and evaluate
Fenofibrate tablets by using a combined approach of Solid dispersion technique and direct compression with
super disintegrant. The tablets were evaluated for weight variation, friability, hardness, in vitro disintegration
time, in vitro drug release profile .And there is no interactions find in FTIR studies. The obtained results showed
that low weight variation. Good hardness, acceptable friability. All the formulation disintegrated within 10-60
seconds and the drug release shows 98.8%. The formulation containing Povidone and superdisintegrants showed
better performance in disintegration and drug release profile.
Key words: Fenofibrate, Bioavailability, Solid dispersion
INTRODUCTION
The proper design and formulation of a dosage
form requires consideration of the physical, chemical and
biological characteristics of all the drug substances and
pharmaceutical ingredients to be used in fabricating the
product. An important physicochemical property of a drug
substance is solubility, especially aqueous system
solubility. A drug must possess some aqueous solubility
for therapeutic efficacy. From an economical point of
view low oral bioavailability results in wasting of a large
portion of an oral dose and adds to the cost of drug
therapy especially when the drug is an expensive one.
Although most of the drugs have encouraging
experimental data obtained in vitro, the in vivo results
have been disappointing. The attributes include
Poor absorption, rapid degradation, and lamination
(peptides and protein) resulting in insufficient
concentration,
Drug distribution to other tissues with high drug toxicities
(anticancer drugs),
Poor solubility of drugs, and
Fluctuations in plasma levels owing to unpredictable
bioavailability.
Solubility is defined in quantitative terms as the
concentration of solute in a saturated solution at a certain
temperature, and in a qualitative way, it can be defined as
the spontaneous interaction of two or more substances to
form a homogeneous molecular dispersion. Statements of
solubilities are indicated by a descriptive phrase and are
intended to apply at 20-300C. The following table
indicates the meaning of the terms used in statements of
approximate solubilities (Brahmankar, 1999).
MATERIALS AND METHODS
Materials:Fenofibrate was obtained as a gift sample from
Micro labs, Bangalore, Povidone, β- Cyclodextrin,
Sodium starch glycolate was obtained from Signet
Chemical Corp, Cross cormellose sodium, Manitol,
Aspartame, Microcrystalline cellulose, Magnesium
Stearate and Talc were obtained from Nice Chemicals
Laboratory, Cochin.
Methods:
Drug - Polymer Compatibility Studies By FTIR:
Fourier-transform infrared (FT-IR) spectra were obtained
by using an FT-IR spectrometer-430 (Perkin Elmer FTIR
spectrophotometer) by potassium bromide (KBr) pellet
method. The samples(Fenofibrate and β-Cyclodextrin,
Povidone combination)were previously ground and mixed
thoroughly with potassium bromide, an infrared
transparent matrix, at 1:5 (Sample: KBr) ratio,
respectively. The KBr discs were prepared by
compressing the powders at a pressure of 5 tons for 5
minutes in a hydraulic press. Scans were obtained at a
resolution of 4 cm-1
, from 4000 to 450 cm-1
Preparation of Fenofibrate tablets by solid dispersion
method
Preparation of solid dispersions by solvent evaporation
(1:1) Fenofibrate: β-cyclodextrine and Povidone K30: The SD of Fenofibrate with β-cyclodextrine and povidone
K 30 simultaneouslyin 1:1ratio was prepared by solvent
evaporation technique, the drug is weighed of 3gm it was
dissolved in the chloroform of 20 ml in a beaker of 50 ml
and kept a side then the 3gmof β-cyclodextrine/ povidone
was weighedand dissolved in 20 ml methanol and stirred
well in the 50 ml beaker. Then drug solution is poured into
the china dish then the polymer solution was added to it
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 603
and stirred well. Then the mixed solution was kept in the
incubator for drying and avoids contamination for 3 to 4
days after drying the dried particles were scraped out from
the china dish and weighed and stored (Tejas patel, 2010).
Preparation of Fenofibrate tablets by direct
compression (Usui, 1998): The amount of complex
equivalent to 40mg of drug were taken and then mixed
with directly compressible diluents and superdisintegrants
in a plastic container. Mg. stearate and talc were passed
through sieve no.60, mixed and blended with the initial
mixture in the plastic container followed by compression
of the blend. Compression was performed on a Cadmach
16 station tablet compression machine using 8mm
punches.
RESULTS AND DISCUSSION
Post compression properties
Thickness: The Fenofibrate tablets showed thickness in
the range of 3.1 – 3.8mm and no significance difference in
the weight of individual formulations. From the average
value was observed and variations within the limits.
Hardness: The difference in the hardness did not affect
the release of the drug from hydrophilic matrices which is
2.8–3.7 kg/cm2.
Weight variation: The weight variation was found in all
designed formulations in the range 343 to 354 mg. The
mean weight variation test results are tabulated in Table
no 8. All the tablets passed weight variation test as the
average percentage weight variation was within 7.5% i.e.
in the pharmacopoeia limits.
Friability: Tablet strength was tested by Roche
Friabilator. The friability of all formulations in limits is
below 1%. The friability of all formulations was observed
within the range of 0.45±0.1 - 0.61±0.2. The values were
given in table no 8.
Wetting time: Wetting time is closely related to the inner
structure of the tablet. The results of wetting time are
shown in Table no 8. The wetting time of Fenofibrate
tablets prepared by solid dispersion method were found to
be in the range of 12.62 to 86.75 sec.
Compatibility Studies: IR spectra of Fenofibrate pure
drug, FP1 Formulation illustrated in Table.5, Figure.2.
Characteristic peaks of Fenofibrate at 2213.46 cm-1
(O-H
stretching), 3533.59 cm-1
(O-H stretching), 2944.61 cm-1
(O-H stretching), 1518.15 cm-1
(C=O stretching) 1592.36
cm-1
(N-H bending), 1542.03 cm-1
(N-H bending), 1382.93
cm-1
(O-H bending) were observed. For the determine the
drug-compatability studies. The drug and drug-excipients
are kept in Desicator for one month,after one month it was
observed that,there is no colour change and Degradation
of compound, this study were conclud there is no
compatability between drug and excipient.the results were
shown in the Table no:6.
Formulations FB1, FB2, FB3, FB4 were made by
using increasing concentrations of β- Cyclodextrin with
40mg of Fenofibrate. The details of the formula were
given in Table no:1 .The formula mixtures were evaluated
for tests such as bulk density, tapped density, angle of
repose,cars index, hausners ratio. The results were shown
in the Table.7. The compressed Tablets were tested for
weight variation, thickness, hardness, friability, and
Wetting time, the results were shown in the Table no: 8. In
vitro disintegration time study was observed for the
formulation FB1,FB2,FB3,FB4 it was found to be in the
range of 31.67-43.82 sec The results were shown in
Table.9. Drug release profiles of formulations FB1, FB2,
FB3, FB4 were conducted for about 35min. The results
were shown in Table.10.
Formulations FP1, FP2, FP3, FP4 were made by
using increasing concentrations of Povidone with 40mg of
Fenofibrate. The details of the formulae were given in
Table no:2 The formula mixtures were evaluated for tests
such as bulk density, tapped density, angle of repose,cars
index, hausners ratio. The results were shown in the Table
no:7. The compressed Tablets were tested for weight
variation, thickness, hardness, friability, and wetting time
of dosage units, the results were shown in the Table.8. In
vitro disintegration time study was observed for the
formulation FP1,FP2,FP3,FP4 it was found to be in the
range of 22.63-35.65 sec The results were shown in
Table.9. Drug release profiles of formulations FP1, FP2,
FP3, FP4 were conducted for about 35min. The results
were shown in Table.10.
Based on mathematical models, the
formulation FP1, the regresion(r=0.99) value was found to
be 0.99 fitted into first order release kinetics , the results
were shown in the Table no:11.The slope value for first
order Kinetics of FP1 formulation was found to be with in
0.45-0.99 hence it is folllows non fickens diffussion.
The comparative in-vitro dissolution study of best
formulation (FP1) shows maximum drug release 98.83%
of Fenofibrate at the end of 35min and the marketed
product conventional tablet (FENOGLIDE) shows
maximum drug release 96.51% of at the end of 45min.The
values were given in Table.12. The represented graph
presented in Fig.4.
Drug-excipients compatibility studies by observing
physical appearance: The drug and drug-excipients are
kept in Desicatorn for one month, after one month it was
observed that, there is no colour change and Degradable of
compound, this study were conclude there is no
compatibility between drug and excipient.
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 604
Preformulation studies: The flow properties and other
derived properties evaluated for all the 8 formulations
were proved to be within limits showing good flow
properties. The physical properties like bulk density,
tapped density, angle of repose, compressibility index, and
Hausner’s ratio were calculated and tabulated in Table.7.
In-vitro disintegration time: The time taken to undergo
complete disintegration. Rapid disintegration within
several minutes was observed in all the formulations. The
in-vitro disintegration time of Fenofibrate fast dissolving
tablets prepared by Solid dispersion method were found to
be in the range of 22.63 to 43.82seconds.
In-vitro drug release studies: In-vitro drug release
studies were performed for all the prepared formulation by
using Phosphate buffer (pH 6.4) as dissolution medium
and measuring drug concentration UV- Spectrophoto
metrically at 287 nm.
Table.1.Preparation of solid dispersion of Fenofibrate with β-cyclodextrine
Formulation Drug and Polymer Drug to polymer ratio Methods
FB1 Fenofibrate(3gm)
and
β-cyclodextrine
1:1 Solvent
evaporation FB2 1:2
FB3 1:3
FB4 1:4
Table.2.Preparation of solid dispersion of Fenofibrate with povidone
Formulation Drug and Polymer Drug to polymer ratio Method
FP1 Fenofibrate(2gm)
and
Povidone
1:1 Solvent
evaporation FP2 1:2
FP3 1:3
FP4 1:4
Table.3.Composition of tablets contain Fenofibrate with β-cyclodextrine
Ingedients FB1(1:1) FB2(1:2) FB3(1:3) FB4(1:4)
Amount of complex equivalent
to 40 mg of Fenofibrate
80mg 120mg 160mg 200mg
Croscarmellose sodium 20 20 20 20
Sodium starch glycolate 15 15 15 15
MCC 60 60 60 60
Mannitol 155 115 75 35
Talc 10 10 10 10
Mg stearate 10 10 10 10
Total 350mg 350mg 350mg 350mg
Table.4.Composition of tablets contain Fenofibrate with povidone
Ingedients FP1(1:1) FP2(1:2) FP3(1:3) FP4(1:4)
Amount of complex equivalent
to 40 mg of Fenofibrate
80mg 120mg 160mg 200mg
Croscarmellose sodium 20 20 20 20
Sodium starch glycolate 15 15 15 15
MCC 60 60 60 60
DC-Mannitol 155 115 75 35
Talc 10 10 10 10
Mg stearate 10 10 10 10
Total 350mg 350mg 350mg 350mg
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 605
Figure.1.FTIR Study of Fenofibrate (Pure Drug) Figure.2.FTIR Study of Fenofibrate and povidone(FP)
Figure.3. FTIR Study of Fenofibrate and β-cyclodextrine(FB)
Table.5.FTIR Spectra Data for Fenofibrate
Frequency cm-1
Group Assigned
1763 O – H Stretching
2130 C – H Stretching
1647 C =C Stretching
1465 CH3 Bending
1320 C =O Stretching, OH Bending
946 C – O – C Ring Stretching
Table.6.Drug-Excipients compatibility studies
Excipient Ratio Description
initial After one month
Fenofibrate 1:0 light yellow powder No change
Fenofibrate + β-Cyclodextrin 1:1 White powder No change
Fenofibrate + Povidone 1:1 light yellow powder No change
Fenofibrate +S.S.G 1:1 light yellow powder No change
Fenofibrate + C.C.S 1:1 White to light yellow powder No change
Fenofibrate +Manitol 1:1 White to light yellow powder No change
Fenofibrate + MCC 1: 1 White to light yellow powder No change
Fenofibrate + MgStearate 1:1 White to light yellow powder No change
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 606
Table.7.Results for derived and flow properties
Formulation
Code
Derived properties Flow properties
Bulk density
(mean±SD) g/ml
Bulk density
(mean±SD) g/ml
Angle of repose
(mean±SD)
Carr’s index
(mean±SD)
Hausner’s ratio
(mean±SD)
FB1 0.51±0.002 0.62±0.01 23.32±1.52 17.18±1.0 1.24±0.02
FB2 0.53±0.005 0.64± 0.01 27.08±1.20 16.12±1.52 1.25±0.04
FB3 0.54±0.003 0.67±0.02 30.21±1.70 16.66±1.20 1.24±0.03
FB4 0.56±0.008 0.63± 0.03 30.11±0.88 15.62± 1.31 1.17±0.03
FP1 0.55± 0.007 0.61± 0.02 28.43±1.46 19.04± 1.13 1.11±0.06
FP2 0.52±0.009 0.63±0.02 31.38±1.31 18.03± 0.93 1.14±0.07
FP3 0.53±0.002 0.65± 0.31 36.03±1.40 15.87± 1.42 1.26±0.11
FP4 0.52±0.005 0.67± 0.02 25.10± 1.13 16.92± 1.10 1.16±0.09
Table.9. In-vitro disintegration time study of FB1 – FP4
Formulations In-vitro disintegration time(sec)
FB1 31.67
FB2 33.43
FB3 41.20
FB4 43.82
FP1 22.63
FP2 26.87
FP3 29.20
FP4 35.65
Table.10.In-vitro cumulative% drug release study of formulation FB1- FP4
Time
(min)
Cumulative % Drug Release
FB1 FB2 FB3 FB4 FP1 FP2 FP3 FP4
5 26.23 23.67 26.39 23.91 25.92 26.92 24.43 23.82
10 45.43 42.82 46.37 43.21 48.32 47.92 45.91 43.01
15 67.56 69.73 66.49 64.32 68.56 67.34 65.93 63.31
20 85.82 82.91 85.82 82.03 81.32 84.21 77.42 72.10
25 91.71 87.52 90.45 86.21 89.68 88.43 84.32 80.34
30 94.71 92.38 93.89 89.01 94.73 93.42 90.02 89.34
35 96.52 95.36 95.62 93.42 98.83 97.32 95.12 94.81
Table.11.Kinetics of drug release studies of FB1-FP4
Formula Zero order First order
K0
Ro2 K
1 R12
FB1 9.015 0.9357 0.696 0.846
FB2 6.207 0.871 0.464 0.959
FB3 6.897 0.777 0.436 0.976
FB4 6.134 0.944 0.159 0.99
FP1 9.21 0.91 0.92 0.99
FP2 12.59 0.785 0.572 0.946
FP3 11.48 0.934 0.591 0.902
FP4 5.473 0.885 0.152 0.988
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 607
Table.12.Comparision of drug release study of marketed product and formulation FP1
Time(min) Cumulative % drug release of FP1 Cumulative % drug release of
Marketed product
0 0 0
5 25.92 20.32
10 48.32 36.72
15 68.56 44.31
20 81.32 56.61
25 89.68 67.31
30 94.73 79.38
35 98.83 83.91
40 91.63
45 96.51
Figure.4.Comparision of drug release study of marketed product and formulation FP1
CONCLUSION
All the formulations of solid dispersions were
successfully prepared and Fenofibrate tablets are prepared
and evaluated for solubility and dissolution rate. Each
examined carrier was effective, even though at different
degrees, in improving drug dissolution properties. The
saturation solubility of drug was found to be more in the
solid dispersions as compared to the phase solubility
achieved in the presence of hydrophilic carriers in the
dissolution media. This may be due to drug carrier
interaction or change in property of drug in the solid
dispersion formulations.Highest solubilizing power of
Povidone towards Fenofibrate was shown by dissolution
studies. From FTIR spectroscopy studies, it was
concluded that there was no defined chemical interactions
between FenofibrateandPovidone. It can provide a
promising way to enhance its solubility and dissolution
rate.
Based on mathematical models, it was concluded t
hat formulation FP1,the regresion(r=0.99) value was found
to be 0.99 fitted into first order release kinetics.The slope
value for first order Kinetics of FP1 formulation was
found to be with in 0.45-0.99 hence it is folllows non
fickens diffussion.Experience with solid dispersions
indicates that this is a very fruitful approach to improve
the release rate and oral bioavailability of poorly soluble
drugs. The most frequent concerns with solid dispersions
have been the ability to scale-up the manufacturing
method, the physical stability of the dispersion and the
amount of carrier needed to facilitate the required increase
in the release rate.
References
Ammar. H.O, Salama. H.A, Ghorab. M, and Mahmoud.
A.A, Formulation and biological evaluation of
glimepiride-cyclodextrin-polymer systems, International
Journal of Pharmaceutics, 309(1-2), 2006, 129-138.
Anguiano-Igea. S, Otero-Espinar. F.J, Vila-Jato. J.L, and
Blanco-Mendez, J. Improvement of Clofibrate dissolution
by complexation with cyclodextrin, International Journal
of Pharmaceutics, 135, 1996, 161-166.
Brahmankar. D.M, and Jaiswal. S.B, Absorption of Drugs
In: Biopharmaceutics and Pharmacokinetics A treatise, 1st
(edn), Vallabhprakashan, 1999, 20-27.
Chang. R.K, and Shojaei. A.H. The effect of
hydroxypropyl β- cyclodextrin on drug solubility in water-
0
20
40
60
80
100
120
0 20 40 60
%C
um
ula
tive
Am
ou
nt
of
Dru
g R
ele
ase
Time(min)
FP1
Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 608
propylene glycol mixtures, Drug development and
industrial pharmacy, 30(3), 2004, 297–302.
Chauhan. B, Shimpi. S, and Paradkar. A. Preparation and
characterization of Etoricoxib solid dispersions using lipid
carriers by spray drying technique, AAPS PharmSciTech,
6(3), 2005, Article 50.
Usui. F, Maeda. K, Kusai. A, Ikeda. M, Nishimura. K,
Yamamoto. K, Dissolution improvement of RS-8359 by
the solid dispersion prepared by the solvent method. Int.
J.Pharm, 170, 1998, 247-256.
Cirri. M, Mura. P, Rabasco. A.M, Gine´s. J.M, Moyano.
J.R, and Go`nzalez-Rodriguez. M.L, Characterization of
Ibuproxam binary and ternary dispersions with
hydrophilic carriers, Drug development and industrial
pharmacy, 30(1), 2004, 65–74.
Craig. D.Q.M, The mechanisms of drug release from solid
dispersions in water-soluble polymers, International
Journal of Pharmaceutics, 231(2), 2002, 131-144.
Dressman. J.B, Kunath. K and Vogt. M, Dissolution
enhancement of nevirapine by micronization, cogrinding
and spray-drying: Comparison with commercial
preparations, European Journal of Pharmaceutics and
Biopharmaceutics, 68, 2008, 283-288.
El-Zein. H, Riad. L, and El-Bary. A.A. Enhancement of
carbamazepine dissolution: in vitro and in vivo evaluation,
International Journal of Pharmaceutics, 168(2), 1998, 209-
220.
Tejas patel, Sunil makwana, Enhancement of dissolution
of fenofibrate by solid dispersion techniqyue, int.
j.res.pharm.sci, 1(2), 2010, 127-132.
Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 609
FORMULATION AND E VALUATION OF FAMOTIDINE FAST DISSOLVING
TABLETS BY DIRECT COMPRESSION METHOD B.Venkateswarlu
*, B.Pragati Kumar, Debjit Bowmik
Nimra College of Pharmacy, Vijayawada, India
*Corresponding author:Email:[email protected]
ABSTRACT
Fast dissolving tablets were highly accepted drug delivery system. Fast dissolving tablets were dissolved/
disintegrated in the mouth within a matter of few seconds without need of water. The aim of the present study was
to prepare and evaluate fast dissolving tablets of Famotidine using a combined approach of complexing agent and
super disintegrant.Fast dissolving tablets were prepared by direct compression technique .The prepared tablets
were dried under oven for evaporate the complexing agent and drug release. The tablets were evaluated for weight
variation, friability, hardness, in vitro disintegration time, in vitro drug release profile .And there is no
interactions find in Ftir studies .The obtained results showed that weight variation. Good hardness, acceptable
friability. All the formulation disintegrated within 10-60 secondsand the drug release shows 99.3%. The
formulation containing complexing agent and superdisintegrants showed better performance in disintegration and
drug release profile.
KEY WORDS: Famotidine, Fast dissolving Tablet, Cross carmalose sodium, Dissolution Time
INTRODUCTION
Solid dosage forms are widely prevalent due to
their age-old application. Especially, oral solid
formulations hold a high potential as they serve to be most
convenient for the administration of drugs. These have
been developed into a wide range of formulations from
conventional dosage forms for immediate release of the
drug to controlled release dosage forms for the constant
rate of drug release. Oral route is the most convenient and
commonly used method of drug delivery. More than 50%
of drug delivery systems available in the market are oral
drug delivery systems. They offer convenience and ease of
administration, greater flexibility in dosage form design
and ease of production and low cost. These dosage forms
are designed either for improving the physical and
mechanical properties of materials during manufacture
and/or for providing a desired drug delivery system. The
tablets and capsules can be made directly from powders or
from granules and pellets, or from film coated multiple
units
(Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Fast
dissolving tablets: A novel drug delivery system, Phrma.
Times, 2003, 35, 3-10.)
MATERIALS AND METHODS
Materials: Famotidine,Indian Drugs ,HYD.Plasidone,β-
Cyclodextrin,Sodium starch glycolate,Cross carmalose
sodium,Mannitol, Signet chemicals ,Mumbai.Aspartame
Lobachemicl Mumbai.Cardamom flavour,Microcrystalline
cellulose Nice Chemicls Laboratory,Cochin.
Preparation of Solid Dispersions by solvent
evaporation (1:1) Famotidine:β-cyclodextrin: The Solid
Dispersion of Famotidine with β-cyclodextrin of ratio 1:1
was prepared by solvent evaporation technique, the drug is
weighed of 2 gm it was dissolved in the chloroform of 20
ml in a beaker of 50 ml and kept a side then the 2 gm β-
cyclodextrin is weighed it was dissolved in 20 ml
methanol and stirred well in the 50 ml beaker. Then drug
solution is poured into the china dish then the polymer
solution was added to it and stirred well. Then the mixed
solution was kept in theincubator for drying and avoids
contamination for 3 to 4 days after drying the dried
particles were scraped out from the china dish and
weighed and stored.
Total 4 Formulations (1:1, 1:2, 1:3, 1:4) were prepared
with Famotidine and β-cyclodextrin.
Preparation of fast dissolving tablets by direct
compression: The amount of complex equivalent to
20mg of drug were taken and then mixed with directly
compressible diluents and superdisintegrants in a plastic
container. Mg.stearate and talc were passed through
sieve No.60, mixed and blended with the initial mixture
in the plastic container followed by compression of the
blend. Compression was performed on a 16 station tablet
compression machine using 8mm punches.
RESULTS AND DISCUSSION
Preformulation studies: The flow properties and other
derived properties evaluated for all the 8 formulations
were proved to be within limits showing good flow
properties. The physical properties like bulk density,
tapped density, angle of repose, compressibility index, and
Hausner’s ratio were calculated and tabulated in table
no:3.The values were found to be within the range of
0.51±0.002 to 0.53±0.005,0.64±0.01 to
0.65±0.02,23.32º±1.52 to 25.10±1.13º,17.18±1.0 to
16.92±1.10,1.22±0.02 to 1.26±0.09
Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 610
Physical properties: The formulated batches were
evaluated for physicochemical parameters like hardness,
thickness, weight variation, friability, content uniformitity,
Wetting Time ,Water absorption ratio. The values
obtained for that studies are tabulated in Table no 4. From
the compatibility studies for drug and excipients it was
observed that there was no interaction between drug and
excipients.
In-vitro drug release studies: In-vitro drug release
studies were performed for all the prepared formulation by
using Phosphate buffer (pH 6.2) as dissolution medium
and measuring drug concentration UV- Spectrophoto
metrically at 210 nm. The comparative in vitro dissolution
study of best formulation (FC1 AndFP1) and the marketed
product fast dissolving tablet (AMFOMAX), shows
maximum drug release 98.43% at the end of 45 min And
FP1 Showing 99.73% of Famotidine at the end of
30min.The values were given in table no:5
Kinetics of Drug Release: Based on mathematical models, it was concluded that for
mulation FP1,the regression(r=0.99) value was found to
be 0.99 fitted into zero order release kinetics.The slope
value for peppas model was found to be with in 0.45-0.89
hence it is folllows non fickens diffussion. Non fickens
diffision refers to combination of both diffusion and
erossion controlled.
Table.1. Composition of fast dissolving tablets contains Famotidine with β-cyclodextrin
Ingedients FC1(1:1) FC2(1:2) FC3(1:3) FC4(1:4) Amount of complex equivalent
to 20 mg of Famotidine 40mg 60mg 80mg 100mg
Croscarmellose sodium 15 15 15 15 Sodium starch glycolate 15 15 15 15 MCC (Avicel PH-102) 20 20 20 20
DC-Mannitol 140 120 1000 80 Talc 10 10 10 10
Mg stearate 10 10 10 10 Total 250mg 250mg 250mg 250mg
Table.2.Composition of Fast dissolving tablets contain Famotidine with PlasdoneK-32
Ingedients FP1(1:1) FP2(1:2) FP3(1:3) FP4(1:4) Amount of complex equivalent
to 20 mg of Famotidine 40mg 60mg 80mg 100mg
Croscarmellose sodium 15 15 15 15 Sodium starch glycolate 15 15 15 15 MCC (Avicel PH-102) 20 20 20 20
DC-Mannitol 140 120 1000 80 Talc 10 10 10 10
Mg stearate 10 10 10 10 Total 250mg 250mg 250mg 250mg
Table.3.Results for derived and flow properties
Formulation
code
DERIVED PROPERTIES FLOW PROPERTIES
Bulk density
(mean±SD) g/ml Tapped density (mean±SD) g\ml
Angle of repose (mean±SD)
Carr’s index (mean±SD)
Hausner’s ratio (mean±SD)
FC1 0.51±0.002 0.64± 0.01 23.32± 1.52 17.18± 1.0 1.22±0.02 FC2 0.52±0.005 0.62± 0.01 27.08± 1.20 16.12± 1.52 1.15±0.04 FC3 0.58±0.003 0.66±0.02 30.21± 1.70 16.66± 1.20 1.24±0.03 FC4 0.53±0.008 0.64± 0.03 30.11± 0.88 15.62±1.31 1.17±0.03 FP1 0.57± 0.007 0.63± 0.02 28.43±1.46 19.04± 1.13 1.21±0.06 FP2 0.54±0.009 0.61± 0.02 31.38± 1.31 18.03± 0.93 1.24±0.07 FP3 0.51±0.002 0.63± 0.31 36.03± 1.40 15.87± 1.42 1.16±0.11 FP4 0.53±0.005 0.65± 0.02 25.10±1.13 16.92±1.10 1.26±0.09
Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 611
Table.4.Physico chemical parameters of all formulations
Formulation code
Thickness (mm)
Hardness (Kg/cm
2) Friability
(%) Weight
variation(mg) Wetting
time (sec) Water
absorption ratio FC1 3.2 2.8 0.52 248 76.12 75.82 FC2 3.4 2.9 0.58 247 75.89 77.64 FC3 3.4 3.1 0.54 254 86.72 64.02 FC4 3.4 3.7 0.56 246 82.54 67.45 FP1 3.5 2.6 0.61 247 14.32 59.12 FP2 3.8 2.9 0.58 253 13.87 58.45 FP3 3.7 3.1 0.45 248 13.48 57.32 FP4 3.2 3.4 0.52 243 12.62 54.48
Table.5. In-Vitro Cumulative % drug release study of formulation FC1- FP4
Time (min)
Cumulative % Drug Release FC1 FC2 FC3 FC4 FP1 FP2 FP3 FP4
0 0 0 0 0 0 0 0 0 5 26.23 23.67 26.39 23.91 25.92 26.92 24.43 23.82 10 45.43 42.82 46.37 43.21 48.32 47.92 45.91 43.01 15 67.56 69.73 66.49 64.32 68.56 67.34 65.93 63.31 20 85.82 82.91 85.82 82.03 86.32 84.21 82.42 82.10 25 93.71 92.52 93.45 90.21 92.68 91.43 91.32 90.34 30 97.71 96.38 95.89 95.01 99.73 98.42 98.02 97.34
Figure.1.FTIR spectra of Famotidine Figure.2.FTIR Spectra of Drug +β cyclodextrin
Figure.3.FTIR spectra of β-Cyclodextrin Figure.4.FTIR Spectra for Formulation FC1
Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 612
Figure.5.FTIR Spectra For Formulation FP1
Figure.6.In-vitro Cumulative %Drug release study of Formulation FC1-FP4
Figure.7.Famotidine Drug Release Profile of FC1showing Zero Order Kinetics
CONCLUSION
Fast dissolving tablets dissolves in the saliva
within a few seconds .among the eight formulations
Tablets containing Palasadone agents shows better results
than β-Cyclodextrinformulation. All formulated batches
showed disintegration with in 45 sec.Fast dissolving
tablets by and superdisintegrent solved the problems
encountered in the administration of drug by oral route.
0
20
40
60
80
100
120
0 10 20 30 40
Cu
mu
lati
ve %
Dru
g R
ele
ase
Time(min)
Cumulative%Drug Release of FC1-FP4
FC1
FC2
FC3
FC4
FP1
FP2
FP3
FP4
y = 3.3622x + 9.7854
R² = 0.9522
0
20
40
60
80
100
120
0 5 10 15 20 25 30 35 % C
um
ula
tive
Dru
g
Rel
ease
Time (min)
Zero Order
Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 613
The results showed low weight variation .good hardness
and acceptable friability. The release profile relieved that
optimized formulation showed greater released than the
marketed formulation.
REFERENCES
Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Fast
dissolving tablets: A novel drug delivery system, Phrma.
Times, 35, 2003, 3-10.
Lailla, J.K., Sharma, A.H., Freeze-drying and its
applications, Indian Drugs, 31, 1993, 503-513.
Seager, H., Drug delivery products and zydis fast
dissolving dosage form, J. Pharm. Phamacol, 50, 1998,
375-382.
Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Mouth
dissolving tablets: A novel drug delivery system, Phrma.
Times, 35, 2003, 3-10.
Lachmann, L., Liebermann, H.A., Kiang, J.L., The theory
and practice of Industrial Pharmacy, 3rd
Ed., Varghese
Publishing House, Bombay, 1998, 430-440.
Kaushik, D, Dureja, H, Saini, T. R., Mouth Dissolving
Tablets: A review. Indian Drugs, 41(4), 2004, 187-193.
Bhaskaran, S., Narmada, G.V., Orally disintegrating
tablets, Indian Pharmacist, 2002, 1(2), 9-12.
Mishra B., Panigrahi D., Mouth dissolving tablets: an
overview of preparation techniques, evaluation and
patented technologies, J. Pham. Res., 2005, 4(3), 33.
Shah, U., Augsburger, L., Evaluation of the functional
equivance of crospovidone NF from different sources:
standard performance test, Pharmaceutical development
and technology, 6, 2001, 419-430.
Swarbrick, J., Boylan, J., Encyclopedia of Pharmaceutical
technology, 2nd
Ed., Marcel Dekker, NY, 2002, 2623-
2638.
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 614
FORMULATION AND EVALUATION OF MATRIX FLOATING TABLETS OF
OFLOXACIN AND TINIDAZOLE COMBINATION Syed Peer Basha
*, Pragati Kumar B, Duraivel S, Abeda Aqther
Nimra College of Pharmacy, Vijyawada, India
*Corresponding author: Email:[email protected]
ABSTRACT Floating matrix tablets of Ofloxacin and tinidazole were developed to prolong gastric residence time and
increase drug absorption further increasing the bioavailability. Ofloxacin chosen as a choice of drug because it is
well absorbed from stomach and Tinidazole is well absorbed in stomach and upper part of small intestine. Pre-
formulation studies were carried out to optimize the required quantity for HPMC (K4M). Xanthan gum (5%),
carbopol 934P (10%) was used in Fourier transform Infrared spectroscopy confirmed that absence of any
drug/polymers/excipients interactions. Formulations were prepared using HPMC K50, HPMC K100, HPMC K4,
Xanthan gum with carbopol 934P at Different Ratios. F12 Formulations showed in-vitro buoyancy 11 hrs. The
concentration of HPMC K4 was increased to control the release of drug from the dosage form for F9 to F12
batches; the concentration was increased for Xanthan gum to increase the binding nature. The cumulative %
drug release of F12 formulation was found to be Ofloxacin (95.8%), Tinidazole (92.8%) at the end of 11th hr. The
formulation containing HPMC k4m and Xanthan gum (1:1) showed better results compared to other formulated
batches. Further Stability studies and IVIVC correlation studies can be performed to ensure the efficacy of the
formulated floating tablets
KEY WORDS: Ofloxacin, Tinidazole, HPMC, Floating lag time, swelling index, in-vitro buoyancy.
INTRODUCTION
Oral controlled release dosage forms have been
developed over the past three decades due to their
considerable therapeutic advantages such as ease of
administration, patient compliance and flexibility in
formulation. The relatively short gastric emptying time in
humans this normally averages 2-3 hrs. Through the major
absorption zone, i.e., stomach and upper part of the
intestine can result in incomplete drug release from the
drug delivery system leading to reduced efficacy of the
administered dose. After oral administration, such a
dosage forms would be retained in the stomach and
release the drug there in a controlled and prolonged
manner, so that the drug could be supplied continuously to
its absorption sites in the upper gastrointestinal tract.
Gastro retentive dosage form can remain in the gastric
region for several hours and hence significantly prolong
the gastric residence time of drugs. Prolonged gastric
retention improves bioavailability, reduces drug waste,
and improves solubility of drugs that are less soluble in a
high pH environment. It is also suitable for local drug
delivery to the stomach and proximal small intestines.
Gastroretention helps to provide better availability of new
products with suitable therapeutic activity and substantial
benefits for patients (Kamalakanan, 2012) (Kulkarni,
2009).
MARERIALS AND METHODS
Marerials: Tinidazole, Ofloxacin, Indian Drugs, HYD.
HPMC K4, Qualikens, Vadodara. Xanthan gum, SD Fine
Chem.Ltd. Mumbai, Sodium bicarbonate, Merck,
Mumbai, Citric acid Finar reagents, Ahmedabad.
Preparation of floating matrix tablets of Ofloxacin and
Tinidazole. Tablets were prepared by using wet
granulation technique. Ofloxacin and Tinidazole was
mixed with required amount of polymers and other
excipients. All the excipients were passed through # 60
mesh , mixed and granulated with 10% solution of HPMC
5CPS in water. The wet mass was passed through #16
mesh and dried at 45˚C for 1 hrs. Dried granules were
passed through #24 mesh and mixed with magnesium
stearate and talc. And finally add the required quantity of
sod. Bicarbonate and citric acid was mixed with granules.
Granules were compressed into tablets using 16 punch
single station tablet compression machine (Cadmach).
Evaluation of floating tablets: Pre-formulation studies
were performed on the drug and excipients which includes
bulk density, tapped density, corr’s index, Hauser’s ratio
and compatability studies.The formulated tablets were
evaluated for its Thickness,hardness, friability, weight
variation,in-vitro buoyancy, swelling index, floating lag
time, in-vitro dissolution studies.
RESULTS AND DISCUSSION
Pre-formulation studies: The formulated batches were
evaluated for Preformulation studies that are Angle of
repose, Carr’s index and Hausner’s ratio, the values
obtained for that studies are tabulated in Table no 2.The
values were found to be in the range from 25.64˚±0.01 to
31.3˚±0.05, 9.37±0.01 to12.5±0.01, 1.07±0.01
to1.14±0.01% respectively. This indicates good flow
property of the granules for compression.
Physical properties: The formulated batches were
evaluated for physicochemical parameters like hardness,
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 615
thickness, weight variation, friability, drug content,
floating lag time and swelling index. The values obtained
for that studies are tabulated in Table no 3. Floating
properties from the evaluation results it was observed that
the tablets containing Xanthan gum and HPMC K4M, F12
showed greater in vitro buoyancy time and when
compared to other prepared formulation. Swelling index
of floating tablets showed significant differences in their
swelling index in the order of Xanthan Gum > HPMCK4
> Ethyl cellulose>Carbopol934. From the compatibility
studies for drug and excipients it was observed that there
was no interaction between drug and excipients.
In-vitro drug release studies of Ofloxacin: Formulations
F1, F2, F3 and F4 containing HPMC alone and
Combination of HPMC and Carbopol. The Formulations
F1 has shown release 78.4% at the end of 11hrs,
Formulations F2 has shown release 75.3% at the end of
1hrs, Formulations F3 has shown release 72.2% at the end
of 11 hrs, Formulations F4 has shown release 75.4% at the
end of 11hrs.
Formulations F5, F6, F7, F8, F10, and F11
containing Combination of HPMC5cps and HPMC K50 .
The Formulations F5 has shown release 76.8% at the end
of 11 hrs, Formulations F6 has shown release 78.9% at the
end of 11 hrs, Formulations F7 has shown release 80.4%
at the end of 11 hrs, F8 has shown release 79.3% at the
end of 11 hrs, Formulations F10 has shown release 81.4%
at the end of 11 hrs, Formulations F11 has shown release
83.4% at the end of 11 hrs.
Formulations F9, and F12 containing Combination of
HPMC and Xanthan gum. The Formulations F9 and F12,
have shown release 92.8% and 95.8% respectively at the
end of 11hrs, the values obtained for that studies are
tabulated in Table no 4.
In-vitro drug release studies of Tinidazole: Formulations F1, F2, F3 and F4 containing HPMC alone
and Combination of HPMC and Carbopol. The
Formulations F1 has shown release 76.3% at the end of
11hrs, Formulations F2 has shown release 74.3% at the
end of 11hrs, Formulations F3 has shown release 71.6% at
the end of 11hrs, Formulations F4 has shown release
73.3% at the end of 11 hrs.
Formulations F5, F6, F7, F8, F10, and F11
containing Combination of HPMC5cps and HPMC K50
were done. The Formulations F5 has shown release 74.2%
at the end of 11 hrs, Formulations F6 has shown release
78.2% at the end of 11 hrs, Formulations F7 has shown
release 81.3% at the end of 11 hrs, F8 has shown release
76.1% at the end of 11 hrs, Formulations F10 has shown
release 79.6% at the end of 11 hrs, Formulations F11 has
shown release 80.1% at the end of 11 hrs. Formulations
F9, and F12 containing Combination of HPMC and
Xanthan gum. The Formulations F9 and F12, have shown
release 88.4% and 92.8% respectively at the end of 11hrs,
the values obtained for that studies are tabulated in Table
no 5.
Kinetics of drug release: Based on mathematical models, it was concluded that for
mulation F12,the regression(r=0.99) value was found to
be 0.99 fitted into zero order release kinetics.The slope
value for peppas model was found to be with in 0.45-0.89
hence it is folllows non fickens diffussion. Non fickens
diffision refers to combination of both diffusion and
erossion controlled.
Table.1.Composition of floating tablets containing combination of Ofloxacin and Tinidazole Ingredients
(Mg)
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
Ofloxacin 200 200 200 200 200 200 200 200 200 200 200 200
Tinidazole 300 300 300 300 300 300 300 300 300 300 300 300
Lactose 120 120 70 70 __ __ __ __ __ __ __ __
HPMC5CPS 60 60 60 60 60 60 30 60 50 40 40 40
HPMCK4 __ __ __ __ __ __ __ __ 50 __ __ 40
HPMCK15 __ 100 __ __ 70 __ __ __ __ __ 40 __
HPMCK50 __ __ __ __ __ 70 100 __ __ __ ___ __
HPMCK100 __ __ __ __ __ __ __ __ __ 50 30 __
Ethyl Cellulose 150 __ 100 __ __ __ __ 60 __ __ __ __
Eudragit __ __ __ 100 __ __ __ __ __ __ 50 __
Xanthungum __ __ __ __ __ __ __ __ 70 70 __ 80
Carbopol 934 50 100 150 150 __ __ __ __ __ __ __ __
Sod.Bicabonate 50 50 50 50 50 70 50 60 50 50 50 50
Citricacid 50 50 50 50 50 30 50 50 30 30 30 30
Total (Mg) 1000 1000 1000 1000 750 750 750 750 750 750 750 750
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 616
Table.2.Results for derived and flow properties Formulation
Code
Derived Properties Flow Properties
Bulk density
(mean ±SD) g/ml
Tapped density
(mean ±SD) g\ml
Angle of repose
(mean ±SD)
Carr’s index
(mean ±SD)
Hausner’s ratio
(mean ±SD)
F1 0.28±0.01 0.32±0.04 25.64±0.01 12.5±0.01 1.14±0.01
F2 0.29±0.03 0.33±0.03 26.5±0.03 12.1±0.01 1.13±0.02
F3 0.34±0.01 0.37±0.01 27.02±0.04 12.4±0.02 1.08±0.03
F4 0.29±0.02 0.32±0.03 28.88±0.01 9.37±0.01 1.10±0.01
F5 0.30±0.01 0.33±0.01 31.3±0.05 9.7±0.01 1.1±0.02
F6 0.35±0.04 0.39±0.02 27.02±0.02 10.2±0.01 1.11±0.01
F7 0.37±0.03 0.42±0.02 29.2±0.04 11.9±0.01 1.13±0.04
F8 0.42±0.01 0.45±0.01 27.02±0.01 10.6±0.03 1.07±0.01
F9 0.338±0.02 0.41±0.04 27.4±0.03 10.3±0.02 1.07±0.02
F10 0.35±0.01 0.39±0.03 27.1±0.01 10.2±0.01 1.11±0.01
F11 0.37±0.04 0.37±0.01 27.02±0.05 12.4±0.01 1.08±0.01
F12 0.39±0.01 0.39±0.04 27.02±0.01 10.2±0.02 1.11±0.02
Table.3. Physico chemical parameters of all formulations Formulations Thickness
(mm)
Hardness
(Kg/cm2)
Friability
(%)
Weight
variation (mg)
Floating lag
time (Sec)
Swelling
index (%)
In vitro
buoyancy(hr)
F1 3.2 2.8 0.72 958 - 184.3 -
F2 3.4 2.9 0.93 964 - 207.5 -
F3 3.4 3.1 0.67 943 - 175.4 -
F4 3.4 3.7 0.86 947 - 192.8 -
F5 3.5 2.6 0.91 739 - 262.5 -
F6 3.8 2.9 0.78 742 - 279.2 -
F7 3.7 3.1 0.75 756 - 300.4 -
F8 3.2 3.4 0.92 763 - 348.6 -
F9 3.4 2.9 0.89 749 32 324.3 10
F10 3.4 2.8 0.81 743 - 316.8 08
F11 3.4 3.1 0.67 742 27 175.4 06
F12 3.8 2.9 0.78 768 35 279.2 11
Table.4. In-Vitro Cumulative% Drug Release study Of F1- F12 (Ofloxacin)
Time
(hrs)
Cumulative % drug release of Ofloxacin
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
0 0 0 0 0 0 0 0 0 0 0 0 0
1 19.6 18.1 15.2 14.3 17.6 18.1 19.7 17.2 15.8 19.2 20.3 17.2
2 26.3 24.3 21.3 19.4 24.3 25.7 26.3 23.7 20.2 25.1 27.2 24.3
3 32.2 29.8 27.4 24.3 29.1 31.1 33.8 29.9 37.2 32.3 34.1 33.1
4 39.8 34.3 32.5 32.3 36.9 38.8 40.2 37.2 45.1 39.4 40.3 40.9
5 45.7 39.1 38.6 39.4 43.1 44.3 46.1 44.2 59.3 45.6 47.9 57.6
6 51.3 43.4 43.4 47.3 51.4 52.2 53.1 51.4 68.2 52.1 54.3 68.4
7 57.3 48.8 49.8 54.4 56.7 58.3 59.1` 58.7 77.2 59.3 60.4 79.2
8 65.4 55.3 55.3 60.4 61.4 63.4 65.2 65.3 80.2 66.4 67.3 85.7
9 69.8 61.4 62.2 67.2 65.3 68.3 72.3 72.1 87.8 73.7 72.3 89.8
10 74.3 62.3 67.4 71.2 71.6 73.5 76.7 75.3 90.1 77.3 78.4 93.5
11 78.4 79.3 72.2 75.4 76.8 78.9 80.4 79.4 92.8 81.4 83.4 95.8
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 617
Table No: 5: In Vitro Cumulative% drug release study of F1- F12 (Tinidazole) Time
(hrs)
Cumulative % drug release of Tinidazole
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
0 0 0 0 0 0 0 0 0 0 0 0 0
1 14.2 15.9 18.3 12.9 15.2 14.2 15.2 17.2 15.8 13.6 18.4 16.2
2 19.8 21.4 26.2 20.2 21.4 19.8 22.8 23.7 20.2 19.6 27.5 21.3
3 27.4. 29.4 31.2 28.1 29.2 27.4. 29.4. 29.9 27.2 26.9 34.6 29.1
4 34.6 36.9 37.4 33.3 36.9 34.6 36.6 35.2 32.1 31.2 42.4 34.9
5 42.4 43.9 42.6 40.6 43.5 42.4 43.4 41.2 37.3 39.7 49.2 45.6
6 49.2 50.6 49.6 46.1 50.6 49.2 49.2 48.4 48.2 46.5 54.5 51.4
7 56.1 55.1 56.8 53.2 55.0 56.1 56.1 55.7 56.2 53.6 60.9 59.2
8 62.2 59.6 62.8 59.2 59.6 62.2 64.2 61.3 65.1 60.2 66.3 65.7
9 69.6 65.9 67.2 64.3 65.9 68.6 69.6 66.1 74.8 67.2 71.9 73.8
10 72.8 70.8 71.3 68.6 70.8 73.8 75.8 72.1 81.3 73.5 76.1 84.9
11 76.3 74.3 74.6 73.3 74.2 78.3 81.3 76.1 89.4 79.6 80.1 92.8
Figure.1. FTIR spectra data for pure Ofloxacin Figure.2.FTIR spectra data for pure Tinidazole
Figure.3.FTIR Spectra of Drug (O+T) + Polymers
+Excipients. Figure.4.FTIR Spectra of Polymers+ Excipients
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 618
Figure no. 5: Cumulative % Drug Releae Profile of F1-F12
(Ofloxacin) Figure no. 6: Cumulative % Drug Releae Profile of
F1-F12 (Tinidazole)
Figure.7.Ofloxacin Drug Releae Profile of F12 Showing
Zero Order Kinetics Figure.8.Ofloxacin DrugReleae Profile of F12 Showing
First Order Kinetics
Figure.9.Ofloxacin drug releae profile of F12 showing
Hiuchi model. Figure.10.Ofloxacin drug releae profile of F12 showing
Peppas Model.
0
20
40
60
80
100
120
0 5 10 15 Cu
mu
lati
ve
% d
rug
rele
ase
Time(hrs)
Cumulative % drug release of Ofloxacin
of F1-F12
F1
F2
F3
F4
F5
F6
F8
F9
F10
F11
F12
0
20
40
60
80
100
0 5 10 15 Cu
mu
lati
ve
% d
rug
rele
ase
Time(hrs)
Cumulative % drug release of
Tinidazole of F1-F12 F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
y = 7.9311x + 4.2872
R² = 0.9942
0
10
20
30
40
50
60
70
80
90
100
0 2 4 6 8 10 12 % C
um
ula
tive
Dru
g
Rel
ease
Time (hr)
Zero Order
y = -73.794x + 98.708
R² = 0.8705
0
20
40
60
80
100
120
0 0.2 0.4 0.6 0.8 1 1.2
% D
rug R
elea
se
Rem
ain
ing
Log Time
First Order
y = 28.293x - 12.785
R² = 0.9341
-20
0
20
40
60
80
100
0 0.5 1 1.5 2 2.5 3 3.5
Cu
mu
lati
ve
% R
elea
se
Squar root of time
Higuchi Equation
y = 0.5x
R2 = 1
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0 0.2 0.4 0.6 0.8 1 1.2 log o
f cu
mu
lati
ve
%
dru
g r
elea
se
log time
Peppas equation
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 619
CONCLUSION
From the above experimental results it can be
concluded that, formulated tablets gave satisfactory results
for various physicochemical characteristics like thickness,
hardness, weight variation, friability, drug, floating lag
time and swelling index. Sodium bicarbonate has
predominant effect on the buoyancy lag time, while
HPMC K4M and xanthan gum has predominant effect on
total floating time and drug release xanthan gum shows
significant effect on drug release. In vitro drug release rate
studies showed that the maximum drug release was
observed in F12 formulation up to 11 hrs. FT-IR studies
revealed that there was no interaction between drug and
polymers used. From the study it is evident that a
promising controlled release floating tablets of Ofloxacin
and Tinidazole can be developed to increase gastric
residence time. Further detailed investigation is required
to establish efficacy of these formulations and fix the
required dose.
REFERENCES
Kamalakanan, M. Karthikraja, K. Ravi, M. Kathikeyan, K.
G.S. Arul Kumran, A Arunachalam, Formulation and
invitro evaluation of tinidazole effervescent floating
tablets, 5(4), 2012, 2321-2325.
Padmavathy D, Saravanan D, Rajesh, Formulation And
Evaluation Of Ofloxacin Floating Tablets Using HPMC,
3(1), 2011, 170-173.
Sonia Dhiman, Thakur Gurjeet Singh, Design and
optimization of floating matrix tablets of famotidine by
central composite design, 5(1), 2012, 45-49.
Basawaraj S.Patil, Sandeep J. Sonawane, Upendra
Kulkarni, Hariprasanna R.C, Formulation and in-vitro
evaluation of captopril floating matrix tablets using
HPMC 50cps, 2(3), 2012, 97-102.
Kulkarni A, Bhatia M. Development and evaluation of
regioselective bilayer floating tablets of Atenolol and
Figure no.11: Tinidazole Drug Releae Profile of
F12 Showing Zero Order Kinetics. Figure no.12: Tinidazole DrugReleae Profile of F12
Showing First Order Kinetics
Figure no.13: Tinidazole DrugReleae Profile of
F12 Showing Higuchi Model. Figure no. 12: Tinidazole Drug Releae Profile of F12
Showing Peppas Model.
y = 7.9311x + 4.2872
R² = 0.9942
0
10
20
30
40
50
60
70
80
90
100
0 2 4 6 8 10 12
% C
um
ula
tive
Dru
g
Rel
ease
Time (hr)
Zero Order
y = -73.794x + 98.708
R² = 0.8705
0
20
40
60
80
100
120
0 0.2 0.4 0.6 0.8 1 1.2
% D
rug R
elea
se
Rem
ain
ing
Log Time
First Order
y = 28.293x - 12.785
R² = 0.9341
-20
0
20
40
60
80
100
0 0.5 1 1.5 2 2.5 3 3.5
Cu
mu
lati
ve
%
Rel
ease
Squar root of time
Higuchi Equation
y = 0.5x
R2 = 1
-0.4
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0 0.2 0.4 0.6 0.8 1 1.2
log o
f cu
mu
lati
ve
%
dru
g r
elea
se
log time
Peppas equation
Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 620
Lovastatin for biphasic release profile. Iranian J Pharm, 8,
2009, 15-25.
Dinesh Dhamecha, Amit A Rathi. Development and In
Vitro Evaluation of Oral Floating Matrix Tablet
Formulation of Ranitidine Hydrochloride. Research J.
Pharma, Dosage Forms and Tech, 1(1), 2009, 41-44.
Ravi Kumar, M. B. Patil, Formulation and Evaluation of
Effervescent Floating Tablet of Famotidine. Int. J. Pharm
Tech Res, 1(3), 2009, 574-563.
Rajesh Kaza, E. Usharani, Design and Evaluation of
Sustained release Floating tablets for thetreatment of
Gastric Ulcers. J. Pharm. Sci. & Res, 1(4), 2009, 81-87.
Rajeswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 621
FORMULATION AND IN-VITRO EVALUATION OF TERBUTALINE SULPHATE
SUSTAINED RELEASE TABLETS Rajeswari Kola*, Deepa Ramani N, Pragati Kumar B
Department of Pharmaceutics, Nimra College of Pharmacy, Vijayawada
*Corresponding author: E.Mail: [email protected]
ABSTRACT
Sustain release formulation maintain a constant level plasma concentration of drug so that multiple and night
dosing can be avoided. Terbutaline sulphate is a β2 stimulant drug which is having a very short half life of less
than 4 hours. It is available in conventional dosage form in thrice a day formulation. Being half life less there is
always a need for dosing frequency. Decreasing dosing frequency will increase the patient compliance for
asthmatic patients and thus avoiding dosing at odd hours. Terbutaline sulphate is available in market in different
immediate release dosage forms. After some time plasma concentration level decreases below MEC. So the
necessity of producing the drug in sustained release formulation. So an attempt is made to formulate terbutaline
sulphate in sustained release formulation with different concentrations of HPMC K15 and HPMC K4M polymers
so that it can provide effective drug release up to 12 hours. The powder blend is subjected to pre compressional
parameters. The prepared tablets were subjected to post compressional parameters. The results of the present
study showed that the polymer ratio used in the formulation F5 showed enhanced result and released the drug up
to 12 hours with 99 % drug release.
Key words: Asthma,Terbutaline sulphate, β2-adrenergicagonists, Sustained release
INTRODUCTION
Asthma is the predeposition to chronic
inflammation of the lungs in which the bronchi are
narrowed. It is most common in childhood and occurs in
approximately 10% of the pediatric population(S.P. Vyas
et.al,2004).. People with asthma have extra sensitive or
hyper responsive airways. The airways react by narrowing
or obstructing when they become irritated. There are two
factors that provoke asthma. Triggers result in tightening
of the airways and other would be inflammation of the
airways due to allergens (Harish NM, 2011). Probably 75-
80% of young asthmatics are allergic. It affects children
varying degree from very mild to very severe. There is a
general trend of increased deaths and hospitalization from
asthma recorded in an entire all the industrialized
countries of the world (Ranabir Chandaa, 2010, Ibrahim
Khattab, 2009).Terbutalinesulphate is an effective broncho
dilator and relatively short acting β2-
adrenergicagonistsused in the treatment of bronchial
asthma, chronic bronchitis and emphysema. It has shorter
biological half life of 3-4hours.The usual does of TBS for
oral adults is 5mg taken every 6 hours 3 times a day. In
children 12 to 15 year age the used does is 2.5 mg 3 times
a daily.Terbutaline is incompletely absorbed from the GIT
and also subject to extensive first pass metabolism by
sulphate conjugation in the liver and possibly by the gut
wall. However due to short biological half life and low
bioavailability of the drug high frequency dosing is
necessary for the effective therapy (NandvishalV.Deore
et.al,1012). Its short biological half life and thus frequent
administration create necessity to development of long
acting formulation is desirable to improve not only the
treatment of lung disorder but also the patients
compliance. In the present investigation it was tried to
develop long acting formulation of terbutalinesulphate to
improve itself.Attempt was made to prepare sustained
release tablets of terbutalinesulphate using different
concentrations of sustained release polymers.(Naresh
B.Rajgor, 2010)
MATERIALS AND METHODS
Terbutaline sulphate was obtained from Darwin
laboratories,Vijayawada,HPMC K15and HPMC K 4Mwas
obtained from Coloron Asia Pvt.Ltd,Goa, Ethyl cellulose
was obtained from Loba Cheme Pvt.Ltd ,Mumbai ,Iso
propyl alcoholwas obtained from Finar
reagents,Ahmedabad, lactosewas obtained from Loba
cheme pvt.ltd,Mumbai, PVP K 30was obtained from
Qualikens,Vadodara, Magnesium stearate and Talc was
obtained from Sd.Fine Chemicals Ltd.Mumbai.
Preformulation studies: The powder blend was subjected
to preformulation studies like bulk density, tapped
density,Angle of repose, Carr’s compressibility
index,Hausner’s ratio.( RaghavendraRao, 2012)
Drug-excipient Compatability Study: The IR absorption
spectra of the pure drug and with different excipients were
taken in the range of 4000-450 cm-1
using KBr disc
method. (Sahin, 2009)
Formulation of 7.5mg Terbutalinesulphate sustained
release tablets: Tablets containing 7.5 mg of
Terbutalinesulphatewere prepared with a total tablet
weight of 120 mg considering the Preformulation studies
and the literature survey, the excipients were selected and
an attempt was made to produce sustained release tablets
maintaining the basic tablet properties.
Rajeswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 622
Procedure: Granules were prepared by using wet
granulation technique. Ingredients were weighed and
taken in to motor. Finally the active ingredient was mixed
homogeneously according to geometric proportions.
Selected polymers are added. All the ingredients are made
into a mass with alcoholic 3% solution of PVP K30.
The coherent mass was thoroughly sieved through
16 mesh and then dried in hot air oven at 50ºC for 45 min.
The dried granules were passed through sieve no 20 to get
uniform granules. To this calculated amount of
Magnesium Stearate and Talc were added as a lubricant.
Then the prepared granules were evaluated in the
following parameters bulkdensity, tapped density, angle of
repose, compressibility index and Hausner’s ratio.
Post formulation studies:The formulated tablets were
subjected to post formulation parameters like Thickness,
Hardness, Weight variation, Friability(Harish NM
et.al,2011).Invitro dissolution and stability
studies.(USP,2010)
RESULTS AND DISCUSSION
Drug-excipients compatibility studies by observing
physical appearance: The pure drug and along with
formulation excipients were subjected to
compatibilitystudies and studies were carried out by
mixing definite proportions of drug andexcipients and
kept on glass vials which are stored in desiccator for one
month.
Drug- Excipients compatibility studies by Infrared
spectroscopy: Infrared spectra were recorded on a Fourier
transform Infrared (FTIR) spectrophotometer using KBr
dispersion method. All samples were recorded in the range
of 4000-400 cm-1
.From IR Spectra’s it was found that
there was no drug-excipients interaction.
Pre compressional studies: The powder blend was
subjected to pre formulation parameters like Bulk density,
Tapped density,A ngle of repose,Compressibility index,
Hausner’s ratio.
Post-compression parameters: The tablets of different
formulations were physically characterized by parameters
like Thickness, Average Weight, Hardness and Friability,
Uniformity of weight, In-vitro dissolution studies.
Table.1.Formulation of Terbutaline sulphate tablets with sustained release polymers
Ingredients (mg) F1 F2 F3 F4 F5 F6 F7 F8 F9 F10
Terbutaline sulphate 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5
HPMC K 15 30 55 25 - 40 35 30 - 20 15
HPMC K4M 30 - 25 45 - - - 25
Ethyl cellulose 30 35 40 45 50 55 60 65 70 75
Isopropyl Alcohol Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S
Lactose 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5
PVP K 30 5 5 5 5 5 5 5 5 5 5
Magnesium stearate 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5
Talc 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5
Total 120 120 120 120 120 120 120 120 120 120
Table.2.Pre-compression parameters
Powder blend Angle of
Repose (°)
bulk density
(g/cc)
Tapped
density (g/cc)
Compressibility
index (%)
Hausner ratio
F1 22.4 0.463 0.529 18.2 1.18
F2 26.5 0.457 0.538 19.22 1.22
F3 25.66 0.466 0.505 15.58 1.22
F4 23.99 0.525 0.669 17.18 1.16
F5 24.3 0.501 0.648 18.1 1.20
F6 28.97 0.453 0.575 19.12 1.21
F7 24.84 0.432 0.55 17.17 1.19
F8 21.99 0.525 0.52 19.78 1.23
F9 29 0.501 0.669 16.61 1.24
F10 28.97 0.451 0.648 20.73 1.26
Rajeswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 623
Table.4.Post-compression parameters
Formulations Average Weight (mg) Friability (%) Hardness (Kg/cm2) Thickness (mm)
F1 120±.01 0.38±0.02 3±0.2 4.22
F2 120±0.13 0.545±0.03 3.5±0.65 4.32
F3 120±0.24 0.676±0.52 4±0.25 4.38
F4 120±0.05 0.432±0.032 4.5±0.17 4.44
F5 120±0.6 0.298±0.01 5±0.15 4.18
F6 120±0.20 0.156±0.020 4±0.62 4.1
F7 120±0.25 0.478±0.6 5±0.38 4.32
F8 120±0.28 0.436±0.32 4.5±0.35 4.32
F9 120±0.65 0.529±0.07 4±0.45 4.38
F10 120±0.71 0.683±0.030 4.5±0.30 4.44
Fig.7.Cumulative %drug release of formulations F1to F10
CONCLUSION
The experimental work was carried out to prepare
sustained release tablets of long acting turbutaline
sulphate. Terbutalinesulphate is a class II drug according
to BCS with a half life of 3-4 hours. It is administered
thrice a day which results in ineffective therapy. Being
half life less there is always a need for dosing frequency.
Decreasing dosing frequency will increase the patient
compliance for asthmatic patients and thus avoiding
dosing at odd hours. Terbutaline sulphate is available in
market in different immediate release dosage forms. After
some time plasma concentration level decreases below
MEC. So the necessity of producing the drug in sustained
release formulation. So attempt is made to formulate
terbutaline sulphate in sustained release formulation with
different ratios of HPMC K15 polymer so that it can
provide effective drug release up to 12 hours. The results
of the present study showed that the polymer ratio used in
the formulation F5 showed optimized result and released
the drug up to 12 hours. The Terbutaline sulphate
sustained release tablets containing polymer HPMC K 15
showed better release based on the drug release which
showed percent drug release approximately 99 % within 8
- 12 hours.
REFERENCES
Chanda R, Ghosh A, Biswas S and Chowdhury SR.
Formulation of oral mucoadhesive tablets of terbutaline
sulphate using some natural materials and in-vitro and in-
vivo evaluation. Journal of Pharmaceutical Research and
Health Care, 2010, 2 (1), 32-45.
Dr.N.G.RaghavendraRao, Harishpanchal and mohd abdul
Hadi, Formulation and evaluation of biphasic drug
delivery system of Terbutaline sulphate for chronotherapy,
Int J Pharm Bio Sci, 2012, 3(3), 626 – 637.
Ibrahim Khattab, Farzana Bandarkar1, Ahmed
Lila,Formulation and optimization of sustained release
0
20
40
60
80
100
120
0 2 4 6 8 10 12 14
%d
rug
rele
ase
Time(hrs) F1 F2 F3 F4 F5
F6 F7 F8 F9 F10
Rajeswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 624
terbutaline sulfate microspheres using response surface
methodology, DrugDiscovTher, 2009, 3(3), 123-135
Jovanvic M, Jovicic G, Duvic Z, Agbaba D, Nikolic
L.Effect of fillers and lubricants on acetylsalicylic acid
release kinetics from Eudragit matrix tablets. Drug Dev
Ind Pharm. 1997; 23:595-602.
Kim CK, Kim MH. Preparation and evaluation of
sustained release microspheres of terbutaline sulfate. Int J
Pharm, 1994; 106:213-219.
Mathew T, Agrawal S. Design and development of fast
Melting Tablets of Terbutaline Sulphate, Research Journal
of Chemical Sciences, 2011; 1(1), 60-63.
NandvishalV.Deore, Vinod M. Thakare, Bharat W.Tekade,
Vijay R. Patil. Formulation and evaluation ofTerbutaline
sulphate pulsatile drug delivery system,,2012 September;
1(3):(p)1004-1015.
Naresh B.Rajgor1, Manish Patel, Viral M. Shah, VH
Bhaskar, Ganesh C.Rajput Preparation and
Characterization of Terbutalin Sulphate Microsphere,
2010, 2(5): 450-459.
Qureshi J, Amir M, Ahuja A, Baboota S, Ali J,
Chronomodulated drug delivery system of salbutamol
sulphate for the treatment of nocturnal asthma, Indian J.
Pharm. Sci. 2008; 70(3), 351-356.
Ranabir Chandaa, AmitRoyb, SanjibBahadurb,
SumanSahab, SujoyDasc, AnantaChoudhury,Formulation
of terbutaline sulphate mucoadhesive sustained release
oral tablets from natural materials, Asian Journal of
Pharmaceutical Sciences 2010, 5 (4), 168-174.
S.P. Vyas, R.K. Khar, Targeted and controlled drug
delivery, CBS publishers, New Delhi,2004, 459 – 463.
Sahin S, Selek H, Ponchel G, Ercan MT, Sargon M,Hincal
AA, Kas HS. Preparation, characterization andin vivo
distribution of terbutaline sulfate loaded albumin
microspheres, J Control Release, 2002, 82, 345-358.
United States Pharmacopoeia 32 NF 27, United States
Pharmacopoeial Convention,Rockville, 2009, 6381.
Vaidya VM, Manwar JV, Mahajan NM, and Sakarkar DM.
Design and In-vitro Evaluation of Mucoadhesive Buccal
Tablets of Terbutaline Sulphate. Int. J. Pharm Tech
Research, 2009; 1(3): 588-597.
Pushpavathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 625
EVALUATION OF ANTIDIABETIC ACTIVITY OF METHANOLIC EXTRACT OF
FLOWERS OF CASSIA SIAMEA IN ALLOXAN INDUCED DIABETIC RATS OF BASAL
DIET AND MAIDA MIXED DIET Pushpavathi P*, Janarthan M, Firasat Ali.
Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India *Corresponding author: Email: [email protected], Phone +91-9966974478
ABSTRACT
This study was carried out to evaluate the antihyperglycemic effect of the Methanol extracts of the flowers of C.
siamea on alloxan induced rats of normal diet and maida mixed diet. The extracts were orally administered daily
at 200 and 400 mg kg-1
body weight for three weeks. The effects of the extracts on Fasting Blood Glucose (FBG)
level were determined weekly. All rats in the diabetic groups (both basal diet and maida mixed diet) had FBG
levels well within the diabetic range (>150 mg dL-1
) at the initial stage of the experiment but after three weeks of
treatment with extracts or metformin. The FBG significantly dropped in dose-dependent manner, and also correct
the lipid profile and liver enzymes. The results suggest that the Methanol extracts of the flowers of Cassia siamea
restored the metabolic changes in alloxan-induced diabetic rats.
Key words: Cassia siamea, Metformin, Alloxan, Maida, Anti diabetic activity
1. INTRODUCTION
Diabetes mellitus is a metabolic disorder initially
characterized by a loss of glucose homeostasis with
disturbances of carbohydrate, fat and protein metabolism
resulting from defects in insulin secretion, insulin action,
or both. Studies have demonstrated that, in some
countries, diabetes affects up to 10% of the population
aged 20 years and older. Plant derived substances has
obtained greater attention in the recent years to prevent
and cure human diseases. In present study Cassia siamea
flower was selected for anti diabetic activity because it is
having anti oxidant property. Diabetes induced by alloxan,
it produce oxidative free radicals. This free radicals
damage the β-Cells of pancreas. Maida also having
alloxan in it, as smoothening agent. It also causes diabetes
hence it was given as feed for one model of animals. Due
to anti oxidant property of flowers of Cassia siamea, the
oxidative species were reduced so that β-Cells were
recovered (1, 2)
.
2. MATERIALS AND METHODS
Collection and authentication of plant material: The
Cassia siamea(Fabaceae) flowers were collected during
the march-2013 from Chinnamunagala, Near Khammam
(Dist),Andhra Pradesh and authenticated from Dr K
Madhava chetty, Assistant professor, Department of
Botany, srivenkateswara, university, Thirupathi.
Preparation of extract: The shad dried flowers were
collected and powdered. The powdered plant material
(100gms) was extracted with methanol (90%v/v) by using
soxhlet apparatus. The extract was air dried to evaporate
solvent (4)
.
Animals: The male wister albino rats (200-250g) were
obtained from the central animal house of Sigma institute
of clinical research & administration PVT LTD,
Hyderabad. The animals were housed at room temperature
(22-28 ºC) for 12 hrs dark light cycles. Given standard
laboratory feed and water ad-libitum for alloxan induced
group and Maida mixed diet and water ad-libitum for
alloxan induced group of maida mixed diet animals.
Institutional Animal Ethics Committee
(769/2010/CPCSEA) approved the study.
Sample Collection: Blood samples were collected by the
retro-orbital plexus puncture method from overnight
fasted rats under light ether anesthesia and blood glucose
levels were estimated using Glucometer ( Gluco check
(Aspen Diagnostic (P) LTD, Delhi).
Acute Toxicity Study: toxicity studies were performed
according to OECD-423guidelines.
Anti hyperglycemic activity: The plant extract of Cassia
siamea exhibited significant anti diabetic activity. As in
the alloxan treated group of basal diet and maida mixed
diet the blood glucose level (BGL) high due to cytotoxic
effect of alloxan on the β-cells of islets of langarhans.
Present study has confirmed that the treatment of
methanolic extract of cassia siamea for a period of
3weeks caused a significant decreased in BGL of diabetic
rats. 200&400 mg/kg of plant extract were screened for
anti diabetic activity against alloxan induced diabetic rate
of basal diet and maida mixed diet. It produced significant
anti diabetic activity in a dose dependent manor. The
animals treated with alloxan and maida mixed diet has
high BGL than animals treated with alloxan and basal diet.
The anti diabetic activity exhibited by extract was
compared with that of standard drug (Metformin).
Pushpavathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 626
Treatment design:
Alloxa +Basal diet Alloxan + Maida mixed diet
Group I Normal rats 0.5 ml of 5% Tween-80 in
distilled Water orally Group I Normal rats 0.5 ml of 5% Tween-80 in
distilled Water orally
Group II Diabetic rats received alloxone
(180mg/kg) Group II Diabetic rats received alloxone
(180mg/kg)+Maida mixed diet.
Group III Diabetic rats treated orally with CS 200
mg/kg Group III Diabetic rats treated orally with CS 200
mg/kg+Maida mixed diet
Group IV Diabetic rats treated orally with CS 400
mg/kg Group IV Diabetic rats treated orally with CS 400
mg/kg+Maida mixed diet
Group V Diabetic rats treated orally with
Metformin 14.2mg/kg Group V Diabetic rats treated orally with Metformin
14.2mg/k+Maida mixed diet
Evaluation of anti diabetic activity of methanolic
extract of flowers of Cassia siamea on alloxan
induced diabetic rats of basal diet.
1. The male wister albino rats (200-250g) were
obtained from the central animal house of Sigma
institute of clinical research & administrationPVT
LTD, Hyderabad.
2. The rats were fasted for 18hrs and water was
given ad libitum.
3. After 18hrs the fasting blood sample were
collected by retro orbital puncture (ROP) Or tail
picking.
4. The initial fasting BGL was estimated by using
glucometer. The animals show high >150mg/dl or
low <75mg/dl were discarded and the animals
showing optimum BGL 75-120mg/dl were
selected.
5. They were injected with alloxan(150mg/kg) i.p
6. After 72hrs of alloxan injection the blood sample
was withdrawn by ROP or tail picking method
and BGL were estimated by glucometer.
7. The animals that show BGL above 200mg/dl and
below 450mg/dl were selected for study.
8. The drug was prepared and administrate orally
according to body weight of animals.
9. Blood sample were withdrawn from all the
animals at 0,1,2,3 weeks by ROP or tail picking
method and BGL was estimated by glucometer.
10. Change BGL, average and SD were calculated
and tabulated.
Evaluation of anti diabetic activity of methanolic
extract of flowers of Cassia siamea on alloxan induced
diabetic rats of maida diet: The procedure was same as
above but the animals fed with maida mixed diet.
Preparation of maida mixed diet showed in the table
Analysis of blood samples: The serum glucose levels
measured in order to calculate their decreased serum
glucose and percentage. After the 1 hrs of treatment with
Cassia siamea flowers extract on 21st day the blood were
collected from retro-orbital plexus under light ether
anesthesia for glucose estimations. On 21st day the animals
are sacrifice under anesthesia the animals blood samples
were collected and serum was separated. The serum stored
at 2-8°C, stored at freezer for one day for the estimations
of ALT, AST, ALP, total cholesterol, triglycerides, HDL
cholesterol and LDL cholesterol, using kit manufactured
by Robonin(india)PVT.LTD, Navi Mumbai, India. The
instrument used for this was autoanalyser Robonin (india)
PVT.LTD, Navi Mumbai, India.
3. RESULTS
Anti diabetic activity of CS flower extract on diabetic
rats fed with basal diet: In an alloxan induced diabetic
rats (Gr. II) significantly increased serum glucose level at
0th (P<0.001), 1
st (P<0.001), 2
nd (P<0.001), and 3
rd
(P<0.001) weeks were shown in the Table No.1.
Administration of CS 200 and 400 mg/kg orally reduced
significantly serum glucose level at 0th week (P>0.001),
(P>0.001), at 1st week (P<0.05), (P<0.001), at 2
nd week
(P<0.001), (P<0.001) and after 3rd
week (P<0.001),
(P<0.001) when compared to (Gr. II) control respectively.
Metformin at an oral dose 14.2 mg/kg reduced serum
glucose level at 0th week (P>0.001) at 1
st week (P<0.001),
at 2nd
week (P<0.001), and after 3rd
week (P<0.001),
significantly when compared with control respectively.
Anti diabetic activity of CS flower extract on diabetic
rats fed with maida mixed diet: In an alloxan induced
diabetic rats (Gr. II) significantly increased serum glucose
level at 0th (P<0.001), 1
st (P<0.001), 2
nd (P<0.001), and 3
rd
Pushpavathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 627
(P<0.001) weeks were shown in the Table No.2.
Administration of CS 200 and 400 mg/kg orally reduced
significantly serum glucose level at 0th week (P>0.05),
(P>0.001), at 1st week (P<0.001) , (ns), at 2
nd week
(P<0.001), (ns) and after 3rd
week (P<0.01), (P<0.05)
when compared to (Gr. II) control respectively. Metformin
at an oral dose 14.2 mg/kg reduced serum glucose level at
0th week (P>0.001) at 1
st week (P<0.001), at 2
nd week
(P<0.001), and after 3rd
week (P<0.001), significantly
when compared with control respectively.
Table.1. Effect of CS flower extract on serum glucose levels on Alloxan induced diabetic rats
All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of
Variance(ANOVA)fallowed by dunnett’s multiple comparison tests,*p<0.05,**p<0.01,***p<0.001 as compared to
control and a p<0.001.
b p<0.01,
c p<0.05 as compared with normal group
Table.2. Effect of CS flower extract on serum glucose levels on Alloxan induced diabetic rats fed with maida mixed
diet
Treated groups Blood glucose levels(mg/dl)
0 week 1st week 2nd week 3rd week
Normal 87.17±4.38 81.67±2.62 80.83±2.67 79.00±1.39
Control(allox150mg/kg+maida
diet
400.2±0.94a 201.2±1.01
a 104.0±0.89
a 94.17±1.30
a
STD(Met14.2mg/kg+maida diet) 215.4±3.85*** 131.8±4.09*** 86.0±0.57*** 73.17±1.74***
CS(200mg/kg) 388.2±0.94* 266.8±0.60*** 131.2±0.83*** 98.33±0.88**
CS(400mg/kg) 310.5±0.76*** 196.7±1.22ns
108.8±0.703ns
89.33±0.61*
Table.3.Effect of CS flower extract on liver enzyme levels on Alloxan induced diabetic rats
Table.4.Effect of CS flower extract on liver enzyme levels on Alloxan induced diabetic rats fed with maida mixed
diet
Treated groups SGOT(iu/l) SGPT(iu/l) ALP(iu/l)
Normal 37.30±0.805 51.35±0.659 92.66±0.707
Control(allox150mg/kg+maida diet 69.07±0.647a
98.48±0.427a
188.65±0.616a
CS(200mg/kg) 43.65±0.764*** 33.08±0.666* 166.39±0.579*
CS(400mg/kg) 40.58±0.595*** 62.16±0.670* 154.28±0.874**
STD(Metf14.2mg/kg+maida diet) 39.46±0.551*** 50.48±0.574** 140.87±0.635***
Note: All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of
Variance(ANOVA)fallowed by dunnett’s multiple comparison tests,*p<0.05,**p<0.01,***p<0.001 as compared to
control and a p<0.001.
b p<0.01,
c p<0.05 as compared with normal group
Treated groups Blood glucose level(mg/dl)
0 week 1st week 2nd week 3rd week
Normal 76.83±0.68 77.83±0.36 73.0±0.52 74.66±0.60
Control(allox 150mg/kg) 239.83±0.92a 217.16±1.13
a 137.83±0.86
a 82±0.70
a
Standard(Met(14.2mg/kg) 220.66±0.64*** 175.83±0.54*** 103.66±0.64*** 78±0.66***
CS(200mg/kg) 318.50±0.69*** 220.50±0.77* 185.83±0.54*** 100.33±0.64***
CS(400mg/kg) 487.50±0.69*** 307.00±0.88*** 191.66±1.01*** 92±0.77***
Treated groups SGOT(iu/l) SGPT(iu/l) ALP(iu/l)
Normal 37.30±0.805
51.35±0.659 92.66±0.707
Control(Alloxan 150mg/kg) 48.05±0.969a
86.88±0.740a
175.82±0.808a
CS(200mg/kg) 40.64±0.626*** 54.23±1.202*** 154.10±1.015***
CS(400mg/kg) 33.99±0.738*** 62.25±0.823*** 144.21±1.008***
Standard(Metformin(14.2mg/kg) 43.21±0.963*** 49.68±0.865*** 143.23±1.49***
Pushpavathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 628
Table.5.Effect of CS flower extract on lipid profile on Alloxan induced diabetic rats
Treated groups TC(mg/dl) HDL(mg/dl) LDL(mg/dl) TG(mg/dl) VLDL(mg/dl)
Normal 70.04±1.87 21.52±0.46 37.64±1.15 77.08±0.66 15.41±0.13
Control(allox 150mg/kg) 124.9±0.73a
17.18±0.26a
91.85±1.00a
159.85±1.62a
31.97±0.32a
CS(200mg/kg) 82.36±2.37*** 22.33±0.61*** 26.06±0.87*** 100.43±0.49*** 20.09±0.09***
CS(400mg/kg) 58.92±0.38*** 25.35±0.52*** 13.08±0.28*** 102.40±0.83*** 20.48±0.15***
STD(Met(14.2mg/kg) 68.67±0.47*** 28.81±0.45*** 11.38±0.71*** 142.35±0.61*** 28.47±0.12***
All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of
Variance(ANOVA)fallowed by dunnett’s multiple comparison tests,*p<0.05,**p<0.01,***p<0.001 as compared to
control and a p<0.001.
b p<0.01,
c p<0.05 as compared with normal group
Table.6.Effect of CS flower extract on lipid profile on Alloxan induced diabetic rats fed with maida mixed diet TREATED GROUPS T C(mg/dl) HDL(mg/dl) LDL(mg/dl) TG(mg/dl) VLDL(mg/dl)
Normal 70.03±1.87 21.52±0.46 37.64±2.09 77.08±0.66 15.41±0.13
Control(alx150mg/kg+maida diet 140.98±0.52a
17.11±0.74a
78.81±1.73a
203.2±6.50a
40.64±1.30a
CS(200mg/kg) 86.72±0.75*** 21.52±0.46*** 45.76±1.05*** 97.16±0.43*** 19.43±0.08***
CS(400mg/kg) 76.17±0.53*** 24.51±0.55ns
12.09±0.16*** 197.76±0.66*** 27.20±5.59**
STD(Met14.2mg/kg+maida diet) 68.66±0.75*** 28.81±0.45** 13.79±0.87*** 130.80±3.05*** 26.15±0.60**
All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of
Variance(ANOVA)fallowed by dunnett’s multiple comparison tests,*p<0.05,**p<0.01,***p<0.001 as compared to
control and a p<0.001.
b p<0.01,
c p<0.05 as compared with normal group
4. DISCUSSIONS
In order to establish a scientific basis for the
utilization Cassia siamea extracts in the treatment of
diabetes, it was decided to evaluate the anti-diabetic effect
in Alloxan-induced diabetic rats of basal diet and maida
mixed diet.
5. CONCLUSION
The Cassia siamea flower extract, possesses anti-
diabetic activities in alloxan diabetic rats of basal diet and
maida mixed diet. The Cassia siamea flower extract,
showed a consistent effect on the Alloxan induced changes
in the blood sugar level and the beta-cell population in the
pancreas. From the above discussion it conclude that the
Cassia siamea flower extract at high doses (200, 400
mg/kg) exhibited significant anti-hyperglycemic activity. So
it can be used for the treatment of insulin dependent
diabetes mellitus.
6. ACKNOWLEDGEMENT
The authors would like to thank beloved parents
and all my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
Anti diabetic properties and brain shrimp toxicity of the
aqueous extract of the root of Cassia siamea lam E.E
Odason and J A Kolawole, Nigerian journal of
pharmaceutical research, 6(1), 2007, 66-69.
Barcelo A and Rajpathak S, Incidence and prevalence
of diabetes mellitus in the Americas.American Journal
of Public Health,10, 2001, 300-308.
Edwin J, Joshi SB, Jain DC. Antidiabetic activity of
flower buds of Michelia champaca Linn, Indian J
Pharmacol, 40, 2008, 256-60.
Manonmani G, Bhavapriya V, Kalpana S, Govindasamy
S, Apparanantham T. Antioxidant activity of Cassia
fistula flowers in alloxan induced diabetic rats, J
Ethnopharmacol, 97, 2005, 39-42.
Ranganathan S and Sridharan K, Effect of an
Antidiabetic Extract of CatharanthusRoseus on
Enzymic Activities In Streptozotocin Induced Diabetic
Rats, Journal of Ethnopharmacology, 76, 2001, 269-
277.
Swanston-Flat, S.K., Day, C., Bailey, C.J., Flatt, P.R,
Traditional plant treatmentfor diabetes: studies in
normal and streptozotocin diabetic mice, Diabetologia,
33, 1990, 462–464.
Szkudelski T, The Mechanism of Alloxan and
Streptozotocin Action in B Cells of The Rat Pancreas,
Physiological Research, 50(6), 6, 2001, 537-546.
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 629
FORMULATION AND EVALUATION OF TRANSDERMAL PATCHES OF ANTI-
HYPERTENSIVE DRUG METOPROLOL SUCCINATE Koteswararao P
1*, Duraivel S
1, Sampath Kumar KP
2, Debjit Bhowmik
3
1. Nimra College Of Pharmacy,Vijayawada, Andhrapradesh
2. Coimbatore Medical College,Coimbatore
3. Karpagam University,Coimbatore
*Corresponding author: Email: [email protected]
ABSTRACT
The present research work is an attempt to develop and evaluate matrix-type transdermal therapeutic system
of metoprolol succinate. It has a relatively greater blocking effect on beta 1-receptors.Transdermal patches of
metoprolol succinate were developed with different ratios of hydrophilic - HPMC and hydrophobic –EC polymer
combinations by solvent evaporation technique. The Fourier transform infrared spectroscopy (FTIR) was used to
confirm compatibility and to rule out any possible interactions between drug and polymers. Ten transdermal patch
formulations consisting HPMC K 15 M and Ethyl Cellulose were prepared. All formulations carried Dimethyl
Sulfoxide as penetration enhancer and Dibutyl Phthalate as plasticizer and dichloromethane and methanol as
solvent system. The prepared patches were evaluated for their physicochemical characteristics such as
weight variation, thickness, folding endurance, percentage moisture absorption, percentage moisture loss,
and drug content and In- vitro drug diffusion studies. Data of In - vitro drug diffusion from patches were fit in to
different equations and kinetic models to explain release kinetics. The Cumulative drug release from Formulation
K10 was found to be (97.36±1.089), after 24 hrs. So the formulation K10 is emerged as ideal formulation for
metoprolol succinate because it showed better release with sustained effect as compared to other formulations.
KEY WORDS: Metoprolol Succinate; HPMC and Ethyl Cellulose, Hypertension, First pass metabolism
INTRODUCTION
Transdermal drug delivery systems are adhesive,
drug containing devices of defined surface area that
deliver a pre-determined amount of drug to the surface of
intact skin at a pre-programmed rate. These systems
provide drug systemically at a predictable rate periods of
time. Currently transdermal drug delivery is one of the
most promising methods for drug application through the
skin to the systemic circulation. Transdermal drug
delivery system Avoidance the first- pass metabolism and
gastro intestinal incompatibility. This Single application
has capacity for multi day therapy, thereby improving
patient compliance and Self medication is possible with
this systems. This is Provides utilization of drugs with
short biological half life, narrow therapeutic window and
avoiding the fluctuations in drug levels. Metoprolol
Succinate dose is (25-200 mg) daily. It used as a treatment
of Hypertension, Angina pectoris and cardiac arrhythmias.
Metoprolol succinate is a greater blocking effect on beta
1-receptors. It is a white crystalline powder. It is freely
soluble in water and soluble in methanol, sparingly
soluble in ethanol, slightly soluble in dichloromethane and
2-propanol. The plasma half-life of Metoprolol Succinate
is 3 to 7 hours and it is indicating about 50% first-pass
metabolism. Only a small fraction of the drug (about 12%)
is bound to human serum albumin. Peak plasma
concentrations are achieved after 2–3 hours is almost
completely absorbed (95%) after oral administration.
Therefore Metoprolol Succinate is an ideal drug
candidate for transdermal drug delivery system.
MATERIALS AND METHODS
Metoprolol Succinate was obtained from as gift
sample from Zyduscadila, Ahmadabad, Gujarat. HPMC K
15 M and Ethyl Cellulose obtained from Micro advance
research center, Banglore, Karnataka. Dibutyl phthalate,
Dimethyl sulfoxide and Dichloro methane were purchased
from Merk specialities, pvt.Ltd.Mumbai and methanol
from Jianasuhuaxi International trade co.ltd. Made in
china.
Transdermal patches of metoprolol succinate were
prepared by solvent evaporation method. The polymers
EC, HPMC-K 15M, were taken in required quantity.
About 14ml of solvent mixture of dichloromethane:
methanol (1:1) was added and stirred well and after
complete solubilization of polymers in mixture of solvent,
added required quantity of Dibutyl Phthalate to this
mixture, it is act as a plasticizer. Next weighed quantities
of metoprolol succinate added to the polymer solution and
mixed well and finally add permeation enhancer (Dichloro
Methane). It was set-aside for some time to exclude any
entrapped air and was then transferred into a previously
cleaned Petri plate and then this was kept aside for solvent
evaporation. The rate of solvent evaporation was
controlled by inverting a glass funnel over the Petri plate.
After over night, the dried films were taken out and stored
in desiccators. The compositions of Transdermal Patches
were shown in table.1.
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 630
Table.1.Composition of Transdermal Patch Ingredients
(In mg or ml) K1 K2 K3 K4 K5 K6 K7 K8 K9 K10
Metoprolol succinate 25 25 25 25 25 25 25 25 25 25
HPMC-K 15 M 800 - 50 100 150 200 250 300 350 400
Ethyl cellulose - 800 750 700 650 600 550 500 450 400
Dibutyl phthalate 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6
Dimethyl sulfoxide 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1
Methanol:
dichloromethane(1:1) 14 14 14 14 14 14 14 14 14 14
EVALUATION OF TRANSDERMAL PATCHES
FTIR study: The Infrared (IR) spectra were recorded
using an FTIR by the KBr pellet method and spectra
were recorded .The spectra obtained for Metoprolol
Succinate, polymers, and physical mixtures of
Metoprolol Succinate with polymers were compared.
Disappearance of metoprolol succinate peaks or shifting
of peak in any of the spectra was studied.
Thickness: The thickness of films was measured by
digital Verniercalipers with least count 0.01mm.
The thickness uniformity was measured at five different
sites and averages of five readings were taken with
standard deviation.
Folding Endurance: It was determined by repeatedly
folding a small strip of films at the same place till it broke.
The number of times, the films could be folded at the
same place without breaking gave the value of folding
endurance.
Weight variation
The three patches from each batch weighed on electronic
balance for weight variation test. The test was done to
check the uniformity of weight and thus check the batch-
to- batch variation.
Percentage of moisture loss: The percent moisture loss
was carried out to check the integrity of the film at dry
condition. This was carried out in the following
manner. The films were weighed accurately and kept in
the desiccators containing anhydrous calcium chloride.
After 3 days, the films were taken out and weighed.
Percentage of moisture loss formula:
Percentage of moisture loss
Per cent moisture absorption: The patches were
accurately weighed and placed in desiccators contains
humidity condition of 80-90 % RH is maintained by using
saturated solution of potassium chloride. The patches were
kept until uniform weight is obtained then taken out and
weighed. The percentage moisture uptake was calculated
as the difference between final weight (w2) and initial
weight (w1) with respect to initial weight.
Percent moisture absorption formula:
Percent moisture absorption
Drug content Determination: The prepared drug
contained patches specified surface area (1 cm2) were cut
and dissolved in 100ml of pH 7.4 phosphate buffer, and
vigorously shaked for 12hrs, and then sonicated for
15minutes, centrifuged at 5000 rpm for 30 min. Filter the
drug contained polymeric solution through 42 number
whatsman filter paper, then 1ml of the filtrate was taken in
a test tube and dilute it for five times with same solvent by
using double beam UV-Visible spectrophotometer to
determined drug content at max 223 nm. Respected
Placebo patch was taken as a blank solution.
In vitro drug release studies: Franz - diffusion cell was
used in our studies for in-vitro drug release. The cell
consists of two chambers, the donor and the receptor. The
donor compartment is open at the top and is exposed to
the atmosphere. The receptor compartment is surround
contain a water jacket for maintaining the temperature at
37oC ± 2 and is provided with a sampling port. The
diffusion medium was pH7.4 buffer, which was stirred
with magnetic beads used a magnetic stirrer. A semi-
permeable cellophane membrane previously soaked
overnight in 0. 1N HCl was placed between the two
chambers. The diffusion media was stirred to prevent the
formation of concentrated drug solution just beneath the
membrane. Samples from the receptor compartment were
taken at various intervals of time over a period of 24 hours
and the concentration of the drug was determined by UV
Spectrophotometric method using the standard curve.
Amount of drug diffused at various time intervals was
calculated and plotted against time.
RESULTS AND DISCUSSION
Our present work comprises the formulation and
evaluation of Metoprolol Succinate transdermal patches
for sustained or extended release for a prolonged period of
time. Transdermal patches of metoprolol succinate were
prepared by solvent evaporation method. Totally, ten
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 631
0
2
4
6
8
10
12
14
16
k1 k2 k3 k4 k5 k6 k7 k8 k9 k10
% m
ois
ture
co
nte
nt
formulation code
Percentage Moisture Content Studies
% moisture
absorption
% moisture
loss
formulation trials (K1 to K10) were done with the aim to
achieve the successful matrix type Metoprolol Succinate
transdermal patches. HPMC K 15 M and controlled
release Ethyl Cellulose polymers in the formulation of
Metoprolol Succinate transdermal patches individually
and in combination. Methanol and Dichloromethane used
as solvents. Dibutyl phthalate used as plasticizer and
dimethyl sulfoxide used as a penetration enhancer.The
compatibility study of the drug with excipients indicate no
characteristic visual changes and no additional peaks were
observed during FTIR studies.
All the patches were evaluated for weight
variation, thickness, percentage moisture absorption,
percentage moisture loss, drug content, folding endurance,
and in-vitro drug release. In this thickness study with the
help of Digital verneircalipers, the thickness of patches
was measured. It was found to be in between 0.15±0.015
to 0.18±0.019. All formulations have good film properties.
The folding endurance of the patches was found between
84.11±5.03 to 131±4.49, the results indicate, as the HPMC
concentration increases the folding endurance of the
patches increases. All formulations from K1 to K10 show
weight variation in between 1.10±0.0013 to 1.25±0.0014 gm. The percentage moisture absorption of the prepared
patches results between 0.99 ± 1.317 to 13.2 ± 1.993,
HPMC K 15 M Alone High Moisture Absorption. The
percentage moisture Loss of the prepared patches are in
following order
K1>K2>K10>K9>K8>K7>K6>K5>K4>K3. The
formulation containing HMPC K 15 M alone shows high
loss of moisture (14±3.30) when compare to other patches.
All formulations show good % drug content in
between 90 to 98. From the results of In - vitro drug
diffusion studies it is observed that, as the
concentration of hydrophilic polymer increases the drug
release from the transdermal patch increases. The
formulation K1 “HPMC alone” showed maximum drug
release of 95.16 ± 1.53 % after 8 hrs, even then the
formulation K1 cannot be considered as ideal formulation
for Metoprolol succinate because it fails to sustain the
drug release for 24 hrs. The formulation K2 showed
lowest drug release of 66.34 ± 0.664 % after 24 hrs.
Increase the hydrophilic polymer increase the % drug
release, formulas K3 to K10 the % drug release shown
order K3 (73.68 ± 1.031), K4 (77.39 ± 0.589), K5 (81.42
± 0.736), K6 (84.76 ± 0.55), K7 (87.13 ± 1.218), K8
(90.36 ± 1.789), K9 (92.58 ± 0.931), K10 (97.36 ± 1.089)
after 24 hrs. The formulation K10 containing HPMC and
EC (400:400) is emerged as ideal formulation for
Metoprolol succinate because it showed better release
with sustained effect as compared to other formulations.
The Cumulative drug release from Formulation K10 was
found to be (97.36±1.089), after 24 hrs. The drug release
kinetics studies showed Non-Fickian diffusion and Zero
order release.
Figure.1.Comparison between moisture loss and moisture absorption
Table.2.Evaluation of Patches Formulation
code
Thickness
(mm)
Folding
endurance
Weight uniformity
(gm)
% moisture loss % moisture
absorption
% drug content
K1 0.17±0.020 150±3.78 1.25±0.0014 14±3.30 13.2±1.993 99±0.25
K2 0.18±0.025 84.11±5.03 1.15±0.0015 12.1±2.01 0.99±1.317 90.11±0.75
K3 0.15±0.015 99.12±4.72 1.10±0.0013 5.50±1.53 2.11±1.514 96.83±0.39
K4 0.16±0.019 106.33±4.5 1.13±0.0012 5.10±1.24 2.151±1.689 97.37±0.48
K5 0.17±0.020 112±5.30 1.11±0.0015 6.13±1.44 3.253±1.734 97.99±0.79
K6 0.16±0.040 117.66±3.1 1.14±0.0013 7.30±2.12 3.514±1.414 98.92±0.39
K7 0.15±0.021 119.47±6.12 1.12±0.0014 8.15±2.33 4.131±1.324 97.91±0.70
K8 0.18±0.019 123±4.30 1.11±0.0015 9.13±1.24 5.32±1.408 97.83±0.52
K9 0.17±0.013 127.66±5.20 1.15±0.0012 9.20±1.75 6.311±1.383 98.95±0.44
K10 0.15±0.031 131±4.49 1.13±0.0013 10.12±2.10 7.123±1.289 98.97±0.43
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 632
0
20
40
60
80
100
120
0 10 20 30
cu
mu
lati
ve %
dru
g r
ea
lea
se
time (hr)
In-vitro drug permeation profile k1
k2
k3
k4
k5
k6
k7
k8
k9
k10
Table.3.In-vitro drug permeation of metoprolol succinate (K1 to K5) Time(hr)
0
Cumulative % drug release
K1 K2 K3 K4 K5
1 0 0 0 0 0
2 17.38±0.410 2.67±0.437 3.91±0.660 4.83±0.983 6.15±0.689
3 33.87±0.680 6.17±1.130 7.36±0.794 8.41±1.134 10.36±0.839
4 47.12±0.864 8.11±0.538 10.57±1.514 12.13±1.647 14.18±1.23
5 62.13±0.539 11.28±0.689 13.11±1.086 15.27±1.073 17.56±0.823
6 77.41±1.234 13.37±0.134 16.23±0.631 17.91±0.899 20.39±0.735
7 84.12±1.1 16.15±1.136 19.83±0.935 21.38±2.30 22.87±0.439
8 89.98±0.678 20.11±1.649 23.14±0.789 24.01±1.003 25.43±1.003
9 95.16±1.534 23.55±0.789 25.12±0.730 26.78±1.678 28.78±1.467
10 - 26.98±0.693 27.36±1.033 29.02±0.406 30.12±1.115
11 - 29.13±0.443 29.78±1.004 32.13±1.650 34.36±0.668
12 - 31.17±0.639 32.51±1.464 35.08±0,996 36.14±0.869
24 - 32.61±0.983 34.36±0.87 37.12±0.403 39.83±0.512
- 66.34±0.664 73.68±1.031 77.39±0.589 81.42±0.736
Table.4.In-vitro drug permeation of metoprolol succinate (K6 to K10) Time(hr)
Cumulative % drug release
K6 K7 K8 K9 K10
0 0 0 0 0 0
1 7.21±0.789 7.96±1.238 8.92±0.324 9.53±0.318 9.81±0.998
2 11.16±0.897 11.73±2.014 12.09±0.567 13.04±0.647 12.38±1.413
3 15.31±1.031 15.84±0.539 15.98±0.638 16.28±0.739 16.47±1.021
4 17.83±1.13 18.12±1.321 18.23±0.781 18.59±0.58 20.12±0.681
5 21.79±0.581 21.83±1.230 22.06±1.367 22.87±0.88 25.43±0.92
6 24.31±0.779 24.86±0.937 25.19±0.813 25.64±0.689 29.03±1.003
7 26.58±0.689 27.18±0.560 29.13±1.31 31.85±0.532 34.83±1.089
8 29.38±0.989 30.41±1.811 33.54±1.065 36.28±0.451 38.04±0.918
9 32.73±0.889 34.89±1.189 37.48±0.894 41.16±1.048 43.17±1.144
10 35.34±1.63 38.13±1.147 40.13±1.004 45.73±0.783 48.84±0.989
11 39.71±1.003 42.33±0.589 45.18±1.037 48.76±0.669 54.91±1.235
12 43.12±1.13 46.72±0.789 49.34±0.986 53.52±1.03 59.31±1.025
24 84.76±0.559 87.13±1.218 90.36±1.789 92.58±0.931 97.36±1.089
Figure.2.In- vitro drug permeation profile of Metoprolol succinate
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 633
Figure.3.FTIR Spectrum of pure Metoprolol succinate drug Figure.4.FTIR spectrum of ethyl cellulose
Figure.5.FTIR Spectrum of pure Metoprolol succinate drug
with ethyl cellulose Figure.6. FTIR spectrum of HPMC K 15 M
Figure.7.FTIR spectrum of pure Metoprolol succinate drug
with HPMC K 15 M
Figure.12.FTIR spectrum of pure Metoprolol succinate drug
with ethyl cellulose and HPMC K 15 M
Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 634
CONCLUSION
Metoprolol succinate is a an anti-hypertensive
agent which selected for the preparation of transdermal
delivery system as it complies with physicochemical
properties required to permeate through skin. The pre
formulation studies involving solubility, melting point,
partition coefficient and pH of the drug were found to be
comparable with the standard. The transdermal films of
metoprolol succinate were prepared by solvent
evaporation method and were subjected for evaluation
parameters such as weight variation, thickness, folding
endurance, drug content, percentage moisture
absorption, percentage moisture loss and diffusion studies.
All the parameters showed by the formulations were
within the limits.
The transdermal drug delivery system K1 (HPMC
K 15 M alone) showed the drug release (95.16±1.534), but
lasts only for 8 hrs. The transdermal drug delivery system
K2 (EC alone) showed lowest drug release but
successfully prolonged the release. Thus, formulations K3
to K10 were developed using different ratios of HPMC K
15 M and EC, in order to achieve better release along
with sustained action. All the formulations carried Dibutyl
Phthalate as plasticizer and Dimethyl sulfoxide as
permeation enhancer. The formulation K10 containing
HPMC K 15 M: EC (400:400mg) showed better release
(97.36±1.089) for sufficiently long period, up to 24 hrs
and emerged as ideal formulation for metoprolol
succinate. From this studies improving patient compliance
of metoprolol succinate by development of transdermal
Drug delivery system using HPMC K 15 M and Ethyl
cellulose.
REFERENCES
Ansari Khushbu, SinghaiAkhlesh Kumar, SaraogiGaurav
Kant, PatilSwaraj, Transdermal Drug Delivery of
Salbutamol Sulphate with Different Concentration of
Polymers, International journal of research in pharmacy
and science, 1(3), 2011, 50-65.
Darshan G. Trivedi, Hiren J. Patel, Anand K, Bhandari,
Dushyant A Shah, Preparation and evaluation of
transdermal patch ofdesloratadine, IJBR, 2(6), 2011,
359‐373.
Himansu Bhusan Samal, Suddhasattya Dey, Itishree
Jogamaya Das, Development and characterization of
transdermal patches of metoprolol Succinate, Journal of
Pharmacy Research, 4 (6), 2011, 1644-1647.
J.R.D.Gupta, R.Irchiayya, N.Garud. Formulation and
evaluation of matrix type transdermal patches of
Glibenclamide. International Journal of Pharmaceutical
Sciences Development and Research, 1(1), 2009, 46-50.
Putta Rajesh Kumar, Rajesh Tatavarthi, Mallikarjuna
gouda M, SomashekarShyale, S.M.Shanta Kumar ,
preparation of monolithic transdermal drug delivery
system for arthritis treatment and effect of permeation
enhancers on release kinetics, International Journal of
Pharmaceutical Sciences Review and Research, 6(2),
2011, 56-60.
Shivakumar H R, vishwanathbhat, Sheshapparai K,
ganeshsanjeev, Bhavyab B, Influence of blending of
chitosan and pullulan on their drug release behavior: an
in-vitro study. International Journal of Pharmacy and
Pharmaceutical Sciences, 4(3), 2012, 313-317.
Suvakanta Dash, Kinetic modeling on drug release from
controlled drug delivery systems drug research, 67(3),
2010, 217-223.
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 635
NEUROPHARMACOLOGICAL SCREENING OF ETHANOLIC EXTRACT OF
NELUMBO NUCIFERA GAERTNER SEEDS Sirisha Chowdary G
*
Department of Pharmacology, M.A.M.College of Pharmacy, Guntur, India
*Corresponding author: Email: [email protected]
ABSTRACT The neuropharmacological activities of the ethanolic extract of Nelumbo nucifera Gaertneer seeds were
screened in mice and rats. The extracts effect on phenobarbitone sodium induced sleep latency and sleeping
time,motor coordination activity,locomotor activity,anxiolytic activity(light-dark model transition in
mice,elevated zero maze),cerebral activator activity(nootropic) were evaluated. The ethanolic extract of Nelumbo
nucifera (50,100 and 200 mg/kg p.o) possess a significant (p<0.05) depression in general behavioral tests, and
potentiation of phenobarbitone induced sleeping time, and also shows anxiolytic action, in dose dependent
manner.The ethanolic extract of Nelumbo nucifera gaertnershows nootropic activity on Conditional avoidance
response, Morri’s water maze for spatial learning, but it weakly acts on acetylcholineesterase enzyme inhibitory
activity.Earlier studies conducted by various workers have revealed that several medicinal plants possess
nootropic activity, but only a few plants like W.somnifera possess both antistress as well as nootropic activity.
Similarly, our studies demonstrate that the plant nelumbo nucifera possesses a combination of activities. As
discussed earlier, these properties are complementary to each other and hence the plant could be a valuable
contribution to the existing armamentarium of nootropic agent having antistress activity.
KEY WORDS: Nelumbo nucifera Gaertner, Nymphaeaceae, Sedative-Hypnotic Activity, Anxiolytic Activity,
Cerebral Activator Activity.
INTRODUCTION
Disorders of the central nervous system (CNS),
including psychiatric disorders and stroke, have a
significant effect on morbidity and mortality. All of us are
aware of the many different states of brain activity,
including
sleep, wakefulness, extreme excitement, and
even different levels of mood such as exhilaration,
depression, and fear. All these states result from different
activating or inhibiting forces generated usually within the
brain itself. Some of the common neurological problems
in human beings are Anxiety, Insomnia, Autism,
Attention-deficit hyperactivity disorder, Tourette’s
disorder, Cognition.
Antipsychotic drugs like fluoxetine, imipramine
and antianxiety drugs like diazepam, alprozolam are used
for the many neurological disorders but the drugs
producing severe adverse effects and withdrawal
symptoms. An herbal medicine overcomes these incidents
traditional medicinal plants show same therapeutic effect
and lesser adverse effects when compared to modern
medicine.
Nelumbo nucifera is one of the aquatic plants
belongs to the family Nymphaeaceae or Nelumbonaceae
and it is called as Indian Lotus. A large aquatic herb with
slender, elongate, branched, creeping stems sending out
roots at the nodes.Alkaloids are reported in leaves, carpels
and rhizomes. The leaves contain three alkaloids, viz.,
Nuciferine (5, 6-dimethoxy aporphine) rosemerine, and
nornuciferine. An alkaloid nelumbine, which acts as a
cardiac poison, has been isolated from petioles.Pedicel
and seed embryo contains Saponin glycosides, Fat-soluble
bioactives etc.The vitamins reported to be present are as
follows (in mg/100gm): Thiamine 0.22, Riboflavin 0.06%
Niacin 2.1, and Ascorbic acid 15. Fresh rhizomes
Contains Water, crude protein, Fat, reducing sugars,
sucrose, starch, fibre, ash, calcium, asparagines. Dried
carpels contains Water, protein, fat, total Carbohydrates
(mostly starch), fibre, and ash, calcium, phosphorus, and
iron, Sucrose, reducing sugars and ascorbic acid etc.
Various phytochemical constituents have been reported in
Nelumbo nucifera Gaertner like fatty acids, carbohydrate,
triterpenes, glycosides, and fat soluble bioactives.
Raffinose and stachyose from rhizomes Nelumboside
0.1% from leaves, characterized as quercetin-3-
glucuronide. Nornuciferine, nuciferine, romaine, dl-
armepavine oxalate, pronuciferine, anonaine, 5-methoxy-
6-hydroxyaporphine, from leaves and seeds.Nornuciferine
characterized as 1-methoxy-2-hydroxyaporphine. A new
base neferine isolated from embryo, a quarternary base
lotusine along with isolienine isolated from embryo N-
nornuciferine, O-nornuciferine, liriodinine, d-
methylcoclaurine, remerine and dl-
armepavine.Methylcorypalline, neferine, isolienine and
lotusine isolated from embryo.
Seeds contain β-sitosterol, palmitic acid and
glucose.Oxoushine and N-norarmepavine isolated from
seeds.Seeds afforded isoliensinine, neferine, armepavine
and 4’-methylcoclaurine, asimilobine and lirinidine
isolated from leaves.Haemostatic activity shown by plant
extract attributed to quercetin which was identified in
receptacle.Rhizomes are used for diarrhea and dysentery,
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 636
menorrhagia.Embryo used to reduce high fever, treatment
of cholera, haemoptysis and spermatorhoea.Petals used for
syphilis, Sedative in the uterus, good in thirst, piles,
inflammation and poisoning. Neferine exhibited
antihypertensive activity, asimilobine and lirinidine
inhibited contraction of rabbit isolated aorta induced by
serotonin(1.0µM) Oxoushinsunine showed tumour
inhibitin activity, against nasopharynx cancer
Nelumbo Nucifera was claimed for many neurological
disorders. Screening of this plant will lead to development
of new drug.
MATERIALS AND METHODS
Plant material: The dried seeds of Nelumbo nucifera
Gaertner were collected from surrounding areas of
Tirupati and Tirumala hills, was identified and
authenticated by the botanist Dr. K. Madhava Chetty,
Assistant Professor, Department of Botany, S. V.
University, Tirupati. A voucher specimen was deposited
in the herbarium, Department of Botany, S.V. University,
Tirupati and the approximately 1 kg of dried plant
specimen was grinded and stored in air tight container at
room temperature until preparation of the extract.
Animals: Healthy Swiss albino mice of either sex
weighing between 25-30 gm, Wistar albino rats of either
of sex weighing between 150-200gm procured. Animal
Ethical Committee approved experimental protocol and
study was carried out under guidelines of CPCSEA. The
animals were kept for two weeks to acclimatize to
laboratory conditions before starting the experiment. They
were allowed to free access of tap water and standard rat
feed. Animal were housed in a laboratory maintained a 12-
hr light-dark cycle, and controlled room temperature (23
20
C) and relative humidity (50 10%). The animal
received an appropriate diet (rat chow). A restricted
feeding procedure was used for at least 1 week before the
study 150 gm/day/cage (n=6) of feed was given.
Preparation of Nelumbo nucifera Gaertner extract:
About 200gm of coarsed powdered Nelumbo nucifera
Gaertner Dried seeds was subjected to extraction with
petroleum ether solvent (60-80°C) by using Soxhlet
apparatus for 12hrs at , to remove fat material and the
marc was reused for extraction with 70%ethanol at 400C.
It was finally dried at low temperature under reduced
pressure in a rotary evaporator. The extract was
evaporated under reduced pressure until all the solvent had
been removed, obtained an extract sample with a yield of
6.8%. Phytochemicals of the extract were screened with
methods described earlier. Concentrated crude extract was
obtained and dissolved in 2%Tween 80 solution to prepare
50 mg/kg, 100 mg/kg and 200 mg/kg concentrations using
glass distilled water, prepared freshly prior to the
treatment.
Drugs and chemicals: Diazepam 2mg (Natco pharma
Ltd) was used as the standard sedative, and anxiolytic
drug, Tween-80 used as vehicle, Petroleum Ether (60-
800C) (Sisco research laboratories Mumbai), Ethanol
absolute(Hong Yang chemicals corporation China),
Phenobarbitone Sodium(Vulcan laboratories pvt Ltd
Kolkata), Piracetam500mg(Micro labs) , Scopolamine
hydrochloride(Sigma Aldrich Bangalore) and Glass
Distilled water.
PHARMACOLOGICAL SCREENING (In vivo
method)
General behavioral tests: Swiss albino mice were
divided into five groups (6 in each group). The first three
groups were treated with NnG seed extract at different
doses (50, 100 and 200mg/kg p.o), the fourth group was
treated with control vehicle 2% tween 80 (10ml/kg p.o)
and the fifth group received Diazepam (DZP, 2mg/kg p.o.)
which served as standard drug. The activities were
recorded at 30 min intervals in the first hour and at hourly
intervals for the next 4 hrs for the following parameters.
Spontaneous activity, awareness and alertness
were evaluated by placing a mouse in a bell jar. It usually
shows a moderate degree of inquisitive behavior. Mice
normally utter no sound, so that vocalization may point to
a noxious. By this property of mice Sound responses was
evaluated. Touch responses was noted when the animal
was touched with a forceps (or) pencil at various parts (i.e.
on the side of the neck, on the abdomen and on the
groin).Pain response was graded when a small artery
clamp was attached to the base of tail.
Sedative and Hypnotic activity
Phenobarbitone sodium induced sleep latency and
sleeping time: Mice were divided into 5 groups
containing six animals in each. On day of experiment,
mice from all groups will be placed in cages. Control
group will received saline and 2% tween80 10ml/kg/day
p.o. The three test groups will treated with 50mg, 100mg
and 200mg/kg/day Ethanolic extract of Nelumbo nucifera
Gaertner seeds. Reference group will received diazepam 2
mg/kg/day i.p. on the same day of experiment all groups
received
phenobarbitone 40 mg/kg/day i.p after thirty
minutes of the last dose of ethanolic extract of Nelumbo
nucifera Gaertner seeds to the three test groups and, 2%
tween 80 to control group to induce sleep. The animals
were observed for the latent period (time between
pentobarbitone administration to loss of righting reflex)
and the duration of sleep (time between the loss and
recovery of righting reflex).
Motor coordination activity: It was recorded in five
groups of (n=6) to the integrity of motor co-ordination
was assessed with a rota-rod apparatus at a rotating speed
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 637
of 8 rpm, by counting the number of falls from the rod in 3
min after 30, 60 and 120 min of treatments. The animals
were placed on a rotating bar (2.5 cm diameter).
Unaclimatised mice were able to remain on the rod for 3
or more min in two successive trials was selected for
testing. 5 Groups of six mice in each were treated with
NnG extract at doses 50mg/kg, 100mg/kg and 200mg/kg
p.o. and 2% tween 80(10 ml/kg p.o.), Diazepam (2mg/kg
i.p).
Locomotor activity: The locomotor activity was
measured using an actophotometer(IM CORP; Ambala,
India). The movement the animal interrupts a beam of
light falling on a photocell, at which a count was recorded
and displayed digitally. Each mouse was placed
individually in the actophtometer for 10 min and basal
activity score was obtained. Subsequently, the animals
were divided into groups, each consisting of six animals.
NnG (50, 100, &200mg/kg), 2% Tween 80, diazepam
(2mg/kg, i.p) was administered and after 30 min the mice
were placed again in the actophotometer for recording the
activity scoring. The locomotor activity count was
expressed in terms of total photo beam counts/ 10 min per
group.
Anxiolytic Activity: Mice were divided into 5 groups
containing six animals in each. On day of experiment,
mice from all groups were placed in cazes. All the drugs
were administered to the respective groups in all the
models for a period of seven days and experiments was
performed one hour after the administration of last dose.
All the experiments were carried in a sound attenuated
dark room. After test with each animal, all the apparatus
was cleaned with 5% alcohol in order to eliminate any
olfactory cues which might modify the behavior of the
next animals
Light-dark model transition test in mice: The light-dark
apparatus consists of two-compartment chamber
(40×60×20cm/h) comprising of a brightly illuminated area
(40×40cm) and a dark area (40×20 cm) separated by a
wall with a round hole (7 cm diameter) was used. Mice
were placed individually in the illuminated part of the
cage and following parameters were recorded during the
test session of 5 min, total no. of crossings between the
light and dark area, total time spent in the illuminated part
of the cage, time spent in the dark part of the cage, no. of
rearings in illuminated part of the cage, no. of rearings in
dark part of the cage, no. of defecation units.
Elevated zero maze: Mice were placed at the entrance of
a closed quadrant in an elevated zero maze (5.5cm width
with a 43cm inner diameter, 70cm high, 2mm thickness),
thickness of the run way edges minimizes the chance of a
mouse slipping off. The total time spent in the two closed
quadrants, which have black walls (20cm high) and two
open quadrants, was recorded for 5 min. The total duration
of time spent in the open quadrants is thought to
negatively reflect anxiety. Room light approximately 30
lux was adjusted (Tang et al. 2002).
Cerebral activator activity (Nootropic): Wistar rats
(160-200g) were divided into following groups each
consisting of six animals. All the drugs were administered
to the respective groups in all the models for a period of
21 days and experiments were performed one hour after
the administration of last dose. All the experiments were
carried in a sound and light attenuated room. All the
groups were received Scopolamine 0.3 mg/kg, only on the
day of experiment, 30 minutes after the administration of
last dose, to induce amnesia.
Morris water maze spatial navigation: Spatial learning
and memory were assessed in the Morris water maze
using established procedures and equipment. Order of
training was: visible platform trials, hidden platform trials
and a final probe trial with the platform removed. Testing
was conducted in a circular pool (120 cm diameter) filled
45 cm deep with tap water rendered opaque with the
addition of non-toxic white paint or milk powder. Visible
and hidden platform training consisted of four trials per
session, with the rat starting facing the pool edge, in a new
quadrant on each trial. During visible training, the
platform was moved to a new quadrant location on each
trial. During hidden platform training, the platform
remained in the same quadrant for all trials across all
sessions. Trials lasted 60 seconds. If a rat did not
successfully locate the platform by the completion of the
trial, it was guided to the platform by the experimenter.
Rat remained on the platform for 15 seconds before being
placed under a warming light for the 30–45 sec intertrial
interval.
Effects of Nelumbo nucifera Gaertner Seed
Extract oral administration on spatial acquisition and
memory were investigated in the Morris water-maze. Rats
were administrated orally with NnG Seed Extract at
different doses 50,100,200mg/kg p.o. and 2% Tween 80,
piracetam for 19 consecutive days, one hour before
training. On day 14 the rats were placed in the water to
swim freely for 2 min to familiarize the environment.
From day 15 to day 19 the rats were given four training
trials per day and the learning/acquisition ability was
measured by the amount of time to locate the hidden
platform. On day 19 a spatial-probe trial was performed
with the platform removed and the rats placed randomly in
the water. CPT (crossing platform times) was measured by
counting the number of times the rats crossed the quadrant
containing the platform within 2 minutes. The CPP
(crossing platform percentage) was calculated as the ratio
of CPT to the total times the mice crossed all quadrants.
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 638
10 days later (day 29), the same experiments were
repeated with and without the platform.
Assessment of nootropic activity: The nootropic activity
was assessed using the active avoidance paradigm. The
apparatus consisted of a soundproof experimental chamber
with a grid floor which could be electrified and with a
provision for a buzzer tone. The enclosure had a clear
Perspex front sliding door, through which the animal
could be introduced into the chamber. A wooden pole,
screwed onto the inner surface of the lid of the chamber
acted as the shock free zone. In the assessment of
nootropic activity, the stimulus provided was a foot shock
of 6 mA given for a period of 10s from the electrified grid
floor. Rats were initially trained to escape the foot shock
by climbing on to the pole, i.e., the shock free zone. This
initial trial was carried out by having three trial sessions
interspersed with an interval of 10s. During each of the
initial trials, the rats were allowed to explore the apparatus
for 10s. This was followed by the foot shock for 10s. Only
those rats which were sensitive to the foot shock and could
climb the pole were included in the study. The animals
were divided into six groups, each group containing six
animals. Ethanolic extracts of NnG (50; 100 and 200
mg/kg p.o.) were administered for a period of 7 days
following which the training trial (TT) was conducted.
This consisted of 10 trial sessions interspersed with an
interval of 30s. During each trial, the rats were allowed to
explore the apparatus for 10s, followed by a buzzer tone
of 50 Hz (conditioned stimulus) for 10s. This was
followed by the foot shock for 10s.
The animal learned to associate the buzzer tone
with the impeding foot shock and was capable of avoiding
the foot shock on hearing the buzzer warning. Jumping
onto the wooden pole before the shock period was
constituted an avoidance response (AR) by the animal.
The percent AR for the 10 trials was computed. Twenty-
four hours later, a relearning trial (RT) composed of 10
trials was carried out and the number of ARs in the 10 trial
sessions was noted. Piracetam 100 mg/kg p.o was used as
the standard reference drug for comparison.
Acute Administration of Nelumbo nucifera Gaertner
extract
Rats were give a dose of 2% tween 80, 10ml/kg to the
control group, 50mg/kg, 100mg/kg, 200mg/kg doses were
give to test groups at morning 9:00 a.m . Rat Body
Temperature wsa measured by rectal thermometers.
Statistical analysis: Statistical Analysis: Statistical
analysis was carried out using Instat3 software.All results
were expressed as Mean ± S.E. Data analysis was done
using ANOVA followed by Student-Newman-Keul’s test
for multiple comparisons. A p≤0.05 level of probability
was used as criterion for significance.
RESULTS AND DISCUSSION
In our study, ethanolic extract of Nelumbo
nucifera significantly enhanced duration of the
phenobarbitone sodium -induced hypnotic effect, which
was observed as soon as 15 min after their administration
suggesting a depressant activity on the CNS with an early
beginning. A prolongation of the phenobarbitone effect
could involve a facilitation of some inhibitory systems like
the GABA-ergic. Further investigation would be
necessary to support this supposition.
The ethanolic extracts increased the time spent
in open-sided arms of the zero-maze by the mice in a
range of doses of 50 to 200 mg/kg, producing an anti-
anxiety response similar to that observed at 2 mg/kg of
diazepam. In the extracts, the anti-anxiety response was
partially reverted when doses were increased to 100 and
200mg/kg, respectively, suggesting the presence of
sedative effects. The findings of the present study clearly
indicate that the ethanolic extracts at a dose of 200 mg/kg
significantly improve the acquisition and retention of
memory of the learned task was seen in the increase in the
percent avoidance response, thus demonstrating nootropic
activity. In our studies, the extracts demonstrated
facilitatory effect on learning and memory only after
treatment for a period of 21 days. This probably may be
attributed to the involvement of neurotransmitters since
the building of memory is augmented only when the levels
of neurotransmitters are attenuated on repeated
administration of the extracts. There is ample evidence
that the central cholinergic system has a vital role in these
processes. Nootropics have also been demonstrated to
interfere with serotonergic transmission and also have an
inhibitory effect on noradrenaline function However, con
troversial reports exist with respect to the involvement of
dopamine in learning and memory processes.
An important point is to be noted that, recently the
plus maze model is also being used to study learning and
memory processes in rodents. The impairment of learning
and memory induced by scopolamine, an anticholinergic
agent, was reflected by prolonged transfer latency from
the open arm to the closed arm.There are studies that
indicate that ‘‘stress’’ is one of the factors leading to
cognitive deficits, anxiety and peptic ulcers Prolonged
stress immobilization,extreme heat, cold and other
stressors are associated with neuron cell degeneration in
the hippocampal and other areas of the brain. Earlier
studiesconducted by various workers have revealed that
several medicinal plants possess nootropic activity, but
only a few plants like W.somnifera possess both antistress
as well as nootropic activity. Similarly, our studies
demonstrate that the plant nelumbo nucifera possesses a
combination of activities. As discussed earlier, these
properties are complementary to each other and hence the
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 639
plant could be a valuable contribution to the existing
armamentarium of nootropic agent having antistress
activity.
A = 2% Tween 80(control)
B = DZP 2mg/kg
C = NnG 50mg/kg
D = NnG 100mg/kg
E = 200mg/kg
Figure.1. Phenobarbitone induced sleeping time
Table.1.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Motor coordination
Treatment Dose (mean + S.E) Number of falling at
30 min 60min 120 min
2% tween 80 10ml/kg 0.00 0.00 0.00
NnG 50mg/kg 0.00 0.00 0.00
NnG 100mg/kg 0.00 0.00 0.00
NnG 200mg/kg 0.00 0.00 0.00
DZP 2mg/kg 1.16 ± 0.16 2.33 ± 0.21 1.25 ± 0.22
Results are expressed as mean ± SEM, (n=6) (ANOVA) and dunnett’s test
Figure.2.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Locomotor Activity
Table.2.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Locomotor Activity
Treatment Dose Counts/ 10 min (Mean ± S.E)
Basal activity After dose administration
2% tween 80 10ml/kg 398.23 + 2.05 391.5 + 9.09
NnG 50mg/kg 412.78 + 10.9 352.66 + 12.87
NnG 100mg/kg 369.26 + 25.1 299.5 + 14.59**
NnG 200mg/kg 386.5 + 4.89 201.66 + 14.58 **
DZP 2mg/kg 370.3 + 0.28* 193.83 + 5.71
**
Results are expressed as mean ± SEM, (n=6) (ANOVA) and Dunnet’s t-test, F= 55.35 df= 25, 4
The P value is < 0.01**
vs Control, P < 0.05* vs Control
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 640
Figure.3.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Light-Dark model transition
chamber
Table.3.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Light-Dark model transition chamber
Treatment Dose Time spent in
Lighted box (S)
No. crossings Time spent in
Dark box (S)
No. crossings
2% Tween 80 10ml/kg 80.0 + 8.4 17.8 ± 1.5
218.0 + 2.4 17.8 ± 1.5
NnG 50mg/kg 83.8 + 6.8 16.8 ± 2.1 215.8 + 4.8 16.8 ± 2.1
NnG 100mg/kg 199.0 + 14.59 **
14.2 ± 1.0 99.0 + 7.59 * 14.2 ± 1.0
NnG 200mg/kg 201.66 + 14.58 **
10.8 ± 1.5**
97.66 + 8.58 * 10.8 ± 1.5
*
DZP 2mg/kg 162.3 + 15.7 * 17.8 ± 1.7
132.3 + 10.7
** 17.8 ± 1.7
n=6; *p< 0.05,
**p <0.01 vs Tween 80 ( one way ANOVA followed by Dunnett’s test)
Figure.4.Effect of 70% ethanolic extract of Nelumbo nucifera Gaertner seeds on Elevated-Zero Maze
Table.4.Effect of 70% ethanolic extract of Nelumbo nucifera Gaertner seeds on Elevated-Zero Maze
Treatment Dose Time spent in
Open arms
No. entries Time spent in
closed arms
No. crossings
2% Tween 80 10ml/kg 50.0 + 6.4 9.3 ± 1.26
245.5 + 8.8 15.8 ± 1.0
NnG 50mg/kg 56.50 + 9.3 8.3± 1.4 243.8 + 8.5 12.5 ± 1.3
NnG 100mg/kg 112.8 + 8.9 10.2 ± 1.3
186.0 + 9.59 * 12.5 ± 1.3
NnG 200mg/kg 204.60 + 7.1* 18.2 ± 1.7
* 95.2 + 8.58
* 11.5 ± 1.0
*
DZP 2mg/kg 162.3 + 15.7 **
22.5 ± 1.9**
162.3 + 15.7 **
17.8 ± 1.7
n=6; *p< 0.05,
**p <0.01 vs Tween 80 (one way ANOVA followed by Dunnett’s test)
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 641
Figure.5.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Acute administration (Regulation
of Body Temperature)
Figure.6. Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Morris water maze
Table.5.Effect of extracts of NnG and piracetam on nootropic activity in rats Group Dose(mg/kg.bw) Day15 Day16 Day17 Day18 Day19 Day29
2% Tween80 10mL/kg 76.7±30.0 56.8±20.2 33.9±27.7 31.8±20.3 34.9±16.8 34.8±10.9
NnG 50mg/kg 63.4±33.4 43.2±25.0 34.5±21.6 24.6±12.8 28.1±14.1 17.4±12.4**
NnG 100mg/kg 55.5±31.1 32.6±19.1 33.9±11.8 25.1±12.7 16.6±16.7 16.9±10.3**
NnG 200mg/kg 52.5±30.2 37.6±21.1 33.6±12.9 22.5±13.2 14.6±15.7 14.6±10.1***
Piracetam 100mg/kg 53.5±29.5 39.5±22.3 32.6±10.7 23.6±14.7 15.5±16.4 15.8±11.3**
Values are expressed as mean ± SEM of 6 animals (n=6) **p<0.001 and ***p<0.0001 v/s 2%Tween80, n=6
SUMMARY AND CONCLUSION
The phytochemical study revealed that the
presence of Alkaloids, Carbohydrates, Glycosides,
Phenolic Compounds, Tannins, Proteins, Saponins, Fixed
Oils and Fats, Flavanoids, Triterpenes. The ethanolic
extract of Nelumbo nucifera gaertner possess depression
in general behavioral tests, and potentiation of
phenobarbitone induced sleeping time, and also shows
anxiolytic action, in dose dependent manner. The
ethanolic extract of Nelumbo nucifera gaertnershows
nootropic activity on Conditional avoidance response,
Morri’s water maze for spatial learning, but it weakly acts
on acetylcholineesterase enzyme inhibitory activity.
Further studies is needed for the isolation of an active
compound, and its exact mechanism of action of ethanolic
extract of nelumbo nucifera.
REFERENCES
Ashok D.B. Vaidya, The Status and Scope of Indian
Medicinal Plants Acting On Central Nervous System,
Indian journal of pharmacology, 29, 1997, 340-343.
Bhattacharya SK, Bhattacharya A, Chakrabarti A,
Adaptogenic activity of Siotone, a polyherbal formulation
of Ayurvedic rasayanas, Indian J Exp Biol, 38, 2000, 19–
28.
Bhattacharya SK, Kumar A, Ghosal S. Effects of
glycowithanolides from Withania somnifera on an animal
model of Alzheimer’s disease and perturbate cholinergic
Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 642
markers of cognition in rats, Phytother Res, 9, 1995,110–
113.
D.C. Rogers B. Costall A.M. Domeney P.A. Gerrard M.
Greener M.E. Kelly, J.J. Hagan A.J. Hunter, Anxiolytic
profile of ropinirole in the rat, mouse and common
marmoset, Psychopharmacology, 2000, 151, 91–97.
Dr Anil Kumar, Protective Effect of St, Johns Wort
(Hypericum Perforatum) Extract On 72-Hour Sleep
Deprivation-Induced Anxiety-Like Behavior and
Oxidative Damaze In Mice, Planta Medica, 73, 2007,
1358-1364.
Jayabalan Nirmal, Chidambaram Saravana Babu,
Thanukrishnan Harisudhan and Muthiah Ramanathan,
Evaluation of behavioural and antioxidant activity of
Cytisus scoparius Link in rats exposed to chronic
unpredictable mild stress, BMC Complementary and
Alternative Medicine, 8, 2008, 8:15
Jennifer R Cracchiolo, Takashi Mori, Stanley J.Nazian,
Jun Tan, Huntington potter, and Gary W.Arendash,
Enhanced Cognitive Activity-Over And Above Social Or
Physical Activity-Is Required To Protect Alzheimers Mice
Against Cognitive Impairment, Reduce A β Desposition,
And Increase Synaptic Immunoreactivity, Neurobiol
Learn Mean, 88(3), 2007, 277-294.
Trease G. E. and Evans W. C, A textbook of
Pharmacognosy, Barliere Tindall and Co: London, XIV
edition, 330-437.
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 643
A REVIEW ON USE OF GENETICALLY ENGINEERED MICROORGANISMS FOR
BIOREMEDIATION OF ENVIRONMENTAL POLLUTANTS AND HEAVY METALS Mariz Sintaha
*
School of Life Sciences, Independent University, Bangladesh (IUB)
*Corresponding author: [email protected]
ABSTRACT Bioremediation refers to the use of organisms to remove environmental pollutants. Besides identifying
different new plasmids capable of degrading environmental pollutants, many attempts have been taken by the
genetic engineers to enhance the bioremediation potential of different microorganisms. Escherichia coli was
engineered to convert chlorinated solvents such as trichloro ethylene and the highly toxic methyl parathion
(pesticide), to non-toxic form. Escherichia coli was also engineered to remove radioactive waste (uranium) from
environment through precipitation. Pseudomonas fluorescens, Escherichia coli and C. testosterone were
engineered to degrade different Polychlorinated Biphenyls. Deinococcus geothermalis, Escherichia coli and
Ralstonia eutropha were engineered for bioaccumulation of heavy metals to remove it from environment.
Sinorhizobium meliloti and Escherichia coli were engineered for decolorization of azodye. Poly Aromatic
Hydrocarbons and 2,4-dichlorophenoxyacetate (pesticide) degrading plasmids have been identified and
transferred to indigenous bacteria of polluted soil through bioaugmentation which rendered them capable of
degrading respective pollutant effectively.
KEY WORDS: Bioremediation, heavy metals, pollutant, genetic engineering, micro organisms
INTRODUCTION
Due to the various limitations of traditional
process of cleaning environmental pollutants,
bioremediation obtained gradual attention over last
two decade. Extensive research in this field identified
many bacterial strains capable of degrading various
environmental pollutants. Many catabolic pathways
for degrading pollutants have also been identified and
explained. However, the degradative capabilities of
these strains and pathways are often limited by
various factors such as low expression of degradative
enzymes, low growth of the bacterial strains in the
contaminated environment and inability of these
strains to degrade various pollutants by same strain.
Various genetic engineering attempts have been
taken to overcome these limitations. Plasmids
containing biodegradative capabilities have been
isolated from parent strains and transformed into
bacterial strains which can survive well in the
polluted environment. Recombinant bacteria
containing several degradative plasmids have also
been produced capable of degrading various
pollutants simultaneously. The expressions of
enzymes involved in catabolic pathway have been
increased by various processes including creation of
recombinant plasmid. Many bacterial strains have
been engineered to express heavy metal transporter or
heavy metal sequestering protein for removal of
heavy metals from environment. Thus, significant
improvement is done in the field of bioremediation
using genetically engineered microorganisms.
BIOREMEDIATION OF VARIOUS POLLUTANTS
1. Biodegradation of Petroleum: In 1970s Chakrabarty
and colleagues created a bacterial strain capable of
degrading different hydrocarbon of petroleum.
Pseudomonas putida was transformed with four plasmids
CAM, OCT, XYL and NAH capable of degrading
camphor, octane, xylene and naphthalene respectively.
The resulting strain has been called superbug for its
increased metabolic capacity. Suparbug can be used to
remove oil spill from sea which poses serious health risks
to the marine creatures. Most of the engineered
microorganisms transformed to confer degradative
capability were mesophils, the organism that grow at 20-
400 centigrade temperature. However the oceans generally
have temperature below 20o centigrade where only
psychrotrophic microorganisms can grow. Tolune
degrading TOL plasmid from Pseudomonas putida PaW1
was transferred into a psychrotrophic bacteria
Pseudomonas putida Q5, which was capable of degrading
salicylate. The resultant strain was capable of degrading
both toluene and salicylate at temperature as low as 00
centigrade (Kolenc RJ, 1988).
2. Biodegradation of Chlorinated Hydrocarbon (Tri
Chloro Ethylene): Chloro ethylenes such as Tri Chloro
Ethylene (TCE) are persistent environmental pollutants
which is carcinogenic in nature. Toluene dioxygenase
(TolDox) in Pseudomonas putida found to have catalytic
activity against TCE. Pseudomonas pseudoalcaligenes
KF707 contains a multi-component enzyme Biphenyl
dioxygenase (BphDox) which is composed of alpha and
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 644
beta subunits, a ferredoxin and a ferredoxin reductase. A
recombinant Escherichia coli was produced containing
BphDox, where alpha subunit of BphDox of Pseudomonas
pseudoalcaligenes KF707 had been replaced with alpha
subunit of toluene dioxygenase from Pseudomonas putid.
It showed higher catalytic activity toward TCE (Maeda T,
2001). In another study Recombinant Escherichia Coli
was created by using Pseudomonas mendocina as donor.
It was capable of reducing the concentration of TCE as
much as 100 folds by converting it to chloride ion, CO2
and water soluble molecule.
3. Biodegradation of PCB: Polychlorinated biphenyls
(PCBs) are widely used in different industries. Since
PCB’s are heat resistant, chemically stable, less soluble in
water and highly soluble in lipid, it easily persists in
environment. PCBs are found in high concentration in soil
around industrial area and used to be removed
traditionally by incineration process. Several soil bacteria
(such as Burkholderia sp. strain LB400) have been found
to have enzymes encoded from bph operon which convert
PCB to chlorobenzoate and 2-hydroxypenta-2, 4-dienoate.
Since Burkholderia sp. strain LB400 cannot survive well
in natural environment, a derivative of Pseudomonas
fluorescens F113 has been transformed with bph operon
Table 1-List of Environmental Pollutants (Vidali, 2001) and Respective Genetically Engineered Microorganism for Bioremediation Class of
contaminants
Specific examples Sources Microorganism Reference
Hydrocarbon of
Petroleum
Naphthalene,
Xylene,
Octane,
Toluene,
Salicylic acid.
Fuel company Pseudomonas putida (Chakrabarty, 1970)
(Kolenc RJ, 1988)
Chlorinated
Solvents
Trichloroethylene,
Perchloroethylene.
Drycleaners,
Chemical manufacture.
Escherichia coli (Maeda T, 2001)
(Robert B. Winter,
1989)
Polychlorinated
Biphenyls (PCB)
4-Chlorobiphenyl,
4,4-Dichlorobiphenyl.
Electrical manufacturing,
Power station,
Railway yards.
Pseudomonas fluorescens,
Escherichia coli,
C. testosterone.
(Erickson BD, 1993)
(Hrywna Y, 1999)
Pesticides Atrazine ,
Carbaryl,
Carbofuran, Coumphos,
Diazinon,
Glycophosphate,
Propham,
2,4-D,Parathion.
Agriculture,
Timber treatment plants,
Pesticide manufacture,
Recreational areas,
Landfills.
Indigenous bacteria of soil (Inoue D, 2012)
(Li L, 2008)
Radioactive
Waste
Uranium
Nuclear reactor Escherichia coli (Nilgiriwala KS,
2008)
Dye Azodye Garment Effluent Sinorhizobium meliloti,
Escherichia coli.
(Schlüter A, 2007)
Poly Aromatic
Hydrocarbons
(PAHs)
Naphthalene, Antracene,
Fluorene,
Pyrene, Benzo(a)pyrene.
Oil production &
storage,
Gas work sites,
Coke plants,
Engine works,
Landfills,
Tar production & storage
oiler ash dump sites,
Power stations.
Indigenous bacteria of soil (Juhasz A. , 1998)
Heavy Metal Iron,
Chromium,
Arsenic,
Cadmium,
Mercury.
Industrial Waste Deinococcus geothermalis,
Escherichia coli,
Ralstonia eutropha.
(Hassan Brim1, 2003)
(Jan Kostal, 2004)
(Kim SK, 2005)
(Wilson, 1997)
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 645
under its own promoter. This bacteria use PCB as sole
carbon source and showed greater survival since it resides
in rhizosphere. To increase the expression of bph operon,
bph operon was cloned under Nod promoters since these
promoters have high expression inside Pseudomonas
fluorescens F113. In a separate study, fusion of Nod
promoter created using nodbox 4 alone and the
nodD1 from Sinorhizobium meliloti resulted in three times
higher expression (M. Whelan, 2005). In another study,
shuffled bph A1 gene was produced by recombination
using Pseudomonas pseudoalcaligenes KF707 and
Burkholderia cepacia LB400. The shuffled bphA1 gene
and other genes of bph operon (bphA2A3A4BC) taken
from Pseudomonas pseudoalcaligene KF707 were used to
transform Escherichia coli JM109. The recombinant E.
coli JM109 showed higher degradation of different
biphenyl compounds due to the presence of chimeric
Biphenyl Dioxygenases (Kumamaru T, 1998). The
substrate specificity of PCB was increased when site
directed mutagenesis was used to convert bphA of LB400
to the corresponding sequence of KF707 (Erickson BD,
1993). Other than E. coli, C. testosteroni was also
transformed by using two plasmids pE43 (containing
ortho dechlorination ohb gene) and pPC3 (containing para
dechlorination fcb gene) to produce C. testosterone VP44
capable of degrading both ortho- and para- chlorinated
biphenyl (Hrywna Y, 1999).
4. Biodegradation of Pesticide (2,4 Dichloro
phenoxyacetate and Methyl Parathion): 2,4-
dichlorophenoxyacetate(2,4-D) is the most widely used
herbicide of this world and identified as "possibly
carcinogenic to humans" by the International Agency for
Research on Cancer (IARC) (Lyon, 1987). Pseudomonas
putida or Escherichia coli contain 2,4-D degradative
plasmid pJP4 which was introduced into soil bacteria by
bioaugmentation. Gene bioaugmentation is the process of
receiving a degradative plasmid by indigenous bacteria in
environment from a newly introduced bacteria via
dissemination. Bioaugmentation conferred the indigenous
bacteria the 2.4-D degradation capability without any
irretrievable depressive effects (Inoue D, 2012).
Methyl parathion (MP) is a widely used pesticide
which is found to be highly toxic. Parathion disrupts
the nervous system by inhibiting acetylcholinesterase (S.
Kegley). It is already restricted or banned into many
countries. Even treatment of methyl parathion containing
water may cause release of it in the environment.
Escherichia coli BL21 was genetically modified for high
express methyl parathion hydrolase, which causes
hydrolysis of methyl parathion and release of p-
nitrophenol (PNP). A laboratory-scale bioreactor
containing genetically modified Escherichia coli BL21
and PNP degrading Ochrobactrum sp. strain LL-1 caused
98% removal of MP and 100% removal of PNP (Li L,
2008).
5. Bioremediation of Radioactive Waste: Radioactive
Uranium is highly toxic to heart, renal system,
reproductive system, central nervous system, immune
system and DNA (Craft, Abu-Qare, Flaherty, Garofolo, &
Rincavage, 2004). phoK gene from Sphingomonas sp.
strain BSAR-1 was cloned and over expressed in
Escherichia coli strain BL21(DE3) which showed 13
times higher secretion of alkaline phosphatase in the
extracellular medium than BSAR-1 and quickly
precipitated more than 90% percent added uranium
(Nilgiriwala KS, 2008).
6. Biodegradation of Triphenylmethane Dye: Plasmid
pGNB1 confers resistance to the triphenylmethane dyes
via its tmr gene observed by the decolorization of the dyes
such as crystal violet, malachite green and basic fuchsin to
a non-toxic form. This plasmid was found to be
transferable to Sinorhizobium meliloti and Escherichia
coli. Since pGNB1 was originally found in activated
sludge compartment of a wastewater treatment plant,
bacteria transformed with it, can easily be used to treat
sewage polluted with triphenylmethane dyes (Schlüter A,
2007).
7. Biodegradation of Poly Aromatic Hydrocarbons
(PAHs): Over decades many PAH degrading bacterial
strains have been isolated. But these microorganisms are
not naturally present in the soil which is highly
contaminated with PAHs. Bioaugmentation is the
technique that can be used to overcome this limitation.
PAH degrading capability can be transferred from the
strains found to be capable of degrading PAHs to the soil
bacteria which are newly contaminated with PAHs and
does not have an adapted microbial population through
bioaugmentation (A.L Juhasz, 1996). Five strains of
Burkholderia cepacia have been found to be capable of
using PAHs as sole carbon source (Juhasz A. B., 1997).
The biodegradation capability of these strains was
successfully transferred to indigenous soil bacteria by
bioaugmentation after a lag period (Juhasz A. , 1998).
Though PAH degrading pathways are exist in many
bacterial strains, inability of PAHs to pass bacterial cell
wall limits the degradation of PAHs by these strains.
BIOREMEDIATION OF HEAVY METAL
Deinococcus radiodurans is the best characterized
strain of Deinococcaceae bacterial family. So it had been
transformed with plasmids pMD727 which rendered it
capable of degrading various heavy metals. Deinococcus
geothermalis was isolated from hot spring and was found
to be resistant to ionizing radiation and capable of
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 646
growing at high temperatures around 55°C
(Ferreira, 1997). Where D. radiodurans degrades
waste at temperatures less than 39°C and cannot
grow in nutritionally restricted environment, D.
geothermalis grow in high-temperature and
nutritionally restricted environment without
exogenous amino acids. So D. geothermalis was
transformed with plasmids pMD727 designed for D.
radiodurans yielding strain MD865 which showed
efficient conversion of heavy metals from toxic to
non-toxic form. Following 14 h of incubation with
Hg(II) in a microplate at 32°C strain MD865
showed substantial Hg(0) volatilization. It Reduced
Fe(III)- nitrilotriacetic acid in the presence of
lactate or pyruvate at 45°C, reduced Cr(VI) in
under both aerobic and anaerobic conditions at
40°C and reduced U(VI) only in the presence of the
AQDS at 40°C. Thus D. geothermalis transformed
with pMD727 was metabolically proficient,
extremely radiation-resistant, capable of growing at
high temperature and efficient for bioremediation of
heavy metal & radionuclides (Hassan Brim1, 2003).
Thermus thermophilus HB8 contains arsentie
oxidase capable of oxidizing arsenic from toxic to
non toxic form. The small and large subunits of
arsentie oxidase is encoded by TTHB128 and
TTHB127 genes respectively. These genes were
cloned into broad-host-range vector pBBR1MCS-5
and it was used to transform various
microorganisms rendering them capable of
oxidizing 87.6% arsenite (Yang C, 2010). The
metallo regulatory protein ArsR has high affinity to
arsenite. When it was over expressed in Escherichia
coli, increased bioaccumulation of arsenite occurred
but the cell growth was reduced. When an elastin-
like polypeptide (ELP153) was fused with ArsR, it
showed improved cell growth without altering its
arsenite bioaccumulation ability. Thermus thermophilus HB8 contains arsentie oxidase capable of oxidizing arsenic from toxic to non toxic form. The small and large subunits of arsentie oxidase is encoded by TTHB128 and TTHB127 genes respectively. These genes were cloned into broad- In total the genetically modified cell accumulated 5-
and 60-fold-higher levels of arsenate and arsenite
than control cells (Jan Kostal, 2004).
A heavy metal tolerant species Ralstonia
eutropha was modified so that it expresses mouse
metallothionein on the cell surface. When this was
introduced in the soil contaminated with Cd2+, it
significantly decreased the toxicity symptom of
Cd2+ in model plant (F.Valls M, 2000). An
Escherichia coli transformed with a manganese
transport gene (mntA) and a metal-sequestering
protein (metallothionein or MT) gene showed six
time higher accumulation of Cd2+ ion in an
aqueous phase than control (Kim SK, 2005).
An Hg2+ transport system and metallothionein
was intrudced into Escherichia coli for the
bioaccumulation of Hg2+. When glutathione S-
transferase fusion protein of Saccharomyces
cerevisiae or pea metallothionein was
overexpressed in the same cell, it significantly
increased the bioaccumulation of Hg2+ and also
protected the cell from its harmful effect (Wilson,
1997).
CONCLUSION
During the past 20 years, recombinant DNA
techniques have been studied intensively to improve
the degradation of hazardous wastes under
laboratory conditions. However, relatively few
examples of GEM applications in environmental
ecosystems exist. Unfortunately, the only manner to
fully address the competence of GEMs in
bioremediation efforts is long-term field release
studies. It is therefore essential to performed field
studies to acquire the requisite information for
determining the overall effectiveness and risks
associated with GEM introduction into natural
ecosystems.
REFERENCES
http://mynature-myfuture.blogspot.com/. (2009, August
07). Retrieved from Superbug: solution to the oil
pollution : http://mynature myfuture. blogspot. com
/2009/08/superbug-solution-to-oil-pollution.html
A.L Juhasz, M. B. (1996). Degradation of high
molecular weight polycyclic aromatic hydrocarbons by
Pseudomonas cepacia. Biotechnology Letters, 18, 577–
582.
Bernard R. Glick, J. J. (n.d.). Molecular Biotechnology:
Principles and Applications of Recombinant DNA. ASM
Press.
Copley SD, R. J. (2011, December 20). The whole
genome sequence of Sphingobium chlorophenolicumL-
1: insights into the evolution of the pentachlorophenol
degradation pathway. Genome Biol Evol.
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 647
Craft, E. S., Abu-Qare, A. W., Flaherty, M. M.,
Garofolo, M. C., & Rincavage, H. L.-D. (2004).
Depleted and natural uranium: chemistry and
toxicological effects. Journal of Toxicology and
Environmental Health.
Erickson BD, M. F. (1993, November). Enhanced
biodegradation of polychlorinated biphenyls after site-
directed mutagenesis of a biphenyl dioxygenase gene.
Appl Environ Microbiol., 59(11), 3858–3862.
F.Valls M, A. S. (2000). Engineering a mouse
metallothionein on the cell surface of Ralstonia eutropha
CH34 for immobilization of heavy metals in soil. Nat
Biotechno., 18, 661-665.
Ferreira, A. C. (1997). Deinococcus geothermalis sp.
nov. and Deinococcus murrayi sp. nov.,two extremely
radiation-resistant and slightly thermophilic species from
hot springs. Int. J. Syst. Bacteriol., 47, 939-947.
Fu-min menn, J. P. (n.d.). Genetically Engineered
Microorganisms and Bioremediation. Knoxville, TN
37996-1605.
Hassan Brim1, A. V. (2003, August). Engineering
Deinococcus geothermalis for Bioremediation of High-
Temperature Radioactive Waste Environments. Appl.
Environ. Microbiol., 69(8), 4575-4582.
Hrywna Y, T. T. (1999). Construction and
characterization of two recombinant bacteria that grow
on ortho- and para-substituted chlorobiphenyls. Appl.
Environ. Microbiol., 65, 2163–2169.
Inoue D, Y. Y. (2012, April). Impacts of gene
bioaugmentation with pJP4-harboring bacteria of 2,4-D-
contaminated soil slurry on the indigenous microbial
community. Biodegradation., 23(2), 263-76.
Jan Kostal, 1. R. (2004, August). Enhanced Arsenic
Accumulation in Engineered Bacterial Cells Expressing
ArsR. Appl Environ Microbio, 70(8), 4582–4587.
Juhasz, A. (1998). Microbial degradation of high
molecular weight polycyclic aromatic hydrocarbons.
Ph.D. Thesis. Victoria University of Technology,
Melbourne, Australia.
Juhasz, A. B. (1997). Degradation of fluoranthene,
pyrene, benz[a]anthracene and dibenz[a,h]anthracene by
Burkholderia cepacia. Journal of Applied Microbiology,
83(2), 189-198.
Kim SK, L. B. (2005, February). Selective cadmium
accumulation using recombinant Escherichia coli. 99(2),
109-14.
Kolenc RJ, I. W. (1988, March). Transfer and expression
of mesophilic plasmid-mediated degradative capacity in
a psychrotrophic bacterium. Appl Environ Microbiol.,
54(3), 638-41.
Kumamaru T, S. H. (1998, July). Enhanced degradation
of polychlorinated biphenyls by directed evolution of
biphenyl dioxygenase. Nat Biotechnol., 16(7), 663-6.
Li L, Y. C. (2008, March 15). Removal of methyl
parathion from artificial off-gas using a bioreactor
containing a constructed microbial consortium. Environ
Sci Technol., 42(6), 2136-41.
Lyon. (1987). IARC monographs on the evaluation of
carcinogenic risks to humans. Monograph, IARC,
France.
M. Whelan, C. M. (2005, May). Polychlorinated
Biphenyl Rhizoremediation by Pseudomonas fluorescens
F113 Derivatives, Using a Sinorhizobium meliloti nod
System To Drive bph Gene Expression. Appl Environ
Microbiol, 71(5), 26.
Maeda T, T. Y. (2001, August 10). Functional analyses
of Bph-Tod hybrid dioxygenase, which exhibits high
degradation activity toward trichloroethylene. J Biol
Chem., 276(32), 29833-8.
Nilgiriwala KS, A. A. (2008). Cloning and
overexpression of alkaline phosphatase PhoK from
Sphingomonas sp. strain BSAR-1 for bioprecipitation of
uranium from alkaline solutions. Appl Environ
Microbiol., 74(17), 5516-23.
Rattan K, S. R. (1999, October1). Stress Survival of a
Genetically Engineered Pseudomonas in Soil Slurries:
Cytochrome P-450cam-Catalyzed Dehalogenation of
Chlorinated Hydrocarbons. Biotechnol Prog., 15(5),
958-962.
Robert B. Winter, K.-M. Y. (1989). Efficient
Degradation of Trichloroethylene by a Recombinant
Escherichia Coli. Nature Biotechnology, 282 - 285.
S. Kegley, B. H. (n.d.). Parathion - Identification,
toxicity, use, water pollution potential, ecological
toxicity and regulatory information. Retrieved from
Pesticide Action Network North America (PANNA):
http://www.pesticideinfo.org/Detail_Chemical.jsp?Rec_I
d=PC35122
Schlüter A, K. I. (2007, October). IncP-1-beta plasmid
pGNB1 isolated from a bacterial community from a
wastewater treatment plant mediates decolorization of
triphenylmethane dyes. Appl Environ Microbiol, 73(20),
6345-50.
Vidali, M. (2001). Bioremediation. An overview. Pure
Appl. Chem., Vol., 73(7), 1163–1172.
Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 648
Wilson, S. C. (1997). Construction and characterization
of Escherichia coli genetically engineered for
bioremediation of Hg(2+)-contaminated environments.
Appl Environ Microbiol. .
Yang C, X. L. (2010). Construction of a genetically
engineered microorganism with high tolerance to
arsenite and strong arsenite oxidative ability. J Environ
Sci Health A Tox Hazard Subst Environ Eng., 45(6),
732-7.
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 649
HEPATOPROTECTIVE EFFECT OF HYDROALCOHOLIC EXTRACT OF Ocimum
gratissimum LEAVES ON RIFAMPICIN-ISONIAZID INDUCED RATS Sreenu Thalla*,Venkata Ramana K, Delhiraj N
A.S.N Pharmacy College, Tenali, Guntur (dt), Andhra Pradesh, India
*Corresponding author: [email protected]
ABSTRACT
Ocimum gratissimum leaves used for treatment of jaundice in Ayurvedic medicine. Adult male wistar rats
were rendered hepatotoxicity by Rifampicin-Isoniazid(50mg/kg each) by intraperitonially for 14days while leaf
extract (100mg/kg and 200mg/kg) was administered orally for 14 days. Administration of leaf extract (100mg/kg
and 200mg/kg) resulted in a significant (p<0.01) increased in plasma and hepatic lipid profiles. The extract
suppresses cytochrome P-450 activity. Decreased levels of transaminases indicate stabilization of plasma
membrane and protection of hepatocytes against damage caused by hepatotoxin. The levels of SOD, catalase,
GSH significantly decreased along with concentration of malondialdehyde in these groups indicating increased
lipid peroxidation. Histomorphological findings also supported the biochemical findings. The present study
demonstrates that administration of leaf extract (100mg/kg and 200mg/kg) has significant hepatoprotective
activity as evidenced by the biochemical, functional and histopathological parameters.
KEY WORDS: Hepatotoxicity, Ocimum gratissimum Aspartate transaminase (AST), Alanine transaminase
(ALT), Glutathione (GSH)
1. INTRODUCTION
The world Health Organization (WHO) estimates
that 4 billion people, 80% of the world population,
presently use herbal medicine for some aspect of primary
health care. Herbal medicine is a major component in all
indigenous people’s traditional medicine and a common
element in ayurvedic, homeopathic, naturopathic,
traditional oriental and Native American Indian medicine.
WHO notes that 119 plant-derived pharmaceutical
medicines, about 74% are used in modern medicine in
ways that correlated directly with their traditional uses as
plant medicines by native cultures. Major pharmaceutical
companies are currently conducting extensive research on
plant materials gathered from the rain forests and other
places for their potential medicinal value (Sreenu Thalla,
2011). Over thousands of years; traditional Chinese
medicine has developed a theoretical and practical
approach to the treatment and prevention of diseases. The
first documented source of Chinese medical theory, the
Huangdi Nei Jing (“Inner Classic of the Yellow
Emperor”) was written between 300 and 100 BC. It
describes the diagnosis and treatment of a huge range of
disorders and gives advice about healthy lifestyles,
exercise, and diet, which conforms remarkably well to
current recommendations for the prevention of chronic
diseases.
The liver is a key organ regulating homeostasis
within the body. It has wide range of functions, including
detoxification, protein synthesis and production of
biochemicals necessary for digestion. This organ plays a
major role in metabolism and has a number of functions in
the body including glycogen storage, decomposition of red
blood cells, plasma protein synthesis, hormone production
and detoxification. It lies below the diaphragm in the
thoracic region of the abdomen. It produces bile, an
alkaline compound which plays in the digestion via
emulsification of lipids. It is also performs and regulates a
wide variety of high-volume biochemical reactions
requiring highly specialized tissues including the synthesis
and breakdown of small and complex molecules many of
which are necessary for normal vital functions. Substances
derived from the plants remain the basis for a large
proportion of the commercial medications used today for
the treatment of heart disease, high blood pressure, pain,
asthma and other problems. In spite of phenomenal
growth of allopathic system of medicine the synthetic drug
to prevent or cure the hepatic damage due to various
hepatotoxins is not available. Treatment of hepatotoxicity
with plants or plant preparations and medicaments has
been mentioned in the ancient indigenous systems of
medicine of many countries. Even today, rural folks and
aboriginal tribes all over the world, including India, are
using many plants in the treatment of liver damage.
Up-regulation of hepatic metabolism of hormones
decreases their levels, and Rifampicin can also in similar
fashion reduce the efficacy of hormonal contraception to
the extent the unintended pregnancies have been reported
among users of oral contraceptives taking Rifampicin in
even short courses (for example, as prophylaxis against
exposure to bacterial meningitis). Ocimum gratissimum is
containing alkaloids, flavonoids, volatile oils, steroids.
Traditionally the plant Ocimum gratissimum is claimed to
treat cytoprotective (Sreenu Thalla, 2012). So we can use
Ocimum gratissimum as hepatoprotective drug which is
caused by Rifampicin- Isoniazid induced liver toxicity
(Abbas L, 2005). Keeping in view all the literature survey
the present study was planned to evaluate the activity
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 650
hepatoprotective. An attempt is also made to evaluate its
effect on liver metabolic functions.
2. MATERIALS AND METHODS
2.1. Animals: Male Wistar rats weighing (150-200g) were
obtained and they were maintained in animal house as per
IAEC guidelines. Animals were access to standard pellet
diet and water given ad libitum. The study was approved
by Institutional animal ethical committee, IAEC/131/2012.
2.2. Plant material: The leaves of Ocimum gratissimum
used in the present study was collected from the natural
habitat in and around Chennai, Tamilnadu and the plant
material was authentified by Dr.P.Jayaraman Ph.D., Plant
Anatomy Research Centre(PARC),Tambaram. Voucher
number is PARC/2012/803.
2.3. Plant extraction: The fresh leaves of Ocimum
gratissimum were collected. It was defatted using
petroleum ether. The marc obtained was dried and
subjected to extraction by adding dried leaf powder of
distilled water (1:10), heated to 50-600C under constant
stirring conditions for 1hour and filtered. The methanol
extract was prepared by using Soxhlet’s appataratus
(Sreenu Thalla, 2011).
2.4. Phytochemical screening: The alcoholic extracts
obtained were subjected to preliminary phytochemical
screening (Kokate CK,) to identify the chemical
constituents. The methods of analysis employed were
those described by Harbon et al., 1973.
2.5. Induction of hepatotoxicity: Hepatotoxicity was
induced by administering the Rifampicin-Isoniazid
(50mg/kg each, i.p) for 14 days in Albino Wistar rats
(Sreenu Thalla, 2011)
2.6. Experimental design: In experiment, totally 24 rats
used. The rats were divided into 4groups of six animals
each
Group I: Control (saline) 5ml/kg, p.o
Group II: Inducing agent (Rifampicin-Isoniazid),
each 50mg/kg, i.p
Group- III Inducing agent 50mg/kg, i.pand
hydroalcoholic leaf extract,100mg/kg,p.o
Group IV: Inducing agent 50mg/kg, i.p and
hydroalcoholic leaf extract, 200mg/kg,p.o
Animals were fasted overnight, the hydroalcoholic
extract of Ocimum gratissimum (100mg/kg, 200mg/kg)
was given orally for 14 days to the third and fourth group
of animals with liver damage induced by Rifampicin-
Isoniazid (50mg/kg) was administered intraperitoneally for
all 14days. At 15th
day 1ml Blood was collected from all
animals by Retro-orbital bleeding for the evaluation of
serum parameters like Aspartate transaminase (AST),
Alanine transaminase (ALT), Alkaline phosphatase
(ALP), Total serum proteins, Bilrubin.Then animals were
sacrificed and liver tissues was used for histopathological
study (Sreenu Thalla, 2012).
2.7. Preparation of rat liver homogenate: Tissue
homogenate was prepared in a ratio of 1 g of wet tissue to
10 times (w/v) 0.05M-ice cold phosphate buffer (pH 7.4)
and homogenized by using a Teflon homogenizer. 0.2 ml
of sample homogenate was used for estimation of Thio-
Barbituric Acid Reactive Substance (TBARS). The
remaining part of the homogenate was centrifuged at
15,000 g at 4°C for 60 minutes and the supernatant was
used for superoxide dismutase, catalase and HMG-CoA
estimation
2.8. Histopathological study of liver: Liver was collected
after the rats were sacrificed in 10% formalin solution and
utilized for the histopathological studies. Liver was
separated from all the groups and blotted free of blood and
tissue fluids. They were fixed in bovine’s fluid (picric
acid:Formalin:Acetic acid in the ratio of 75:52:5). After
24 hours the tissues were washed thoroughly in 70%
alcohol and then dehydrated in ascending grades of
alcohol (70,100%). Dehydration in absolute alcohol was
followed by treatment of tissue with toluene:xyline
(50:50) successively by 10%, 50%, 70%, 90% paraffin
wax in toluene and finally to 100 % paraffin wax, at 60-
62º C followed by embedding of tissue in wax.5-15 micro-
meter thick sections were serially cut in leitz microtome in
horizontal plane and mounted on glass slides with the help
of egg albumin in glycerin solution (50% v/v). The
sections were de-paraffinated in xylene and downgraded
through 100, 90, 50 and 30% alcohol and then finally in
water. They were then stained with105 hematoxylin for 3-
5 minutes and staining was intensified by running water.
The hematoxylin stained section was stained with 10%
eosin for two minutes and were then quickly passed
through ascending grades of alcohol and finally treated
with xylene followed by mounting in DPX. The sections
were observed and desired area was photographed in an
Olympus microscope. The sections were observed under
40X magnifications.
2.9. Statistical analysis: All the data were expressed as
mean ± SEM. Statistical significance was tested using one
way ANOVA followed by the Dunnet’s t test using
computer based fitting program (Prism, Graph pad.).
Statistical significance was determined at P < 0.05.
3. RESULTS AND DISCUSSION
Literature survey indicates that there is no
scientific evidence to support hepatoprotective activity,
therefore the present study is undertaken to investigate the
actions of hydroalcoholic extract of Ocimum gratissimum
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 651
leaves in Rifampicin-Isoniazid induced rats ascertain used
to scientific basis.
3.1. Phytochemical screening: Preliminary
phytochemical screening of the plant extract of Ocimum
gratissimum reveals the presence of alkaloids,
carbohydrates, phytosterols, glycosides, saponins, tannins
and phenollic compounds.
3.2. Histopathology of liver: The use of rats as
experimental animals for hepatoprotective activity is
mainly because of the structural homology of rat CYP 450
enzymes with that of humans (Burke, 1994) and moreover
female rats are less susceptible to chemical induced liver
damage, especially hydroxyl-proline accumulation. So, we
had used male rats in our study. Rifampicin acts directly
on messenger RNA synthesis. Isoniazid inhibits the
mycolic acid synthesis. Necrosis or membrane damage
releases the enzymes into circulation and hence it can be
measured in the serum. The reversal of increased serum
enzymes in Rifampicin-Isoniazid induced liver damage by
the extract may be due to the prevention of the leakage of
intracellular enzymes by its membrane stabilizing activity
(Serum biochemical parameters).
Amino transferases contribute a group of enzymes
that catalyse the inter-conversion of amino acids and α-
keto acids by the transfer of amino groups. These are liver
specific enzymes and are considered to be very sensitive
and reliable indices for necessary hepatotoxic as well as
hepatoprotective or curative effect of various compounds.
Both AST and ALT levels increase due to toxic
compounds that affect the integrity of liver cells.
Decreased levels of transaminases indicate stabilisation of
plasma membrane and protection of hepatocytes against
damage caused by hepatotoxin. Both the test groups could
significantly lower the elevated amino transferase levels
when compared to Rifampicin-Isoniazid group. This is in
agreement with the commonly accepted view that serum
levels of transaminases return to normal with the healing
of hepatic parenchyma and the regeneration of
hepatocytes. Moreover, the Test extract (200mg/kg,p.o)
showed a remarkable decrease in the enzyme levels than
the Test extract (100 mg/kg,p.o) indicating the greater
hepatoprotective activity (Sreenu Thalla, 2011).
Alkaline phosphatase is a membrane bound
glycoprotein enzyme with a high concentration in
sinusoids and endothelium. This enzyme reaches the liver
mainly from the bone. It is excreted into the bile; therefore
its elevation in serum occurs in hepatobiliary diseases.
Serum alkaline phosphatase is related to the functioning of
hepatocytes and increase in its activity is due to the
increased synthesis in presence of biliary pressure. The
results of the present study indicate that both Test groups
probably stabilize the hepatic plasma membrane from
Rifampicin-Isoniazid induced damage. Reduction of
alkaline phosphatase levels with concurrent depletion of
raised bilirubin levels suggests the stability of biliary
function during injury with Rifampicin-Isoniazid.There
was a remarkable reduction in the bilirubin levels of both
Test groups implying its potential as hepatoprotective
agent (Sreenu Thalla, 2012).
The liver was also known to play a significant role
in the serum protein synthesis, being the source of plasma
albumin, fibrinogen and also the other important
components like α and β-globulin. The liver is also
concerned with the synthesis of γ- globulin. The serum
albumin level is low in hepatic diseases. The metabolic
biotransformation of amino acids in liver by synthesis,
transamination, etc., may be impaired due to the escape of
both non-proteins and protein nitrogenous substances from
injured cells as mediated by raise in the serum enzyme
levels of ALP, AST and ALT. The reduction in the total
protein (TP) is attributed to the initial damage produced
and localised in the endoplasmic reticulum which results
in the loss of CYP 450 leading to its functional failure
with a decrease in protein synthesis and accumulation of
triglycerides leading to fatty liver. The Test groups
considerably enhanced the synthesis of TP which may be
by accelerating the regeneration process and protecting the
liver cells. The increased levels of total protein in serum
are indicative of the hepatoprotective activity.
Inhibition of bile acid synthesis from cholesterol
which is synthesized in liver or derived from plasma lipids
leading to an increase in cholesterol levels also results
during Rifampicin-Isoniazid intoxication. Significant
suppression of cholesterol levels by both the Test groups
suggests that bile acid synthesis inhibition was reversed.
Decrease in enzyme activity of superoxide dismutase
(SOD) is a sensitive index of hepatocellular damage and is
the most sensitive enzymatic index in liver injury. Curtis
and Mortiz (Curtiz, 1972) reported SOD as one of the
most important enzymes in the enzymatic antioxidant
defense system. It scavenges the superoxide anion to form
hydrogen peroxide and thus diminishes the toxic effect
caused by this radical. The Test groups showed a
markable increase in the SOD levels when compared to
the Rifampicin-Isoniazid treated group. (Tissue and
funcitional parameters present in Table.2)
Catalase (CAT) is an enzymatic antioxidant
widely distributed in all animal tissues and its highest
activity is found in the red blood cells and liver. CAT
decomposes hydrogen peroxide and protects the tissues
from highly reactive hydroxyl radicals. Therefore,
reduction in the activity of CAT may result in a number of
deleterious effects due to the assimilation of superoxide
radical and hydrogen peroxide. The Test groups showed a
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 652
drastic increase in the catalase levels when compared to
the Rifampicin-Isoniazid treated group. This clearly
implies the antioxidant ability of Ocimum gratissimum.
Glutathione (GSH) is one of the most abundant tripeptide,
non-enzymatic biological antioxidant present in the liver.
It removes free radical species such as hydrogen peroxide,
superoxide radicals and maintains membrane protein
thiols. Also it is a substrate for glutathione peroxidase
(GPx). Decreased levels of GSH are associated with an
enhanced lipid peroxidation in Rifampicin-Isoniazid
treated rats. Test group was found to produce a rise in the
collapsed GSH levels when compared to Rifampicin-
Isoniazid group.This demonstrates an increase in the liver
tissue GSH levels.
The activated radicals bind covalently to the
macro molecules and induce peroxidative degradation of
membrane lipids of endoplasmic reticulum rich in
polyunsaturated fatty acids. This leads to the formation of
lipid peroxides, which in turn give products like
malondialdehyde (MDA) that cause damage to the
membrane. MDA levels have seen a dramatic reduction in
Test groups. This may be attributed due to the anti lipid
peroxidative potential of Test groups which could
considerably decrease MDA levels. This might be due to
the presence of alkaloids in our plant which are
responsible for antioxidant activity. The extent of hepatic
damage is assessed by histological evaluation along with
the levels of various biochemical parameters in
circulation. The animals in the Rifampicin-Isoniazid group
showed severe hepatotoxicity evidenced by profound
steatosis, centrilobular necrosis, ballooning degeneration,
nodal formation and fibrosis as compared to the normal
hepatic architecture of the control group animals. Test
groups showed the healing of damaged parenchyma .The
efficacy of any hepatoprotective drug is dependent on its
capacity of either reducing the harmful effect or restoring
the normal hepatic physiology that has been disturbed by a
hepatotoxin. Both the Test groups decreased Rifampicin-
Isoniazid induced elevated enzyme levels, indicating the
protection of structural integrity of hepatocytic cell
membrane or the regeneration of damaged liver cells.Both
the test groups showed hepatoprotective activity. The Test
group containing the plant extract showed an
improvement in the liver activity. It clearly indicates that
the plant “Ocimum gratissimum” has the hepatoprotective
potential which is independent. Thus, the drastic
improvement in liver functions may be due
phytoconstituents present in Ocimum gratissimum. The
activity of extract is due to the chemical constituents
present in it like the flavonoids, triterpenoids, saponins
and alkaloids are known to possess hepatoprotective
activity. Along with these, the antioxidants and
prooxidants in our plant i.e. Ocimum gratissimum might
be responsible for its antioxidant and thus
hepatoprotective activity (Sreenu Thalla, 2011).
In summary, this study suggests that the oral
administration of Ocimum gratissimum alone significantly
ameliorates Rifampicin-Isoniazid induced hepatotoxicity
in rats. The extract may be protecting the liver by free
radical scavenging activity and thus preventing
peroxidation of lipids of the endoplasmic reticulum. And
this may be due to the presence of flavonoids and
alkaloidal pigments in our extract. However, the
possibility that Ocimum gratissimum might suppress the
cytochrome P-450 mediated metabolic activation of
Rifampicin-Isoniazid cannot be ruled out.
Figure.1.Histopathology of liver
A B C D
A= Control B=Rifampicin+Isoniazid (50mg/kg each)
C= Rifampicin+Isoniazid (50mg/kg each) +leaf extract
(100mg/kg, p.o)
D= Rifampicin+Isoniazid (50mg/kg each) +leaf extract
(200mg/kg, p.o)
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 653
Table 1.Effect of Ocimumgratissimum on serum biochemical parameters
All values are shown as mean ± SEM and n=6.
# indicate p< 0.05,##indicate p<0.01, ### indicate p<0.001 when compared to control group.
* indicate p<0.05, ** indicate p<0.01, *** indicate p<0.001 when compared to Rifampicin-Isoniazidgroup.
AST: AsparatateAminotransaminase, ALT: Alanine Aminotransaminase, ALP: Alkaline phosphatase, TB: Total bilirubin.
Table 2.Effect of Ocimumgratissimum on tissue and functional parameters
Group
SOD(U/mg
protein)
CAT(µM
H2O2consumed/mg
protein)
Reduced GSH(µg of
GSH/mg protein)
MDA (nM of
MDA/mg protein)
Control (saline) 8±0.80 10.68±0.54 9.854±1.002 0.448±0.07
Rifampicin-Isoniazid treated 4.394±0.51##
6.136±0.45##
5.35±0.64##
1.288±0.14***
Rifampicin + Isoniazid + Test
extract (100 mg/kg PO) treated
9.808±0.83***
10.99±0.50
10.52±0.64 0.4384±0.05
Rifampicin + Isoniazid + Test
extract (200 mg/kg PO) treated
7.658±0.73 10.73±0.87* 9.516±0.41
** 0.718±0.059
**
All values are shown as mean ± SEM and n=6.
# indicate p< 0.05, ##indicate p<0.01, ### indicate p<0.001 when compared to control group.
* indicate p<0.05, ** indicate p<0.01, *** indicate p<0.001 when compared to Rimpicin-Isoniazid group.
SOD: Superoxide dismutase, CAT: Catalase, GSH: Glutathione, MDA: Malondialdehyde
5. CONCLUSION
In our study we have made an attempt to study the
hepatoprotective activity of a locally available plant which
is in use by the local tribal people but lacks its mention in
scientific literature. Our work aims to study the
therapeutic effect of the hydroalc0holic extract of the plant
Ocimum gratissimum by examining the prevention of
Rifampicin-Isoniazid induced hepatotoxicity in rats.From
all these findings we can conclude that the plant Ocimum
gratissimum has significant hepatoprotective activity as
evidenced by the biochemical, functional and histological
parameters.The present findings provide scientific
evidence to the ethno medicinal use of this plant genetic
resource by the tribal people in treating hepatotoxicity.The
potential usefulness of the extract in clinical conditions
associated with liver damage is still to be demonstrated.
Further studies are needed to be carried out with regard to
the isolation of active principles responsible for
hepatoprotective activity and also for the intoxication with
other models such as iron, alcohol etc to prove its efficacy.
REFERENCES
Abbas.L, abul k, Robbins and cotran pathologic basis of
disease, St. Louis, mo: elsevier saunders, 2005, 878.
Anasuya.N, K.Raju, S.Manian, Hepatoprotective and
toxicological assessment of an ethnomedicinal plant
Euphorbia fusiformisBuch-Ham.ex.D.Don, Journal of
Ethnopharmacology, 127, 2010, 463-467.
Ayurvedicpharmacopiea of India by Govt. Of India, The
ministry of health and welfare society of ayush, 5,146.
Curtis and Mortiz, SOD one of the most important
enzymes in the enzymatic antioxidant defence system,
Ind.J.Pharmacol, 2010, 246-248.
Evan I. Saad, Sahar M.EI-Gowilly, MarbrokO.Sherhaa,
Azza E.Bistawroos, Role of oxidative stress and nitric
oxide in the protective effects of α-lipolic acid and
aminoguanidine against Isoniazid-rifampicin induced
hepatotoxicity in rats” Food and chemical Toxiocol, 48,
2010, 1869-1875.
Harbone JB, Phytochemical methods a guide to modern
techniques of plant analysis, Chapman and Hall, London,
1, 1973, 279.
Henry, R. J., Cannon, D. C. and Winkleman, J. W.,
Clinical Chemistry, Principles and Technics, 2nd Ed.,
Harper and Row, New York, 1974, 884-889.
Indian Medicinal plants by Kritikar Coll. No.AVS 1528,
Volume-I, Page No:346
Jaeschke H, Gores GJ, Cederbaum AI, Hinson JA,
Pessayre D, Lemasters JJ, Mechanisms of hepatotoxicity,
Toxicol. Sci, 65 (2), 2002, 166–76.
Group AST (IU/L) ALT (IU/L) ALP (KA units) TB (mg/dl)
Control (saline) 14.48±0.53 15.71±0.63 17.03±1.03 0.4083±0.01641
Rifampicin-Isoniazid treated 41.62±0.90##
32.52±0.65###
32.12±0.62###
0.9433±0.03904###
Rifampicin + Isoniazid +Test extract
(100 mg/kg P.O)
32.28±0.62***
23.1±0.77***
29.12±0.76*
0.785±0.02291***
Rifampicin + Isoniazid +Test extract
(200 mg/kg P.O)
19.28±0.76***
13.7±1.5***
24.68±1.02***
0.567±0.01352***
Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 654
Kokate CK. Practical Pharmacognosy, 3rd
Ed, Vallabh
Prakashan, New Delhi, 1994, 07.
Marklund S, The involvement of the Superxoide anion
radical in the auto-oxidation of pyrogallol and a
convenient assay for SOD, Eur.J.Biochem, 1974, 121-
126.
SreenuThalla, JyothibasuTammu, Subba Reddy Thalla,
Nootropic activity of Ocimum gratissimum in
streptozotocin induced Amnesia, AJRC, 5(12), 2012,
1437-1439.
SreenuThalla, K.Venkata Ramana, JyothibasuTammu,
Subba Reddy Thalla, Cytoprotective effect of Ocimum
gratissimum in the Attenuation of Myocardial Infarction
Induced by Musa acuminate, AJPTR, 2(6), 2012, 724-730.
SreenuThalla. BhavaniPentela, Hepatoprotective effect of
hydroalcoholic extract of Calycopteris floribunda leaves
on Rifampicin-Isoniazid induced rats, IJCPS, 2 (3), 2011,
15-21.
Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 655
ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF AMITRIPTYLINE
HYDROCHLORIDE AND CHLORDIAZEPOXIDE IN TABLET BY RP-HPLC Neeli Sujatha* K Haritha Pavani
Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Jupudi, Vijayawada, Andhra
Pradesh, India
*Corresponding author: Email: [email protected], Phone: 8142540237
ABSTRACT
A simple, economic, selective, precise, and accurate Reverse Phase High Performance Liquid Chromatography
method for analysis of Amitriptyline Hcl & Chlordiazepoxide in tablet dosage form was developed and validated
according to ICH guidelines. The quantification of the drug was carried out by using YMC Colimited C8 (250 X
4.6 mm,5μ) column its equivalent in isocratic mode and maintain column at 400C, using mobile phase comprising
of Ortho phosphoric Acid : Methanol in the ratio of 50:50 v/v (Adjust pH -2 with Orthophosphoric Acid ), with a
flow rate of 1.0mL/min and the detection wavelength was carried at 253 nm. The retention time for
Amitriptyline Hcl & Chlordiazepoxide was found to be 2.502&5.176. The percent assay was found to be
101%&99%. Proposed method was validated for precision, accuracy, linearity & range, specificity and robustness
according to ICH guidelines. The method was successfully applied to Amitriptyline Hydrochloride and
Chlordiazepoxide combination Tablet dosage form.
KEY WORDS: Amitriptyline Hydrochlorde, Chlordiazepoxide, RP-HPLC, YMC-Colimited Column, Validation.
INTRODUCTION
Amitriptyline Hydrochloride is a 3-(10,11-Dihydro-5H-
dibenzo[a,d] cyclo hepten-5- ylidene)-N,N- dimethyl-1-
propanamine hydrochloride.TricyclicAntidepressent drug. They contain a tricyclic ring system with an alkyl amine
substituent on the central ring. In non-depressed
individuals, amitriptyline does not affect mood or arousal,
but may cause sedation.It is Decrease reuptake of nor
epinephrine and serotonin. Amitriptyline appears to exert
effect on both norepinephrine and serotonin (5-HT),
although the selective acting desipramine is a more potent
inhibitor of norepinephrine transport. The drug structure
shows in figure no-1.
Chlordiazepoxide is a (7-chloro 2(methylamino)-
5-phenyl-3-H-1,4 benzodiazepine 4-oxide).Tricyclic
Antidepressent drug.It is bides to stereospecific
benzodiazepine binding sites on GABA receptor
complexes at several sites within the central nervous
system including the limbic system and reticular
formation.This result in an increased binding of the
inhibitory neurotransmitter GABA receptor BZDs
therefore enhance GABA-mediated chloride influx
through GABA receptor channel causing membrane
hyperpolarization.The drug structure shows in figure no-2.
Literature review reveals that several methods are
reported for these drugs alone or in combination with
other drugs. For combination of these drugs Spectroscopic
method, HPTLC method is reported, there is no single
work done for this combination by using RP-HPLC.
Hence an attempt has been made for the development of
RP-HPLC method for the combination of drugs.
The present study illustrate development and
validation of simple, economical, selective, accurate,
precise RP-HPLC method for the determination of
Amitriptyline Hcl and Chlordiazepoxide in tablets dosage
forms as per ICH guidelines.
MATERIALS AND METHODS
List of equipment: Quantitative HPLC was performed on
a high performance liquid chromato graph -Waters
e2695Alliance HPLC system connected with PDA
Detector 2998 and Empower2 Software. The drug analysis
data were acquired and processed using Empower2
software running under Windows XP on a Pentium PC
and YMC Colimited C8 (250 X 4.6 mm,5μ)Column. In
addition an analytical balance (DENVER 0.1mg
sensitivity), digital pH meter (Eutech pH 510), a sonicator
(Unichrome associates UCA 701) were used in this study.
List of chemicals: Pharmaceutical grade Amitriptyline
Hcl & Chlordiazepoxide were kindly supplied as a gift
sample by Dr.Reddy’s Laboratory, Hyderabad, and
Andhra Pradesh, India. Methanol was of HPLC grade and
Purchased from E. Merck, Darmstadt, Germany. Ortho
Phosphoric Acid was analytical reagent grade supplied by
Fischer Scientific Chemicals. Water HPLC grade was
obtained from a Milli-QRO water purification system.
Amitriptyline Hcl & Chlordiazepoxide Tablets available
in the market as 'Amixide' (Sun pharmaceutical Ind ltd
,Gujarat, India.) in composition of Amitriptyline Hcl
(50mg), Chlordiazepoxide(20mg).
Preparation of mobile phase: The mobile phase was
prepared by mixing Ortho phosphoric acid Buffer and
Methanol in the ratio 50:50 v/v. Then it was sonicated for
15min and filtered through 0.45µ membrane filter.
Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 656
Preparation of standard solution: Accurately 50mg of
Amitriptyline Hcl and 20mg of Chlordiazepoxide was
weighed and transferred into 50mL volumetric flask and
diluted with 30mL diluent and sonicated for 15minutes.
Then the volume was makeup to 50mL with diluent and
filtered through 0.45µ nylon filter. Further 10mL of above
solution was diluted to 50 mL and mixed to get a
concentration of 100 µg/mL. From this stock solution
further dilutions were made by taking the two drugs for
the validation of the method developed.
Preparation of sample solutions: 20 tablets were
powdered and weigh and transfer tablet powder equivalent
to 50 mg(291.6mg) of Amitriptyline Hcl &20mg of
chlordiazepoxide into 100 mL volumetric flask, diluted to
60 mL diluent and sonicated for 15 mins and makeup to
final volume with diluent and filtered through 0.45µ
membrane filter. Further dilute 5 mL of this solution to 25
mL diluent and mixed to get a concentration of 100
µg/mL. From this stock solution further dilutions were
made for the validation of the method developed.
System suitability: The purpose of system suitability is to
ensure that the complete testing (including
instrument,method,analyst ) is suitable for the intended
application. All system suitability parameters shows in the
table no:2
Calibration curves for Amitriptyline Hcl &
Chlordiazepoxide: Replicate analysis of solution
containing 25-75µg/mL of Amitriptyline Hcl &10-
30µg/mL of Chlordiazepoxide sample solutions
respectively were injected into HPLC according to the
procedure in a sequence and chromatograms were
recorded. Calibration curves were constructed by plotting
by taking concentrations on X-axis and ratio of peak areas
of standards on Y-axis. Calibration graphs shows in the
figure no:7, 8.
Optimized method: The quantification of the drug was
carried out by using YMC Colimited C8 (250 X 4.6 mm,5
μ) column its equivalent in isocratic mode and maintain
column at 400C, using mobile phase comprising of Ortho
phosphoric Acid : Methanol in the ratio of 50:50v/v
(Adjust pH 2 with Orthophosphoric Acid ), flow rate of
1.0mL/min and the detection wavelength was carried at
253 nm. Mobile phase was used as diluent during the
standard and test samples preparation. The optimized
chromatographic conditions are mentioned in Table-1 and
chromatogram for standard was shown in the figure no: 3.
Validation parameters:
Specificity: Specificity is the ability of analytical method
to measure accurately and specifically the analyte in the
presence of components that may be expected to be
present in the sample. The specificity of method was
determined by spiking possible impurities at specific level
to standard drug solution (100ppm). The diluent and
placebo solutions were also injected to observe any
interference with the drug peak.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given range.
Linearity in the concentration range of 25-75µg/mL for
Amitriptyline Hcl, 10-30µg/mL for Chlordiazepoxide.
From the linearity studies calibration curve was plotted
and concentrations were subjected to least square
regression analysis to calculate regression equation. The
regression coefficient was found to be 0.999 and shows
good linearity for both the drugs.
Precision: Precision is the degree of closeness of
agreement among individual test results when the method
is applied to multiple sampling of a homogeneous sample.
Study was carried out by injecting six replicates of the
same sample preparations at a concentration of 100ppm.
Accuracy: Accuracy is the closeness of results obtained
by a method to the true value. It is the measure of
exactness of the method. Accuracy of the method was
evaluated by standard addition method. Recovery of the
method was determined by spiking an amount of the pure
drug (50%,100% ,150%) at three different concentration
levels in its solution has been added to the pre analyzed
working standard solution of the drug.
Lod&Loq: Limit of detection and limit of quantification
were calculated using following formula LOD=3.3(SD)/S
and LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of the
calibration curve.
Robustness: The robustness is evaluated by the analysis
of Amitriptyline Hcl & Chlordiazepoxide under different
experimental conditions such as making small changes in
flow rate (±0.2 mL/min), λmax (±5), column temperature
(±5), mobile phase composition (±5%), and pH of the
buffer solution.
RESULTS & DISCUSSION
Specificity: As no other extra peaks were found at
retention time of 2.50 min & 5.17 min the proposed
method was a specific for the detection of Amitriptyline
Hcl & Chlordiazepoxide. The results are tabulated in the
table no-3 and the chromatogram was shown in the figure
no- 3,4,5,6.
Linearity: From the Linearity data it was observed that
the method was showing linearity in the concentration
range of 25-75µg/mL for Amitriptyline Hcl 10-30µg/mL
for Chlordiazepoxide. Correlation coefficient was found to
be 0.999 for both the compounds. The results are tabulated
Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 657
in the table no-5 & Linearity graphs shows in the figure
no-7,8.
Accuracy: The percentage recovery of Amitriptyline Hcl
& Chlordiazepoxide was found 101% and 99%
respectively. The percentage RSD of the samples was
found less than 2. The results are tabulated in the table no-
4.
Precision: The percentage relative standard deviation
value for precision of six replicate samples of
Amitriptyline Hcl & Chlordiazepoxide was found to be
0.43&0.22, which was well within the acceptance criteria
limit.
Lod&Loq: The limit of detection was obtained as
0.154mg/mL for Amitriptyline Hcl and 0.130mg/mL for
Chlordiazepoxide. The limit of quantitation was obtained
as 0.466mg/mL for Amitriptyline Hcl and 0.395mg/mL
for Chlordiazepoxide.
Robustness: All the system suitability parameters are
within limits for variation in flow rate (±0.2 mL). Hence
the allowable flow rate should be within 0.8 mL to 1.2
mL. All the system suitability parameters are within limits
for variation (±50C) in temperature. Hence the allowable
variation in Temperature should be within 350C to
450C.The results shows Table no.7.
All validation parameters shows in the table no.6
All the results obtained were satisfactory and good
agreement as per the ICH guidelines.
Fig:1 Structure of Amitriptyline Hcl Fig:2 Structure of Chlordiazepoxide
Fig:3 Chromatogram for Standard Fig:4 Chromatogram for Sample
Fig:5 Chromatogram for Blank Fig:6 Chromatogram for Placebo
Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 658
Fig:7 Linearity plot for Amitriptyline Hcl
Fig:8 Linearity plot for Chlordiazepoxide
Table.1. Optimised Conditions for Amitriptyline Hcl & Chlordiazepoxide
Parameter Chromatographic Condition
Column YMC-Co-limited column, C8 (150×4.6)mm, 5µ
Mobile phase OPA Buffer : Methanol(50:50) v/v
Flow rate 1.0 mL/ min
Wavelength 253 nm
Injection volume 5 l
Column temperature 400C
Run time 10 min
Table.2. System Suitability Parameters
Parameter Amitriptyline Hcl Chlordiazepoxide Acceptance criteria
Theoretical plates 8604 7548 >2000
Tailing factor 1.263 1.810 <2
Asymmetric factor 0.4 0.38 0.9-1.2
Retention time 2.502 5.176 ±10% of Actual Rt
%RSD 0.43 0.22 <2
Table.3. Specificity data for Amitriptyline Hcl & Chlordiazepoxide
Sample name Amitriptyline Hcl Area Rt Chlordiazepoxide Area Rt
Standard 1077129 2.508 2293861 5.239
Sample 1064380 2.486 2274042 5.094
Blank -- -- -- --
Placebo -- -- -- --
Table.4. Accuracy data for Amitriptyline Hcl & Chlordiazepoxide Amitriptyline HCI
Spiked Level Sample
Weight(mg) Sample Area µg/mL added µg/mL found % Recovery % Mean
50% 145.80 535849 49.500 49.83 101
101 100% 291.60 1068848 99.000 99.40 100
150% 437.40 1600269 148.500 148.82 100
Chlordiazepoxide
50% 145.80 1137087 20.000 19.84 99
99 100% 291.60 2279745 40.000 39.77 99
150% 437.40 3401849 60.000 59.34 99
533515
800575
1060145
1331620
1600675
y = 10661.46x+840
r² = 0.99
0
200000
400000
600000
800000
1000000
1200000
1400000
1600000
1800000
0 50 100 150 200
1139722
1701723
2279771
2829389
3403237
y = 22618.78x+8890
r² = 0.99
0
500000
1000000
1500000
2000000
2500000
3000000
3500000
4000000
0 50 100 150 200
Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 659
Table.5. Linearity data for Amitriptyline Hcl & Chlordiazepoxide sample Linearity level
(µg/mL)
Peak area Slope Y-intercept r²
Amitriptyline
Hcl
25 533515
10661.4
840
0.999 37.5 800575
50 1060145
62.5 1331620
75 1600675
Chlordiazepoxide 10 1139722
22618.78
8890
0.999 15 1701723
20 2279771
25 2829389
30 3403237
Table.6. Summary of validation parameters Parameter Amitriptyline Hcl Chlordiazepoxide
Specificity(Rt) 2.50min 5.17min
Range,Linearity(r2) 25-75µg/mL,0.999 10-30µg/mL,0.999
Precision(% RSD) 0.43 0.22
Accuracy 101% 99%
LOD & LOQ 0.154,0.466 0.130,0.395
Table.7. Robustness data for Amitriptyline Hcl & Chlordiazepoxide
sample Parameters Optimized Used Rt Peak area Plate count
Amitriptyline
Hcl
Flow rate
(±0.2)
1mL/min
0.8 2.487 1063950 7324
1 2.500 1065899 8291
1.2 2.492 1072653 7432
Temperature
(±5°C)
40°C
35 2.482 1084297 7423
40 2.501 1062198 8684
45 2.481 1076311 7245
Chlordiazepoxide Flow rate
(±0.2)
1mL/min 0.8 5.146 2240382 7942
1 5.173 2256757 7613
1.2 5.156 2306841 7413
Temperature
(±5°C)
40°C 35 5.040 2330109 7701
40 5.158 2262283 7674
45 5.044 2127480 7563
CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of ICH
guidelines for method validation. The proposed method
was simple, accurate, specific, precise, robust, rugged and
economical. Hence the method was a good approach for
obtaining reliable results and found to be suitable for the
routine analysis of Amitriptyline Hcl & Chlordiazepoxide
in Tablets dosage forms.
ACKNOWLEDGEMENT
The authors would like to thank beloved parents
and all my well wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
Barbai C, Hotopf M, The British Journal of Psychiatry,
The Journal of Mental Science, 178(2), 129-144.
Bhatt, Mitesh, Shah, Sanjay, Shiv Prakash, Method
development and validation of amitriptyline and its
metabolites in human plasma by ultra performance liquid
chromatography; Tandam mass spectrometry and its
application to a bioequivalence study, Bio med
chromotogr, 24(11), 2010, 1247-54.
Dhara patel, Vivek patel, Simultaneous estimation of
amitriptyline hcl and perphenazine by absorption ratio (Q-
Analysis) UV spectrophotometric method in combined
tablet dosage form, International journal of
pharmaceutical sciences and research, 1(12), 2010, 133-
137.
Sejal patel, N.T Patel, Spectrophotometric and
chromatographic simultaneous estimation of amitriptyline
and chlordiazepoxide in tablet dosage form, Indian Journal
of Pharmaceutical Sciences, 7 (4), 2009, 472-476.
Shoba Rani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 660
EVALUATION OF HEPATOPROTECTIVE ACTIVITY OF SAPINDUS EMARGINATUS VAHL.PERICARP
EXTRACT AGAINST ANTI TUBERCULAR DRUGS INDUCED LIVER DAMAGE IN RATS
Shoba Rani J *, Janarthan M, Firasat Ali,
Department of Pharmacology, Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email: [email protected], Phone:7382222566
ABSTRACT
The objectiveof the present study is to evaluate the hepato protective activity of Sapindus emarginatus Vahl.
pericarp against anti tubercular drugs induced liver damage in rats. Hepatotoxicity was induced by Rifampicin
and Isoniazid administration (100±50 mg/kg p.o) at every 72 hrs for 21days. Sapindus emarginatus extract at
different doses (200 and 400 mg/kg) 1hr prior to Rifampicin and Isoniazid administration. The degree of
protection was determined by measuring levels of biochemical markers like SGOT,SGPT,ALP and Bilirubin and
anti oxidant enzymes CAT, SOD, non enzymatic anti oxidant GSH and level of lipid peroxidation .The
histopathology studies also carried out. Treatment of rats with different doses of plant extract (200 and 400
mg/kg) significantly (P<0.001) altered serum marker enzymes and antioxidant levels to near normal against
rifampicin and isoniazid treated rats. The activity of the extract at dose of 200 mg/kg was comparable to the
standard drug, silymarin (50 mg/kg, p.o.). The present study suggests that the methanolic extract of Sapindus
emarginatus posses significant hepatoprotective and anti oxidant activities
Keywords: Sapindus emarginatus; Rifampicin; Isoniazid; Biochemical parameters; Antioxidants; Lipid
peroxidation
1. INTRODUCTION
Herbal drugs have gained importance and
popularity in recent years because of their safety, efficacy
and cost effectiveness. They have recently attracted much
attention as alternative medicines useful for treating or
preventing life style related disorders and relatively very
little knowledge is available about their mode of action.
There has been a growing interest in the analysis of plant
products which has stimulated intense research on their
potential health benefits (Pushpangadan, 2007). Liver, the
key organ of metabolism and excretion has an immense
task of detoxification of xenobiotics, environmental
pollutants and chemotherapeutic agents. Hence, this organ
is subjected to variety of diseases and disorders. Several
hundred plants have been examined for use in a wide
variety of liver disorders. Antioxidants play an important
role in inhibiting and scavenging free radicals and thus
providing protection against infections and degenerative
diseases (Subramaniam, 2000).
Sapindus emarginatus Vahl family Sapindaceae is
a medium-sized deciduous tree found in south
India.Traditionally, Sapindus emarginatus is used as anti-
inflammatory and antiprurutic. It is used to purify the
blood. The seed is in intoxicant and the fruit rind has
oxytropic action. Its powder is used as nasal insufflations.
S.emarginatus also showed strong anti bacterial activity
against the tested bacterial strains (Nair, 2005).
Antifertility and antiandrogenic activities of Sapindus
emarginatus extract have been reported (Venkatesh,
2002). High content of saponins such as Two Pisicidal
triterpenoid saponins (Wilawan, 1990) acetylated
triterpene saponins, hederagenin, sweet acyclic
sesquiterpene glycoside, Mukurozioside IIb15 have been
isolated from the Pericarps of S. emarginatus. Flavonoids
have been isolated from the pericarp of Sapindus
emarginatus (Tripetch, 2001). The presence of such
flavonoids, triterpenoid or saponins, encouraged us to
evaluate the hepatoprotective activity of S. emarginatus
against antitubercular drugs induced hepatotoxicity in rats.
2. MATERIALS AND METHODS
Collection and authentication of plant material:
Sapindus emarginatus pericarps were collected during the
may-2013 from Vuyyuru, Krishna (Dist),Andhra Pradesh,
India and authenticated by Dr K Madhavachetty,
Assistant professor, Department of Botany, Sri
Venkateswara, university, Tirupati.
Preparation of extract: The shad dried pericarps were
collected and powdered. Dried powder material (500g) of
the pericarp of Sapindus emarginatus was extracted with
2000ml of methanol in a Soxhelt apparatus. The resulted
extract yield was 7.45% and the appearance of the extract
was dried gum resin in nature
Animals: The Female wister albino rats (200-210g) were
obtained from the central animal house of Sigma institute
of clinical research & administration PVT LTD,
Hyderabad. The animals were housed at room temperature
(22-28 ºC) for 12 hrs dark light cycles. The study was
conducted after obtaining Institutional animal ethical
committee clearance.
Acute toxicity studies: Toxicity studies were performed
according to OECD-423guidelines.
Shoba Rani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 661
Experimental design: Animals were divided in to Five groups
(n=6)
Group I Control animals received the vehicle viz.
normal saline (2 ml/kg)
Group II Animals received RCIN and INH (100 ±50
mg/kg p.o.) at every 72hours
Group III Animals received silymarin 50 mg/kg p.o. for
21 days and simultaneously administered
RCIN and INH (100 ±50 mg/kg p.o.) every
72 hours
GroupIV Animals received MSE 200 mg/kg p.o for 21
days and after 1hour Simultaneously
administered RCIN and INH (100 ±50 mg/kg
p.o.) every 72 hours.
Group V Animals received MPA 400 mg/kg p.o. for
21 days and after 1hour Simultaneously
administered RCIN and INH (100 ±50 mg/kg
p.o.) every 72 hours
At the end of all experimental methods, all the animals
were sacrificed by cervical decapitation. Blood samples
were collected, allowed to clot. Serum was separated by
centrifuging at 2500 rpm for 15 min and analyzed for
various biochemical parameters.
Assessment of liver function: Biochemical parameters
i.e., aspartate amino transferase (AST) alanine amino
transferase (ALT), alkaline phosphatase (ALP), total
bilirubin and total protein were analyzed according to the
reported methods. The liver was removed, weighed and
morphological changes were observed. A 10% of liver
homogenate was used for antioxidant studies such as
reduced glutathione (GSH), (lipid peroxidation (LPO),
superoxide dismutase (SOD), catalase. The liver was
removed, weighed and morphological changes were
observed. A portion of liver was fixed in 10% formalin for
histopathological studies.
Histopathological studies: Liver slices fixed for 12 hrs in
Bouin’s solution were processed for paraffin embedding
following standard micro techniques.5μm sections of liver
grained with alum haematoxylin and eosin were observed
microscopically for histopathological changes.
Statistical analysis: The values were expressed as mean ±
SEM. Statistical analysis was performed by one way
analysis of variance (ANOVA) followed by Dunnett,s
multiple comparison test and data on liver weight
variations were analyzed using Student’s ‘t’ test. P values
< 0.05 were considered as significant.
3. RESULTS
The effect of MSE on serum marker enzymes are
presented in table 1.The levels of serum AST, ALT, ALP,
total bilirubin, were markedly elevated and that of protein
decreased in RCIN and INH treated animals, indicating
liver damage. Administration of MSE at the doses of 200
and 400 mg/kg remarkably prevented RCIN and INH -
induced hepatotoxicity in a dose dependent manner. LPO
levels in the INH and RCIN treated rats showed a
significant (P<0.001) increase. Treatment with MSE (200
mg/kg and 400 mg/kg) significantly (P<0.001) prevented
the increase in LPO level which was brought to near
normal. The effect of MSE was comparable with that of
standard drug silymarin.
RCIN and INH treatment caused a significant
(P<0.001) decrease in the level of SOD, catalase, and
GSH, in liver tissue when compared with control group
(table 2). The treatment of MSE at the doses of 200 and
400 mg/kg resulted in a significant increase of enzymic
and non enzymic antioxidants when compared to RCIN
and INH treated rats. The liver of silymarin treated
animals also showed a significant increase in antioxidant
enzymes levels compared to INH and RCIN treated rats.
Morphological observations showed an increased size and
enlargement of the liver in RCIN and INH treated groups.
These changes were reversed by treatment with silymarin
and also MSE at the doses tested. Histopathological
studies, showed RCIN and INH to produced extensive
vascular degenerative changes and centrilobular necrosis
in hepatocytes. Treatment with different doses of MSE
produced mild degenerative changes and absence of
centrilobular necrosis when compared with control. All
these results indicate a hepatoprotective potential of the
extract.
4. DISCUSSION
Drug-induced hepatotoxicity is a potentially
serious adverse effect of the currently used anti-tubercular
chemotherapeutic regimens containing RCIN and INH.
The conversion of monoacetyl hydrazine, a metabolite of
INH, to a toxic metabolite via cytochrome P450 leads to
hepatotoxicity. RCIN induces cytochrome P450 enzyme
resulting an increased production of toxic metabolites
from acetyl hydrazine (AcHz). RCIN can also increase the
metabolism of INH to isonicotinic acid and hydrazine,
both of which are hepatotoxic.
The plasma half life of AcHz (metabolite of INH)
is shortened by RCIN and AcHz is quickly converted to its
active metabolites by increasing the oxidative elimination
rate of AcHz, which is related to the higher incidence of
liver necrosis caused by RCIN and INH combination. In
addition to these mechanisms; oxidative stress induced
hepatic injury is one of the important mechanisms in
hepatotoxicity produced by anti-tubercular drugs (Mitra,
1998). When liver cell plasma membrane is damaged, a
variety of serum marker enzymes, like AST, ALT, ALP,
total bilirubin located in the cytosol are released in to the
blood stream. Their estimation in the serum is a useful
quantitative marker of the extent and type of
hepatocellular damage. The enhanced activities of these
Shoba Rani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 662
serum marker enzymes observed in RCIN and INH treated
rats in our study correspond to the extensive liver damage
induced by RCIN and INH. Results indicate that MSE
administration could blunt RCIN and INH -induced
increase in activities of different marker enzymes of
hepatocellular injury, viz. AST, ALT, ALP, total bilirubin,
and total protein, (Table 1) suggesting that MSE possibly
has a protective influence against RCIN and INH induced
hepatocellular injury and degenerative changes.
The combination of RCIN and INH was reported
to result in higher rate of inhibition of biliary secretion and
an increase in liver cell lipid peroxidation, and
cytochrome P-450 was thought to be involved in the
synergistic effect of RCIN and INH (Ramaiah,
2001).Treatment of the rats with MSE significantly
reduced the elevated levels of LPO. Alterations of various
cellular defense mechanisms consisting of enzymatic and
non-enzymatic antioxidant components [superoxide
dismutase (SOD), catalase, reduced glutathione,
Glutathione reductase, have been reported in RCIN and
INH -induced hepatoxicity (Table 2). The RCIN and INH
administered animals exhibited significantly (p<0.001)
low levels of hepatic enzymatic and non-enzymatic
antioxidant components, and significantly increased with
co-administration of MSE (200 and 400 mg/kg) at the all
the doses and in silymarin treatment group after 21 days.
Table.1.Effect of MSE on Biochemical Parameters in RCIN and INH -induced hepatotoxicity rats
Notes: All the values are mean ± SEM, n=6, ns=Not significant, One way Analysis of Variance (ANOVA) followed by
Dunnett,s multiple comparision test, *P<0.05, **P<0.01, ***P<0.001 Vs control group and aP<0.001,
bP<0.01,
cP<0.05
Vs Sham operated normal
Table.2.Effect of MSE on enzymic and non-enzymic antioxidants level in RCIN and INH -induced hepatotoxicity
rats Treated groups LPO SOD CATALASE GSH
Normal 9.97±0.27 44.87±0.66 72.33±0.81 3.17±0.05
Control (R±I 100:50mg/kg) 24.39±0.59a 26.45±0.84
a 30.63±0.84
a 1.13±0.06
a
Standarrd (Silymarin) 50mg/kg 15.64±0.37***
41.25±0.37***
69.72±0.74***
2.42±0.07***
MSE 200mg/kg)T1 15.91±0.65***
37.87±0.7***
46.59±0.91***
1.93±0.01***
MSE(400mg/kg)T2 17.53±0.58***
32.64±0.94***
60.57±0.82***
1.80±0.02***
Notes: All the values are mean ± SEM, n=6, ns=Not significant, One way Analysis of Variance (ANOVA) followed by
Dunnett,s multiple comparision test, *P<0.05, **P<0.01, ***P<0.001 Vs control group and aP<0.001,
bP<0.01,
cP<0.05
Vs Sham operated normal
5. CONCLUSION
From the results obtained, we can conclude that
methanolic pericarp extract of Sapindus emarginatus
possess hepatoprotective activity.
6. ACKNOWLEDGEMENT
I would like to take the privilege to thank the
selfless people such as my parents , teachers friends, well-
wishers and relatives from the core of my heart who with
their constant support , affection ,inspiration and
encouragement made me feel comfortable to successfully
complete this venture.
REFERENCES
Mitra SK, Venkataranganna MV, Sundaram R,
Gopumadhavan S. Protective effect of HD-03, a herbal
formulation,against various hepatotoxic agents in rats, J
Ethnopharmacol, 63, 1998, 18-186.
Nair R,Kalariya T, Sumitra Chandra, Antibacterial activity
of some selected Indian Medicinal Flora .Turk J Biol, 29,
2005, 29, 410
Treated groups SGPT SGOT ALP Total protein Total bilirubin Direct Bilirubin
Normal
(0.9%Saline)
31.86±2.14 51.94±1.50 76.87±1.64 10.53±0.67 0.17±0.010 0.18±0.02
Control
(R±I 100:50mg/kg)
102.33±2.13a 165.62±1.66
a 212.30±1.87
a 3.29±0.32
a 1.94±0.20
a 0.54±0.03
a
Standarrd
(Silymarin) 50mg/kg
43.63±1.93***
89.88±1.03***
123.30±1.87***
7.56±0.31***
0.33±0.01***
0.33±0.01***
MSE
(200mg/kg)T1
37.71±2.02***
68.01±1.48***
142.71±1.67***
6.92±0.030***
0.33±0.03***
0.30±0.01***
MSE
(400mg/kg)T2
47.05±2.02***
87.69±1.38***
158.98±2.12***
8.56±0.42***
0.38±0.01***
0.40±0.001**
Shoba Rani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 663
Pushpangadan P, Kumar B, Vijayakumar M and
Govindarajan R Ethnopharmacological approaches to
wound healing exploring medicinal approaches to wound
healing exploring medicinal plants, J Ethnopharmacol,
2007, 114, 2007, 103-113.
Ramaiah SK, Apte U, Mehendale HIM. Cytochrome
P4502E1 induction increases thioacetamide liver injury in
diet-restricted rats. Drug Metab Dispos, 29, 2001, 1088-
95.
Subramaniam A, Evans DA, Rajasekharan S and
Pushpangadam P,Effect of Trichopus zeylanicus Gaertn
(active fraction) on phagocytosis by peritoneal
macrophages and humoral immune in response in mice,
Indian J Pharmacol, 32, 2000, 221-225.
Tripetch Kanchanapoom, Ryoji Kasai and
KazuoYamasaki, Acetylated Triterpene Saponins from the
Thai Medicinal Plant, Sapindus emarginatus, Chem Pharm
Bull, 49(9), 2001, 1195.
Venkatesh V, Sharmal JD and Raka Kamal, A
Comparative study of alcoholic extract of Saem,
Terminalia belerica, Cuminnum cyminum and Allium
cepa on reproductive organs of Male albino rats, Asian
J.Exp Sci, 16(1), 2002, 510.
Wilawan Maha Busarakam, Towers GHN, Pittaya
Tuntiwachwesttikul and pichaet Wiryachitra, Pisicidal
triterpenoid saponins of the pericarps of Sapindus
emarginatus, J.Sci.SOC, Thailand, 16, 1990, 187.
Srilakshmi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 664
EVALUATION OF ANTI-DIABETIC AND HEPATO PROTECTIVE ACTIVITY OF
95% METHANOLIC EXTRACT OF TERMINALIA TOMENTOSA BARK BY USING
ALBINO RATS Srilakshmi P
*, Janarthan M, Zuber Ali M
Department of Pharmacology, Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email: [email protected], Phone +91-9032571580
ABSTRACT
The anti-diabetic and hepatoprotective activity of the Methanolic extract of the bark of Terminalia tomentosa
(family: combrataceae) was investigated on alloxan induced diabetic albino rats. A comparison was made
between both plant extract and a known antidiabetic drug glibenclamide (5mg/kg-1
). The dried bark of Terminalia
tomentosa was subjected to extraction by continuous hot extraction method using methanol as a solvent.
Phytochemical estimation was done for the presence of phytoconstituents. Dose selection was made on the basis
of acute oral toxicity study (250mg/kg-1
, 500mg/kg-1
bodyweight) as per OECD guidelines. Oral administration of
extract of Terminalia tomentosa for 21days resulted in significant reduction in blood glucose level. Alloxan
induced diabetic rat model and oral glucose tolerance test (OGTT) model was used for evaluation of antidiabetic
activity. The biochemical parameters were analysed. All rats in the diabetic groups had FBG levels well within
the diabetic range (>150 mg dL-1
) at the initial stage of the experiment but after three weeks of treatment with
extracts or glibenclamide the FBG significantly dropped in dose-dependent manner, and also correct the lipid
profile and liver enzymes. The results suggest that the Methanol extracts of the bark of Terminalia tomentosa
restored the metabolic changes in alloxan-induced diabetic rats.
Key words: Terminalia tomentosa, glibenclamide, alloxan, anti-diabetic activity
INTRODUCTION
Diabetes mellitus is a metabolic disorder initially
characterized by a loss of glucose homeostasis with
disturbances of carbohydrate, fat and protein metabolism
resulting from defects in insulin secretion, insulin action,
or both. (Alberto Barceló1 and Swapnil Rajpathak,
2001) In 2005, an estimated 1.1 million people died from
diabetes with a projected rise in deaths of 50% over the
next 10 years. It is estimated that at least 1 in 20 deaths,
globally and across all ages, are attributable to diabetes.
(WHO, 2005) Diabetes induced by alloxan, it produce
oxidative free radicals. This free radicals damage the β-
Cells of pancreas. In present study Terminalia tomentosa
bark was selected for anti diabetic activity because it is
having anti oxidant property. Due to this anti oxidant
property the oxidative species were reduced so that β-
Cells were recovered.
MATERIALS AND METHODS
Chemicals: Alloxan monohydrate, glibenclamide,
glucose, all other chemicals and reagents used were
analytical grade.
Plant material: The stem bark of Terminalia tomentosa
(Roxb.) Wight & Arn. Belonging to Combrataceae were
collected from Tirumala Hills, Chithoor district (A.P). The
plant material was identified and authenticated by Dr.
Prathibha (Professor and H.O.D. of Department of Botany
Osmania University, Hyderabad, India.
Preparation of plant extraction: The collected bark was
shade dried and powdered in mixer grinder to get coarse
powder. The powdered plant material (100gms) was
extracted with methanol (95%v/v) by using soxhlet
apparatus. The extract was air dried to evaporate solvent.
Phytochemical screening: The preliminary
phytochemical screening of methanolic extract of
Terminalia tomentosa was carried by using standard
procedures.
Acute Toxicity Study: toxicity studies were performed
according to OECD-425guidelines.
Experimental model: Alloxan monohydrate was weighed
individually for each animal according to their body
weight and solubilised with saline just prior to injection.
Diabetes was induced by injecting it at a dose of 150
mg/kg body weight intrapertonially. The animals were
kept under observation and after 48 hrs blood glucose
level was measured by One-touch glucometer. The
diabetic rats (glucose level 200-300 mg/dl) were separated
and divided into five different groups for experimental
studies, with each group containing six animals. Present
study has confirmed that the treatment of methanolic
extract of Terminalia tomentosa for a period of 3weeks
caused a significant decreased in BGL (Blood glucose
level) of diabetic rats. 250&500 mg/kg of plant extract
were screened for anti diabetic activity against alloxan
induced diabetic rats. It produced significant anti diabetic
activity in a dose dependent manner. The animals treated
with alloxan had high BGL. The anti diabetic activity
Srilakshmi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 665
exhibited by extract was compared with that of standard
drug (glibenclamide).
Experimental design:
The rats were divided into five groups each consist of six
rats. Significant hyperglycaemia was achieved within 48
hrs after alloxan (150 mg/kg body weight i.p) injection.
Group I- Served as normal control and did not receive any
treatment
Group II- Served as diabetic control and received Inducer
(alloxan-150mg/kg) and vehicle
Group III- Alloxan + Glibenclamide (5 mg/kg p.o.) and
served as standard
Group IV- Alloxan + 95% MTT extract (250 mg/kg, p.o.)
Group V- Alloxan + 95% MTT extract (500 mg/kg, p.o.)
Statistical Analysis: The result of the study were
subjected to one way analysis of variance (ANOVA)
fallowed by Dunnet’s test for multiple comparisions.
Values with p<0.05 were consider significant.
RESULTS
Phytochemical Screening: Phytochemical screening of
methanolic extract of Terminalia tomentosa showed the
presence of various chemical constituents mainly
alkaloids, Proteins, glycosides, phytosterols and saponins.
Extract may be responsible for antidiabetic and
hepatoprotective properties. The results obtained were
comparable and satisfied the standard literature.
Acute oral toxicity studies: In the present study the MTT
was subjected for toxicity studies. For the LD50 dose
determination MTT was administered the dose level of
1000 mg/kg and 2000 mg/kg body weight and both doses
did not produce any mortality. Hence one-fourth of the
dose tested i.e. 250mg/kg and 500mg/kg body weight
was selected for the study in order to ascertain a
scientific base for the useful of this plant in the treatment
of diabetes. It was decided to evaluate experimental
design of antidiabetic activity by Alloxan induced model.
Anti-diabetic activity:
Alloxan induced diabetic model: The anti-diabetic effect
of MTT in alloxan induced diabetic animals is presented.
The results showed that after single dose treatment of the
extract in individual group of alloxan induced diabetic
rats, there was a significant reduction in serum glucose
levels throughout the entire period of study (21 days) as
compared to diabetic control group. Terminalia tomentosa
bark extract were screened for antidiabetic activity in rats
Where Alloxan (150 mg/kg, i.p.) used as the diabetogenic
agent.
In an alloxan induced diabetic rats (Gr. II)
significantly increased serum glucose level at ‘0’day
(P<0.001), 1st
day (P<0.001), 7th day (P<0.001), 14
th day
(P<0.001) and 21st day (P<0.001) were shown in the Table
No.1.
Glibenclamide at an oral dose 5 mg/kg reduced
serum glucose level at ‘0’day (P<0.001), 1st
day
(P<0.001), 7th day (P<0.001), 14
th day (P<0.001) and 21
st
day (P<0.001) significantly when compared with control
respectively.
Administration of MTT 250 and 500 mg/kg orally
reduced significantly serum glucose level at ‘0’
day
(P>0.001), (P>0.001), at 1st day (P<0.001), (P<0.001), at
7th day (P<0.001), (P<0.001), 14
th day (P<0.001),
(P<0.001) and 21st day (P<0.001), (P<0.001) when
compared to (Gr. II) control respectively.
Oral glucose tolerance test (OGTT) model: The anti-
diabetic effect of MTT in glucose induced diabetic
animals is presented. The results showed that after single
dose treatment of the extract in individual group of
glucose induced diabetic rats, there was a significant
reduction in glucose levels throughout the entire period of
study (1440 min) as compared to diabetic control group.
In an glucose induced diabetic rats significantly
increased serum glucose level at ‘0’min (P<0.01), 30 min
(P<0.001), 60 min (P<0.001), 90 min (P<0.001), 120 min
(P<0.01) and 1440 min (P<0.001) were shown in the
Table No.2.
Glibenclamide at an oral dose 5 mg/kg reduced
serum glucose level at ‘0’min (P<0.01), 30 min
(P<0.001), 60 min (P<0.001), 90 min (P<0.001), 120 min
(P<0.001) and 1440 min (P<0.001) significantly when
compared with control respectively.
Administration of MTT 250 and 500 mg/kg orally
reduced significantly serum glucose level at ‘0’min
(P<0.001) (P<0.001), 30 min (P<0.001) (P<0.001), 60
min (P<0.001) (P<0.001), 90 min (P<0.001) (P<0.001),
120 min (P<0.001) (P<0.001) and 1440 min (P<0.001)
(P<0.001) when compared with control respectively.
Srilakshmi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 666
Table.1. Effect of 95% MTT extract on fasting blood glucose level in Alloxan induced diabetic rats Normal Control
(Allaxon-
150mg/kg)
Standard
(Glibenclamide-
5mg/kg)
MTT
(250mg/kg)
MTT
(500mg/kg)
0 Day 83.5±0.84 371.83±0.72 a 254.17±0.64
*** 283.17±0.77
*** 260.83±0.64
***
1st Day 79.83±0.44 355±0.82
a 240.17±0.64
*** 249.67±0.77
*** 235.83±0.86
***
7th
Day 74.83±1.01 298.33±1.05 a 179±0.67
*** 185.17±0.76
*** 154.5±0.87
***
14th
Day 71±0.47 232.16±0.89 a 175.5±0.61
*** 179.83±0.83
*** 149.5±0.87
***
21st Day
79.5±0.39 234.5±2.10 a 120.33±0.77
*** 131.5±0.51
*** 121±0.47
***
All the values are mean± SEM, n=6, One way ANOVA followed by multiple compression Dennett’s test ***
P<0.001
as compare to control. a P<0.001 when compared with normal
Table.2. Effect of 95% MTT extract on OGTT in oral glucose induced diabetic rats Normal Control (glucose-
1gm/kg)
Standard
(Glibenclamide
5mg/kg)
MTT
(250mg/kg)
MTT
(500mg/kg)
0 min 68±0.666 72±0.5270b 73.33±0.6085
** 73.16±0.8633
*** 78.66±0.6526
***
30 min 72±0.666 122±0.7817a 94.33±0.4513
*** 96.16±0.5485
*** 80±0.7453
***
60 min 75.66±0.5610 140±0.5270a 80.5±0.6972
*** 91.33±0.6526
*** 79.33±0.4513
***
90 min 77.66±0.5610 92.66±0.7698a 71.66±0.6085
*** 83.16±0.5485
*** 71.83±0.4356
***
120 min 77±0.4082 80.16±0.6419b 61.66±0.6085
*** 71.5±0.6972
*** 66.16±0.6419
***
1440 min 75.33±0.3849 70.5±0.6972 a 70.5±0.6971
*** 71.33±0.4513
*** 71.16±0.4356
***
Table.3. Effect of 95% MTT extract on lipid profile in Alloxan induced diabetic rats
Parameters
TREATMENT
Normal Control
(ALLOXAN
-150mg/kg)
STANDARD
(GLIBENCLA
MIDE-5mg/kg)
MTT
(250mg/kg)
MTT
(500mg/kg)
Cholesterol 152.25±0.50 353.86±1.49a 163.58±0.60
*** 188.32±0.75
*** 157.74±0.78
**
Tri glycerides 144.92±0.95 292.29±1.05a 151.07±0.79
*** 152.04±0.78
*** 163.73±0.81
***
HDL
cholestol
48.87±0.58 19.42±0.65 a 65.45±0.59
*** 62.05±0.71
*** 62.89±0.73
***
LDL cholestrol 73.89±0.46 275.98±1.91a 67.89±0.64
*** 95.87±1.20
*** 62.09±1.34
***
VLDL cholestrol 28.82±0.22 58.48±0.21 a 30.21±0.16
*** 30.41±0.16
*** 32.75±0.16
***
All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression
Dennett’s test ***
P<0.001, **
P<0.01 as compared to control. a P <0.001 when compared with normal.
Table.4. Effect of 95% MTT extract on liver enzyme levels in Alloxan induced diabetic rats
Parameters
Treatment
Normal Control
(Alloxan-
150mg/kg)
Standard
(Glibenclamide-
5mg/kg)
MTT
(250mg/kg)
MTT
(500mg/kg)
SGPT 15.13±0.23 58.55±0.72a 11.68±0.55
*** 21.77±0.38
*** 17.00±0.37
***
SGOT 20.65±0.50 63.23±0.76a 22.45±0.63
*** 22.51±0.55
*** 26.05±0.79
***
ALP 66.06±0.84 114.06±0.83a 107.33±0.77
*** 123.94±0.92
*** 106±0.42
***
Total
bilurubin
0.82±0.02 1.43±0.056a 1.28±0.08
*** 0.85±0.01
*** 0.43±0.01
***
Direct
Bilurubin
0.25±0.01 0.33±0.01a 0.26±0.01
*** 0.37±0.01
*** 0.27±0.01
***
Total protein 8.50±0.26 6.77±0.15a 7.88±0.30
*** 4.83±0.19
*** 6.28±0.032
***
All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression Dennett’s test ***
P<0.001
as compared to control. a P <0.001 when compared with normal.
Srilakshmi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 667
Table.5. Effect of 95% MTT extract on body weight of Alloxan induced diabetic rats Normal Control
(Allaxon-
150mg/kg)
Standard
(Glibenclamide-
5mg/kg)
MTT (250mg/kg) MTT (500mg/kg)
0 Day 231.66±5.97 210±7.0710a 231.66±5.485
*** 236.66±4.513
*** 235±5.1370
***
1st Day 231.66±5.49 206.66±5.610
a 230.33±6.0858
*** 233.33±4.5133
*** 231.66±4.953
***
7th
Day 233.33±6.94 205±5.6519 a 231.66±6.419
*** 235±3.908
*** 231.66±4.356
***
14th
Day 236.66±4.51 208.33±3.664 a 228.33±6.419
*** 228.33±4.356
*** 228.333±3.664
***
21st Day
240±6.666 200±8.0794 a 230±6.666
*** 234.166±6.057
*** 240±3.333
***
All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression
Dennett’s test ***
P<0.001,**P<0.01 as compared to control, a P <0.001 when compared with normal.
DISCUSSION
The results obtained from the present
investigation demonstrated that the bark extract of
Terminalia tomentosa constantly maintained significant
reduction of the glucose level in alloxan and oral glucose
mediated diabetic rats throughout the experimental period
suggesting the antidiabetic property of the title plant.
Diabetes mellitus causes failure to use of glucose for
energy that leads to increased utilization and decreased
storage of protein responsible for reduction of body
weight essentially by depletion of the body proteins. (John
E. Hall, 2001) In the present study, it was observed that
the extract reversed the weight loss of the diabetic rats.
Alloxan has been shown to induce free radical production
and cause tissue injury. (Halliwell and Gutteridge, 1985)
The pancreas is especially susceptible to the action of
alloxan induced free radical damage. The dose of
150mg/kg of alloxan can induces an autoimmune process
that results in the destruction of the β-cells of islets of
Langerhans; it also results in the toxicity of beta cells with
emergence of clinical diabetes within 2-4 days. (Weiss
RB)
CONCLUSION
The results of the present study indicated
that Terminalia tomentosa bark extract possesses
significant antidiabetic activity and hepatoprotective
activity against alloxan induced diabetic rats. Thus
justifies the traditional use of this plant in the
treatment of diabetes mellitus. Bark extract of the
title plant possesses almost equipotent antidiabetic
activity when compared with reference standard
Glibenclamide.
REFERENCES
Alberto Barceló1 and Swapnil Rajpathak, Incidence
and prevalence of diabetes mellitus in the Americas,
Pan Am J Public Health, 10(5), 2001, 300-308.
Halliwell B, Gutteridge JMC, Free radicals in biology
and medicine Clearendon Press Oxford, 1985, 215-
17.
John E. Hall, Guyton and Hall a text book of medical
physiology, Philadelphia Pennsylvania: The Curtis
center Saunders, 2000, 884-889.
Weiss RB, Streptozocin: A review of its
pharmacology, efficacy and toxicity, Cancer
Treatment Report, 66 (3), 1982, 427-38.
Wolrd Health Organization, W. H. Preventing
chronic diseases: a vital investment, 2005.
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 668
IN-VIVO ANTI-INFLAMMATORY ACTIVITY OF METHANOLIC EXTRACT OF
CISSUS REPANDA Vijay Kumar S
1*, Satyanarayana T
2, Anjana Mathew
2, S.Chandrasekhar
3, Rajendra G
1
1. Sri Krishna chaithanya college of pharmacy, Madanapalle, A.P
2. University College of pharmaceutical sciences, Andhra University, Visakhapatnam, A.P
3.Govt.Ayurvedic Dispensory,Nagenahalli,Karnataka
*Corresponding author: E mail: [email protected]
ABSTRACT The present investigation deals with the in-vivo acute toxicity studies and in-vivo anti-inflammatory
activity by Carrageenan induced rat paw edema model of methanolic extract in the stems of Cissus Repanda.
TheLiterature review reveals the presence of steroids, flavonoids, triterpenoids, and glycosides in Cissus
Repanda. Some plants belonging to Cissus genus have been reported to possess anti-inflammatory activity hence
methanolic extract of stems of C. Repanda were screened for anti-inflammatory activity. Carrageenan induced
significant inflammation when compared with the animals treated with the extracts. Standard drug, indomethacin
at 10 mg/kg inhibited the inflammation significantly at all-time intervals. C.Repanda exhibited significant anti-
inflammatory activity in dose dependant manner. C.Repanda inhibited the carrageenan induced inflammation
significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and 5 hours.
KEY WORDS:Cissus Repanda, Carrageenan induced Paw edema, Anti-Inflammatory, Acute toxicity.
1. INTRODUCTION
Plants have been used for medicinal purposes long
before recorded history in many countries such as India,
China and Africa. Since then, thousands of indigenous
plants have been used for the treatment of chronic
ailments. Many other herbs and minerals were later
described by ancient Indian herbalists such as Charaka and
Sushruta during the 1st millennium BC. The
SushrutaSamhita attributed to Sushruta in the 6th century
BC describes 700 medicinal plants (Agarwal, 2007). In
20th century, as part of industrial revolution, the practice
of allopathic medicines gained popularity. Eventually, the
spirit of herbal medicine declined from conventional
medicinal use as safety and effectiveness of herbal
medicines were not scientifically corroborated and remain
largely unknown. Due to the fact that the safety of
medicine has always been around for us, it becomes a
common theme to rely on safe treatments. Usage of herbal
traditional medicine is rising steadily, because of lesser
side effects, affordability and in certain diseases where no
suitable allopathic medicines are available. Based on the
therapeutics significant of herbs and by proper monitoring
of quality, dosage of the drug by the ayurvedic physician
is essential. Recent advances in the methodologies used to
extract, purify and evaluate plant extracts for biological
activity have enable the miniaturization and automation of
extremely specific biochemical tests. As a result, in
number of patients a resurgence of interest on plants and
plant derived products as a source of medicine is
increasing. There is an urgent need to re-emphasize and
enhance research in natural products in many therapeutic
areas (Bhujbal, 2008). Inflammation term is derived from
Latin word inflammare, which means - to set on fire.
Inflammation refers to a vital response of a tissue against
injury elicited by physical trauma, noxious chemical or
microbiological agents. It is considered to be body’s
defensive reaction either to inactivate or destroy the
injurious foreign agent or organism. It is triggered by the
release of chemical mediators which includes amines such
as histamine, serotonin and lipids such as prostaglandins
and small peptides such as kinins from the injured tissues
and migrating cells. Mainly, inflammatory responses
occur in three distinct phases, each apparently mediated
by different mechanisms: Accordingly, pharmacological
methods for anti-inflammatory evaluation have been
developed by artificially inducing inflammation by using
phlogistic agent (irritants) such as: Brewer’s yeast,
formaldehyde, dextran, egg albumin, kaolin, aerosol,
sulfated polysaccharides like carrageenan. The effects can
be measured by several methods such as UV-erythema in
guinea pigs, vascular permeability, Croton-oil ear edema
in rats and mice, Paw edema in rats and Granuloma pouch
technique (Brooks, 1991).
2. METHODOLOGY
2.1 Toxicity Studies on stems of methanolic extract of
C. Repanda in rats
2.1.1 Acute toxicity study in rats with test drugs: The
animals were used with the approval of Institutional
Animal Ethics Committee (Reg .No.627/02/A/CPCSEA).
Two groups, each of three female rats, were treated with
methanolic extract of stems of C. Repanda by oral
administration at a dosage of 2000 mg/kg body weight.
The test drugs were formulated in vehicle (distilled water)
at a concentration of 2000 mg/kg and administered at the
dose of 1ml/kg.
2.1.2 Treatment: The animals received a single dose of
the test item by oral administration at 2000 mg/kg body
weight for groups I and II, after being fasted for
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 669
approximately 18.0 hours but with free access to water.
Food was provided again at approximately 3.0 hours after
dosing for both the groups. The administration volume
was 10 ml/kg body weight. The animals were dosed using
18 G oral Stainless steel feeding tubes. The animals were
observed daily during the acclimatization period and
mortality/viability and clinical signs were recorded. All
animals were observed for clinical signs during first
30 minutes and at approximately 1, 2, 3 and 4 hours after
administration on test day 0 and once daily during test
days 1-14. Mortality/viability was recorded twice daily
during days 1-14 (at least once on day of sacrifice). Body
weights were recorded on test day 0 (prior to
administration), test days 7 and 14. All animals were
necrosed and examined macroscopically (Dorni, 2006).
2.1.3 Necroscopy: All animals were sacrificed at the end
of the observation period by carbon dioxide in euthanasia
chamber and discarded after the gross/macroscopic
pathological changes were visually observed and
recorded. No organs or tissues were retained.
2.2 Screening for anti-inflammatory activities of
methanolic extract of stems of C. Repanda in rats
2.2.1 Carrageenan induced rat paw edema model: The
model is based on the principle of release of various
inflammatory mediators by carrageenan. Edema formation
due to carrageenan in the rat paw is biphasic event. The
initial phase is attributed to the release of histamine and
serotonin. The second phase of edema is due to the release
of prostaglandins, protease and lysosome.Subcutaneous
injection of carrageenan into the rat paw produces
inflammation resulting from plasma extravasation,
increased tissue water and plasma protein exudation along
with neutrophil extravasation. All these events occur as a
result of metabolism of arachidonic acid. The
pharmacological screening of the C. Repanda was carried
out using standard protocols1. The crude extract was
suspended in 1% carboxy methyl cellulose (CMC) for
administration to albino rats. Albino rats of 150-200 g
were used for present investigation and were used with the
approval of the Institutional Animal Ethics Committee
(Regd. No. 627/02/A/CPSCSEA). They were kept in
polypropylene cages in an air-conditioned area at 25 +
2oCin 10-14 hours light dark cycle. They were provided
with Amruth brand balanced feed and tap water ad libitum
(Eshrat MH, 2003).
2.2.2 Experimental procedure: Seventy two rats were
divided into five groups (n=6) starved overnight with
water adlibitum prior to the day of experiment. The group
I kept as carrageenan control, groups II to IV received test
drugs at different doses and group V kept as standard drug
control, respectively.Left paw was marked with ink at the
level of lateral malleolus; basal paw volume was measured
plethysmographically by volume displacement method
using Plethysmometer (UGO Basile 7140) by immersing
the paw till the level of lateral malleolus. In the
experiment, animals from the control group were given
vehicle control, Carboxy Methy Cellulose (CMC) and
animals from standard drug were treated with
Indomethacin 10 mg/kg b.w orally as given in table 2.
Other groups were treated with different doses of test
drugs orally as given in table 2. After 30 min. of drug
treatment the rats are charged by a subcutaneous injection
of 0.1ml of 1% solution of carrageenan into the sub-
plantar side of the left hind paw (Gupta R, Bajpai KG,
2008). The paw volume is measured again at 1, 2, 3, 4 and
5 hours after charging. The increase in paw volume is
calculated as percentage compared with the basal volume.
The difference of average values between treated animals
and control group is calculated for each time interval and
evaluated statistically. The percent increase in paw
volume was calculated using formula as follows.
% increase in paw volume = 100)(
XV
VV
c
ct
Where Vt = paw volume at a time t, Vc = paw volume at a
time 0
3. RESULTS
All animals survived in group I and group II until
the end of the experimental period. All the animals dosed
at 2000 mg/kg body weight did not show evident toxicity
throughout the experimental period. The animals showed
increase in their body weight by day 14 as compared to
day 0. No abnormalities were detected for all the animals
at necropsy. Based on the results, the median lethal doses
(LD50)of, C. Repanda was greater than 2000 mg/kg b.w
and were classified as category 4 (it indicates that no death
was observed at 2000mg/kg b.w.) as per OECDguidelines
(Hoareau and DaSilva,1999).
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 670
Table.1.Body weight analysis of test drug treated rats Test drug Group Dose(mg/kg
bodyweight) Animal
Numbers
Sex Test day 0
(treatment)(g)
Testday7
(g)
Testday14
(g)
C.
Repanda I 2000
002013 Female 201.00 231.30 252.10
002014 Female 210.14 231.72 252.60
002015 Female 203.86 229.92 242.84
II 2000
002016 Female 205.66 231.54 252.25
002017 Female 201.44 232.06 253.03
002018 Female 212.61 232.22 263.18
mg/kg = miligram/kilogram, g = gram
Table.2 Macroscopic findings of animals from test drug treated groups
Table.3.Showing percentage of inflammation indicating Anti-inflammatory activity of test drugs on
Carrageenan induced rat paw oedema Groups Drug Doses Percentage of inflammation at time (hours)
1 2 3 4 5
I Carrageenan
Control
38.83±1.03 81.83±1.16 113.3±2.39 131.0±4.98 146.72±5.46
II C.Repanda
250mg/kg
38.57 ±0.80 80.58 ±1.10 110.9 ±1.94 130.02 ±5.35 138.75 ± 6.42
III C.Repanda
500mg/kg
36.78 ±1.76 80.16 ±0.62 * 99.07 ±4.00 *** 120.55 ±4.29 ** 114.32 ± 4.30 ***
IV C.Repanda
1000mg/kg
36.28 ±1.82 * 79.60 ±1.04 ** 97.5±2.32*** 113.8±5.26*** 98.00±3.67 ***
V Indomethacin
10 mg/kg
12.55±0.86*** 19.1±0.48 *** 27.17±1.07*** 32.65±1.52*** 30.15±2.50 ***
* P<0.05, ** P<0.01, *** P<0.001 significant from control
Figure.1.Percentage of inflammation indicating Anti-inflammatory activity of C. Repanda in Carrageenan induced rat
paw oedema
Test
drug
Group Dose
(mg/kgbw)
Animal
Numbers
Sex Mode of death Macroscopic findings
C.
Repand
a
I 2000
002013 Female Terminal Sacrifice No abnormalities
Detected
002014 Female Terminal Sacrifice No abnormalities
Detected
002015 Female Terminal Sacrifice No abnormalities
Detected
II 2000
002016 Female Terminal Sacrifice No abnormalities
Detected
002017 Female Terminal Sacrifice No abnormalities
Detected
002018 Female Terminal Sacrifice No abnormalities
Detected
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 671
4. CONCLUSION
In the control group, carrageenan induced
significant inflammation when compared with the animals
treated with the extracts. Standard drug, indomethacin at
10 mg/kg inhibited the inflammation significantly at all
time intervals. C. Repanda exhibited significant anti-
inflammatory activity in dose dependent manner. C.
Repanda inhibited the carrageenan induced inflammation
significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and
5 hours.
REFERENCES
Agarwal SS, Herbal Drug Technology, Universities Press,
India, 2007, 582.
Bhujbal SS, Chitlange SS, Suralkar AA, et al., Anti-
inflammatory activity of an isolated flavonoid fraction
from Celosia argentea Linn, Journal of Medicinal Plants
Research, 2(3), 2008, 52-54.
Brooks RR, Carpenter JF, Jones SM, Ziegler TC, Pong
SF, Canine carrageenin-induced acute paw inflammation
model and its response to nonsteroidal anti-inflammatory
drugs, Journal of Pharmacological Methods, 25, 1991,
275–283.
Dorni C, Vidyalakshmi KS, Vasanthi HR, Anti-
inflammatory activity of Plumbago capensis,
Pharmacognosy Magazine, 2(8), 2006, 239-243.
Eshrat MH, Effect of Coccinia indica (L) and Aroma
augusta (L) on glycemia, lipid profile and on indications
of end-organ damage in streptozotocin induced diabetic
rats, Indian Journal of Clinical Biochemistry, 18(2), 2003,
54-63.
Ghosh MN, Fundamental Experimental Pharmacology,
Calcutta, 1981, 145.
Gupta R, Bajpai KG, Johri S, Saxena AM, An overview of
Indian novel traditional medicinal plants with antidiabetic
potentials, The African Journal of Traditional, 5(1), 2008,
1-17.
Hoareau L, DaSilva EJ, Medicinal plants, a re-emerging
health aid, Electronic Journal of Biotechnology, 2(2),
1999, 56-70.
Kanwar P, Sharma N, Rekha A, Medicinal plants use in
traditional healthcare systems prevalent in western
Himalayas, Indian Journal of Traditional Knowledge,
5(3), 2006, 300-309.
Maduka IC, Neboh EE, Kwubiri UN, The prevalence of
diabetic nephropathy in diabetic patients, European
Journal of Scientific Research, 26(2), 2009, 255-259.
Mbanya JC, Ramiya K, Diabetes mellitus,
http://www.ncbi.nlm.nih.gov/bookshelf, Accessed, 2010.
Mohan V, Sandeep S, Deepa R, Epidemiology of type 2
diabetes, Indian Scenario, Indian Journal of Medical
Research, 125, 2007, 217-230.
Mujumdar AM, Naik DG, Dandge CN, et al., Anti-
inflammatory activity of Curcuma amada Roxb in Albino
rats, Indian Journal of Pharmacology, 32, 2000, 375-377.
Mukherjee PK, Quality control of herbal drugs,
Pharmaceutical Publishers, India, 2005, 554.
OECD/OCDE guideline for testing of chemicals, Revised
draft guidelines 423, Acute oral toxicity- acute toxic class
method, Revised document, 17th December 2001, 12.
Prempeh ABA, Attipoe JM, Analgesic activity of crude
aqueous extract of the root bark of Zanthoxylum
xanthoxyloides, Ghana Medical Journal, 42(2), 2008, 79-
84.
Turner AR, Screening Methods in Pharmacology,
Academic press, London, 1965, 152.
Winter CA, Risley EA, Nuss GW, Carrageenan -induced
oedema in hind paw of the rat as an assay for anti-
inflammatory drugs, Proc.Soc.Exp.Biol.Med., 111, 1962,
544-547.
Winter CA, Risley EA, Nuss GW, Antiinflammatory and
antipyretic activities of indomethacin, (1-
(pchlorobenzoyl)-5-methoxy-2-methyl-indole-3-acetic
acid, Journal of pharmacolological experimental
therapeutics, 141, 1963, 369-376.
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 672
IN-VIVO ANTI-INFLAMMATORY ACTIVITY OF METHANOLIC EXTRACT OF
CISSUS VITIGINEA Vijay Kumar S
1*, Satyanarayana T
2, Anjana Mathew
2, S.Chandrasekhar
3, Reddysekhar1
1.Sri Krishna Chaithanya college of pharmacy, Madanapalle, A.P
2. University College of pharmaceutical sciences, Andhra University, Visakhapatnam, A.P
3.Govt. Ayurvedic Dispensory,Nagenahalli,Karnataka
*Corresponding author: E mail: [email protected]
ABSTRACT
The present investigation deals with the in-vivo acute toxicity studies and in-vivo anti-inflammatory activity
by Carrageenan induced rat paw edema model of methanolic extract in the stems of Cissus Vitiginea. The
Literature review reveals the presence of steroids, flavonoids, triterpenoids, and glycosides in Cissus Vitiginea.
Some plants belonging to Cissus genus have been reported to possess anti-inflammatory activity hence
methanolic extract of stems of C. Vitiginea were screened for anti-inflammatory activity. Carrageenan induced
significant inflammation when compared with the animals treated with the extracts. Standard drug, indomethacin
at 10 mg/kg inhibited the inflammation significantly at all-time intervals. C.Vitiginea exhibited significant anti-
inflammatory activity in dose dependant manner. C.Vitiginea inhibited the carrageenan induced inflammation
significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and 5 hours.
KEY WORDS: Cissus Vitiginea, Carrageenan induced Paw edema, Anti-Inflammatory, Acute
1. INTRODUCTION
Plants have been used for medicinal purposes long
before recorded history in many countries such as India,
China and Africa. Since then, thousands of indigenous
plants have been used for the treatment of chronic
ailments. Many other herbs and minerals were later
described by ancient Indian herbalists such as Charaka and
Sushruta during the 1st millennium BC. The Sushruta
Samhita attributed to Sushruta in the 6th century BC
describes 700 medicinal plants (Agarwal, 2007). In 20th
century, as part of industrial revolution, the practice of
allopathic medicines gained popularity. Eventually, the
spirit of herbal medicine declined from conventional
medicinal use as safety and effectiveness of herbal
medicines were not scientifically corroborated and remain
largely unknown. Due to the fact that the safety of
medicine has always been around for us, it becomes a
common theme to rely on safe treatments. Usage of herbal
traditional medicine is rising steadily, because of lesser
side effects, affordability and in certain diseases where no
suitable allopathic medicines are available. Based on the
therapeutics significant of herbs and by proper monitoring
of quality, dosage of the drug by the ayurvedic physician
is essential. Recent advances in the methodologies used to
extract, purify and evaluate plant extracts for biological
activity have enable the miniaturization and automation of
extremely specific biochemical tests. As a result, in
number of patients a resurgence of interest on plants and
plant derived products as a source of medicine is
increasing. There is an urgent need to re-emphasize and
enhance research in natural products in many therapeutic
areas (Bhujbal, 2008). Inflammation term is derived from
Latin word inflammare, which means - to set on fire.
Inflammation refers to a vital response of a tissue against
injury elicited by physical trauma, noxious chemical or
microbiological agents. It is considered to be body’s
defensive reaction either to inactivate or destroy the
injurious foreign agent or organism. It is triggered by the
release of chemical mediators which includes amines such
as histamine, serotonin and lipids such as prostaglandins
and small peptides such as kinins from the injured tissues
and migrating cells. Mainly, inflammatory responses
occur in three distinct phases, each apparently mediated
by different mechanisms: Accordingly, pharmacological
methods for anti-inflammatory evaluation have been
developed by artificially inducing inflammation by using
phlogistic agent (irritants) such as: Brewer’s yeast,
formaldehyde, dextran, egg albumin, kaolin, aerosol,
sulfated polysaccharides like carrageenan. The effects can
be measured by several methods such as UV-erythema in
guinea pigs, Vascular permeability, Croton-oil ear edema
in rats and mice, Paw edema in rats and Granuloma pouch
technique (Brooks, 1991).
2. METHODOLOGY
2.1. Toxicity Studies on stems of methanolic extract of
C. Vitiginea in rats:
2.1.1 Acute toxicity study in rats with test drugs: The
animals were used with the approval of Institutional
Animal Ethics Committee (Reg .No. 627/02/A/CPCSEA).
Two groups, each of three female rats, were treated with
methanolic extract of stems of C. Vitiginea by oral
administration at a dosage of 2000 mg/kg body weight.
The test drugs were formulated in vehicle (distilled water)
at a concentration of 2000 mg/kg and administered at the
dose of 1ml/kg.
2.1.2 Treatment: The animals received a single dose of
the test item by oral administration at 2000 mg/kg body
weight for groups I and II, after being fasted for
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 673
approximately 18.0 hours but with free access to water.
Food was provided again at approximately 3.0 hours after
dosing for both the groups. The administration volume
was 10 ml/kg body weight. The animals were dosed using
18 G oral Stainless steel feeding tubes. The animals were
observed daily during the acclimatization period and
mortality/viability and clinical signs were recorded. All
animals were observed for clinical signs during first
30 minutes and at approximately 1, 2, 3 and 4 hours after
administration on test day 0 and once daily during test
days 1-14. Mortality/viability was recorded twice daily
during days 1-14 (at least once on day of sacrifice). Body
weights were recorded on test day 0 (prior to
administration), test days 7 and 14. All animals were
necrosed and examined macroscopically(Dorni,2006).
2.1.3 Necroscopy: All animals were sacrificed at the end
of the observation period by carbon dioxide in euthanasia
chamber and discarded after the gross/macroscopic
pathological changes were visually observed and
recorded. No organs or tissues were retained.
2.2 Screening for anti-inflammatory activities of
methanolic extract of stems of C. Vitiginea in rats:
2.2.1 Carrageenan induced rat paw edema model: The
model is based on the principle of release of various
inflammatory mediators by carrageenan. Edema formation
due to carrageenan in the rat paw is biphasic event. The
initial phase is attributed to the release of histamine and
serotonin. The second phase of edema is due to the release
of prostaglandins, protease and lysosome. Subcutaneous
injection of carrageenan into the rat paw produces
inflammation resulting from plasma extravasation,
increased tissue water and plasma protein exudation along
with neutrophil extravasation. All these events occur as a
result of metabolism of arachidonic acid.
The
pharmacological screening of the C. Vitiginea was carried
out using standard protocols1. The crude extract was
suspended in 1% carboxy methyl cellulose (CMC) for
administration to albino rats. Albino rats of 150-200 g
were used for present investigation and were used with the
approval of the Institutional Animal Ethics Committee
(Regd. No. 627/02/A/CPSCSEA). They were kept in
polypropylene cages in an air-conditioned area at 25 + 2oC
in 10-14 hours light dark cycle. They were provided with
Amruth brand balanced feed and tap water ad libitum
(Eshrat MH, 2003).
2.2.2 Experimental procedure: Seventy two rats were
divided into five groups (n=6) starved overnight with
water adlibitum prior to the day of experiment. The group
I kept as carrageenan control, groups II to IV received test
drugs at different doses and group V kept as standard drug
control, respectively. Left paw was marked with ink at the
level of lateral malleolus; basal paw volume was measured
plethysmographically by volume displacement method
using Plethysmometer (UGO Basile 7140) by immersing
the paw till the level of lateral malleolus. In the
experiment, animals from the control group were given
vehicle control, Carboxy Methy Cellulose (CMC) and
animals from standard drug were treated with
Indomethacin 10 mg/kg b.w orally as given in table 2.
Other groups were treated with different doses of test
drugs orally as given in table 2. After 30 min. of drug
treatment the rats are charged by a subcutaneous injection
of 0.1ml of 1% solution of carrageenan into the sub-
plantar side of the left hind paw (Gupta R, Bajpai KG,
2008). The paw volume is measured again at 1, 2, 3, 4 and
5 hours after charging. The increase in paw volume is
calculated as percentage compared with the basal volume.
The difference of average values between treated animals
and control group is calculated for each time interval and
evaluated statistically. The percent increase in paw
volume was calculated using formula as follows.
% increase in paw volume = 100)(
XV
VV
c
ct
Where Vt = paw volume at a time t, Vc = paw volume at a
time 0
3. RESULTS
All animals survived in group I and group II until
the end of the experimental period. All the animals dosed
at 2000 mg/kg body weight did not show evident toxicity
throughout the experimental period. The animals showed
increase in their body weight by day 14 as compared to
day 0. No abnormalities were detected for all the animals
at necropsy. Based on the results, the median lethal doses
(LD50) of, C. Vitiginea was greater than 2000 mg/kg b.w
and were classified as category 4 (it indicates that no death
was observed at 2000mg/kg b.w.) as per OECD
guidelines (Hoareau and DaSilva,1999).
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 674
Table.1 Body weight analysis of test drug treated rats Test drug Group Dose(mg/kg
bodyweight) Animal
Numbers
Sex Test day 0
(treatment)(g)
Testday7
(g)
Testday14
(g)
C.
Vitiginea I
2000
002001 Female 220.23 241.22 252.38
002002 Female 221.24 241.89 252.13
002003 Female 202.28 240.92 251.68
II
2000
002004 Female 222.41 243.11 263.61
002005 Female 223.12 243.68 253.84
002006 Female 222.51 243.00 253.38
mg/kg = miligram/kilogram, g = gram
Table.2 Macroscopic findings of animals from test drug treated groups Test drug Group Dose
(mg/kgbw)
Animal
Numbers
Sex Mode of death Macroscopic findings
C.
Vitiginea I 2000 002001 Female Terminal Sacrifice No abnormalities Detected
002002 Female Terminal Sacrifice No abnormalities Detected
002003 Female Terminal Sacrifice No abnormalities Detected
II 2000 002004 Female Terminal Sacrifice No abnormalities Detected
002005 Female Terminal Sacrifice No abnormalities Detected
002006 Female Terminal Sacrifice No abnormalities Detected
bw = body weight,T.S.= Terminal Sacrifice, N.A.D.= No abnormalities Detected
Table 3: Showing percentage of inflammation indicating Anti-inflammatory activity of test drugs on
carrageenan induced rat paw oedema Groups Drug Doses Percentage of inflammation at time (hours)
1 2 3 4 5
I Carrageenan Control 38.83±1.03 81.83±1.16 113.3±2.39 131.0±4.98 146.72±5.46
II C.Vitiginea, 250mg/kg 37.18 ±1.15 80.10 ±1.03 109.83 ±3.23 130.60 ±3.74 143.68 ± 4.62
III C.Vitiginea,500mg/kg 36.00 ±3.36 78.63 ±3.15 108.58 ±1.71 127.00 ±2.18 139.87 ± 5.20
IV C.Vitiginea,1000mg/kg 37.88 ±2.74 77.42 ±3.39 * 101.87 ±3.14 *** 128.75 ±2.63 126.74 ± 5.84 *** V Indomethacin,10 mg/kg 12.55±0.86*** 19.1±0.48 *** 27.17±1.07*** 32.65±1.52*** 30.15±2.50 ***
Figure.1. Percentage of inflammation indicating Anti-inflammatory activity of C. Vitiginea in carrageenan induced
rat paw oedema
4. CONCLUSION
In the control group, carrageenan induced
significant inflammation when compared with the animals
treated with the extracts. Standard drug, indomethacin at
10 mg/kg inhibited the inflammation significantly at all
time intervals. C. Vitiginea exhibited significant anti-
inflammatory activity in dose dependent manner. C.
Vitiginea inhibited the carrageenan induced inflammation
significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and
5 hours.
Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 675
REFERENCES
Agarwal SS, Herbal Drug Technology, Universities Press,
India, 2007, 582.
Bhujbal SS, Chitlange SS, Suralkar AA, et al., Anti-
inflammatory activity of an isolated flavonoid fraction
from Celosia argentea Linn, Journal of Medicinal Plants
Research, 2(3), 2008, 52-54.
Brooks RR, Carpenter JF, Jones SM, Ziegler TC, Pong
SF, Canine carrageenin-induced acute paw inflammation
model and its response to nonsteroidal anti-inflammatory
drugs, Journal of Pharmacological Methods, 25, 1991,
275–283.
Dorni C, Vidyalakshmi KS, Vasanthi HR, et al., Anti-
inflammatory activity of Plumbago capensis,
Pharmacognosy Magazine, 2(8), 2006, 239-243.
Eshrat MH, Effect of Coccinia indica (L) and Aroma
augusta (L) on glycemia, lipid profile and on indications
of end-organ damage in streptozotocin induced diabetic
rats, Indian Journal of Clinical Biochemistry, 18(2), 2003,
54-63.
Ghosh MN, Fundamental Experimental Pharmacology,
Calcutta, 1981, 145.
Gupta R, Bajpai KG, Johri S, Saxena AM, An overview of
Indian novel traditional medicinal plants with antidiabetic
potentials, The African Journal of Traditional, 5(1), 2008,
1-17.
Hoareau L, DaSilva EJ, Medicinal plants, a re-emerging
health aid, Electronic Journal of Biotechnology, 2(2),
1999, 56-70.
Kanwar P, Sharma N, Rekha A, Medicinal plants use in
traditional healthcare systems prevalent in western
Himalayas, Indian Journal of Traditional Knowledge,
5(3), 2006, 300-309.
Maduka IC, Neboh EE, Kwubiri UN, The prevalence of
diabetic nephropathy in diabetic patients, European
Journal of Scientific Research, 26(2), 2009, 255-259.
Mbanya JC, Ramiya K, Diabetes mellitus,
http://www.ncbi.nlm.nih.gov/bookshelf, Accessed, 2010.
Mohan V, Sandeep S, Deepa R, et al., Epidemiology of
type 2 diabetes, Indian Scenario, Indian Journal of
Medical Research, 125, 2007, 217-230.
Mujumdar AM, Naik DG, Dandge CN, et al., Anti-
inflammatory activity of Curcuma amada Roxb in Albino
rats, Indian Journal of Pharmacology, 32, 2000, 375-377.
Mukherjee PK, Quality control of herbal drugs,
Pharmaceutical Publishers, India, 2005, 554.
OECD/OCDE guideline for testing of chemicals, Revised
draft guidelines 423, Acute oral toxicity- acute toxic class
method, Revised document, 17th December 2001, 12.
Prempeh ABA, Attipoe JM, Analgesic activity of crude
aqueous extract of the root bark of Zanthoxylum
xanthoxyloides, Ghana Medical Journal, 42(2), 2008, 79-
84.
Turner AR, Screening Methods in Pharmacology,
Academic press, London, 1965, 152.
Winter CA, Risley EA, Nuss GW, Carrageenan -induced
oedema in hind paw of the rat as an assay for anti-
inflammatory drugs, Proc.Soc.Exp.Biol.Med., 111, 1962,
544-547.
Winter CA, Risley EA, Nuss GW, Antiinflammatory and
antipyretic activities of indomethacin, (1-
(pchlorobenzoyl)-5-methoxy-2-methyl-indole-3-acetic
acid, Journal Of Pharmacolological Experimental
Therapeutics, 141, 1963, 369-376.
Indumathi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 676
FORMULATION AND EVALUATION OF BILAYER TABLET OF CONVENTIONAL
RELEASE PARACETAMOL AND MODIFIED RELEASE DICLOFENAC SODIUM Indhumathi D*, Mastan Vali Sheik, Priyadharshini N, Damodharan N
SRM College of Pharmacy, SRM University, Kattankulathur, Kanchipuram, Tamil Nadu, India
*Corresponding author: Email: [email protected]
ABSTRACT
The present study deals with formulation and evaluation of bilayer tablet of paracetamol and diclofenac
sodium to provide control over release of drug and to maintain the drug concentration. The major ingredients are
paracetamol granules and diclofenac sodium granules and were prepared separately by wet granulation method.
Paracetamol, PEG6000 and intragranular fraction granules were cooled and blended with microcrystalline
cellulose, croscarmellose, Cab-O-Sil and magnesium stearate and mixture of diclofenac sodium and HPMC K4M
were granulated using water and isopropyl alcohol. The wet mass is passed through a 20# sieve and dried. The
granules of optimized batch of paracetamol and diclofenac sodium were compressed to obtain bi-layer tablet. The
tablets were evaluated for percentage friability, crushing strength and in-vitro drug release. Totally 9 formulations
for paracetamol and 6 formulations of diclofenac were prepared and studied for their various precompression and
postcompression parameters. The formulation F9 for paracetamol showed in-vitro drug release of 93.09% and
exhibited satisfactory results in all parameters and subjected to stability studies. And the formulation F6 showed
in-vitro drug release of 71.68% and exhibited satisfactory results and was subjected to stability studies. Thus
formulation F9 for paracetamol and F6 for Diclofenac was found to be successful as immediate release and
extended release bi-layer tablet and can be manufactured with reproducible characteristics from batch to batch.
Key words: Bilayer tablet, Paracetamol, Diclofenac sodium
INTRODUCTION
The conventional dosage forms provide no control
over release of drug. To maintain the drug concentration
within the therapeutically effective range, it is necessary
to take it several times a day which results in significant
fluctuation in drug levels. The sustain release of drug, in a
general way is to modify the normal behaviour of drug
molecule in a physiological environment. The present
study deals with formulation and evaluation of bilayer
tablet of Paracetamol and Diclofenac sodium to provide
control over release of drug and to maintain the drug
concentration.
MATERIALS AND METHODS
Preparation of Microcrystalline cellulose granules:
Microcrystalline cellulose was granulated using 5% w/v
aqueous PVP K30 solution. The wet mass was passed
through a 20# sieve to obtain granules and dried at 60oC in
a tray drier. The 20/40 mesh cut granules were used for
preparing paracetamol tablets.
Preparation of Paracetamol tablets: Paracetamol,
PEG6000 and intragranular fraction granules were cooled
and blended with microcrystalline cellulose,
croscarmellose, Cab-O-Sil and magnesium stearate. The
tablets were prepared on a single station tablet press and
evaluated for percentage friability, crushing strength and
disintegration time.
Preparation of Diclofenac sodium tablets: Mixture of
diclofenac sodium and HPMC K4M were granulated
using water (1part) and isopropyl alcohol (9parts). The
wet mass passed through a 20# sieve and dried at 55oC for
15 min in tray drier. Cab-O-Sil and magnesium stearate,
each at 0.5% w/w were mixed with the granules. The
tablet were prepared on single station tablet press and
evaluated for percentage friability, crushing strength and
in vitro drug release.
Preparation of Bi-Layer tablet: The granules of
optimized batch of Paracetamol were added in the die
cavity of single punch tablet machine. The granules of
optimized batch of Diclofenac sodium were added over
the granules of paracetamol. The granules were
compressed to obtain bi-layer tablet. The tablets were
evaluated for percentage friability, crushing strength and
in vitro drug release.
RESULTS AND DISCUSSION
Nine formulations were prepared for Paracetamol
and similarly 6 formulations were made for diclofenac
sodium and their precompression and postcompression
parameters were studied. The formulation F9 for
paracetamol showed in-vitro drug release of 93.09% and
exhibited satisfactory results in all parameters and
subjected to stability studies. And the formulation F6
showed in-vitro drug release of 71.68% and exhibited
satisfactory results and was subjected to stability studies.
Indumathi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 677
0
20
40
60
80
100
0 10 20 30 40 50
Percentage drug release of paracetamol bilayer tablets with respect to time in min
Table.1.Formulation table for Paracetamol Ingrediants (mg)
Quantities(mg/tab)
F1 F2 F3 F4 F5 F6 F7 F8 F9
Paracetamol 500 500 500 500 500 500 500 500 500
PEG 6000 30.00 20.00 - - - - - - -
Water q.s q.s q.s q.s q.s q.s q.s q.s q.s
MCC PH 101 60.00 60.00 80.00 40.00 40.00 55.00 50.00 56.56 58.40
Magnesium stearate 1.00 1.00 1.00 1.00 1.50 1.50 1.00 1.50 1.00
Gelatin - 10.00 - - - - - - -
Talc 2.00 2.00 2.00 2.00 2.00 2.00 - - -
Aerosol 1.00 1.00 1.00 1.00 1.00 1.00 - - -
Lactose 20.00 - 30.00 30.00 20.00 18.00 20.00 16.00 16.00
Hydroxylpropyl cellulose
LF
- - - 2.00 1.50 1.50 1.80 1.60 1.20
Calcium carbonate - - - 40.00 36.00 40.00 38.00 24.00
MCC PH 102 - - - 10.00 10.00 10.00 10.00 10.00 10.00
Croscarmellose sodium - - - 25.00 - 12.00 16.00 7.00 4.50
Croscarmellose sodim - 16.00 - - - - - 6.5 9.10
Total weight (mg/tab) 614.0 604.0 614.0 611.0 617.0 637.0 641.0 640.0 635.0
Table.2.Formulation table for Diclofenac Sodium Ingrediants(mg/tab) F1 F2 F3 F4 F5 F6
Diclofenac sodium 100.00 100.00 100.00 100.00 100.00 100.00
HPMC K 100 90.00 110.00 120.00 130.00 140.00 150.00
PVP K 90 87.00 30.00 18.60 25.00 23.80 22.50
IPA q.s q.s q.s q.s q.s q.s
Stearic acid 36.68 40.95 46.40 35.20 21.40 11.50
Total weight (mg/tab) 313.0 313.68 315.0 325.0 320.0 320.0
Table.3.Evaluation parameters for Paracetamol and Diclofenac sodium Bilayer tablet Parameters T1 T2 T3 T4 T5 Average
Hardness (kg/ ) 9.38 9.20 9.28 9.10 9.39 9.26
Thickness(mm) 7.32 7.44 7.35 7.40 7.39 7.38
Friability(%) 0.09 0.11 0.14 0.10 0.15 0.12
Disintegration time(sec) Paracetamol 373 382 375 379 371 376
Drug content (%) of Paracetamol 105.71 111.70 - - - 108.70
Drug content(%) of Diclofenac sodium 101.38 102.16 - - - 101.77
In-vitro Dissolution (%) Paracetamol 93.09 - - - 93.09
In-vitro dissolution (%) Diclofenac sodium 71.68 - - - 71.68
Fig 1: Percentage drug release of Diclofenac sodium
bilayer tablets with respect to time in min
Fig 2: Percentage drug release of Paracetamol bilayer
tablets with respect to time in min
0
20
40
60
80
0 200 400 600 800
Percentage drug release of diclofenac sodium bilayer tablets with respect to time in min
Indumathi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 678
CONCLUSION
From this study, it may be concluded that the
formulation F9 for Paracetamol and F6 for Diclofenac
sodium was found to be successful as immediate release
and extended release bi-layer tablet and can be
manufactured with reproducible characteristics from batch
to batch.
REFERENCES Collins SL., Moore RA., McQuay HJ., Wiffen PJ.,
Edwards JE, Single dose oral ibuprofen and diclofenac for
postoperative pain, Cochrane Systematic Rev, 3, 1998, 3,
1-10.
Davie IT, Gordon NH, Comparative assessment of
fenoprofen and paracetamol given in combination for pain
after surgery, Br J anaesth, 50, 1978, 931-5.
Davie IT., Gordon NH, Comparitive assessment of
fenoprofen and paracetamol, Br J Anaesth, 50, 1978, 931-
5.
Montgomery JE, Sutherland CJ, Kestin IG, Sneyd JH,
morphine consumption in patients receiving rectal
paracetamol and diclofenac alone and in combination. BJ
Anaesth, 77, 1996, 445-7.
Parkhouse J., Hallinon P. A comparison of aspirin and
paracetamol, Br J Anaesth, 39, 1967, 146-54.
Shah HJ., Rathod IS.,Shah SA.,Savale SS., Shishoo CJ,
Sensitive HPTLC method for monitoring dissolution
profiles of diclofenac sodium from different tablets
containing combined diclofenac and acetaminophen, J
Planar chromatogr, 16, 2003, 36-44.
Ward B, Alexander-Williams JM, Paracetamol revisted: a
review of the pharmacokinetics and pharmacodynamics,
Acute Pain, 12, 1999, 139-149.
Wiebalck CA, Van Aken H, Paracetamol and
propacetamol for post-operative pain: contrasts to
traditional Nsaids, Bailliere’s Clin Anaesthesiol, 1995, 9,
469-482.
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 679
DEVELOPMENT AND VALIDATION OF ASSAY METHOD FOR MELOXICAM
TABLETS BY RP-HPLC K. Ranjith1, M.V.Basaveswara Rao2, T.E.G.K.Murthy3
1 &3.Department of Pharmaceutical Analysis, Bapatla College of Pharmacy, Bapatla, Guntur, Andhra Pradesh, India.
2. Department of Chemistry and Pharmacy, Krishna University, Machilipatnam, Krishna, Andhrapradesh, India.
*Corresponding author: E.Mail: [email protected]
ABSTRACT
A simple, precise, accurate and economical RP-HPLC method has been developed and validated
for the assay of Meloxicam tablets. The method was developed using pH 7.0 Phosphate buffer: Acetonitrile (40:60
v/v) in isocratic mode and Waters Xterra C 18 (150 X 4.6mm), 5µ column. Flow rate and detection wavelengths
were fixed at 0.8 ml/min and 344 nm. Retention time for Meloxicam was found to be 2.448 minutes. Method
was validated as per ICH guidelines to test its suitability for intended purpose. Linearity range for Meloxicam
was set at 10-75 µg/ml with correlation coefficient 0.999. Accuracy values for method were found to be 99.53-
99.66%. Method found to be robust against changes in flow rate, organic composition, pH of mobile phase and
detection wavelength. The proposed method is suitable for quality control analysis of Meloxicam tablets.
Key words: Meloxicam, RP-HPLC, Method development and Validation.
INTRODUCTION
Meloxicam is a potent non-steroidal anti-
inflammatory drug of the enolic acid class of oxicam
derivatives. Chemically it is 4-hydroxy-2-methyl-N-(5-
methyl-2-thiazolyl)-2H-1, 2-benzo-thiazine-3-
carboxamide-1, 1-dioxide (C14H13N3O4S2).It is more
effective at low doses with a good gastrointestinal
tolerability. Literature survey reveals the availability of
various analytical methods for quantitation of meloxicam
present in different matrices i.e. biological and tablet, by
employing different techniques like UV-Visible
Spectrophotometry, Fluorimetry, RP-HPLC, LC-MS, LC-
MS/MS and Capillary Zone Electrophoresis. Many of
reported methods employed internal standard for the
estimation of meloxicam present in matrix, which turned
the analytical procedure tedious. Some RP-HPLC methods
are not economical in terms of mobile phase composition,
column dimensions and run times. Hence there is need for
the development of newer analytical method to overcome
above discussed hurdles for the estimation of meloxicam
present in tablets. Aim of the present study is to develop a
simple, precise and accurate method for the estimation of
meloxicam in formulations by RP-HPLC.
MATERIALS AND METHODS
Chemicals and Solvents: Meloxicam working reference
standard (Potency-99.95 %w/w on as is basis) was
obtained from Dr.Reddy’s Laboratories Ltd., Hyderabad.
HPLC grade- Acetonitrile and Water were procured from
E.Merck (India) Ltd., Mumbai, India. Orth AR grade –
Potassium dihydrogen orthophosphate and Triethylamine
were obtained from E.Merck (India)Ltd., Mumbai, India.
Muvera 7.5 manufactured by Sun Pharma Limited,Sikkim
were procured from local pharmacy.
Preparation of Phosphate Buffer:
21.10 gm of Potassium dihydrogen orthophosphate was
weighed and dissolved in 3000 mL of water (HPLC
grade). pH was adjusted to 7.01 with triethylamine and
sonicated for 10 min. Filtered through 0.45 µ Millipore
Nylon filter.
Preparation of Mobile Phase: A mixture of pH 7.01
phosphate buffer 2400 mL (40%) and acetonitrile 3600
mL (60%) were mixed well, degassed in a sonicator for
about 10 minutes and filtered through 0.45 µ Millipore
Nylon filter.
Diluent: Mobile phase was used as diluent
Chromatographic Conditions: Assay of Meloxicam
tablets was carried out on a Waters HPLC system
equipped with Aliance 2695 binary pump, a 100 µL
injection loop, auto sampler and a 2487 dual wavelength
UV detector and running on Waters Empower software.
The chromatographic conditions are as follows, Column:
Waters Xterra C18 (150 x 4.6mm), 5µ; Flow rate: 0.8
ml/min; Detection wavelength: 344 nm; Injection volume:
20 µl; Runtime: 6 minutes; Column temperature: Ambient
and Sample cooler temperature: 20°C
Preparation of Standard Stock Solution for Assay:
Accurately 50.07 mg of Meloxicam working reference
standard was weighed and transferred into a 50 mL clean
dry volumetric flask. 10 mL of diluent was added and
sonicated for 10 min for complete dissolution of the drug.
Finally the volume was made up to the mark with the
diluent.
Preparation of Standard Solution for Assay: 3 mL of
standard stock solution was pipetted into a 100 mL
volumetric flask and diluted up to the mark with diluent.
Filtered through 0.45µ Millipore Nylon filter.
Preparation of Sample Stock Solution for Assay: 20
tablets were weighed and the average weight was
determined. Tablets were crushed into fine powder.
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 680
Accurately weighed and transferred 1001.1 gm of powder
equivalent to 50 mg of meloxicam into 50 mL volumetric
flask, 20 mL of diluent was added and sonicated for 20
minutes with intermittent shaking. Volume was made up
to the mark with the diluent. Mixed well and centrifuged
at 5000 RPM for 8 minutes.
Preparation of Sample Solution for Assay: 3 mL of
supernatant sample stock solution was pipetted into a 100
mL volumetric flask and diluted up to the mark with
diluent. Filtered through 0.45µ Millipore Nylon filter.
System Suitability Criteria:
1. %RSD for the peak areas of responses of three replicate
injections of the standard solution is not more than 2.0%.
2. The number of theoretical plates (N) for meloxicam
should be NLT 2000.
3. The tailing factor (T) for meloxicam should be NMT
2.0
Method Validation: The proposed method for assay was
subjected to validation as per ICH guidelines to test its
suitability for intended purpose.
Specificity was demonstrated by comparing blank,
standard and sample chromatograms. Linearity was
demonstrated from 33-250% of sample concentration.
System precision was demonstrated by injecting six
replicate injections of standard solution. Method precision
for assay was demonstrated by injecting a set of of six
separate assay samples in to chromatographic system.
Ruggedness for assay was demonstrated by injecting a set
of six separate assay samples in to chromatographic
system on different day. Accuracy was performed by
standard addition method,spiking 50% to 150%of
standard into 100% sample .Robustness was evaluated by
changing ± 10% flow rate, ± 0.2 units of buffer, ± 5 nm
variation in detection wavelength and ± 2% absolute in
organic content of mobile phase.
RESULTS AND DISCUSSION
In proposed method retention time of Meloxicam
was found to be 2.448 minutes. USP Plate Count for
Meloxicam 2552 indicated suitability of column. Linearity
was demonstrated for Meloxicam from 33 to 250% of test
concentration with correlation coefficient 0.999.All types of
precisions showed %RSD 0.2-0.35 indicated method was
precise. Accuracy values 99.53-99.66 for Meloxicam
indicated high recovery of analyte from its matrix. LOD and
LOQ values obtained were 0.06µg/ml and 0.135µg/ml for
Meloxicam. Calculated LOQ values allowed confidant
determination of analyte by proposed method. System
suitability was passed against changes in flow rate, pH of
buffer, detection wavelength and organic content, indicated
high robustness of proposed methods.
Figure.1.Molecular structure of Meloxicam Figure.2.retention time of Meloxicam
Table.1.System suitability evaluation for assay
Retention Time Name of the Peak Area USP Plate count USP Tailing
2.067 Meloxicam 182287 2552 1.6
Table.2.Linearity of Meloxicam for assay
Level Concentration Retention time (min) Peak Area
I 10 µg/mL 2.453 634405
II 20 µg/mL 2.452 1294705
III 30 µg/mL 2.448 1856592
IV 40 µg/mL 2.443 2479121
V 50 µg/mL 2.448 2962653
VI 60 µg/mL 2.452 3365663
VII 75 µg/mL 2.457 4825300
Slope 59179
Intercept 21703
Correlation Coefficient 0.999
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 681
CONCLUSION
A simple, precise, accurate and economical RP-HPLC
method was developed and validated for the assay of
meloxicam in tablet formulations. The proposed method
showed high recoveries with good linearity and precision.
It can be concluded that the proposed method is a good
approach for obtaining reliable results and found to be
suitable for the routine analysis of meloxicam
formulations in quality control.
REFERENCES
Ekram M.Hassan, Journal of Pharmaceutical and
Biomedical Analysis, 27, 2002, 771-777.
Emirhan Nemutlu, Sedef Kir, Journal of pharmaceutical
and Biomedical Analysis, 31, 2003, 393-400.
Farzana S Bandarkar, Pradeep R Vavia, Tropical Journal
Pharmaceutical Research, 3, 2009, 254-264
Gunter Trummlitz, Peter Luger, Klaus Daneck, Wolfhard
Engel , Klaus Wagner, European Journal of
Pharmaceutical Sciences, 4, 1996, 175-187.
J. Joseph-Charles and M. Bertucat, Analytical letters, 32
(10), 1999, 2051-2059.
Mrunalini C. Damle, Purushotam K. Sinha, Rajesh M.
Jeswani, Kirti S. Topagi, International Journal of
PharmTech Research, 1(4), 2009, 1051-1060.
Najma Sultana, M.Saeed. Arayne, F.A. Siddiqui, Pakistan
Journal of Pharmaceutical Science, 18(4), 2005, 58-62.
S.M. El-Moghazy Aly, N.H. Zawilla, M. Abdul-Azim
Mohammad, N.M. El Kousy, Journal of Pharmaceutical
and Biomedical Analysis, 32, 2003, 1135-1144.
Teodoro.S. Kauffman S.E. Vignaduzzo, P.M. Castellano,
Journal of Pharmaceutical and Biomedical Analysis, 46,
2008, 219-225.
United States Pharmacopeia 34, National Formulary 29,
2010, 3407-3408.
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 682
RP-HPLC DEVELOPMENT AND VALIDATION OF ASSAY AND UNIFORMITY OF
DOSAGE UNITS BY CONTENT UNIFORMITY FOR IN HOUSE LAMIVUDINE AND
ABACAVIR COMBINED TABLET K. Ranjith1, M.V.Basaveswara Rao2, T.E.G.K.Murthy3
1 &3.Department of Pharmaceutical Analysis, Bapatla College of Pharmacy, Bapatla, Guntur, Andhra Pradesh, India.
2. Department of Chemistry and Pharmacy, Krishna University, Machilipatnam, Krishna, Andhrapradesh, India.
*Corresponding author: E.Mail: [email protected]
ABSTRACT
A precise, accurate, h ighly sens i t ive , rugged and robust HPLC method has been developed and
validated for the assay and content uniformity of Lamivudine and Abacavir in combined tablets. The method was
developed using pH 3.0 Phosphate buffer: Methanol (80:20 v/v) in isocratic mode and Waters Symmetry C 18 (100 X
4.6mm), 3.5µ column. Flow rate and detection wavelengths were fixed at 0.5 ml/min and 276 nm. Retention times for
Lamivudine and Abacavir were found to be 2.122 and 3.194 minutes respectively. Both methods were validated as per
ICH guidelines to test their suitability for intended purpose. Linearity ranges for Lamivudine and Abacavir were set at
50-150 µg/ml with correlation coefficient 1.000 and 100-300 µg/ml with correlation coefficient 1.000. Accuracy values
for both methods were found to be found to be 100.09-100.14% for Lamivudine and 99.99-100.11 for Abacavir.
Methods found to be robust against changes in flow rate, organic composition, pH of mobile phase and detection
wavelength. The proposed method is suitable for quality control analysis of in house Lamivudine and Abacavir
combined tablets.
Key words: Lamivudine, Abacavir sulphate, RP-HPLC, Method development and Validation.
INTRODUCTION
Lamivudine is a 4-amino-1-((2R,5S)-2-(hydroxyl
methyl)-1,3-oxathiolan-5-yl)pyrimidin-2(1H)-one.
Lamivudine is a synthetic nucleoside analogue with potent
activity against HIV virus (Type-I) and hepatitis-B.
Abacavir sulphate is [(1S,4R)-4-[2-amino-6-
(cyclopropylamino)-9H-purin-9-yl]cyclopent-2-en-1-
yl]methanol sulphate. Abacavir is a carbocyclic synthetic
nucleoside analogue with activity against HIV virus (type-
I). These both drugs act by inhibiting reverse transcriptase
enzyme. In the recent past Lamivudine and Abacavir
combined formulations are designed as they exhibit
synergistic effect in activity against HIV-virus.
UV, RP-HPLC and HPTLC methods were
reported for individual assay of Lamivudine and Abacavir
in bulk and formulations. Analytical methods such as UV
and HPTLC were available for the estimation of
Lamivudine and Abacavir combination. Few RP-HPLC
methods were only reported for assay of combined tablets
of Lamivudine and Abacavir and only one method was
reported for content uniformity. Methods already available
were not efficient to perform assay and content uniformity
of in house tablets due to changes in grade of bulk drug
and excipients. In the present study authors report a
precise, accurate, highly sensitive, rugged and robust RP-
HPLC method for assay and content uniformity of in
house Lamivudine and Abacavir combined tablets.
MATERIALS AND METHODS
Chemicals and Solvents: Lamivudine working reference
standard (Potency-99.91%w/w on as is basis) and
Abacavir sulphate working reference standard (Potency-
99.89 on as is basis) were obtained from Aurobindo
Pharma Limited., Hyderabad. HPLC grade Methanol and
Water were procured from E.Merck (India) Ltd., Mumbai,
India. Potassium dihydrogen phosphate AR grade,
Orthophosphoric acid AR grade and Triethylamine AR
grade were obtained from E.Merck (India)Ltd., Mumbai,
India.
Preparation of Phosphate Buffer: 2.72 g of Potassium
dihydrogen phosphate dihydrate was transferred in to
1000 ml of water. Mixed well and sonicated to dissolve.
pH was adjusted to 3.0 with Orthophosphoric acid and
filtered through 0.45µ Millipore Nylon filter.
Preparation of Mobile Phase: Phosphate buffer pH 3.0
and Methanol -80:20 v/v were mixed to prepare mobile
phase.
Diluent: Mobile phase was used as diluent
Chromatographic Conditions: Assay and Content
uniformity of tablets were carried out on a Waters
HPLC system equipped with a reverse phase Waters
Symmetry C18 (100 x 4.6 mm I.D., 3.5 µm particle
size), Aliance 2695 binary pump, a 100 µL injection
loop, auto sampler and a 2487 dual wavelength UV
detector and running on Waters Empower software. The
chromatographic conditions are as follows, Column:
Waters Symmetry C18 (100 x 4.6mm), 3.5µ; Flow rate:
0.5 ml/min; Detection wavelength: 276 nm; Injection
volume: 5 µl; Runtime: 9 minutes; Column temperature:
Ambient; Sample cooler temperature: 20°C
Preparation of Standard Stock Solution for Assay and
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 683
Content Uniformity: 25.08 mg of Lamivudine standard
and 58.71 mg of Abacavir sufphate standard were
weighed accurately and transferred in to dried 25 ml
volumetric flask.10 ml of diluent was added and sonicated
to dissolve components. Cooled and made up to the
volume with diluent.
Preparation of Standard Solution for Assay and
Content Uniformity: 5 ml of standard stock solution was
diluted to 50 ml with diluent to get 0.1 mg/ml of
Lamivudine and 0.2 mg/ml of Abacavir.
Preparation of Sample Stock Solution for Assay:
Twenty tablets were weighed accurately to determine
average weight of tablet.446.66 mg of powder equivalent
to 100 mg of Lamivudine was transferred in to dried 100
ml volumetric flask.25 ml of diluent was added and
sonicated for 25 minutes with intermittent shaking. Cooled
and made up to the volume with diluent. Solution was
centrifuged at 8000 RPM for 8 min.
Preparation of Sample Solution for Assay: 5 ml of
supernatant solution was transferred in to 50 ml
volumetric flask, made up to the volume with diluent and
filtered through 0.45µ Millipore Nylon filter.
Preparation of Sample Stock Solution for Content
Uniformity: Ten tablets were taken and weighed
individually. Each tablet was transferred in to separate 500
ml flask. 50 ml of diluent was added to each flask to
disperse the tablet.200 ml of diluent was added to each
flask and sonicated for 30 minutes with intermittent
shaking. The solution was centrifuged at 8000 RPM for 8
min.
Preparation of Sample Solution for Content
Uniformity: 4 ml of supernatant solution was transferred
in to 25 ml volumetric flask, diluted to volume with
diluent and filtered through 0.45µ Millipore Nylon filter.
System Suitability Criteria:
1. Tailing factor for any peak from standard injection
should be not more than 2.0.
2. USP plate count (N) should be not less than 2000 for
Lamivudine and 4000 for Abacavir.
3. USP resolution should not be less than 2.0
4. %RSD of areas of the five standard injections should be
not more than 2.0.
Method Validation: The proposed methods for assay and
content uniformity were subjected to validation as per ICH
guidelines to test its suitability for intended purpose.
Specificity was demonstrated by comparing blank,
standard and sample chromatograms. Linearity was
demonstrated from 50-150% of sample concentration.
System precision was demonstrated by injecting six
replicate injections of standard solution. Method precision
for assay and content uniformity were demonstrated by
injecting a set of of six separate assay samples and a set of
six separate content uniformity samples in to
chromatographic system. Ruggedness for assay and
content uniformity were demonstrated by injecting a set of
six separate assay samples and a set of six separate content
uniformity samples in to chromatographic system on
different day. Accuracy was performed by spiking active
pharmaceutical ingredient in to placebo from 50% to
150%.Robustness was evaluated by changing ± 10% flow
rate, ± 0.2 units of buffer, ± 5 nm variation in detection
wavelength and ± 2% absolute in organic content of
mobile phase.
N
N
S
O
NH2
O
Lamivudine
N
N N
N
HN
H2N
CH2OH
H2SO4
2
.
OH
Abacavir sulphate
Figure.1.Molecular structure of Lamivudine and Abacavir sulphate
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 684
Figure.2.Retention time of Lamivudine and Abacavir sulphate
Table.1. System suitability evaluation for assay and content uniformity Retention Time Name of the Peak Area USP Resolution USP Plate count USP Tailing
2.067 Lamivudine 2238019 3952 1.12
3.293 Abacavir 4834253 4.12 6124 1.32
Table.2.Standard areas for standard of assay and content uniformity Injection Retention Time Peak Area
Lamivudine Abacavir Lamivudine Abacavir
1 2.126 3.105 2238019 4835162
2 2.134 3.183 2237664 4826278
3 2.112 3.145 2235649 4834896
4 2.246 3.128 2245672 4836045
5 2.121 3.152 2242416 4835074
Mean 2239884 4833491
SD 4069.82 4056.55
%RSD 0.2 0.1
Table.3.Linearity of Lamivudine and Abacavir for assay and content uniformity Linearity of Lamivudine Linearity of Abacavir
Concentration Area S.No Concentration Area
50 1115389 1 100 2426458
75 1689123 2 150 3621546
100 2238694 3 200 4836218
125 2808246 4 250 6054321
150 3346745 5 300 7245698
Correlation coefficient 1.000 Correlation coefficient 1.000
Slope 22389 Slope 24180
Intercept 2466.21 Intercept 2980.79
R2 1.000 R
2 1.000
Linearity of Abacaviry = 24180x +2980.79
R² = 1
0
1000000
2000000
3000000
4000000
5000000
6000000
7000000
8000000
0 100 200 300 400
Concentration (µg/ml)
Pe
ak A
rea
Figure.2.Linearity of Lamivudine and Abacavir sulphate
Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 685
Table.4. Precision of Lamivudine and Abacavir sulphate Name of Precision %RSD
Lamivudine Abacavir
System precision for assay and content uniformity 0.1 0.1
Method precision Assay 0.1 0.2
Content uniformity 0.1 0.1
Intermediate precision Assay 0.2 0.2
Content uniformity 0.2 0.2
CONCLUSION
The developed method is precise, accurate, highly
sensitive, rugged and robust for assay and content
uniformity of Lamivudine and Abacavir combined tablets
and can be reliably adopted for quality control analysis of
Lamivudine and Abacavir in combined tablets.
REFERENCES
B. Jayakar, M. Kumar, C. Saravanan and M. V.
Kumudhavalli, Journal of Chemical and Pharmaceutical
Research, 2(1), 2010, 478-480
Ch. Balasekarreddy, Bahlul Z.Awen, Ch.Babu rao,
N.Sreekanth and P.Ramalingam, International Journal of
Advances In Pharmaceutical Sciences,1(1), 2010, 23-25.
D. Anantha Kumar, M.V. Naveen Babu, J.V.L.N.
Seshagiri Rao and V. Jayathirtha Rao, Rasayan J.Chem,
3(1), 2010, 94-96.
D. Anantha Kumar, J.V.L.N. Seshagiri Rao and
G.SrinivasaRao, E.Journal of Chemistry, 7(1), 2010,
180-182.
T. Sudha, V.R. Ravikumar and P.V. Hemalatha,
International Journal of Pharmaceutical Sciences and
Research, 1(11), 2010, 107-109.
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 686
DEVELOPMENT AND VALIDATION OF A SIMPLE AND RAPID RP- HPLC
METHOD FOR THE DETERMINATION OF METRONIDAZOLE AND
NORFLOXACIN IN COMBINED DOSAGE FORM SK Asma
Parveen
*, Chandana Nalla
Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-8885919500
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise reverse phase
high performance liquid chromatographic method for the simultaneous estimation of Metronidazole and
Norfloxacin in pure and pharmaceutical dosage forms. Metronidazole and Norfloxacin were well separated using
a Thermohypersil BDS C18, (5 μ, 150 x 4.6mm) and a mobile phase consisting of Phosphate buffer pH- 4.6: ACN
(45:55) at the flow rate 1 ml/min and the detection was carried out at 254nm with UV detector. The Retention
time for Metronidazole and Norfloxacin were found to be 2.440 & 4.510 respectively. The developed method was
validated for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was
successfully applied to Metronidazole and Norfloxacin combination pharmaceutical dosage form.
KEY WORDS: RP-HPLC, Metronidazole, Norfloxacin, Accuracy, Precision.
INTRODUCTION
Metronidazole [2-(2-methyl-5-nitro-1H-imidazol-
1-yl) ethanol] is a Nitro-imidazole antibiotic medication
used particularly for anaerobic bacteria and protozoa.
Metronidazole is an antibiotic, amoebicide, and
antiprotozo*al. Metronidazole, taken up by diffusion, is
selectively absorbed by anaerobic bacteria and
sensitive protozoa. Once taken up by anaerobes, it is non-
enzymatically reduced by reacting with
reduced ferrodoxin, which is generated by pyruvate oxido
reductase. In addition or alternatively, the metronidazole
metabolites are taken up into bacterial DNA, and form
unstable molecules. This function only occurs when
metronidazole is partially.
Norfloxacin [1-ethyl-6-fluoro-4-oxo-7-piperazin-
1-yl-1H-quinoline-3-carboxylic acid] is a
synthetic chemotherapeutic antibacterial agent.
Occasionally used to treat common as well as
complicated urinary tract infections. It is sold under
various brand names with the most common
being Noroxin. In form of ophthalmic solutions it is
known as Chibroxin. Norfloxacin is a first generation
synthetic fluoroquinolone (quinolone). Norfloxacin is
a broad spectrum antibiotic that is active against
both Gram positive and Gram negative bacteria. It
functions by inhibiting DNA gyrase, enzymes necessary to
separate bacterial DNA, thereby inhibiting cell division.
Literature survey revealed that very few methods
have been reported for the analysis of Metronidazole and
Norfloxacin combinational dosage forms which include
UV spectroscopy, Reverse Phase High performance
Liquid Chromatography, Densitometric method, HPTLC
methods. The present study illustrate development and
validation of simple, economical, selective, accurate,
precise RP-HPLC method for the determination of
Metronidazole and Norfloxacin in bulk and
Pharmaceutical dosage forms as per ICH guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of
Metronidazole and Norfloxacin in combined dosage form
using most commonly employed column (C18) and simple
mobile phase preparation. In the present proposed work a
successful attempt had been made to develop a method for
the simultaneous estimation of Metronidazole and
Norfloxacin pharmaceutical dosage form and validate it.
From the economical point of view and for the purpose of
routine analysis, it was decided to develop a more
economical RP-HPLC method with simple mobile phase
preparation for the estimation of Metronidazole and
Norfloxacin combinational dosage form. The method
would help in estimate of drugs in single run which
reduces the time of analysis and does not require separate
method for each drug. Thus, the paper reports an
economical, simple and accurate RP-HPLC method for the
above said pharmaceutical dosage forms.
MATERIALS AND METHODS
Quantitative HPLC was performed on a high performance
liquid chromatograph -Waters e2695Alliance HPLC
system connected with UV Detector 2998 and Empower2
Software. The drug analysis data were acquired and
processed using Empower2 software running under
Windows XP on a Pentium PC and Thermohypersil BDS
C18 column of dimension 100 × 4.6, 5µm particle size. In
addition an analytical balance (DENVER 0.1mg
sensitivity), digital pH meter (Elico pH meter LI120), a
sonicator (Unichrome associates UCA 701) were used in
this study.
Standards and chemicals used: The reference samples of
Metronidazole and Norfloxacin standards were kindly
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 687
supplied as gift samples by Hetero Drugs Ltd., Hyderabad,
Andhra Pradesh, India. All the chemicals were analytical
grade. Potassium dihydrogen orthophosphate and
phosphoric acid from Rankem Ltd., Mumbai, India, while
acetonitrile (HPLC grade) and triethylamine (HPLC
grade) from Merck Pharmaceuticals Private Ltd., Mumbai,
India. Ortho phosphoric acid used was of HPLC grade and
purchased from Merck Specialties Private
Ltd.,Mumbai,India. Metronidazole and Norfloxacin
Tablets available in the market as Bacigyl N(Aristo
Pharmaceuticals Ltd.) in composition of
Metronidazole(200mg), Norfloxacin(200mg).
Preparation of mobile phase: Transfer water into
1000ml of beaker dissolve and diluted volume with water.
Then adjust its pH to 4.5 +/- 0.5 phosphate buffer and
Acetonitrile in the ratio of 45:55 was prepared and filtered
through 0.45µ membrane filter and degassed by
sonication.
Preparation of calibration standards: Metronidazole
150mg and 150mg Norfloxacin was taken into a 10, 50 ml
of volumetric flask and add 10ml of Diluent and sonicated
for 10 minutes and made up with Diluent. It was further
diluted to get stock solution of Metronidazole and
Norfloxacin. This is taken as a 100% concentration.
Working standard solutions of Metronidazole and
Norfloxacin was prepared with mobile phase. To a series
of 10 ml volumetric flasks, standard solutions of
Metronidazole and Norfloxacin in the concentration range
of 100µg/ml were transferred respectively.
System suitability: System suitability is an integral part
of chromatographic system. To ascertain its effectiveness,
certain system suitability test parameters were checked by
repetitively injecting the drug solutions at 100%
concentration level for Metronidazole and Norfloxacin to
check the reproducibility of the system. At first the HPLC
system was stabilized for 40 min. One blank followed by
six replicate analysis of solution containing 100% target
concentration of Metronidazole and Norfloxacin were
injected to check the system suitability. To ascertain the
system suitability for the proposed method, a number of
parameters such as theoretical plates, peak asymmetry,
and retention time were taken and results were presented
in Table 1.
Calibration curves for Metronidazole and Norfloxacin: Replicate analysis of solution containing 60-140µg/mL of
Metronidazole and Norfloxacin sample solutions
respectively were injected into HPLC according to the
procedure in a sequence and chromatograms were
recorded. Calibration curves were constructed by plotting
by taking concentrations on X-axis and ratio of peak areas
of standards on Y-axis and regression equation were
computed for both drugs and represented in Table .6
Analysis of marketed formulation: The content of ten
tablets was weighed accurately. Their average weights
were determined. Powder of tablets equivalent to one
tablet weight (595.2mg) were weighed and taken in a 50
ml volumetric flask, dissolved in diluents, shaken and
sonicated for about 20 minutes then filtered through 0.45µ
membrane filter. The filtered solution was further diluted
(5 to 50ml) in the diluents to make the final concentration
of working sample equivalent to 100% of target
concentration. The prepared sample and standard solutions
were injected into HPLC system according to the
procedure. From the peak areas of Metronidazole and
Norfloxacin the amount of the drugs in the sample were
computed. The contents were calculated as an average of
six determinations and experimental results were
presented in Table 4. The representive standard and
sample chromatograms were shown in fig.2 and fig.3.
Validation study of Metronidazole and Norfloxacin:
An integral part of analytical method development is
validation. Method validation is the process to confirm
that the analytical procedure employed for a specific test
is suitable for its intended use. The newly developed RP-
HPLC method was validated as per International
Conference on Harmonization (ICH) guidelines for
parameters like specificity, system suitability, accuracy,
linearity, precision (repeatability), limit of detection
(LOD), limit of Quantification (LOQ) and robustness.
Specificity: The effect of wide range of excipients and
other additives usually present in the formulation of
Metronidazole and Norfloxacin in the determination under
optimum conditions were investigated. The specificity of
the RP-HPLC method was established by injecting the
mobile phase and placebo solution in triplicate and
recording the chromatograms. The common excipients
such as lactose anhydrous, microcrystalline cellulose and
magnesium state have been added to the sample solution
injected and tested.
Precision: precision study of sample (Metronidazole and
Norfloxacin) was carried out by estimating corresponding
responses 6 times on the same day for the 100% target
concentration. The percent relative standard deviation
(%RSD) is calculated which is within the acceptable
criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range of
60-140µg/ml (100-140%) Metronidazole and Norfloxacin
respectively. Method of least square analysis is carried out
for getting the slope, intercept and correlation coefficient,
regression data values and the results were presented in
Table 2. The representative chromatograms indicating the
sample were shown in fig.2&3. A calibration curve was
plotted between concentration and area response and
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 688
statistical analysis of the calibration curves were shown in
fig.6 &7.
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Atorvastatin and Fenofibrate by the method of addition.
Known amount of Metronidazole and Norfloxacin at
100%, 120%, 140% is added to a pre quantified sample
solution. The recovery studies were carried out in the
tablet in triplicate each in the presence of placebo. The
mean percentage recovery of Metronidazole and
Norfloxacin at each level is not less than 98% and not
more than 102%.
Robustness: The robustness is evaluated by the analysis
of Metronidazole and Norfloxacin under different
experimental conditions such as making small changes in
flow rate (±0.2 ml/min), λmax (±5), column temperature
(±5), mobile phase composition (±5%), and pH of the
buffer solution.
LOD and LOQ: Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified. Under the stated experimental
conditions, the limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy. Limit
of detection and limit of quantification were calculated
using following formula LOD=3.3(SD)/S and
LOQ=10(SD)/S, where SD= standard deviation of
response (peak area) and S= average of the slope of the
calibration curve.
RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Metronidazole and Norfloxacin.
Preliminary experiments were carried out to achieve the
best chromatographic conditions for the simultaneous
determination of the drug substances. Several column
types and lengths were tried considering other
chromatographic parameters. C18 column with a 4.6 mm
inner diameter and 5µm particle size was chosen. The
detection wave length was selected as 385nm with PDA
detector. Chromatographic conditions were optimized by
changing the mobile phase composition and buffers used
in mobile phase. Different experiments were performed to
optimize the mobile phase but adequate separation of the
drugs could not be achieved. By altering the pH of buffer
results a good separation. Different proportions of solvents
were tested. Eventually the best separation was obtained
by the isocratic elution system using a mixture of
Phosphate buffer pH- 4.6: ACN (45:55) at a flow rate of 1
ml/min. A typical chromatogram for simultaneous
estimation of the two drugs obtained by using a above
mentioned mobile phase. Under these conditions
Metronidazole and Norfloxacin were eluted at minutes
2.440 & 4.510 respectively with a run time of 5 minutes.
The representative chromatogram of this simultaneous
estimation shown in fig. 3 & 4 and results were
summarized in Table 1.
The Phosphate buffer pH- 4.6: ACN (45:55) was chosen
as the mobile phase. The run time of the HPLC procedure
was 5 minutes at flow rate of 1ml/min was optimized
which gave sharp peak, minimum tailing factor. The
system suitability parameters were shown in Table 1 were
in within limit, hence it was concluded that the system
was suitable to perform the assay.
The method shows linearity between the
concentration range of 60-140µg/ml for Metronidazole
and Norfolxacin. The experimental results were shown in
table 6 and fig.6&7. The % recovery of Metronidazole and
Norfloxacin was found to be in the range of 98.96 to
101.84 % and 98.29 to 100.54% respectively. As there
was no interference due to excipients and mobile phase,
the method was found to be specific. As both compounds
pass the peak purity, the method was found to be specific.
The method was robust and rugged as observed from
insignificant variation in the results of analysis by changes
in Flow rate, column oven temperature, mobile phase
composition and wave length separately and analysis
being performed by different analysts. The results were
shown in Table 5. The LOD and LOQ values were
calculated based on the standard deviation of the response
and the slope of the calibration curve at levels
approximately the LOD and LOQ. The limit of detection
was obtained as 2.50974µg/mL for Metronidazole and
3.59µg/mL for Norfloxacin. The limit of quantitation was
obtained as 7.60529µg/mL for Metronidazole and
10.88µg/mL for Norfloxacin which shows that the method
is very sensitive. The results were shown in Table-7.
Fig. 1: Structure of Metronidazole Fig. 2: Structure of Norfloxacin
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 689
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions
Instrument Waters e2695 Alliance HPLC with Empower2 software
Column Thermohypersil BDS C18, (5 μ, 150 x 4.6mm)
Detector UV Detector 2998
Diluents Methanol
Mobile phase Phosphate buffer pH- 4.6: ACN (45:55) Flow rate 1ml/min
Detection wavelength 325nm
Temperature 25°c
Injection volume 20µl
Retention time
Metronidazole 2.440
Norfloxacin 4.510
Theoretical plate count
Metronidazole 2570
Norfloxacin 3126
Tailing factor
Metronidazole 1.460
Norfloxacin 1.045
Resolution factor 8.593
Table.2.Specificity study
Name of the solution Retention time in min
Blank No peaks
Metronidazole 2.446
Norfloxacin 4.519
Table.3.Recovery data of the proposed Metronidazole and Norfloxacin
Sample Spiked Amount
(µg/ml)
Recovered Amount
(µg/ml)
%Recovered %Average
recovery
Metronidazole
80 101.84 101.84
99.96% 110 119.24 99.51
120 138.54 98.96
Norfloxacin
80 100.32 100.32
99.71% 100 120.64 100.54
120 137.60 98.29
Table.4.Results of Precision study
Sample Injection number precission
RT Peak area
Metronidazole
1 2.483 4538.983
2 2.437 4451.407
3 2.463 4448.696
4 2.467 4474.308
5 2.453 4539.624
6 2.483 4517.392
Mean 2.4643 4495.068
%RSD(NMT 2.0) 0.94
Norfloxacin
1 4.523 2975.916
2 4.483 2993.931
3 4.513 2948.557
4 4.517 2992.825
5 4.497 2984.785
6 4.523 3006.637
Mean 4.509 2983.775
%RSD(NMT 2.0) 0.67
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 690
Table 5-a: Robustness data for Metronidazole
Parameter Rt Peak Area Theoretical
Plates
Asymmetry
Decreased Flow Rate 3.413 6231.711 2745 1.444
(0.8ml/min)
Actual Flow rate(1ml/min) 2.666 4587.238 2543 1.460
Increased Flow Rate (1.2ml) 1.920 3502.766 2344 1.476
Decreased Wave length(252nm) 2.450 4095.817 2589 1.462
Actual wave length(254nm) 2.438 4454.386 2585 1.463
Increased Wave length (256nm) 2.447 4812.955 2582 1.462
Table 5-b: Robustness data for Norfloxacin
Parameter Rt Peak Area
Theoretical Plates Asymmetry
Decreased Flow Rate (0.8ml/min) 6.263 4128.098 4775 1.138
Actual Flow Rate(1ml/min) 4.92 3202.361 4484 1.157
Increased Flow Rate (1.2ml/min) 3.577 2276.625 4194 1.176
Decreased wave length(252nm) 4.513 2794.526 4598 1.195
Actual wave length(254nm) 4.508 2903.456 4585 1.181
Increased wave length (256nm) 4.503 3066.386 4577 1.167
Table 6: Linearity data of the Metronidazole and Norfloxacin
Table 7: Limit of Detection and Limit of Quantification
Metronidazole Norfloxacin
Mcg Area Mcg Area
LOD 2.50974 104.53 3.59 104.46
LOQ 7.60529 316.77 10.88 316.56
Fig. 3: Typical Chromatogram of standard Metronidazole and
Norfloxacin
Fig. 4: Typical chromatogram of Metronidazole and
Norfloxacin tablets in marketed formulation
Sample Parameters Optimized Used RT Peak area Plate count
Metronidazole
Flow rate
(±0.2)
1ml/min 60 2.457 2603 2739.882
80 2.460 2610 3570.039
100 2.452 2603 4517.959
Temperature
(±5°C)
35°C 120 2.463 2617 5338.82
140 2.477 2646 6014.213
Norfloxacin
Flow rate
(±0.2)
1ml/min 60 4.520 4611 1805.882
80 4.517 4605 2400.415
100 4.520 4611 3007.73
Temperature
(±5°C)
35°C 120 4.520 4421 3616.148
140 4.523 4618 4105.921
Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 691
CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Metronidazole and Norfloxacin in tablet
dosage forms in bulk and pharmaceutical dosage forms
was established. The method was completely validated
shows satisfactory results for all the method validation
parameters tested and method was free from interferences
of the other active ingredients and additives used in the
formulation. Infact results of the study indicate that the
developed method was found to be simple, reliable,
accurate, linear, sensitive, economical and reproducible
and have short run time which makes the method rapid.
Hence it can be concluded that the proposed method was a
good approach for obtaining reliable results and found to
be suitable for the routine analysis of Metronidazole and
Norfloxacin in Bulk drug and Pharmaceutical
formulations.
ACKNOWLEDGEMENT
The authors would like to thank beloved parents and all
my well wishers, one and all who have helped me directly
and indirectly in completing this project work.
REFERENCES
Amit J. Kasabe, Vikram V. Shitole, Vikram V.
Waghmare, Vijay Mohite Department of Pharmaceutical
Chemistry, Simultaneous Estimation of Metronidazole and
Ofloxacin in Combined dosage form by Reverse Phase
High performance Liquid Chromatography Method,
International Journal of ChemTech Research, 1(4), 2009,
1244-1250.
Ghante, Minal R, Pannu, Harpreet K, Loni, Amruta,
Shivsharan, Tejashree, Development and Validation of a
RP- HPLC Method for Simultaneous Estimation of
Metronidazole and Norfloxacin in Bulk and Tablet
Dosage form, International Journal of Pharmacy &
Pharmaceutical Sciences, 4, 2012, 241.
Rajyalakshmi Chavakula, Rambabu Chintala,
Benjamin Tadanki, Application of Validated Stability
Indicating HPLC method in Stability Testing of Nor-
Metrogyl tablets, Journal of Pharmacy Research, 6(5),
2013, 499-503.
T. Saffaj M. Charrouf, A. Abourriche, Y. Abboud, A.
Bennamara, M. Berrada Spectrophotometric
Determination of Metronidazole and Secnidazole in
Pharmaceutical Preparations. Il Farmaco, 59(10), 2004,
843–846.
Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 692
ANALYTICAL METHOD DEVELOPMENT AND VALIDATION FOR THE
ESTIMATION OF OLMESARTAN MEDOXOMIL BY RP-UPLC IN BULK AND
PHARMACEUTICAL DOSAGE FORMS Farhana pattan, K.Haritha Pavani, A.Kiran Kumar, N.Sunny Babu, K.V.Kalyan Kumar, Chandana N
Department of pharmaceutical analysis, Nimra College of Pharmacy
Corresponding Author: [email protected], Phone no: 8885818293
ABSTRACT
A simple rapid, accurate, precise and reproducible validated reverse phase UPLC method was developed for
the determination of Olmesartan medoxomil in bulk and pharmaceutical dosage forms. The quantification was
carried out using Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm) column run in Gradient way using
mobile phase-A [pH 3.4 Buffer: Acetonitrile (70:30% v/v)] and mobile phase-B [pH 3.4 Buffer:Acetonitrile (30
:70 % v/v)] and a detection wavelength of 250nm, and injection volume of 4µL, with a flow rate of 0.5mL/min.
The retention times of Olmesartan medoxomil was found to be 3.418. The method was validated in terms of
linearity, precision, accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges
of the proposed method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 10% to 150% and
with correlation coefficient of r2=0.9999.The assay of the proposed method was found to be 98.79%. The
recovery studies were also carried out and mean % Recovery was found to be 100.5%. The % RSD from
reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for
routine quality control analysis of Olmesartan medoxomil in bulk and in Pharmaceutical dosage form.
Key Words: Olmesartan medoxomil, RP-UPLC, Waters acquity UPLC BEH C18, Tablets, Validation.
1. INTRODUCTION
Olmesartan medoxomil is (5-methyl-2-
oxo-2H-1,3-dioxol-4-yl)methyl 4-(2-hydroxypropan-2-yl)-
2-propyl-1-({4-[2-(2H-1,2,3,4-tetrazol-5-
yl)phenyl]phenyl}methyl)-1H-imidazole-5-
carboxylate.The molecular weight is 558.59,molecular
formula is C29H30N6O6. Olmesartan is a prodrug that
works by blocking the binding of angiotensin II to the
AT1 receptors in vascular muscle; it is therefore
independent of angiotensin II synthesis pathways,
unlike ACE inhibitors. By blocking the binding rather
than the synthesis of angiotensin II, olmesartan inhibits
the negative regulatory feedback on renin secretion. As a
result of this blockage, olmesartan reduces
vasoconstriction and the secretion of aldosterone. This
lowers blood pressure by producing vasodilation, and
decreasing peripheral resistance and is used as
antihypertensive.
Literature review reveals very few methods are
reported for the assay of Olmesartan medoxomil in Tablet
dosage forms using RP-HPLC method and no method has
been developed by RP-UPLC. The proposed RP-UPLC
method utilizes economical solvent system and having
advantages like Less time consuming,better retention time,
less flow rate, very sharp and symmetrical peak shapes.
The aim of the study was to develop a simple, precise,
economic and accurate RP-UPLC method for the
estimation of Olmesartan medoxomil in Tablet dosage
forms.
Figure.1. Olmesartan medoxomil
2. MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV-
probe software,UV-VISIBLE spectrophotometer with 1cm
matched quartz cells. UPLC system (Waters Acquity
equipped with Empower software), Waters Acquity UPLC
BEH column
2.1. Chemicals and reagents: Gifted sample of
Olmesartan medoxomil pure sample and dosage form
“OLME TECH” marketed by REDDY’S was purchased
from local pharmacy. Other chemicals all are of HPLC
grade and GR grade.
2.2. Preparation of mobile phase:Preparation of pH 3.4
Buffer: Dissolve 2.04gm of monobasic potassium
phosphate in 1000mL of water, mix well adjust to pH 3.4
with diluent OPA (1mL in 10mL of water) and filtered
through 0.22µm filter.Mobile phase-A: pH 3.4 Buffer :
ACN (70 :30 % v/v)
Mobile phase-B: pH 3.4 Buffer : ACN (30 :70 % v/v)
2.3. Standard solution preparation:weighed and
transferred about 56mg of olmesartan medoxomil working
standard in to a 100ml volumetric flak,added 60ml of
acetonitrile and sonicated to dissolve.Diluted up to the
Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 693
volume with acetonitrile.Diluted 4ml of the above solution
to 50ml with diluents and filtered through 0.22um filter.
2.4. Preparation of sample solution: Five tablets were
weighed and finely powdered and a powder quantity
equivalent to 56mg of Olmesartan medoxomil were
accurately weighed and transferred to a 100ml volumetric
flask and 60ml of acetonitrile was added to the same. The
flask was sonicated and volume was made up to the mark
with acetonitrile. Diluted 4ml of the above solution to
50ml with diluents and filtered through 0.22um
filter,mixed well and injected. The amount present in each
tablet was calculated by comparing the area of standard
Olmesartan medoxomil and tablet sample.
2.5. Method optimization: The chromatographic
separation was performed using Waters Acquity UPLC
BEH C18 (100 mm X 2.1 mm, 1.7µm) column. For
selection of mobile phase, various mobile phase
compositions were observed for efficient elution and good
resolution. The mobile phase consisting of Mobile phase-
A [pH 3.4 Buffer: ACN (70:30% v/v)] and Mobile phase-
B [pH 3.4 Buffer: ACN (20 :80 % v/v)] was found to be
the optimum composition for efficient elution of analyte.
The mobile phase was injected to the column at a flow
rate of 0.5 ml/min for 6min. The column temperature was
maintained at 25oC. The analyte was monitored at 250 nm
using UV-detector. The retention time of the drugs was
found to be 3.418min. Water:CAN(50:50) was used as
diluent during the standard and test samples preparation.
The optimized chromatographic conditions are mentioned
in Table-1 and chromatogram for standard was shown in
the figure no:
3. RESULTS
3.1. Method Validation
3.1.1. System suitability: System suitability tests are an
integral part of method validation and are used to ensure
adequate performance of the chromatographic system.
Retention time (RT), number of theoretical plates (N) or
column efficiency and tailing factor (T) were evaluated for
six injections of standard solution at a solution of
44.8µg/ml of Olmesartan medoxomil. The results are
tabulated in the table no-2 and the chromatogram was
shown in the figure no- 4.
3.1.2. Specificity: Specificity is the ability of analytical
method to measure accurately and specifically the analyte
in the presence of components that may be expected to be
present in the sample. The specificity of method was
determined by spiking possible impurities at specific level
to standard drug solution (44.8ppm). The diluent and
placebo solutions were also injected to observe any
interference with the drug peak.There was no blank and
placebo interference was found.
3.1.3. Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given range.
The linearity of Olmesartan medoxomil was in the
concentration range of 10-150%.From the linearity studies
calibration curve was plotted and concentrations were
subjected to least square regression analysis to calculate
regression equation. The regression coefficient was found
to be 0.9999 shows good linearity. The results are
tabulated in the table no-4 and the chromatogram was
shown in the figure no- 7, 8, 9.
3.1.4. Accuracy: Accuracy is the closeness of results
obtained by a method to the true value. It is the measure of
exactness of the method. Accuracy of the method was
evaluated by standard addition method. Recovery of the
method was determined by spiking an amount of the pure
drug (50%,75%,100% ,150%) at four different
concentration levels in its solution has been added to the
pre analyzed working standard solution of the drug. The
results are tabulated in the table no-5, 6, 7.
3.1.5. Precision: The precision of the analytical method
was studied by analysis of multiple sampling of
homogeneous sample. The Precision expressed as
standard deviation or relative standard deviation.
3.1.6. System precision: System precision was performed
by injecting a standard solution of Olmesartan medoxomil
for six times. The results are tabulated in the table no-8.
3.1.7. Method precision: Method precision was
performed by analyzing a sample solution of Olmesartan
medoxomil by injecting six replicates of the same sample
preparations at a concentration of 44.8ppm/mL. The
results are tabulated in the table no-9.
3.1.8.Intermediate precision(Ruggedness): Intermediate
precision was performed by analyzing a standard and
sample solutions of Olmesartan medoxomil by injecting
six replicates of the same standard and sample
preparations at a concentration of 44.8 ppm/mL. The
results are tabulated in the table no-9.
3.1.8. Robustness: Robustness shows the reliability of an
analysis with respect to deliberate variations in method
parameters. If measurements are susceptible to variations
in analytical conditions, the analytical conditions should
be suitably controlled or a precautionary statement should
be included in the procedure. The results are tabulated in
the table no-4.
3.1.9. LOD and LOQ:Calibration curve was repeated for
five times and the standard deviation (SD) of the
intercepts was calculated.The results shows,the limit of
detection with a signal to noise ratio of 3:1 was found to
Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 694
be 0.010 µg/ml. the limit of quantification with a signal to noise ratio of 10:1 was found to be 0.032 µg/ml.
Table.1.Optimized chromatogram conditions for Lamivudine, Zidovudine and Efavirenz
Table.2. System suitability Data for Olmesartan medoxomil
System suitability parameters Results
% RSD 0.08
Tailing factor 1
Theoretical plates 40289
Table.4. Linearity Data for Olmesartan medoxomil
Level Con.
(mg/ml)
Peak area
10% 5.63 65673
50% 22.53 259905
75% 33.8 395268
100% 45.06 525796
150% 67.60 787084
Slope 11674.33
Intercept 826.20
Correlation coefficient
(R2)
0.9999
Table.4. Accuracy Data for Olmesartan medoxomil Level % Recovery % RSD
50% 100 65673
75% 100.6 259905
100% 100.8 525796
150% 100.6 787084
Table.5. System precision of Olmesartan medoxomil
Column Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm)
Mobile phase Mobile phase-A: pH 3.4 Buffer: ACN (70 :30 % v/v) ,Mobile
phase-B: pH 3.4 Buffer: ACN (70 :30 % v/v)
Flow rate 0.5 ml/ min
Wavelength 250 nm
Injection volume 2 l
Column temperature Ambient
Run time 6 min
No of injections Area RT
1 524321 3.418
2 523789 3.417
3 523912 3.418
4 524832 3.418
5 524721 3.416
6 524198 3.416
Average 524297 -
SD 420.1 -
% RSD 0.08 -
Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 695
Table.6. Method precision and intermediate precision Data for Olmesartan medoxomil Sample no. %ASSAY
Method precision Intermediate precision
1 98.79 98.76
2 98.74 98.66
3 98.94 98.86
4 98.76 98.76
5 98.94 98.86
6 98.9 98.66
Mean 98.81 98.76
%RSD 1.06 0.090
Table.7. Variation in flow rate, column temperature for Olmesartan medoxomil Parameter Flow (mL/min) Temperature(
oC)
Low
(0.3ml/min)
Actual
(0.5ml/min)
High
(0.7ml/min)
Low
(20 oC)
Actual
(25 oC)
High
(30 oC)
%RSD 0.16 0.08 0.11 0.15 0.089 0.1
Retention time 4.451 3.336 2.528 3.856 3.418 3.014
Plate count 51056 40289 38529 42106 40289 40562
Tailing factor 1 1 1 1 1 1
Figure.2. Standard chromatogram of Olmesartan Figure.3. Sample chromatogram
Figure.4.Linearity Figure.2. Chromatogram for specificity
4. DISSCUSSION
4.1. System suitability: From the system suitability
studies it was observed that retention time of Olmesartan
medoxomil was found to be 3.418 min. % RSD of peak
area was found to be 0.08. Theoretical plates were found
to be more than 40289. USP tailing factor was found to be
1. All the parameters were within the limit.
4.2. Specificity: The Chromatograms of Standard and
Sample are identical with nearly same Retention time.
There is no interference with blank and placebo to the
drugs. Hence the proposed method was found to be
specific.
4.3. Linearity: From the Linearity data it was observed
that the method was showing linearity in the concentration
range of 10-150μg/ml. Correlation coefficient was found
to be 0.9999.
4.4. Accuracy: The recoveries of pure drug from the
analyzed solution of formulation were in the range of
98%-102%, which shows that the method was accurate.
Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 696
4.5. Precision
4.5.1. System precision: The percentage relative standard
deviation (RSD) for the peak area 0.08.
4.5.2. Method precision: The percentage relative
standard deviation for the assay values found to be 1.06
4.6. Ruggedness: Comparison of both the results obtained
for two different Analysts shows that the method was
rugged for Analyst-Analyst variability. The %RSD for
intermediate precision was 0.09.
4.7. Robustness
As the % RSD of retention time and asymmetry
were within limits for variation in flow rate (± 0.2
ml). Hence the allowable flow rate should be
within 0.3 ml to 1.7 ml.
As the % RSD of retention time and asymmetry
were within limits for variation (+ 50C) in column
oven temperature. Hence the allowable variation
in column oven temperature is + 50C.
The results obtained were satisfactory and are in
good agreement as per the ICH guidelines.
4.8. Acknowledgement: The authors thankful to Mr.
A.Kiran kumar,Mr. N.Sunny babu, and Mr.K.V.kalyan
kumar for providing necessary facilities to carry out the
research work.
5. CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of ICH
guidelines for method validation. The proposed method
was simple, accurate, specific, precise, robust, rugged and
economical. Hence this method is validated and can be
used for routine sample analysis.
REFERENCES
Jain Pritam,Chaube Udit,Chaudhari Rakesh,UV-
Spectrophotometric method for determination of
olmesartan medoxomil in bulk and in
formulation.Internationale Pharmaceutica
Sciencia,1(7),2011, 2231-5896.
Selvadurai Muralidharan, Kumar, developed Sensitive
estimation of olmesartan medoxomil tablets by RP- HPLC
method. International Journal of Pharmacy & Life
Sciences, 1(7), 2012, 0976-7126.
Chaitanya Prasad MK, Vidyasagar G, Sambasiva Rao
KRS, developed RP-HPLC method for the estimation of
olmesatan medoxomil in tablet dosage form, Der pharma
chemica, 3(6), 2011:208-212
Lakshmi surekha M, Kumara swamy G, RP-HPLC
method for the estimation of olmesartan medoxomil in
bulk and tablet dosage form. Contemporary Investigations
and Observations in Pharmacy, 2(1), 2013, 3-6, 2278-
7429.
Suman Avula K.Naveen Babu, M.V.Ramana, RP-HPLC
method for the estimation of olmesatan medoxomil in bulk
and tablet dosage form. An international journal of
advances in pharmaceutical sciences, 2(2-3), 2011, 0976-
3090.
Sharma ritesh, Pancholi syam.S, RP-HPLC-DAD method
for determination of olmesartan medoxomil in bulk and
tablets exposed to forced conditions, INIST-CNRS, 60,
2010, 1330-0075.
Vaibhav and Shasi Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 697
FORMULATION DEVELOPMENT AND EVALUATION OF GLICLAZIDE GEL
USING WATER SOLUBLE SODIUM CARBOXY METHYL CELLULOSE POLYMER Vaibhav Kumar Mishra, Shashi Shekhar Tripathi
Sir Madan Lal Institute of Pharmacy, Alalpur Hauz Etawah, U.P, India
*Corresponding author:[email protected]
ABSTRACT
High molecular weights water soluble homopolymer of Sodium Carboxy Methyl Cellulose (Sodium CMC) are
reported to possess very high viscosity in low concentration, transparency, film forming properties and are useful in
formation of gel. The Gliclazide gels were prepared by using different concentration of Sodium Carboxy Methyl Cellulose
for topical drug delivery with an objective to increase transparency and spreadability. These preparations were with
marketed Gliclazide gel. Spreadability and consistency of sodium CMC gel containing Gliclazide were 6.5g.cm/sec. The
percent drug release was 97.11 and 98.66 from F9. Stability studies under accelerated condition showed satisfactory
results. It can be concluded that sodium CMC gel containing Gliclazide showed good consistency, homogeneity,
spreadability and stability and has wider prospect for topical preparations.
Key words: Topical drug delivery, Water soluble polymer, Gliclazide, Sodium Carboxy Methyl Cellulose
1. INTRODUCTION
Topical gel preparations are intended for skin
application or to certain mucosal surfaces for local action
or percutaneous penetration of medicament or for their
emollient or protective action. Gels are typically formed
from a liquid phase that has been thickened with other
components. The continuous liquid phase allows free
diffusion of molecules through the polymers scaffold and
hence release should be equivalent to that from a simple
solution. Gliclazide is an oral hypoglicemic drug and Oral
hypoglycemic drugs are used only in the treatment of type
2 diabetes which is a disorder involving resistance to
secreted insulin. Type 1 diabetes involves a lack of insulin
and requires insulin for treatment. There are now four
classes of hypoglycemic drugs: Sulfonylureas, Metformin,
Thiazolidinediones, Alpha-glucosidase inhibitors
Bioadhesion is the phenomenon between two materials,
which are held together for extended periods of time by
interfacial forces. It is referred as bioadhesion when
interaction occurs between polymer and epithelial surface;
mucoadhesion when occurs with the mucus layer covering
a tissue. Generally bioadhesion is deeper than the
mucoadhesion (Sudhakar, 2006).
Topical gel preparations are intended for skin
application or to certain mucosal surfaces for local action
or percutaneous penetration of medicament or for their
emollient or protective action. Gels are typically formed
from a liquid phase that has been thickened with other
components. The continuous liquid phase allows free
diffusion of molecules through the polymers scaffold and
hence release should be equivalent to that from a simple
solution. Sodium CMC is used as water soluble or
hydrophilic polymers topically in gel drug delivery system
(H.S.Golinkin, 1979). A range of grades based on
molecular fractions of these polymer are available, they
are typically used at a concentration between 5 to 10% in
topical gel formulation. Due to their non greasy properties,
they can provide easily washable film on the skin. Sodium
CMC polymer of high molecular weight do not penetrate
the skin and are non toxic (D.J.King, 1989). Human
cutaneous tolerance tests performed to evaluate the
irritation of 1-5% w/w Sodium CMC indicated that the
polymer was well tolerated. Sodium CMC polymers have
the potential to be naturally broken down and
biodegradable and do not persist or accumulate in the
environment (C.D.Rowland, 1999; Yang JF, 2004).
2. MATERIAL AND METHODS
Gliclazide was received as gift sample from
Torrent Pharmaceuticals, Ahmedabad, Gujrat, India.
Sodium CMC homopolymer, Iso Propyl Myristate and
Ethyl Paraben were bought from Loba Chemi Pvt
Ltd,Mumbai (India). Cineole is received from local
market (Etawah). All the ingredients used in this project
were of analytical grade.
Procedure of gel preparation: About 3.75 g of sodium
CMC was weighed and dissolved in upto 50 ml of water
than gel formulation and specified quantity of glycerin or
drug Gliclazide (2.5gm) was added and weighed quantity
of iso propyl myristate (2.5ml) was added in reference and
add to the Ethyl paraben (0.5gm) and add the Glycerin
(5gm) to mix than the formulation. Cineole was added to
enhance permeability. Precipitation or turbidity occurs in
some of the batches (F3, F4, F5, F6, and F7 and F8) of
Gliclazide gel containing sodium CMC which could be
due to the incompatibility in the system due to presence of
glycerin
Evaluation of Gliclazide gel containing sodium CMC:
The above formulate Gliclazide gel containing sodium
CMC were subjected to evaluation for the following
parameters:
pH: The pH of the various gel formulations was
determined by using digital pH meter
Vaibhav and Shasi Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 698
Spreadability: It was determined by wooden block and
glass slide apparatus. Weights about 20g were added to
the pan and the time were noted for upper slide (movable)
to separate completely from the fixed slides.
Consistency: The measurement of consistency of the
prepared gels was done by dropping a cone attached to a
holding rod from a fix distance of 10cm in such way that it
should fall on the centre of the glass cup filled with the
gel. The penetration by the cone was measured from the
surface of the gel to the tip of the cone inside the gel. The
distance traveled by cone was noted down after 10sec.
Homogeneity: All developed gels were tested for
homogeneity by visual inspection after the gels have been
set in the container. They were tested for their appearance
and presence of any aggregates.
Skin irritation test: Test for irritation was performed on
human volunteers. For each gel, five volunteers were
selected and 1.0g of formulated gel was applied on an area
of 2 square inch to the back of hand. The volunteers were
observed for lesions or irritation.
Drug content: A specific quantity (100mg) of developed
gel and marketed gel were taken and dissolved in 100ml
of phosphate buffer of pH 6.8. The volumetric flask
containing gel solution was shaken for 2hr on mechanical
shaker in order to get complete solubility of drug. This
solution was filtered and estimated spectrophotometrically
at 276.0nm using phosphate buffer (pH 6.8) as blank
(U.V.Sera, 2006).
Accelerated stability studies: All the selected
formulations were subjected to a stability testing for three
months as per ICH norms at a temperature of 40º ± 2º. All
selected formulations were analyzed for the change in
appearance, pH or drug content by procedure stated
earlier.
Permeability studies: Phosphate buffer of pH 6.8 was
used for in vitro release as a receptor medium. The
pretreated skin of albino mice was used in fraz diffusion
cell. The gel sample was applied on then skin and then
fixed in between donor and receptor compartment of
diffusion cell. The receptor compartment contained
phosphate buffer (100ml) of pH 6.8. The temperature of
diffusion medium was thermostatically controlled at 37º ±
1º by surrounding water in jacket and the medium was
stirred by magnetic stirrer at 500rpm. The sample at
predetermined intervals were withdrawn and replaced by
equal volume of fresh fluid. The samples withdrawn were
spectrophotometrically estimated at 276nm against their
respective blank.
3. Results and discussion The pH values of all developed (F3, F4, F5, F6,
F7, and F8) and reference Iso Propyl Myristate gel
Reference was 5.5. The values of spreadability indicate
that the gel is easily spreadable by small amount of shear.
Spreadability of Reference gel was 5.5g.cm/sec while F9
was 6.5g.cm/sec, indicating spreadability of sodium CMC
containing Gliclazide gel. The consistency reflects the
capacity of the gel, to get ejected in uniform and desired
quantity when the tube is squeezed. Consistency in terms
of distance travel by cone was 5mm. Consistency is
inversely proportional to the distance traveled by falling
cone. Hence, the consistencies of Gliclazide gel
containing with add permeation enhencer Cineole
compare to Iso propyl myristate.
All developed gel showed good homogeneity with
absence of lumps. The developed preparations were much
clear and transparent gel. The skin irritation studies of
developed gel were carried out on human volunteers and
that confirmed the absence of any irritation on the applied
surface. During the stability studies the appearance was
clear and no significant variation in pH was observed.
Considering the accelerated stability studies and
physiochemical parameters, batch was selected for in vitro
permeability release studies.
In vitro Permeability study showed that
permeation studies of Gliclazide gel containing enhencer
Cineole compare to Iso propyl myristate. It was observed
that Gliclazide gel containing produced better
spreadability and consistency. The developed gel showed
good homogeneity, no skin irritation, good stability and in
vitro permeability. The sodium CMC forms water soluble
gel and has wider prospects to be used as a topical drug
delivery system.
Vaibhav and Shasi Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 699
Table.1. Composition and concentration of Gliclazide gel. Batch
No
Polymer (g)
Sod CMC
Drug (g)
Gliclazide
Isopropyl
Myristate(ml)
Ethyl
Paraben(g)
Glyceri
n (g)
Cineole
(ml)
Distilled
water (ml)
Remarks
F1 2.5 - - 0.5 5.0 - Upto50 Too Fluid
F2 5 - - 0.5 5.0 - Upto50 Too
Viscous
F3 3.75 2.5 2.5 0.5 5.0 - Upto50 Desired
Viscosity
F4 3.75 2.5 - 0.5 5.0 1.5 Upto50 Desired
Viscosity
F5 3.75 2.5 - 0.5 5.0 2.0 Upto50 Desired
Viscosity
F6 3.75 2.5 - 0.5 5.0 2.5 Upto50 Desired
Viscosity
F7 3.75 2.5 - 0.5 5.0 3.0 Upto50 Desired
Viscosity
F8 3.75 2.5 - 0.5 5.0 3.5 Upto50 Desired
Viscosity
Table.2. Release rate of Gliclazide from different gellants Batch No pH Spreadability
(g.cm/sec)
Drug Content
F3 5.4 7.1 99.96
F4 5.6 6.8 99.86
F5 5.5 7.0 99.79
F6 5.8 6.7 99.56
F7 5.5 6.9 99.45
F8 5.9 7.3 99.38
Table.3. Stability study of Gliclazide Batches Week Appearance pH Drug Content (%)
F3 (Reference) 0 Clear 5.4 99.20
1 Clear 5.5 98.95
2 Clear 5.7 98.54
3 Clear 5.8 98.09
F4 (test) 0 Clear 5.4 99.75
1 Clear 5.6 99.32
2 Clear 5.7 99.08
3 Clear 5.9 98.68
F5 (test) 0 Clear 5.5 99.79
1 Clear 5.6 99.43
2 Clear 5.7 98.75
3 Clear 5.8 98.32
F6(test) 0 Clear 5.5 99.90
1 Clear 5.7 99.56
2 Clear 5.8 98.86
3 Clear 5.8 98.32
F7(test) 0 Clear 5.4 99.45
1 Clear 5.6 99.11
2 Clear 5.7 98.78
3 Clear 5.8 98.31
F8(test) 0 Clear 5.5 99.38
1 Clear 5.7 98.67
2 Clear 5.8 98.43
3 Clear 5.9 98.09
Vaibhav and Shasi Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 700
Table.4. Drug permeability release profile of Gliclazide gel formulation Time interval Media ph %drug release
30 5.5 72.35%
60 5.6 75.68%
90 5.8 79.68%
120 5.9 86.79%
4. CONCLUSION
The polymer being macromolecules of very high
molecular weight remain unabsorbed on the skin and from
our studies it can be concluded that sodium CMCcan be
used for various topical dosage form for external
application. It has been observed that optimized batch
produces the gel with good consistency, homogeneity,
spreadabiltity and stability. Since, the polymer is water
soluble; consequently, it forms water washable gel and has
wider prospects to be used as a topical drug delivery
dosage form.
ACKNOWLADGEMENT
Authors are thankful to H-Jules Corporation
(Nagpur, India) for supply of gift sample of Gliclazide.
The Management of Sharad Pawar College of Pharmacy
for providing necessary facilities to carry out this research
work.
REFERENCES
C.D.Rowland, J.R. Burton, A review on toxicity of
various hydrophilic polymers, Environ Toxi Chem., 19,
1999, 2136-2139.
D.J.King, R.R.Noss, Toxicity of polyacrylamide and
acrylamide polymers, Environ Toxi Chem, 16, 1989, 1-4.
G.D.Gupta, R.S. Gound, Release rate of nimesulide from
different gellants, Indian J Pharm Sci, 61, 1999, 229-234.
H.S.Golinkin, Process for fracturing well formations using
aqueous gels, US Patent No. US4137182, 1979.
Sudhakar Y, Kuotsu K, Bandyopadhyay AK, Buccal
bioadhesive drug delivery promising option for orally
less efficient drugs, J. Control Rel., 114, 2006, 15 – 40.
U.V.Sera, M.V.Ramana, In vitro skin absorption and drug
release – a comparison of four commercial hydrophilic gel
preparations for topical use, The Indian Pharmacist, 73,
2006, 356-360.
Yang JF,Wei GL,Lu R. Determination of Gliclazide in
human plasma by high performance liquid
chromatography, Asian J Drug Metab Pharmaxokinet,
4(3), 2004, 231-234.
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 701
ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF
GEMIFLOXACIN AND AMBROXOL IN SOLID DOSAGE FORM BY REVERSE
PHASE HIGH PERFORMANCE LIQUID CHROMATOGRAPHY Md Haseena Begum, Nanda Kishore Agarwal and Duraivel.S
Department of Pharmaceutical Analysis and Quality Assurance,
Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India
*Corresponding author: Email: [email protected], Phone +91-9494766717
ABSTRACT
The present investigation describes about a simple rapid, accurate, precise and reproducible validated
reverse phase HPLC method was developed for the determination of Ambroxol and Gemifloxacin in tablet dosage
forms. The quantification was carried out using Hypersil BDS HypersilC18(4.6*250mm,3.5 µm,make;ACE)
column run in isocratic way using mobile phase comprising of Sodium Phosphate buffer: acetonitrile, in the ratio
of 40:60 with a detection wavelength of 246nm, and injection volume of 20µL, with a flow rate of 1.2ml/min. The
retention times of the drugs was found to be 3.4min and 2.3min. The linearity ranges of the proposed method lies
between 60-140mcg and 7.5-17.5mcg for Gemifloxacin and Ambroxol with correlation coefficient of r2=0.999
and r2=0.998. The assay of the proposed method was found to be 101.22% and 101.92%. The recovery studies
were also carried out and % RSD from reproducibility was found to be <2%. LOD and LOQ were found to be
2.93 and 9.91 for Gemifloxacin and 3.0 and 9.97 for Ambroxol respectively. The proposed method was
statistically evaluated and can be applied for routine quality control analysis of Gemifloxacin and Ambroxol in
bulk and in Pharmaceutical dosage form.
Key Words: Gemifloxacin, Ambroxol, RP-HPLC, Hypersil BDS, validation.
1. INTRODUCTION
Gemifloxacin is an oral broad-spectrum quinolone
antibacterial agent used in the treatment of acute bacterial
exacerbation of chronic bronchitis and mild-to-moderate
pneumonia. Gemifloxacin acts by inhibiting DNA
synthesis through the inhibition of both DNA gyrase and
topoisomerase IV, which are essential for bacterial
growth. Gemifloxacin is indicated for the treatment of
infections caused by susceptible strains of the designated
microorganisms in the conditions listed below. Acute
bacterial exacerbation of chronic bronchitis caused by S.
pneumoniae, Haemophilus influenzae, Haemophilus
parainfluenzae, or Moraxella catarrhalis. Community-
acquired pneumonia (of mild to moderate severity) caused
by S. pneumoniae (including multi-drug resistant strains,
Haemophilus influenzae, Moraxella catarrhalis,
Mycoplasma pneumoniae, Chlamydia pneumoniae, or
Klebsiella pneumoniae. (Snyder,1997)
Ambroxol is kind of strong expectorant, clinically
proven active mucolytic agent. The medicine helps to
remove sticky phlegm from the respiratory tract easily and
quickly by enhancing the bronchial secretions that loosen
congested phlegm. It also releases and strengthens tiny
striking hairs inside the windpipe and bronchial tubes,
which is referred to as the cilia , which can then expel the
abnormal phlegm with their conveyor-belt like action.
Ambroxol increases the body's production of surfactant
which helps to overcome infection in the bronchi.
Ambroxol has local anesthetic properties, which make it
an efficacious treatment for sore throat and to reduce
symptoms of chronic, neuropathic, and inflammatory pain.
Ambroxol inhibits the release of histamine, leukotrienes
and cytokines from human leukocytes and mast cells.It
has also well documented antioxidant properties.
(Sethi P.D,2010).
Literature survey revealed that very few methods
have been reported for the analysis of Gemifloxacin and
Ambroxal Hcl combinational dosage forms which include
UV spectroscopy,Spectrophotometric,spectroflurimetric,
Reverse Phase High performance Liquid Chromatography,
HPTLC methods. The present study illustrate
development and validation of simple, economical,
selective, accurate, precise RP-HPLC method for the
determination of Gemifloxacin and Ambroxol bulk and
Pharmaceutical dosage forms as per ICH guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of
Gemifloxacin and Ambroxol combined dosage form using
most commonly employed column (C18) and simple
mobile phase preparation.
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 702
In the present proposed work a successful attempt had
been made to develop a method for the simultaneous
estimation of Gemifloxacin and Ambroxol dosage form
and validate it. From the economical point of view and for
the purpose of routine analysis, it was decided to develop
a more economical RP-HPLC method with simple mobile
phase preparation for the estimation of Gemifloxacin and
Ambroxol dosage form. The method would help in
estimation of drugs in single run which reduces the time of
analysis and does not require separate method for each
drug. Thus, the paper reports an economical, simple and
accurate RP-HPLC method for the above said
pharmaceutical dosage forms.
2. MATERIALS AND METHODS
Quantitative HPLC was performed on a high performance
liquid chromatograph (Waters make), (software Empower,
2695 seperation module) HPLC system connected with
Lambindia UV detector. The drug analysis data were
acquired and processed using Empower software running
under Windows XP on a Pentium PC and Thermohypersil
BDS C18column (of dimension 100 × 4.6, 5µm particle
size). In addition an analytical balance (Afcoset ER-200A
0.1mg sensitivity), digital pH meter (Adwa-AD 1020), a
sonicator (Ultra sonic Cleaner) were used in this study
(Chagan, 2003).
Standards and chemicals used: Pharmaceutical grade
Gemifloxacin and Ambroxol were kindly supplied as a
gift sample by Reddy´s Laboratory, Hyderabad, and
Andhra Pradesh, India. Methanol was of HPLC grade and
Purchased from E. Merck, Darmstadt, Germany. Ortho
Phosphoric Acid was analytical reagent grade supplied by
Fischer Scientific Chemicals.Water HPLC grade was
obtained from a Milli-QRO water purification system.
Gemifloxacin and Ambroxol Tablets available in the
market in composition of Gemifloxacin (320mg),
Ambroxol (75mg).
Preparation of mobile phase: Mix a mixture of above
buffer 400 mL (40%) and 600 mL of acetonitrile HPLC
(60%) and degas in ultrasonic water bath for 5 minutes.
Filter through 0.45 µ filter under vacuum filtration.
Preparation of Sodium Phosphate buffer: Weighed
2.5milligrams of Sodium di hydrogen ortho phosphate into
a 1000ml beaker, dissolved and diluted to 1000ml with
HPLC water. pH of the mobile phase was adjusted to 5.8
with orthophosporic acid.
Diluent Preparation: Use the Mobile phase as diluent.
Standard Solution Preparation: Accurately weigh and
transfer 10 mg of Gemifloxacin & Ambroxol working
standard into a 100ml clean dry volumetric flask add
Diluent and sonicate to dissolve it completely and make
volume up to the mark with the same solvent. (Stock
solution)
Sample Solution Preparation: Accurately weigh and
transfer equivalent to 10 mg of Gemifloxacin & Ambroxol
sample into a 100ml clean dry volumetric flask add about
70mL of Diluent and sonicate to dissolve it completely
and make volume up to the mark with the same solvent.
(Stock solution).
System suitability: System suitabilityare an integral part
of chromatographic system. To ascertain its effectiveness,
certain system suitability test parameters were checked by
repetitively injecting the drug solutions at 100%,
concentrations level for Gemifloxocin and Ambroxol to
check the reproducibility of the system. At first the HPLC
system was stabilized for 40 min.One blank followed by
six replicate analysis of solution containing, 100% target
concentrations of Gemifloxocin and Ambroxol were
injected to check the system suitability. To ascertain the
system suitability for the proposed method, a number of
parameters such as theoretical plates, peak asymmetry,
and retention time were taken.
Recommended procedure:
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range of
60-140mcg and 7.5-17.5 mcg (50-150%) Gemifloxacin
and Ambroxol respectively. Method of least square
analysis is carried out for getting the slope, intercept and
correlation coefficient, regression data values and the
results were presented in Table:8. Calibration curves for
Gemifloxacin and Ambroxol: Accurately weigh and
transfer 10 mg of Gemifloxacin & Ambroxol working
standard into a 100mL clean dry volumetric flask add
about 70mL of Diluent and sonicate to dissolve it
completely and make volume up to the mark with the
same solvent.
Preparation of Level – I (50ppm of Gemifloxacin &
11.7 ppm Ambroxol): 5.0ml &1.17ml of Gemifloxacin &
Ambroxol stock solution has taken in 10ml of volumetric
flask dilute up to the mark with diluent.
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 703
Preparation of Level – II (60ppm of Gemifloxacin &
14.1 ppm Ambroxol): 6.0ml &1.41ml of Gemifloxacin &
Ambroxol stock solution has taken in 10ml of volumetric
flask dilute up to the mark with diluent.
Preparation of Level – III (70ppmof Gemifloxacin &
16.4 ppm Ambroxol): 7.0ml &1.64ml of Gemifloxacin &
Ambroxol stock solution has taken in 10ml of volumetric
flask dilute up to the mark with diluent.
Preparation of Level – IV (80ppmof Gemifloxacin &
18.8 ppm Ambroxol): 8.0ml &1.88ml of Gemifloxacin &
Ambroxol stock solution has taken in 10ml of volumetric
flask dilute up to the mark with diluent.
Preparation of Level – V (90ppmof Gemifloxacin &
21.1 ppm Ambroxol): 9.0ml & 2.11ml of Gemifloxacin
& Ambroxol stock solution has taken in 10ml of
volumetric flask dilute up to the mark with diluent.
Procedure:: Inject each level into the chromatographic
system and measure the peak area. Plot a graph of peak
area versus concentration (on X-axis concentration and on
Y-axis Peak area) . Represented in Table:9&10.
Validation study of Gemifloxacin and Ambroxol: An
integral part of analytical method development is
validation. Method validation is the process to confirm
that the analytical procedure employed for a specific test
is suitable for its intended use. The newly developed RP-
HPLC method was validated as per International
Conference on Harmonization (ICH) guidelines for
parameters like system suitability,
accuracy,linearity,precision (repeatability), limit of
detection (LOD), limit of Quantification (LOQ) and
robustness. (Dennis J, 2003)
Precision: Precision study of samples (Gemifloxacin and
Ambroxol) was carriedout by estimating corresponding
responses 5 times on the same day for the 100% target
concentration. The percent relative standard deviation
(%RSD) is calculated which is within the acceptable
criteria of not more than 2.0
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Gemifloxacin and Ambroxol by the method of addition.
Known amount of Gemifloxacin and Ambroxol at 50%,
100%, 150% is added to a pre quantified sample solution.
The recovery studies were carried out in the tablet. The
mean percentage recovery of Gemifloxacin and Ambroxol
at each level is not less than 98.0% and not more than
102%.
Robustness: The robustness is evaluated by the analysis
of Gemifloxacin and Ambroxol under different
experimental conditions such as making small changes in
flow rate (1.1 ml/min to 1.3ml/min), λmax (±5), column
temperature (±5), mobile phase composition (±5%), and
pH of the buffer solution.
LOD and LOQ:Limit of detection is the lowest
concentration in a sample that can be detected but not
necessarily quantified under the stated experimental
conditions. The limit of quantification is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy. Limit
of detection and limit of quantification were calculated
using following formula LOD = (SD)/S and LOQ =
(SD)/S, where SD= standard deviation of response (peak
area) and S= average of the slope of the calibration curve.
3. RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Gemifloxacin and Ambroxol.
Preliminary experiments were carried out to achieve the
best chromatographic conditions for the simultaneous
determination of the drug substances. Several column
types and lengths were tried considering other
chromatographic parameters. C18 column with a 4.6 mm
inner diameter and 5µm particle size was chosen. The
detection wave length was selected as 246nm with UV
detector. Chromatographic conditions were optimized by
changing the mobile phase composition and buffers used
in mobile phase. Different experiments were performed to
optimize the mobile phase but adequate separation of the
drugs could not be achieved. By altering the pH of buffer
results a good separation. Different proportions of solvents
were tested. Eventually the best separation was obtained
by the isocratic elution system using a mixture of
Acetonitrile and Orthophosphoric acid in the ratio of
(60:40) adjusted to pH- 5.8 at a flow rate of 1.2 ml/min. A
typical chromatogram for simultaneous estimation of the
two drugs obtained by using a above mentioned mobile
phase. Under these conditions Gemifloxacin and
Ambroxol were eluted at be 3.4min and 2.3min
respectively with a run time of 8 minutes.
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 704
The Acetonitrile and Orthophosphoric acid in the
ratio of (60:40) adjusted to pH- 5.8 was chosen as the
mobile phase. The run time of the HPLC procedure was 8
minutes at flow rate of 1.2ml/min was optimized which
gave sharp peak, minimum tailing factor.The system
suitability parameters were shown in Table:7 were in
within limit, hence it was concluded that the system was
suitable to perform the assay. The method shows linearity
between the concentration range of 60-140mcg for
Gemifloxacin and 7.5-17.5 for Ambroxol. The
experimental results were shown in table 9,10.The %
recovery of Gemifloxacin and Ambroxol was found to be
in the range of 98.0 to 102.0 and 100.5-100.59
respectively. As there was no interference due to
excipients and mobile phase, the method was found to be
specific. As both compounds pass the peak purity, The
method was robust and rugged as observed from
insignificant variation in the results of analysis by changes
in Flow rate, column oven temperature, mobile phase
composition and wave length separately and analysis
being performed by different analysts. The results were
shown in Table.1.The LOD and LOQ values were
calculated based on the standard deviation of the response
and the slope of the calibration curve at levels
approximately LOD and LOQ were found to be 2.93 and
9.91 for Gemifloxacin and 3.0 and 9.97 for Ambroxol
respectively which shows that the method is very
sensitive.
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method
Parameter Chromatographic conditions
Instrument Waters, HPLC soft ware Empower,2695 seperation module 2487
Column Thermohypersil BDS C18column of dimension 100 × 4.6, 5µm particle
size.
Detector 2487 UV Detector.(DAD)
Diluents Methanol,Acetonitrile,Orthophosphoric acid.
Mobile phase Acetonitrile,orthophosphoric acid (60:40 )pH- 5.8
Flow rate 1.2ml/min
Detection wavelength 246nm
Temperature 25°c
Injection volume 20µl
Retention time Gemifloxacin:3.4; Ambroxol:2.3
Theoretical plate count Gemifloxacin:2265; Ambroxol: 4067
Tailing factor Gemifloxacin: 1.71; Ambroxol: 1.41
Table.2.Specificity study Table.3.Results of precision study Name of the solution Retention time in min
Blank No peaks
Gemifloxacin 3.4
Ambroxol 2.3
Injection Area
(Gemifloxacin)
Area
(Ambroxol)
Injection-1 2226346 618580
Injection-2 2225186 610329
Injection-3 2217922 614718
Injection-4 2176317 616030
Injection-5 2187753 616391
Average 2206705 615210
Standard Deviation 23107 3061.4
%RSD 1.05 0.50
Table.4.Recovery data of the proposed Gemifloxacin %Concentration
(at specification Level)
Area Amount
Added (mg)
Amount
Found (mg)
% Recovery Mean
Recovery
50% 1023451 5.0 4.97 99.56% 100.05%
100% 2055454 10.0 9.99 99.9%
150% 3105394 15.0 15.10 100.7%
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 705
Table.5. Recovery data of the proposed Ambroxol %Concentration
(at specification Level)
Area Amount
Added (mg)
Amount
Found (mg)
% Recovery Mean
Recovery
50% 263040 5.0 5.02 100.47% 100.59%
100% 520157 10.0 9.93 99.34%
150% 800883 15.0 15.30 101.97%
Fig.1. Structure of Gemifloxacin Fig.2. Structure of Ambroxol
Fig.3. Standard chromatogram for Gemifloxacin and Ambroxol
Fig.4. Sample chromatogram for Gemifloxacin and Ambroxol
4. CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Gemifloxacin and Ambroxol tablet
dosage forms in bulk and pharmaceutical dosage forms
was established. The method was completely validated
shows satisfactory results for all the method validation
parameters tested and method was free from interferences
of the other active ingredients and additives used in the
formulation. Infact results of the study indicate that the
developed method was found to be simple, reliable,
accurate, linear, sensitive, economical and reproducible
and have short run time which makes the method rapid.
Hence it can be concluded that the proposed method was a
good approach for obtaining reliable results and found to
be suitable for the routine analysis of Gemifloxacin and
Ambroxol Bulk drug and Pharmaceutical formulations.
ACKNOWLEDGEMENT
The authors would like to thank beloved parents and all
my well-wishers, one and all who have helped me directly
and indirectly in completing this project work.
REFERENCES
Snyder, L.R., Kirkland, J.J. and Glajch, J.L, “Practical
HPLC Method Development”, 2nd edition. John Wiley
and Sons, Inc, 1997, 653-660.
Sethi P.D. HighPerformance Liquid Chromatograph
Quantitative Analysis of Pharmaceutical Formulations, 1st
Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 706
edition. CBS Publishers and Distributors, New Delhi,
2001, 60.
ICH Guidelines Q2B, Validation of Analytical Procedure,
Definitions, Geneva, Switzerland, March 1996
Chagan L, Gemifloxacin for the Treatment of Acute
Bacterial Exacerbation of Chronic Bronchitis and
Community-Acquired Pneumonia, Drug Forecast, 28(12),
2003, 769-79.
Dennis J. Cada, Terri Levien, Danial E. Baker,
Gemifloxacin Mesylate, Hospital Pharmacy, Wolters
Kluwer Health, Inc, 38, 2003, 85161.
Aqheel et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 707
EVALUATION OF THE ANTI HYPERGLYCEMIC ACTIVITY OF METHANOLIC
EXTRACT OF ROOT OF HELIOTROPIUM INDICUM IN STREPTOZOTOCIN AND
ALLOXAN INDUCED DIEBETIC RATS. Aqheel MA
* Janardhan M, Durrai vel S,
Department of pharmacology, Nimra College of pharmacy, Vijayawada, Andhra Pradesh, India
Corresponding author: [email protected]
ABSTRACT
The root of Heliotropium indicum is reported to have good medicinal values in traditional system of
medicines. Commonly called as Indian Turnsole, is a herb with slightly woody at base. The present study
highlights the anti hyperglycemic activity of Methanolic extract of root of Heliotropium Indicum in
Streptozotocin (60mg/kg i.p) for 15days and Alloxan (120mg/kg i.p) for 21 days induced Diabetic rats. The anti
hyperglycemic activity of oral administration of Methanolic extract of root of Heliotropium Indicum at 100mg/kg,
250mg/kg, and 500mg/kg was investigated in diabetic rats. Glibenclamide10mg/kg, p.o was used as standard
drug. The extract decreased the blood glucose level, feed and water intake as well as triacylglycerols at the three
doses investigated while the best result was obtained at 500 mg/Kg for both STZ and Alloxan induced diabetic
rats. In addition, the weight loss of diabetic-treated rats was markedly normalized at all doses. The glucose
tolerance level of diabetic animals was effectively reduced to near normal level after 90 min of extract
administration especially at the dose of 250 and 500 mg/Kg. Further, the Histopathological examination of
pancreas supported the anti-Hyperglycemic activity of test extract. All the data was analyzed by using one way
analysis of variance (ANOVA) followed by multiple comparison Dunnett’s test and the acceptance criteria was
P<0.05.
KEY WORDS: Heliotropium indicum, Streptozotocin (STZ), Alloxan, Glibenclamide.
INTRODUCTION
Diabetes is defined as a state in which the
homeostasis of carbohydrate and lipid metabolism is
improperly regulated by the pancreatic hormone, insulin,
ultimately resulting in increased blood glucose level. It is
the world’s largest endocrine disorder and is one of the
major killers in recent times. According to World Health
Organization (WHO), the world wide global population is
in the midst of a diabetes epidemic with people in
Southeast Asia and Western Pacific being mostly at risk.
The number of cases for diabetes which is currently at 171
million is predicted to reach 366 million by the end of
2030. Therefore, it is necessary to search for new drugs
and interventions that can be used to manage this
metabolic disorder. The most prevalent form of diabetes is
non-insulin dependent diabetes mellitus (type 2).
Ayurvedic, the Indian system of traditional medicine,
provides a number of medicinal plants to treat type2
diabetes. Traditional knowledge and historic literatures on
medicine play an important role in the discovery of novel
leads from medicinal plants.
Heliotropium indicum Linn. Commonly known as
‘Indian heliotrope’ is very common in India and some
parts of Africa and Bangladesh, but also found in other
countries. H. indicum has been used in different traditional
and folklore systems of medicine for curing various
diseases. An ethnopharma-cological survey revealed that,
the traditional healers in Kancheepuram district of Tamil
Nadu, India use H. indicum to cure skin diseases, poison
bites, stomachache and nervous disorders.
In some
African countries, another ethnopharma-cological survey
reports that H. indicum is believed to be useful in treating
malaria, abdominal pain and dermatitis. The highest
number of usages (22%) was reported for the treatment of
malaria. H. indicum is very rich in pyrrolizidine alkaloids.
Numerous pyrrolizidine alkaloids have been identified in
this plant by several authors. The alkaloids reported in the
entire plant include heliotrine , lasiocarpine, indicine, 12-
acetyl indicine , indicinine.
MATERIALS AND METHODS
Collection of Plant Material: The fresh root of
Heliotropium Indicum was collected from the surrounding
fields of Harapanahalli in the month of June 2013.
Identification and authentification was done by Dr K.
Madhava Chetty, Assistant Professor, Department of
Botany, at Sri Venkateswara University, Tripati, A.P,
India
Preparation of the plant Extract: The fresh roots were
collected, cleaned and shade dried at room temperature.
The dried roots were coarse powdered by using grinder.
The coarse powder was packed in Soxhlet column and
then extracted with 95% Methanol (75-80⁰C). Thereafter,
the extract was concentrated using rotary flash evaporator
(50⁰C).
Animals: Sprague Dawley rats weighing 200-250 g were
used for the present study. The animals were maintained
under standard environmental conditions and were fed
with standard pellet diet and water ad libitum.
Aqheel et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 708
The study was approved by Institutional Animal
Ethics Committee (Reg.no.769/2010/CPCSEA), Proposal
no.191/ACE/CPCSEA. CPCSEA guidelines were adhered
during the maintenance and experiment.
Acute Toxicity Study: 95% MEHI was studied for acute
toxicity at dose of 200 mg/kg i.p. in female albino mice.
The extract was found devoid of mortality of the animals.
Hence 2500 mg/kg was considered as LD50 cut off value.
Hence, the doses selected for extract as per the OECD
guidelines No. 420 (Annexure - 2d) fixed dose method are
mentioned below.
100 mg/kg (1/25th of 2500 mg/kg)
250 mg/kg (1/10th of 2500 mg/kg)
500 mg/kg (1/5th of 2500 mg/kg)
Induction of Non Insulin Dependent Diabetes Mellitus
(NIDDM):
Streptozotocin induced hyperglycemia: Fasting blood
glucose was determined after depriving food for 16 hr
with free access of drinking water. Hyperglycemia was
induced by a single i.p. injection of 60 mg/kg of
Streptozotocin (SISCO Chem Pvt. Ltd., Mumbai, India) in
0.1M citrate buffer pH of 4.5. After 3 days of
Streptozotocin injection, the hyperglycemic rats (glucose
level > 200 mg/dl) were separated and divided into
various groups comprising of 6 rats. Normal control,
diabetic control and standard groups kept same for
antidiabetic activity of root extract. The treatment (p.o.)
was started from the same day except normal control and
diabetic control groups for a period of 15 days. During
this period, animals in all groups had free access to
standard diet and water. Body weight and blood glucose
levels were measured on ‘0’ day, 7th, 10th and 15th day of
the post treatment in overnight fasted animals. On 15th
day, blood samples were collected from rats by retro
orbital plexus for biochemical estimations. The whole
pancreas from all the animals was removed immediately
and was kept in 10% formalin solution for
Histopathological examination.
Alloxan induced hyperglycemia: Fasting blood glucose
was determined after depriving food for 16 hr with free
access of drinking water. Hyperglycemia was induced by a
single i.p. injection of 120 mg/kg of alloxan monohydrate
(s.d. fine-chem. Ltd., Mumbai, India) in sterile saline.
After 5 days of alloxan injection, the hyperglycemic rats
(glucose level > 200 mg/dl) were separated and divided
into various groups comprising of 6 rats. Normal control,
diabetic control and standard groups kept same for
antidiabetic activity of root extract. The treatment (p.o.)
was started from the same day except normal control and
diabetic control groups for a period of 21 days. During
this period, animals in all groups had free access to
standard diet and water. Body weight and blood glucose
levels were measured on ‘0’ day, 7th, 14th and 21th day of
the post treatment in overnight fasted animals. On 21th
day, blood samples were collected from rats by retro
orbital plexus for biochemical estimations. The whole
pancreas from all the animals was removed immediately
and was kept in 10% formalin solution for
Histopathological examination.
Anti Hyperglycemic Study:
Group I - Served as normal control and did not receive
any treatment.
Group II - Served as diabetic control and received Inducer
and vehicle.
Group III - Inducer + Glibenclamide (10 mg/kg p.o.) and
served as standard.
Group IV - Inducer + 95% MEHI extract (100 mg/kg,
p.o.)
Group V - Inducer + 95% MEHI extract (250 mg/kg, p.o.)
Group VI - Inducer + 95% MEHI seed extract (500
mg/kg, p.o.)
The parameters studied are as follows:
Biochemical parameters include;
a) Fasting blood glucose.
b) Serum urea.
c) Serum creatinine.
d) Serum total cholesterol.
e) Serum protein.
Morphological parameter includes; Body weight.
Statistical Analysis: Values were represented as mean ±
S.D. for 6 animals in each group. Data were analyzed
using one-way analysis of variance (ANOVA) followed
by multiple comparison Dunnett’s test. The values were
considered significant when p< 0.05.
RESULTS AND DISCUSSION
Table.1.Effect of 95% MEHI Extract on Body weight in Streptozotocin Induced Diabetic Rats Groups Dose (mg/ kg) Body Weight (Mean ± S.E.M)
0thday 7thday 10thday 15thday
G I Norma control 229.33±2.53 232 ±4.31 251.00 ±6.84 258.50 ±9.79
G II Diabetic control (Vehicle) 190.67 ±3.72 175 ±3.41 163.50 ±0.99 129 ±1.59
G III 10 mg/ kg 193.17 ±2.20 176.1 ±5.6 182.00±2.28*** 165.20 ±2.08***
G IV 100 mg/ kg 186.50 ±3.53 184 ±3.61 183.17±2.52***
187.17 ±3.23***
G V 250 mg/ kg 190.83 ±1.30 185 ±2.90* 178.50±4.22** 178.67 ±3.46***
G VI 500 mg/ kg 185.83 ±3.00 191.5±4.17* 192.67±4.04*** 196.17±1.35*** Values are expressed as mean ± SEM; n=6. *P < 0.05, **P<0.01 and ***P<0.001 Vs Diabetic control
Aqheel et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 709
Table.2. Effect of 95% MEHI Extract on Serum Glucose levels in Streptozotocin Induced Diabetic Rats
Groups Dose (mg/ kg) Fasting Serum Glucose (mg/dl) Mean ± S.E.M)
0th
day 7th
day 10th
day 15th
day
G I Norma control 95.90 ± 3.4 94.87 ± 2.1 94.1 ± 1.70 95.67 ± 4.0
G II Diabetic
control(Vehicle)
250.80 ±9.76
256.51±8.8 233.80± 9.76 259.62 ±10.1
G III 10 mg/ kg 250.52±10.87 220.63±9.71* 165.76±12.11 121.25±12.3***
G IV 100 mg/ kg 253.39 ±7.78 250.3 ± 6.9 230.54 ± 9.9 189.91±10.87***
G V 250 mg/ kg 253.15±10.12 240.41 ±11.1 175.63±10.09** 143.69 ±11.4***
G VI 500 mg/ kg 254.98 ± 19 229.13 ±10.1 167.21 ±10.1***
122.01 ±1.35***
Table.3. Effect of 95% MEHI Extract on Biochemical Parameters in Streptozotocin Induced Diabetic Rats
Groups Dose(mg/kg) Serum
Urea (mg/dl)
Serum
Creatinine (mg/dl)
Serum
Cholesterol (mg/dl)
Serum
Protein (g/dl)
G I Norma control 55.61 ±1.80 0.7 ± 0.01 65.13 ± 2.5 8.1 ± 0.9
G II Diabetic control(Vehicle) 123.67±0.05 1.56 ± 0.05 130.13±2.3 5.1 ± 0.24
G III 10 mg/ kg 58.88±3.19** 0.54±0.02*** 61.9± 4.1*** 8.5 0.34***
G IV 100 mg/ kg 87.96 ±4.75 0.96±0.01*** 108.4± 4.4** 5.9 ± 0.19*
G V 250 mg/ kg 74.27 ±4.60* 0.71±0.04*** 81.8± 3.6*** 7.01±0.48**
G VI 500 mg/ kg 65.62±3.61** 0.59±0.03*** 73.4±1.2*** 7.6 ±0.47** Values are expressed as mean ± SEM; n=6.*P < 0.05, **P<0.01 and ***P<0.001 Vs Diabetic control.
Table.4. Effect of 95% MEHI Extract on Body weight in Alloxan Induced Diabetic Rats TREATMENT Body weight (gram)
Day 1 Day 7 DAY14
G I 223±2.10
229.5±2.94 231.7±2.19
G II 222±3.15 213±2.17c 216.7±2.74b
G III 220±2.46 222.5±4.56* 229.2±3.18***
G IV 219.5±3.16 222.5±3.15* 228.3±2.70*
G V 224.16±2.47 248.3±2.26* 251.7±2.10**
G VI 223.15±2.56 248.6±2.25 253.45±2.13
Table.5. Effect of 95% MEHI Extract on Serum Glucose levels in Alloxan Induced Diabetic Rats Groups Fasting Serum Glucose (mg/dl) Mean ± S.E.M)
0th
DAY 1stday 7
thday 14
thday
G I 82.00±3.540 85.839±3.030 88.44±5.162 87.76±2.056
G II 253.00±7.739 264.25±3.199 271.17±4.786a 240.25±3.071
a
G III 229.83±5.597 229.34±3.613 115.14±3.189** 94.49±2.421***
G IV 220.00±3.765 225.12±2.055 155.20±4.112* 112.45±1.987*
G V 231.68±6.332 228.15±2.045 122.90±1.53* 109.55±1.998**
G VI 245.65±7.23 210.58±2.46 110.36±1.59*** 97.25±1.67***
Table.6.Effects of 95% MEHI Extract on Biochemical Parameters in Alloxan Induced Diabetic Rats Groups Dose (mg/kg) Serum urea (mg/dl) Serum creatinine (mg/dl) Serum cholesterol (mg/dl) Serum protein (g/dl)
G I Norma control 45.23 ±1.85 0.5 ± 0.01 70.12 ± 2.5 9.3 ± 0.9
G II Diabetic
control(Vehicle)
110.5±2.54 1.23 ± 0.05 150.25±2.3 4.63 ± 0.24
G III 10 mg/ kg 52.36±3.19** 0.65±0.02*** 50.28±4.1*** 8.5 ±0.34***
G IV 100 mg/ kg 92.55 ±4.75 0.84±0.01*** 120.56±4.4** 6.23 ± 0.19*
G V 250 mg/ kg 83.20 ±4.60* 0.78±0.04*** 100.45±3.6*** 8.25±0.48**
G VI 500 mg/ kg 68.25±3.61** 0.59±0.03*** 75.63±1.2*** 7.56 ±0.47**
All the values are expressed as mean±SEM, N=6, One way analysis of variance (ANOVA) followed by multiple comparison Dunnett’s test, *p<0.05, **p<0.01
and ***p<0.001 as compared to control group. And bp<0.01, cp<0.05as compared to Normal group
Aqheel et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 710
Effects of 95% MEHI Extract on Histopathological
changes of pancreas in Streptozotocin Induced
Diabetic Rats: Group –I: Normal control - Photomicrograph shows
normal acini and normal cellular population in the islets of
langerhans of pancreas (Fig-1).
Group – II: Diabetic control - It suggests extensive
damage to the islets of langerhans and reduced dimensions
of islets (Fig-2).
Group –III: Standard - It suggests restoration of normal
cellular size of islets with hyperplasia (Fig-3).
Group –IV: 95% Methanolic root extract (100 mg/kg) -
Less restoration of cells of islet of langerhans can be
observed (Fig-4).
Group –V: 95% Methanolic root extract (250 mg/kg) - It
suggests possible restoration of repair of the cells of islet
of langerhans (Fig-5).
Group –VI: 95% Methanolic root extract (500 mg/kg) –
Maximum restoration of the cells of islet of langerhans
can be observed (Fig-6).
The results obtained from the present investigation
demonstrated that the root extract of Heliotropium indicum
constantly maintained significant reduction of the glucose
level in streptozotocin and alloxan mediated diabetic rats
throughout the experimental period suggesting the
antihyperglycemic property of the title plant. In the present
study, it was observed the extract reversed the weight loss
of the diabetic rats. Alloxan has been shown to induce free
radical production and cause tissue injury. The pancreas is
especially susceptible to the action of alloxan induced free
radical damage.
The Dose of 60mg/kg Streptozotocin can induces
an autoimmune process that results in the destruction of the
ß-cells islets of Langerhans; it also results in the toxicity of
beta cells with emergence of clinical diabetes within 2-4
days. The results of the present study also indicated the
extract can reduce the levels of serum urea, creatinine, and
cholesterol. Increase the serum protein and the major
function of the extract is to protect vital tissues (Kidney
and liver) including the pancreas, thereby reducing the
causation of diabetes in the experimental animals.
Figure.1 Figure.2 Figure.3 Figure.4
CONCLUSION
The results of the present study indicated that
Heliotropium Indicum root extract possesses significant
anti hyperglycemic activity against streptozotocin and
alloxan induced diabetic rats. Thus justifies the traditional
use of this plant in the treatment of diabetes mellitus. Root
extract of the title plant possesses almost equipotent
antidiabetic activity when compared with reference
standard Glibenclamide.
REFERENCES
Asprey GF and Thornton P, Medicinal plants of Jamaica,
Part-III, West Indian Med J, 4(4), 1955, 69-82.
Bhat M, Zingarde SS, Bhargava SY, Kumar AR, Joshi
BN, Antidiabetic Indian plants: a good source of potent
amylase inhibitors. Evidence Based on Complementary
and Alternative Medicine, 2008,
doi:10.1093/ecam/nen040
Buenz EJ, Johnson HE, Beekman EM, Motley TJ, Bauer
BA, Bioprospecting Rumphius’s Ambonese herbal, I.
Journal of Ethnopharmacology, 1(96), 2005, 57–70.
Chellaiah M, Muniappan A, Nagappan R and Savarimuthu
I, Medicinal plants used by traditional healers in
Kancheepuram district of Tamil Nadu. Indian J Ethnobiol
Ethnomed, 2, 2006, 43.
World Health Organization (WHO), 2006.Diabetes
Programme. Available at http://www.who.Int/diabetes/en/
(accessed 15.10.07).
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 711
NOVEL RP-HPLC METHOD DEVELOPMENT AND VALIDATION OF METFORMIN AND
PIOGLITAZONE DRUGS IN PURE AND PHARMACEUTICAL DOSAGE FORMS Alekhya Pallapolu, Aneesha A
Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email: [email protected], Phone +91-9700244833
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise reverse phase
high performance liquid chromatographic method for the simultaneous estimation of metformin and pioglitazone
in pure and pharmaceutical dosage forms. Metformin and pioglitazone were well separated using a HYPERSIL
BDS C18column of dimension 250 × 4.6, 5µm and Mobile phase consisting of Phosphate buffer( Pottasium
dihydrogen phosphate) : Methanol (Adjusted with Ortho phosphoric acid to pH-4.5) in the ratio of 70:30v/v at the
flow rate 1 ml/min and the detection was carried out at 240nm with PDA detector. The Retention time for
Metformin and Pioglitazone were found to be 1.945, 3.595min respectively. The developed method was validated
for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully
applied to Metformin, and Pioglitazone combination pharmaceutical dosage form.
KEY WORDS: RP-HPLC, Metformin, Pioglitazone, Accuracy, Precision.
1. INTRODUCTION
Metformin (1, 1- Dimethyl biguanide monohydro
chloride) is a member of the drug class known as Anti
Diabetic agent. It is used for type-2 diabetes. Metformin
improves hyperglycemia primarily through its suppression
of hepatic glucose production (hepatic glucogenesis). It
activates AMP-activated protein kinase (AMPK), a liver
enzyme that plays an important role in insulin signaling,
whole body energy balance, and metabolism of glucose
and fats, incisory effect on the production of glucose by
liver cells. The mechanism by which bigaunides increase
the activity of AMPK remains uncertain. Metformin
increases the amount of cytosolic AMP. Metformin
increases insulin sensitivity, fatty acid oxidation and
decreases absorption of glucose from the gastrointestinal
tract. AMPK probably plays a role, as Metformin
administration increases AMPK activity skeletal muscle.
AMPK is known to cause GLUT4 deployment to the
plasma membrane, resulting insulin –independent glucose
uptake.
Pioglitazone acts as an agonist at peroxisome
proliferator activated receptors (PPAR) in target tissues
for insulin action such as adipose tissue, skeletal muscle,
and liver. Activation of PPAR- gamma receptors increases
the transcription of insulin-response genes involved in the
control of glucose production, transport, and utilization. In
this way, pioglitazone both enhances tissue sensitivity to
insulin and reduces hepatic gluconeogenesis. Thus, insulin
resistance associated with type-2 diabetes mellitus is
improved without an increase insulin secretion by
pancreatic cells.
Literature survey revealed that very few methods
have been reported for the analysis of Metformin and
Pioglitazone combinational dosage forms which include
UV spectroscopy, Chromatography. In view of the need
for a suitable Spectrophotometric and RP-HPLC methods
for routine analysis of Metformin and Pioglitazone in
formulations, attempts were made to develop simple,
precise and accurate analytical method for estimation of
Metformin and Pioglitazone and extend it for their
determination in formulation as per ICH guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of Metformin
and Pioglitazone in combined dosage form using most
commonly employed column (C18) and simple mobile
phase preparation. In the present proposed work a
successful attempt had been made to develop a method for
the simultaneous estimation of Metformin and
Pioglitazone pharmaceutical dosage form and validate it.
From the economical point of view and for the purpose of
routine analysis, it was decided to develop a more
economical RP-HPLC method with simple mobile phase
preparation for the estimation of Metformin and
Pioglitazone combinational dosage form. The method
would help in estimate of drugs in single run which
reduces the time of analysis and does not require separate
method for each drug. Thus, the paper reports an
economical, simple and accurate RP-HPLC method for the
above said pharmaceutical dosage forms.
2. MATERIALS AND METHODS
Quantitative HPLC was performed on a high
performance liquid chromatograph -Waters e2695Alliance
HPLC system connected with PDA Detector 2998 and
Empower2 Software. The drug analysis data were
acquired and processed using Empower2 software running
under Windows XP on a Pentium PC and HYPERSIL
C18column of dimension 100 × 4.6, 5µm particle size. In
addition an analytical balance (DENVER 0.1mg
sensitivity), digital pH meter (Eutech pH 510), a sonicator
(Unichrome associates UCA 701) were used in this study.
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 712
Standards and chemicals used: Pharmaceutical grade
Metformin and Pioglitazone were kindly supplied as a gift
sample by NATCO, Hyderabad, and Andhra Pradesh,
India. Methanol was of HPLC grade and Purchased from
E. Merck, Darmstadt, Germany. Ortho Phosphoric Acid
was analytical reagent grade supplied by Fischer Scientific
Chemicals. Water HPLC grade was obtained from a Milli-
QRO water purification system.Metformin and
Pioglitazone Tablets available in the market as zipio m, in
composition of Metformin (500mg), Pioglitazone (7.5mg).
Preparation of mobile phase: Transfer 13.02gm of
KH2PO4into 1000ml of beaker dissolve and diluted
volume with methanol. Then adjust its pH to 4.5.
Composition of mobile phase was 70:30 v/v Buffer and
Methanol respectively. Finally the mobile phase was
filtered through 0.45µ membrane filter and degassed by
sonication.
Preparation of calibration standards: 500mg
Metformin and 7.5mg pioglitazone was taken into a 50, 5
ml of volumetric flask and add 25ml of diluent and
sonicated for 10 minutes and made up with Diluent. It was
further diluted to get stock solution of Metformin and
Pioglitazone. This was taken as a 100% concentration.
Working standard solutions of Metformin and
Pioglitazone was prepared with mobile phase. A series of
25 ml volumetric flasks containing standard solutions of
Metformin and Pioglitazone were prepared.
System suitability: System suitability is an integral part
of chromatographic system. To ascertain its effectiveness,
certain system suitability test parameters were checked by
repetitively injecting the drug solutions at 100%
concentration level for Metformin and Pioglitazone to
check the reproducibility of the system. At first the HPLC
system was stabilized for 40 minion blank followed by six
replicate analysis of solution containing 100% target
concentration of Metformin and Pioglitazone were
injected to check the system suitability. To ascertain the
system suitability for the proposed method, a number of
parameters such as theoretical plates, peak asymmetry,
and retention time were taken and results were presented
in Table 1.
Recommended procedure:
Calibration curves for Metformin and Pioglitazone:
Replicate analysis of solution containing 1-3µg/mL,
0.015-0.45µg/mL of Metformin and Pioglitazone sample
solutions respectively were injected into HPLC according
to the procedure in a sequence and chromatograms were
recorded.Calibration curves were constructed by plotting
by taking concentrations on X-axis and ratio of peak areas
of standards on Y-axis and regression equation were
computed for both drugs and represented in Table .6
Analysis of marketed formulation: The content often
tablets was weighed accurately. Their average weights
were determined. Powder of tablets equivalent to
twotablets weight (1302.6mg) were weighed and taken in
a 50ml volumetric flask, dissolved in diluents, shaken and
sonicated for about 20 minutes then filtered through 0.45µ
membrane filter. The filtered solution was further diluted
(5 to 25ml) in the diluents to make the final concentration
of working sample equivalent to 100% of target
concentration. The prepared sample and standard solutions
were injected into HPLC system according to the
procedure. From the peak areas of Metformin and
Pioglitazone the amount of the drugs in the sample were
computed. The contents were calculated as an average of
six determinations and experimental results were
presented in Table 4. The representive standard and
sample chromatograms were shown in fig.2 and fig.3.
Validation study of Metformin and Pioglitazone: An
integral part of analytical method development is
validation. Method validation is the process to confirm
that the analytical procedure employed for a specific test
is suitable for its intended use. The newly developed RP-
HPLC method was validated as per International
Conference on Harmonization (ICH) guidelines for
parameters like specificity, system suitability, accuracy,
linearity, precision (repeatability), limit of detection
(LOD), limit of Quantification (LOQ) and robustness.
Specificity: The effect of wide range of excipients and
other additives usually present in the formulation of
Metformin and Pioglitazone in the determination under
optimum conditions were investigated. The specificity of
the RP-HPLC method was established by injecting the
mobile phase and placebo solution in triplicate and
recording the chromatograms. The common excipients
such as lactose anhydrous, microcrystalline cellulose and
magnesium state have been added to the sample solution
injected and tested.
Precision: precision study of sample (Metformin and
Pioglitazone) was carried out by estimating corresponding
responses 6 times on the same day for the 100% target
concentration. The percent relative standard deviation
(%RSD) is calculated which is within the acceptable
criteria of not more than 2.0.
Linearity: The linearity graphs for the proposed assay
methods were obtained over the concentration range of1-
3µg/mL, 0.015-0.045µg/mL (50-150%) Metformin and
Pioglitazone respectively. Method of least square analysis
is carried out for getting the slope, intercept and
correlation coefficient, regression data values and the
results were presented in Table 2. The representative
chromatograms indicating the sample were shown in
figures 2&3. A calibration curve was plotted between
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 713
concentration and area response and statistical analysis of
the calibration curves were shown in figures 6&7.
Accuracy (Recovery studies): The accuracy of the
method is determined by calculating recovery of
Metformin andPioglitazone by the method of addition.
Known amount of Metformin andPioglitazone at 50%,
100%, 150% is added to a pre quantified sample solution.
The recovery studies were carried out in the tablet in
triplicate each in the presence of placebo. The mean
percentage recovery of Metformin and Pioglitazone at
each level is not less than 99% and not more than 100%.
Robustness: The robustness is evaluated by the analysis
of Metformin and Pioglitazone under different
experimental conditions such as making small changes in
flow rate (±0.2 ml/min), λmax (±5), column temperature
(±5), mobile phase composition (±5%), and pH of the
buffer solution.
LOD and LOQ: Limit of detection is the lowest
concentration in as ample that can be detected but not
necessarily quantified under the stated experimental
conditions. The limit of quantification is the lowest
concentration of analytic in a sample that can be
determined with acceptable precision and accuracy. Limit
of detection and limit of quantification were calculated
using following formula LOD=3.3(SD)/S and
LOQ=10(SD)/S, where SD = standard deviation of
response (peak area) and S= average of the slope of the
calibration curve.
RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Metformin and Pioglitazone.
Preliminary experiments were carried out to achieve the
best chromatographic conditions for the simultaneous
determination of the drug substances. Several column
types and lengths were tried considering other
chromatographic parameters. C18 column with a 4.6 mm
inner diameter and 5µm particle size was chosen. The
detection wave length was selected as 240nm with PDA
detector. Chromatographic conditions were optimized by
changing the mobile phase composition and buffers used
in mobile phase. Different experiments were performed to
optimize the mobile phase but adequate separation of the
drugs could not be achieved. By altering the pH of buffer
results a good separation. Different proportions of solvents
were tested. Eventually the best separation was obtained
by the isocratic elution system using a mixture of
phosphate buffer ( potassium di hydrogen phosphate) :
Methanol (70:30, v/v)(Adjusted pH 4.5 with Ortho
Phosphoric Acd ) at a flow rate of 1 ml/min. a typical
chromatogram for simultaneous estimation of the two
drugs obtained by using a above mentioned mobile phase.
Under these conditions Metformin and Pioglitazone were
eluted at 1.94 minutes and 3.59 minutes respectively with
a run time of 6 minutes. The representative chromatogram
of this simultaneous estimation shown in fig. 3 & 4 and
results were summarized in Table 1.
The Methanol and water (pH 4.5 with Potasssium
Di hydrogen Phosphate) (70:30, v/v) was chosen as the
mobile phase. The run time of the HPLC procedure was 6
minutes at flow rate of 1ml/min was optimized which
gave sharp peak, minimum tailing factor. The system
suitability parameters were shown in Table 1were in
within limit, hence it was concluded that the system was
suitable to perform the assay. The method shows linearity
between the concentration ranges of 1-3µg/mL, 0.015-
0.045µg/mL. The experimental results were shown in
table 6 and fig.6&7.The % recovery of Metformin and
Pioglitazone was found to be in the range of 99.41 to
99.67 % & 99 to 100% respectively. As there was no
interference due to excipients and mobile phase, the
method was found to be specific. As both compounds pass
the peak purity, the method was found to be specific. The
method was robust and rugged as observed from
insignificant variation in the results of analysis by changes
in Flow rate, column oven temperature, mobile phase
composition and wave length separately and analysis
being performed by different analysts. The results were
shown in Table5.The LOD and LOQ values were
calculated based on the standard deviation of the response
and the slope of the calibration curve at levels
approximately the LOD and LOQ. The limit of detection
was obtained as 0.125µg/mL for Metformin and
0.026µg/mL for Pioglitazone which shows that the
method is very sensitive. The results were shown in
Table.7.
Figure.1.Structure of Metformin Figure.1.Structure of Pioglitazone
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 714
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions
Instrument Waters e2695 Alliance HPLC with Empower2 software
Column HYPERSIL C18, (5μ, 250 x 4.6mm)
Detector PDA Detector 2998
Diluents Methanol
Mobile phase Phosphate buffer(Potassium dihydrogen phosphate):methonal (adjusted pH
4.5 with ortho phosphate) (70:30 v/v)
Flow rate 1ml/min
Detection wavelength 240nm
Temperature 35°c
Injection volume 10µl
Retention time Metformin:1.948; Pioglitazone:3.594
Theoretical plate count Metformin:2132; Pioglitazone:2349
Tailing factor Metformin:1.84; Pioglitazone:1.76
Resolution factor 7
Table.2.Specificity study
Name of the solution Retention time in min
Blank No peaks
Metformin 1.948min
Pioglitazone 3.594min
Table.3.Results of precision study
Sample Injection number Precision
RT Peak area
Metformin
1 1.947 10627252
2 1.948 10643033
3 1.951 10699827
4 1.954 10695555
5 1.949 10626006
6 1.954 10646083
Mean 10656293
%RSD(NMT 2.0) 0.3
Pioglitazone
1 3.594 5647514
2 3.593 5642430
3 3.595 5649391
4 3.595 5653442
5 3.593 5643778
6 3.593 5647612
Mean 5647361
%RSD(NMT 2.0) 0.1
Table.4.Recovery data of the proposed Metformin and Pioglitazone
Sample Spiked Amount
(µg/ml)
Recovered Amount
(µg/ml)
%Recovered %Average
recovery
Metformin 992.78 993.19 100
99.66% 1985.5 1975.6 99
2969.2 2958.22 100
Pioglitazone 14.89 14.90 100
100.% 29.78 29.77 100
44.53 44.6 100
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 715
Table.5.Robustness results of Metformin and Pioglitazone
Table.6.Linearity data of the Metformin and Piogitazone
Sample Linearity level
(µg/ml)
Peak area Slope Y-intercept r²
Metformin 0.1 2581359
192888
99780.88
0.999 0.15 4170046
0.2 4989227
0.25 5779047
0.3 7896996
Pioglitazone 0.01 1465678
19288
61387
0.999 0.015 2455416
0.02 2921616
0.025 3411233
0.03 4689975
Table.7.Limit of Detection and Limit of Quantification
Parameter Metformin Pioglitazone
Limit of detection(LOD) 0.125µg/mL 0.026µg/mL
Limit of Quantification(LOQ) 0.416µg/mL 0.0877µg/mL
Figure.3.Typical Chromatogram of blank
Figure.4.Typical Chromatogram of standard Figure.5.Typical chromatogram of Metformin marketed
formulation
Sample Parameters Optimized Usedp RT Peak area Plate count
Metformin
Flow rate
(±0.2)
1ml/min
0.8 2.399 6671088 2576
1 1.617 4016272 2543
Temperature
(±5°C)
30°C
20 1.931 4408830 2535
30 1.924 4984239 2586
Pioglitazone
Flow rate
(±0.2)
1ml/min
0.8 5.149 3896192 2808
1 3.469 2335282 2800
Temperature
(±5°C)
30°C
20 4.158 2858998 2902
30 4.082 2215484 3112
Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 716
Figure.6.Linearity of metformin Figure.7.Linearity of pioglitazone
4. CONCLUSION
A new validated RP-HPLC method has been
developed for the quantitative and Qualitative
determination of Metformin andPioglitazone in tablet
dosage forms in bulk and pharmaceutical dosage forms
was established. The method was completely validated
shows satisfactory results for all the method validation
parameters tested and method was free from interferences
of the other active ingredients and additives used in the
formulation. Infact results of the study indicate that the
developed method was found to be simple, reliable,
accurate, linear, sensitive, economical and reproducible
and have short run time which makes the method rapid.
Hence it can be concluded that the proposed method was a
good approach for obtaining reliable results and found to
be suitable for the routine analysis of Metformin and
Pioglitazone Bulk drug and Pharmaceutical formulations.
ACKNOWLEDGEMENT
The authors would like to thank beloved parents
and all my well-wishers, one and all who have helped me
directly and indirectly in completing this project work.
REFERENCES
T A Phaznadevi, Pharmaceutical Drug Analysis, 2nd
edition 2005, New age international publishers, 452-456.
The British Pharmacopoeia, Volume 2, 2007, 1575.
The Indian Pharmacopoeia, 2nd edition, Volume 2,
Controller publications, New Delhi, 1996, 554.
United States Pharmacopeia and National Formulary
(USANF), Asian Edition, Volume 2, 2007, 1269.
Sahoo PK, Sharma R, Chaturvedi SC, Simultaneous
Estimation of Metformin hydrochloride and Pioglitazone
hydrochloride by RP-HPLC method from combined tablet
dosage form, Ind J Pharm Sci, 2008, 70, 383-386.
Shaiaja et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 717
CARBON NANO TUBE: A REVIEW K.Shailaja
*, Tahseen Sameena, S.P.Sethy, Prathima Patil, Md. Owais Ashraf,
Department of Pharmaceutics, Sushrut Institute of Pharmacy, Taddanpally, Pulkal, Medak, India
*Corresponding author: Email: [email protected]
ABSTRACT
Carbon nanotubes are fullerene-related structures which consist of graphene cylinders closed at either end
with caps containing pentagonal rings. This is a nanoscopic structure made of carbon atoms in the shape of a
hollow cylinder. The cylinders are typically closed at their ends by semi-fullerene-like structures. There are three
types of carbon nanotubes: armchair, zig-zag and Chiral (helical) nanotubes. These differ in their symmetry.
Namely, the carbon nanotubes can be thought of as graphene planes 'rolled up' in a cylinder (the closing ends of
carbon nanotubes cannot be obtained in this way). Depending on how the graphene plane is 'cut' before rolled up,
the three types of carbon nanotubes are obtained. Within a particular type, carbon nanotubes with many different
radii can be found. These tubes can be extremely long .Some consider them as special cases of fullerenes. When
produced in materials, carbon nanotubes pack either in bundles (one next to another within a triangular lattice) -
single-walled carbon nanotubes, or one of smaller radius inside others of larger radii - multi-walled carbon
nanotubes. Carbon nanotubes have already found several technological applications, including their application in
high-field emission displays.
Key words: Nanotechnology, Nanotubes, Nanoparticles.
INTRODUCTION
Nanotechnology is the creation of
useful/functional materials, devices and systems (of any
useful size) through control/manipulation of matter on the
nanometer length scale and exploitation of novel
phenomena and properties which arise because of the
nanometer length scale.Research and technology
development aimed to understand and control matter at
dimensions of approximately 1 - 100 nanometer – the
nanoscale .Ability to understand, create, and use
structures, devices and systems that have fundamentally
new properties and functions because of their nanoscale
structure. Ability to image, measure, model, and
manipulate matter on the nanoscale to exploit those
properties and functions. Ability to integrate those
properties and functions into systems spanning from nano-
to macro-scopic scales.A Carbon Nanotube is a tube-
shaped material, made of carbon, having a diameter
measuring on the nanometer scale. A nanometer is one-
billionth of a meter, or about one ten-thousandth of the
thickness of a human hair. The graphite layer appears
somewhat like a rolled-up chicken wire with a continuous
unbroken hexagonal mesh and carbon molecules at the
apexes of the hexagons. Carbon Nanotubes have many
structures, differing in length, thickness, and in the type of
helicity and number of layers. Although they are formed
from essentially the same graphite sheet, their electrical
characteristics differ depending on these variations, acting
either as metals or as semiconductors. As a group, Carbon
Nanotubes typically have diameters ranging from <1 nm
up to 50 nm. Their lengths are typically several microns,
but recent advancements have made the nanotubes much
longer, and measured in centimeters.
Discovery: They were discovered in 1991 by the Japanese
electron microscopist Sumio Iijima who was studying the
material deposited on the cathode during the arc-
evaporation synthesis of fullerenes. He found that the
central core of the cathodic deposit contained a variety of
closed graphitic structures including nanoparticles and
nanotubes, of a type which had never previously been
observed
Category of carbon nanotubes: Carbon Nanotubes can
be categorized by their structures:
1. Single-wall Nanotubes (SWNT)
2. Multi-wall Nanotubes (MWNT)
3. Double-wall Nanotubes (DWNT)
Single-wall Nanotubes: Single-Walled Nano Tubes:
Most single-walled nanotubes (SWNT) have a diameter of
close to 1 nanometer, with a tube length that can be many
millions of times longer. The structure of a SWNT can be
conceptualized by wrapping a one-atom-thick layer of
graphite called graphene into a seamless cylinder.
Double-wall Nanotubes: Double-wall nanotubes are an
important sub-segment of MWNT. These materials
combine similar morphology and other properties of
SWNT, while significantly improving their resistance to
chemicals. This property is especially important when
functionality is required to add new properties to the
nanotube. Since DWNT are a synthetic blend of both
SWNT and MWNT, they exhibit the electrical and
thermal stability of the latter and the flexibility of the
former.
Multi walled annotates: Multi-walled nanotubes
(MWNT) consist of multiple rolled layers (concentric
tubes) of graphene. There are two models that can be used
Shaiaja et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 718
to describe the structures of multi-walled nanotubes. In
the Russian Doll model, sheets of graphite are arranged in
concentric cylinders, e.g., a (0,8) single-walled nanotube
(SWNT) within a larger (0,17) single-walled nanotube.
Properties of a carbon nanotube: The intrinsic
mechanical and transport properties of Carbon Nanotubes
make them the ultimate carbon fibers. The following
tables (Table 1 and Table 2) compare these properties to
other engineering materials. Overall, Carbon Nanotubes
show a unique combination of stiffness, strength, and
tenacity compared to other fiber materials which usually
lack one or more of these properties. Thermal and
electrical conductivity are also very high, and comparable
to other conductive materials.
132,000,000:1 Length-To-Diameter Ratio
Diameter of 3 to 9 nm
Lengths in the millimeter range
Efficient electrical conductors
Can act as both thermal conductors and thermal
insulators
Applications of carbon nanotubes: Carbon Nanotube
Technology can be used for a wide range of new and
existing applications:
1. Micro-electronics / semiconductors
2. Conducting Composites
3. Controlled Drug Delivery/release
4. Artificial muscles
5. Supercapacitors
6. Batteries
7. Field emission flat panel displays
8. Field Effect transistors and Single electron
transistors
9. Nano lithography
10. Nano electronics
11. Doping
12. Nano balance
13. Nano tweezers
14. Data storage
15. Magnetic nanotube
16. Nanogear
17. Nanotube actuator
18. Molecular Quantum wires
19. Hydrogen Storage
20. Noble radioactive gas storage
21. Solar storage
22. Waste recycling
23. Electromagnetic shielding
24. Dialysis Filters
25. Thermal protection
26. Nanotube reinforced composites
27. Reinforcement of armour and other materials
28. Reinforcement of polymer
29. Avionics
30. Collision-protection materials
31. Fly wheels
Table.1.Mechanical Properties of Engineering Fibers
Fiber Material Specific Density E (TPa) Strenght (GPa) Strain at Break (%)
Carbon Nanotube 1.3 - 2 1 10 - 60 10
HS Steel 7.8 0.2 4.1 < 10
Carbon Fiber - PAN 1.7 - 2 0.2 - 0.6 1.7 - 5 0.3 - 2.4
Carbon Fiber - Pitch 2 - 2.2 0.4 - 0.96 2.2 - 3.3 0.27 - 0.6
E/S - glass 2.5 0.07 / 0.08 2.4 / 4.5 4.8
Kevlar* 49 1.4 0.13 3.6 - 4.1 2.8
Table.2. Transport Properties of Conductive Materials
Material Thermal Conductivity (W/m.k) Electrical Conductivity
Carbon Nanotubes > 3000 106 - 107
Copper 400 6 x 107
Carbon Fiber - Pitch 1000 2 - 8.5 x 106
Carbon Fiber - PAN 8 - 105 6.5 - 14 x 106
Carbon nanotubes in healthcare: Researchers have
demonstrated artificial muscles composed of yarn woven
with carbon nanotubes and filled with wax. Tests have
shown that the artificial muscles can lift weights that are
200 times heavier than natural muscles of the same size.
Nanotubes bound to an antibody that is produced by
chickens have been shown to be useful in lab tests to
destroy breast cancer tumors. The antibody-carrying
Shaiaja et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 719
nanotubes are attracted to proteins produced by one type
of breast cancer cell. Once attached to these cells, the
nanotubes absorb light from an infrared laser, tumor.
Carbon nanotubes and the environment: Carbon
nanotubes are being developed to clean up oil spills.
Researchers have found that adding boron atoms during
the growth of carbon nanotubes causes the nanotubes to
grow into a sponge like material that can absorb many
times it's weight in oil. These nanotube sponges are made
to be magnetic, which should make retrieval of them
easier once they are filled with oil. Carbon nanotubes can
be used as the pores in membranes to run reverse osmosis
desalination plants. Water molecules pass through the
smoother walls of carbon nanotubes more easily than
through other types of Nano pores, which requires less
power.
Carbon nanotubes and electronics: Building transistors
from carbon nanotubes enables minimum transistor
dimensions of a few nanometers and the development of
techniques to manufacture integrated circuits built with
nanotube transistors. Carbon nanotubes used to direct
electrons to illuminate pixels, resulting in a lightweight,
millimeter thick "nanoemissive" display panel. Printable
electronic devices use nanotube "ink" in inkjet printers,
transparent, flexible electronic devices using arrays of
nanotubes.
Toxicity: The toxicity of carbon nanotubes has been an
important question in nanotechnology. Such research has
just begun. The data are still fragmentary and subject to
criticism. Preliminary results highlight the difficulties in
evaluating the toxicity of this heterogeneous material.
Parameters such as structure, size distribution, surface
area, surface chemistry, surface charge,
and agglomeration state as well as purity of the samples,
have considerable impact on the reactivity of carbon
nanotubes. However, available data clearly show that,
under some conditions, nanotubes can cross membrane
barriers, which suggests that, if raw materials reach the
organs, they can induce harmful effects such as
inflammatory and fibrotic reactions.
CONCLUSION
Carbon annotates are allotropes of carbon with
a cylindrical nanostructure. Nanotubes have been
constructed with length-to-diameter ratio of up to
132,000,000:1, significantly larger than for any other
material. These cylindrical carbon molecules have unusual
properties, which are valuable
for nanotechnology, electronics, optics and other fields
of materials science and technology. In particular, owing
to their extraordinary thermal conductivity and mechanical
and electrical properties, carbon nanotubes find
applications as additives to various structural materials.
REFERENCES
Gullapalli, S.; Wong, M.S. Nanotechnology: A Guide to
Nano-Objects, Chemical Engineering Progress 107 (5),
2011, 28–32.
Hsu, Hsin-Cheng; Chen-Hao Wang, S.K. Nataraj, Hsin-
Chih Huang, He-Yun Du, Sun-Tang Chang, Li-Chyong
Chen, Kuei-Hsien Chen, Stand-up structure of graphene-
like carbon nanowalls on CNT directly grown on
polyacrylonitrile-based carbon fiber paper as
supercapacitor, Diamond and Related Materials, 25, 2012,
176–9
Liu, Q, Ren, Wencai; Chen, Zhi-Gang; Yin, Lichang; Li,
Feng; Cong, Hongtao; Cheng, Hui-Ming, Semiconducting
properties of cup-stacked carbon nanotubes,
Carbon, 47 (3), 2009, 731–736.
Nitrogen-Doped Multiwall Carbon Nanotubes for Lithium
Storage with Extremely High Capacity Weon Ho Shin,
Hyung Mo Jeong, Byung Gon Kim, Jeung Ku Kang, and
Jang Wook Choi Nano Letters, 12 (5), 2012, 2283-2288.
Wang, M.; Li, C.M, An oscillator in a carbon peapod
controllable by an external electric field: A molecular
dynamics study, Nanotechnology, 21 (3), 2010, 03570.
Yu, Kehan; Ganhua Lu, Zheng Bo, Shun Mao, and
Junhong Chen, Carbon Nanotube with Chemically
Bonded Graphene Leaves for Electronic and
Optoelectronic Applications, J. Phys. Chem. Lett, 2 (13),
2011, 1556–1562.
Zavalniuk V, Marchenko S, Theoretical analysis of
telescopic oscillations in multi-walled carbon nanotubes,
Low Temperature Physics, 37 (4), 2011, 337.
Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 720
STABILITY INDICATING RP-HPLC METHOD FOR THE SIMULTANEOUS
DETERMINATION OF CANDESARTAN CILEXETIL AND
HYDROCHLOROTHIAZIDE IN BULK AND DOSAGE FORMS Veeranjaneyulu D, Aneesha A, Nandakishore Agarwal
Department of pharmaceutical analysis, Nimra College of Pharmacy, Vijayawada, India
Corresponding author: [email protected], phone no: 9951523344
ABSTRACT
A simple, specific and accurate reverse phase high performance liquid chromatographic method was
developed for the simultaneous determination of Candesartan cilexetil and Hydrochlorothiazide in pharmaceutical
dosage form. The column used was Hypersil BDS C18 (150*4.6mm, 5µ) in isocratic mode, with mobile phase
containing phosphate buffer- acetonitrile (55:45) adjusted to pH 4.6 using ortho phosphoric acid was used and
injection volume of 20µL, with a flow rate of 1.0ml/min. and effluents were monitored at 244 nm. The retention
times of Candesartan cilexetil and hydrochlorothiazide were 2.6 min and 3.6.min, respectively. The linearity for
Candesartan cilexetil and Hydrochlorothiazide were in the range of 38.4-86.6 mcg/mL and 30-70 mg/mL
respectively with correlation coefficient of r2=0.999 for both. The assay of the proposed method was found to be
99.38% and 99.26%. The recoveries of Candesartan cilexetil and Hydrochlorothiazide were found to be 101.3%
and 99.86%, respectively. The % RSD from reproducibility was found to be <2%. The proposed method was
statistically evaluated and can be applied for routine quality control analysis of Candesartan cilexetil and
Hydrochlorothiazide in bulk and in Pharmaceutical dosage form.
Key Words: Candesartan cilexetil, hydrochlorothiazide, RP-HPLC, Hypersil BDS, Validation, Forced
degradation studies.
INTRODUCTION
Candesartan cilexetil (CAN) belongs to
angiotensin II receptor blocker effective in lowering blood
pressure in hypertensive patients. Chemically it is known
as 2, 3-dihydroxy-2-butenyl 4-[1-hydroxy-1-methylethy] -
2-propyl-1- [p (o-1H-tetrazol-5-ylphenyl) benzylimida -
zole-5-carboxylate, cyclic-2, 3-carbonate.
Hydrochlorothiazide (HCTZ) is a diuretic of the class of
benzothiadiazine widely used in antihypertensive
pharmaceutical formulations, alone or combination with
other drugs, which decreases active sodium reabsorption
and reduced peripheral vascular resistance. It is
chemically 6-chloro-3, 4-dihydro-2H-1, 2, 4-
benzothiadiazine-7-sulfonamide 1, 1-dioxide, and was
successfully used as one content in association with other
drugs in the treatment of hypertension. Literature survey
revealed that a various analytical methods have been
reported for the determination of Candesartan cilexetil and
Hydrochlorothiazide in pure drug, pharmaceutical dosage
forms and in biological samples using liquid
chromatography either in single or in combined forms.
Confirmation of the applicability of the developed method
was validated according to the International Conference
on Harmonization (ICH) for the simultaneous
determination of CAN and HCTZ in bulk and in tablet
dosage form. (K. Balamuralikrishna, 2010)
MATERIALS AND METHODS
UV-3000 LABINDIA double beam with UV win
5software UV-VISIBLE spectrophotometer with 1cm
matched quartz cells. Schimadzu HPLC equipped with
SPD 20A UV-VIS detector and the column used was
HYPERSIL BDS C18 (150*4.6mm, 5µ). The data
acquisition was performed by using LC solutions
software. In addition an analytical balance (DENVER
0.1mg sensitivity), digital pH meter (Eutech pH 510), a
sonicator (Unichrome associates UCA 701) were used in
this study.
Chemicals and reagents: Candesartan cilexetil and
Hydrochlorothiazide pure sample was taken as a gift
sample from local labs and dosage form “atacand”
manufactured by astrazeneca was purchased from local
pharmacy. Other chemicals all are of HPLC grade.
Figure.1.Structure of Candesartan Figure.2.Structure of Hydrochlorothiazide
Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 721
Preparation of mobile phase: Potassium dihydrogen
phosphate was weighed (4.6 g) and dissolved in 1000 ml
of water. Finally the pH was adjusted to 4.6 with ortho
phosphoric acid (0.1 M). The solution was sonicated for
10 minutes and filtered using Whatman filter paper (No.1)
and used.
Preparation of stock solutions:
Candesartan standard stock solution: An accurately
weighed quantity of candesartan 64 mg was transferred
to the 100ml volumetric flask add 30ml of diluents (buffer
: ACN 55:45), sonicate to dissolve, dilute upto the mark
with diluent and mix well. (Concentration of candesartan
is about 640g/ml).
Hydrochlorothiazide standard stock solution: An
accurately weighed quantity of hydrochlorothiazide 50 mg
was transfer to the 100ml volumetric flask add 30ml of
diluent, sonicate to dissolve, dilute up to the mark with
diluent and mix well. (Concentration of Hydrochlothiazide
is about 500g/ml).
Preparation of standard: Take 10 ml solution from
standard stock solution of Candesartan and 10ml solution
from standard stock solution of hydrochlorothiazide and in
100 ml volumetric flask and make up the volume up to the
mark with diluents.
Preparation of the sample solution: The powder
equivalent to 300.54 mg of Candesartan and
Hydrochlorothiazide were weighed and taken into a
100mL volumetric flask. To this 25mL of diluents was
added and sonicated for 15min to dissolve the drugs then
made up the volume to required volume with the diluents.
From this solution 10ml was taken into a 100mL flask and
made upto final volume with diluents to get concentration
of Candesartan is about 64 g/ml, concentration of
Hydrochlorothiazide is about 50g/ml and filtered through
0.45µ filter under vacuum filtration. From this stock
solution further dilutions were made for the validation of
the method developed. (Narendra Devanaboyina, 2012).
RESULTS AND DISCUSSION
Method Validation:
Specificity: Specificity is the ability of analytical method
to measure accurately and specifically the analyte in the
presence of components that may be expected to be
present in the sample. The specificity of method was
determined by spiking possible impurities at specific level
to standard drug solution (100ppm). The diluent and
placebo solutions were also injected to observe any
interference with the drug peak.
Linearity: Linearity is the ability of the method to
produce results that is directly proportional to the
concentration of the analyte in samples with given range.
The linearity of CANDESARTAN was in the
concentration range of 38.4-86.6 %, for
HYDROCHLOTHIAZIDE 30-70%. From the linearity
studies calibration curve was plotted and concentrations
were subjected to least square regression analysis to
calculate regression equation. The regression coefficient
was found to be 0.999 and shows good linearity for both
the drugs.
Precision: Precision is the degree of closeness of
agreement among individual test results when the method
is applied to multiple sampling of a homogeneous sample.
Study was carried out by injecting six replicates of the
same sample preparations at a concentration of CAN 64
ppm/ml & HCTZ 50 ppm/ml.
Accuracy: Accuracy is the closeness of results obtained
by a method to the true value. It is the measure of
exactness of the method. Accuracy of the method was
evaluated by standard addition method. Recovery of the
method was determined by spiking an amount of the pure
drug (80%,100% ,120%) at three different concentration
levels in its solution has been added to the pre analyzed
working standard solution of the drug.
LOD& LOQ: LOD is the lowest concentration of analyte
in a sample that can be detected but not quantified under
experimental conditions. The LOD values were
determined by the formulae LOD=3.3σ/s (where σ is the
standard deviation of the responses and s is the mean of
the slopes of the calibration curves). LOQ is the lowest
concentration of analyte in a sample that can be
determined with acceptable precision and accuracy under
experimental conditions. It is a parameter of the
quantitative determination of compounds in the mixtures.
The LOQ values were determined by the formulae
LOD=10σ/s.
Forced degradation of candesartan and
hydrochlorothiazide:
Acid degradation: Accurately weighed 300.10 mg of
tablet powder was transferred into 100 ml volumetric
flask, 2.5 ml 5N Hydrochloric acid was added and heated
for 1 hour on a water bath at 80°C. The solution was
cooled and neutralized with 2.5ml 5 N sodium hydroxide,
10 ml diluent, sonicated for 10 minutes. The volume was
made up to mark with diluent, mixed well, filtered through
0.45µ nylon filter. The 5 ml of this solution was diluted to
50 ml diluent and analysed to record chromatogram.
Base Degradation: Accurately weighed 300.10 mg of
tablet powder was transferred into 100 ml volumetric
flask, 2.5ml 5N sodium hydroxide was added and heated
for 1 hour on awater bath at 80°C. The solution was
cooled and neutralized with 2.5ml 5 N hydrochloric acid,
10 ml diluent was adeed and sonicated for 10 minutes,
The volume was made upto mark with diluent mixed well,
Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 722
filtered through 0.45µ nylon filter. The 5 ml of this
solution was diluted to 50 ml diluent and analysed to
recorded chromatogram.
Oxidative degradation: Accurately weighed 300.10 mg
of tablet powder was transferred into 100 ml volumetric
flask, add 1ml of 5%H2O2 and 10 ml diluent was adeed
and sonicated for 10 minutes, The volume was made upto
mark with diluent mixed well, filtered through 0.45µ
nylon filter. The 5 ml of this solution was diluted to 50 ml
diluent and analysed to recorded chromatogram.
Thermal degradation: Accurately weighed 300.10 mg of
tablet powder was taken and kept in a controlled
temperature oven at 800c for 12hrs.After that transferred
into 100 ml volumetric flask, 10 ml diluent was adeed and
sonicated for 10 minutes, The volume was made upto
mark with diluent mixed well, filtered through 0.45µ
nylon filter. The 5 ml of thissolution was diluted to 50 ml
diluent and analysed to recorded chromatogram.
Photolytic degradation: Accurately weighed 300.10 mg
of tablet powder was exposed to UV light for 12hrs. After
that transferred into 100 ml volumetric flask, 10 ml diluent
was adeed and sonicated for 10 minutes, The volume was
made upto mark with diluent mixed well, filtered through
0.45µ nylon filter. The 5 ml of thissolution was diluted to
50 ml diluent and analysed to recorded chromatogram.
Discussion: Several trials has made until getting good
peak resolution, acceptable plate count and tailing factor.
Method was optimized and the retention times of
candesartan cilexetil and hydrochlorothiazide was
reported as 2.6 &3.6
Specificity: The chromatograms of standard and sample
are identical with nearly same retention time. There is no
interference with blank and placebo to the drugs. Hence
the proposed method was found to be specific.
Linearity: From the Linearity data it was observed that
the method was showing linearity in the concentration
range of 38.4-86.6μg/ml for candesartan and 30-70 μg/ml
for Hydrochlorothiazide. Correlation coefficient was
found to be 0.999 for both the compounds.
Accuracy: The recoveries of pure drug from the analyzed
solution of formulation were 101.37 % for Candesartan
and 99.89 % for Hydrochlorothiazide, which shows that
the method was accurate.
Precision: The %RSD for the sample chromatograms of
method precision was found to be 0.34&0.42 (Rt & Area)
for Candesartan and 0.62 &0.44 (Rt & Area) for
Hydrochlorothiazide. Hence it passes method precision.
Robustness: All the system suitability parameters are
within limits for variation in flow rate (±0.2 ml). Hence
the allowable flow rate should be within 0.8 ml to 1.2 ml.
All the system suitability parameters are within limits for
variation (±2nm) in wavelength. Hence the allowable
variation in wavelength is ± 2nm
LOD & LOQ: LOD & LOQ of candesartan was found to
be 2.05, 6.20 and for Hydrochlorothiazide was found to be
2.59, 7.85 respectively. All the system suitability
parameters are within in the limits when the drugs are
subjected to stress conditions like acid, base peroxide,
thermal and photolysis. The results obtained were
satisfactory and good agreement as per the ICH
guidelines.
Table.1. Details of marketed Formulation
Brand name Content Manufacturing Company
Atacand HCT CAN&HCTZ (32mg & 25mg Respectively) Astrazeneca
Table.2. Optimized chromatogram conditions for candesartan and hydrochlorothiazide
Column Hypersil BDS C18 (150*4.6mm,5µ)
Mobile phase Phosphate Buffer pH 4.8:ACN(55:45)
Flow rate 1.0 ml/ min
Wavelength 244 nm
Injection volume 20 l
Column temperature Ambient
Run time 5 min
Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 723
Table.3. Specificity Data for Candesartan and Hydrochlorothiazide:
Table.4. Linearity data for Candesartan and Hydrochlorothiazide
Candesartan Hydrochlorothiazide
Mcg/ml Area Rt Mcg/ml Area Rt
38.4 1088.683 2.6 30 529.605 3.6
51.2 1497.424 2.6 40 728.278 3.6
64 1876.036 2.6 50 914.671 3.6
76.8 2286.045 2.6 60 1150.078 3.6
86.6 2595.886 2.6 70 1325.845 3.6
Slope 31.2 Slope 20.14
Correlation coefficient 0.999 Correlation Coefficient 0.9998
Table.5.Summary of validation parameters
Parameter Candesartan Hydrochlorothiazide
Linearity 38.4-86.6µg/ml 30-70µg/ml
Precision (% RSD) 0.34 (Rt) 0.2(Area) 0.62 (Rt) 0.44 (Area)
Accuracy 101.37% 99.86%
LOD & LOQ 2.05, 6.20 2.59,7.85
Assay 100.41% 99.85 %
Table.6.Summary of Forced degradation data for candesartan and hydrochlorothiazide
Stress Condition Time(hrs) Retention Time Time(hrs) Retention Time
As such 12hrs 2.673 12hrs 3.637
Acid Hydrolysis (0.1 N, at RT) 12hrs 2.673 12hrs 3.637
Base Hydrolysis (0.1N at RT) 12hrs 2.707 12hrs 3.610
Oxidation (5% H2O2 at RT) 12hrs 2.680 12hrs 3.583
Photolysis(UV Light and sunlight) 12hrs 2.677 12hrs 3.630
Thermal (at 800c) 12hrs 2.663 12hrs 3.610
Figure.3.Chromatogram of standard drug
Standard
Injection
Retention time Area Theoretical
Plates
Retention
time
Area Theoretical
Plates
2.6 1811.967 3940 3.6 928.994 3048
2.6 1907.112 3708 3.6 915.563 3256
2.6 1948.456 3506 3.6 919.607 3088
Sample Injection
2.6 1902.678 3708 3.6 907.612 3256
2.6 1811.967 3940 3.6 928.994 3048
2.6 1955.852 3532 3.6 932.645 3105
Blank injection - - - - - -
Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 724
Figure.4.Chromatogram for specificity sample
CONCLUSION
Finally it concludes that all the parameters are
within the limits and meet the acceptance criteria of ICH
guidelines for method validation. The proposed method
was simple, accurate, specific, precise, robust, rugged and
economical. Hence this method is validated and can be
used for routine and stability sample analysis.
ACKNOWLEDGEMENT The authors thankful to Dr.Nanda Kishore
Agarwal Professor, Department of Pharmaceutical
Analysis and Quality Assurance for his valuable guidance
and all the staff and non-teaching staff of Nimra College
of Pharmacy for providing necessary facilities to carry out
the research work. The authors would like to thank
beloved parents and all my well wishers, one and all who
have helped me directly and indirectly in completing this
project work.
REFERENCES
K. Balamuralikrishna and B. Syamasundar, Development
and validation of high performance liquid
chromatographic method for the simultaneous estimation
of Candesartan cilexetil and Hydrochlorothiazide in
combined tablet dosage form.
Scholars Research Library, Der Pharma Chemica, 2010,
2(6), 231-237.
Narendra Devanaboyina, Satyanarayana T, Ganga Rao B,
Simultaneous determination of Candesartan and
Hydrochlorothiazide in combined Pharmaceutical Dosage
form by New RP-HPLC Method, Research Journal of
Pharmaceutical, Biological and Chemical Sciences, 3(1),
2012, 270.
Khopkar SM, Basic concepts of analytical chemistry,
2nd
ed. New Delhi: New age International Ltd. Publishers,
1998, 178-179.
Settle F, Handbook of Instrumental techniques for
analytical chemistry, 17th ed. NJ: Prentice Hall PTR; 1997,
56-57.
Thomas A Little, Assay development and method
validation essentials, Bio pharm, 1, 2012, 1-5.
Skoog DA, Holler FJ, Crouch SR, Principle of
Instrumental Analysis. 6th ed. India: Thomson
Publications, 2007, 145-147,180.
Chakravarthi and Duraivel Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 725
A REVIEW ON ENHANCEMENT OF SOLUBILITY AND DISOLUTION RATE OF
BCS CLASS-II DRUG BY SOLID DISPERSION AND NONAQEOUS
GRANULATION TECHNIQUE Chakravarthi V
*, Duraivel S
Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email:[email protected]
ABSTRACT Solid dispersion, defined as the dispersion of one or more active ingredient in a carrier or matrix at solid
state, is an efficient strategy for improving dissolution of poorly water-soluble drugs for enhancement of their
bioavailability. Non aqueous granulations technique means size enlarged granules containing MCC with CCS
showed higher solubility and dissolution rate compared to other conventional formulations such as tablets or
capsules, solid dispersion which can be prepared by various methods has many advantages. Fairly soluble drugs
in gastrointestinal (GI) media exhibit complete oral absorption, and thus good bioavailability. About 40% of drugs
are not soluble in water in practice and therefore are slowly absorbed, which results in insufficient and uneven
bioavailability and GI toxicity. For BCS class II drug, solubility is a crucial rate limiting factor to achieve its
desired level in systemic circulation for pharmacological response. Thus, problematic solubility of BCS class II
drug is a main challenge for dosage. This review give detail information to improve the BCS class II drug
solubility by solid dispersion method and non aqueous granulation methods are ease and efficiency is most
promising and routinely employed technique to resolve the solubility problems of BCS class II drug.
Key Words: Simvastatin, Solid dispersion, Non aqueous granulations, bioavailability, dissolution,
gastrointestinal (GI) media.
I. INTRODUCTION
Fairly soluble drugs in gastrointestinal media
exhibit complete oral absorption, and thus good
bioavailability. About 40% of drugs are not soluble in
water in practice and therefore are slowly absorbed, which
results in insufficient and uneven bioavailability and GI
toxicity. Thus, most exigent phase of drug development
practice particularly for oral dosage forms is the
enhancement of drug solubility thereby its oral
bioavailability. Bioavailability refers to the limit of
therapeutically active drug that approaches the systemic
circulation and thus, is available at the site of action.
There are two reasons proposed for poor aqueous
solubility of drugs (i) high lipophilicity and (ii) strong
intermolecular forces which cause the insolubilization of
drugs. Various approaches have been proposed to enhance
solubilisation of poorly water soluble drugs for the
improvement of their bioavailability commonly used for
drug solubilisation includes micronization, chemical
modification, pH adjustment, solid dispersion,
complexation, co-solvency, micellar solubilisation and
hydrotropy.
Simvastatin, an inactive lactone, is cholesterol
lowering agent and a lipid lowering agent developed
synthetically from a fermentation product of Aspergillus
terreus. After oral ingestion, simvastatin is hydrolyzed to
the analogous β-hydroxyacid form. This is a major
metabolite and an inhibitor of 3-hydroxy-3-methylglutaryl
coenzyme A (HMG CoA) reductase, the enzyme that
catalyzes the conversion of HMG-CoA to mevalonate, the
rate-limiting step in the biosynthesis of cholesterol. This
review is prepared to narrate different traditional and
novel methodologies for the increase in solubility of
hydrophobic drugs for converting to oral dosage forms.
Advantages of solid dispersions over other strategies to
improve bioavailability of poorly water soluble drugs
(Dhananjay S Saindane, 2011):
Improving drug bioavailability by changing their
water solubility has been possible by chemical
approaches, in this active target can be achieved by
incorporating polar in the main drug structure,
resulting in the formation of a pro-drug.
Formulation approaches include solubilisation and
particle size reduction techniques, and solid
dispersions.
Milling or micronization for particle size reduction
is commonly performed as approaches to improve
solubility, on the basis of the increase in surface
area.
Among others solid dispersions appear to be a better
approach to improve drug solubility than these
techniques.
Solid dispersions are more efficient than these
particle size reduction techniques, since the latter
have a particle size reduction limit around 2–5 mm
which frequently is not enough to improve
considerably the drug solubility or drug release in
the small intestine and, consequently, to improve the
bioavailability.
Solid dispersions are more acceptable to patients
than solubilisation products, since they give rise to
Chakravarthi and Duraivel Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 726
solid oral dosage forms instead of liquid as
solubilisation products.
Solid dispersions disadvantages:
Despite extensive expertise with solid dispersions,
they are not broadly used in commercial products,
mainly because there is the possibility that during
processing (mechanical stress) or storage
(temperature and humidity stress) the amorphous
state may undergo crystallization.
The effect of moisture on the storage stability of
amorphous pharmaceuticals is also a significant
concern, because it may increase drug mobility and
promote drug crystallization.
Most of the polymers used in solid dispersions can
absorb moisture, which may result in phase
separation, crystal growth or conversion from the
amorphous to the crystalline state or from a meta
stable crystalline form to a more stable structure
during storage.
This may result in decreased solubility and
dissolution rate. Therefore, exploitation of the full
potential of amorphous solids requires their
stabilization in solid state, as well as during in-vivo
performance
Limitations:
Laborious and expensive methods of preparation.
Reproducibility of physicochemical characteristics
Difficulty in incorporating into formulation of
dosage forms, Scale-up of manufacturing process,
and Stability of the drug and vehicle.
Liquisolid technology: (Manpreet Kaur, 2013)
Spireas described the method for promoting
dissolution i.e. the formation of liquisolid compacts. A
liquid may be transformed into a free flowing, readily
compressible and apparently dry powder with the
liquisolid technology by simple physical blending with
selected excipients named the carrier and coating material.
The liquid portion which can be a liquid drug, drug
suspension or a drug solution in suitable non-volatile
liquid vehicles is incorporated into the porous carrier
material. Water miscible organic solvent systems with
high boiling point such as liquid poly ethylene glycols,
propylene glycol or glycerine are best suitable as liquid
vehicles. Once the carrier is saturated with liquid, a liquid
layer is formed on the particle surface which is instantly
adsorbed by the fine coating particles. Thus, an apparently
dry, free flowing, and compressible powder is obtained.
Schematic representation of liquisolid
system
Advantages:
Practically water-insoluble liquid and solid drugs
can be formulated into liquisolid systems using
new formulation mathematical model.
Better availability of an orally administered water-
insoluble drug is achieved when the drug is in
solution form.
It can be used for the formulation of liquid oily
drugs.
It can be used in controlled drug delivery.
Disadvantages:
The liquisolid systems have low loading
capacities and they require high solubility in non
volatile liquid vehicles.
High levels of carrier and coating materials are
required to maintain acceptable flowability and
compatibility for liquisolid powder formulation
and that in turn will increases the weight of each
tablet above 1gm which is very difficult to
swallow.
Applications:
Mechanisms of enhanced drug release from liquisolid system
increased drug surface area
increased aqueous solubility
increased wettability
Chakravarthi and Duraivel Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 727
Liquisolid compact technology is a powerful tool
to improve bioavailability of water insoluble
drugs. Several water insoluble drugs on dissolving
in different non-volatile solvents have been
formulated into liquisolid compacts.
Rapid release rates are obtained in liquisolid
formulations.
These can be efficiently used for water insoluble
solid drugs or liquid lipophilic drugs.
Solubility and dissolution improvement.
Non aqueous granulation technique: All the ingredients
were separately weighed and sifted using mesh no.40.and
mixed in a poly bag for 10 min. the binder solution was
prepared by using volatile solvents. Then the above dry
mixture was granulated with binder solution and dried in
the tray drier at the temperature 40-500C untile the
moisture reduce down to NMT-2%. The dried granules
were passed through mesh no.30and then diluents are
added to granules and blended for 10 min. the lubricants
also added to granules then evaluated for the flow
properties and the evaluated blend was compressed into
tablets to get tablets.
Methods of preparation of solid dispersions: Various
methods used for preparation of solid dispersion system.
1. Melting method
2. Solvent method
3. Melting solvent method (melt evaporation)
4. Melt extrusion methods
5. Lyophilization techniques
6. Melt agglomeration Process
7. The use of surfactant
8. Electrospining
9. Super Critical Fluid (Scf) technology
10. Dropping method
The advantageous properties of solid dispersions:
1. Particles with higher porosity: Particles in solid
dispersions have been found to have a higher degree of
porosity. The increase in porosity also depends on the
carrier properties, for instance, solid dispersions
containing linear polymers produce larger and more
porous particles than those containing reticular polymers
and, therefore, result in a higher dissolution rate. The
increased porosity of solid dispersion particles also
hastens the drug release profile.
2. Particles with improved wettability: Carriers with
surface activity, such as cholic acid and bile salts when
used, can significantly increase the wettability property of
drug. Even carriers without any surface activity, such as
urea, improved drug wettability. Carriers can influence the
drug dissolution profile by direct dissolution or co-solvent
effects.
3. Particles with reduced particle size: Molecular
dispersions, as solid dispersions, represent the last state on
particle size reduction, and after carrier dissolution the
drug is molecularly dispersed in the dissolution medium.
Solid dispersions apply this principle to drug release by
creating a mixture of a poorly water soluble drug and
highly soluble carriers. A high surface area is formed,
resulting in an increased dissolution rate and,
consequently, improved bioavailability.
4. Drugs in Amorphous State: Poorly water soluble
crystalline drugs, when in the amorphous state tend to
have higher solubility. The enhancement of drug release
can usually be achieved using the drug in its amorphous
state, because no energy is required to break up the crystal
lattice during the dissolution process.
Types of solid dispersion: Based on their molecular
arrangement, 6 different types of solid dispersions can be
distinguished
1. Eutectics
2. Amorphous precipitations in crystalline matrix
3. Solid solutions
i. Continuous solid solutions
ii. Discontinuous solid solutions
iii. Substitutional solid solutions
iv. Interstitial solid solutions
4. Glass suspension (contain 2 phases)
5. Glass suspension (contain1 phase)
6. Glass solution
Applications of solid dispersions:
To increase the solubility of poorly soluble drugs
thereby increase the dissolution rate, absorption
and bioavailability.
To stabilize unstable drugs against hydrolysis,
oxidation, recrimination, isomerisation, photo
oxidation and other decomposition procedures.
To reduce side effect of certain drugs.
Masking of unpleasant taste and smell of drugs.
Improvement of drug release from ointments
creams and gels.
To avoid undesirable incompatibilities.
To obtain a homogeneous distribution of a small
amount of drug in solid state.
To dispense liquid (up to 10%) or gaseous
compounds in a solid dosage.
To formulate a fast release primary dose in a
sustained released dosage form.
Chakravarthi and Duraivel Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 728
To formulate sustained release regimen of soluble
drugs by using poorly soluble or insoluble
carriers.
Characterization of solid dispersion: Several different
molecular structures of the drug in the matrix can be
encountered in solid dispersions. Several techniques have
been available to investigate the molecular arrangement in
solid dispersions. However, most effort has been put into
differentiate between amorphous and crystalline material.
Many techniques are available which detect the amount of
crystalline material in the dispersion.
Drug -carrier miscibility:
Hot stage microscopy: HSM is used to characterize the
interactions of many drugs with polymer.
Differential scanning calorimetry: Differential Scanning
Calorimetry (DSC) technique is used to detect the amount
of crystalline material.
Powder X-ray diffraction: Powder X-ray diffraction can
be used to qualitatively detect material with long range
order. Sharper diffraction peaks indicate more crystalline
material.
NMR 1H Spin lattice relaxation time: 1H NMR spin-
lattice relaxation provides a picture of the differences in
structure and dynamics in these materials. NMR
relaxometry has been shown to provide novel information
about the particle size of the drug and its recrystallisation
behaviour within swelling solid dispersions.
Drug carrier interactions:
FT-IR spectroscopy: Infrared spectroscopy (IR) can be
used to detect the variation in the energy distribution of
interactions between drug and matrix. Sharp vibrational
bands indicate crystallinity. Fourier Transform Infrared
Spectroscopy (FTIR) was used to accurately detect
crystallinities ranging from 1 to 99% in pure material.
Using IR or FTIR, the extent of interactions between drug
and matrix can be measured.
Raman spectroscopy: Confocal Raman Spectroscopy
was used to measure the homogeneity of the solid
mixture.
Physical Structure: Several different molecular
structures of the drug in the matrix can be encountered in
solid dispersions. Many attempts have been made to
investigate the molecular arrangement in solid dispersions.
However, most effort has been put into differentiate
between amorphous and crystalline material.
Scanning electron microscopy: Macroscopic techniques
that measure mechanical properties that are different for
amorphous and crystalline material can be indicative for
the degree of crystallinity.
Dynamic vapor sorption: Water vapour sorption can be
used to discriminate between amorphous and crystalline
material when the hygroscopicity is different.
DSC (MTDSC): Temperature Modulated Differential
Scanning Calorimetry (TMDSC) can be used to assess the
degree of mixing of an incorporated drug.
Stability: Humidity studies, Isothermal Calorimetry, DSC
(Tg, Temperature re crystallization), Dynamic vapor
sorption,
Dissolution: Dissolution Calorimetry measures the energy
of dissolution, which is dependent on the crystallinity of
the sample. Intrinsic dissolution, Dynamic solubility,
Dissolution in bio-relevant media
CONCLUSION
Solubility is a most important parameter for the
oral bio availability of poorly soluble drugs. Dissolution
of drug is the rate determining step for oral absorption of
the poorly water soluble drugs, which can subsequently
affect the in vivo absorption of drug. Currently only 8% of
new drug candidates have both high solubility and
permeability. Because of solubility problem of many
drugs the bio availability of them gets affected and hence
solubility enhancement becomes necessary. Solid
dispersion technology is one of the possible modes that
increase the solubility of poorly soluble drugs.
REFERENCES
Ansel C. Howard, Allen V. Loyd, Popovich A.
Nicholas, Pharmacetical dosage forms and drug
delivery systems, 7 th edition, 2000; 248-252.
D Praveen Kumar, Arora Vandana, Solid Dispersions:
A review, JPSI, 1(4), 2012, 27-34.
Dhirendra K, Solid dispersions: a review, Pak. J.
Pharm. Sci., 22(2), 2009, 234-246.
Lachman L., Liberman H.A, theory and practice of
industrial pharmacy, 3 rd edition, 1998; 462-464.
Luhadiya A, Agrawal S, Jain P, Dubey P K, A review
on solid dispersion, IJARPB, 2 (2), 2012, 281-291
Manpreet Kaur, International journal of advances in
pharmaceutical sciences.2013,4(1).
Pawar Anil R & Choudhari Pravin D, Novel
techniques for solubility, dissolution rate and
bioavailability enhancement of class II and IV drugs,
2(4), 2012, 9-14.
Saindane D.S, Kulkarni A. S, Khade T.S, Patil M.D,
Enhancing drug solubility and bioavailability using
solid dispersion: a review, International Journal of
Biopharmaceutics, 2(1), 2011, 22-30.
Karthik et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 729
EVALUATION OF ANTI-INFLAMMATORY ACTIVITY OF CANTHIUM
PARVIFLORUM BY IN-VITRO METHOD Kandikattu Karthik
1*, Bharath Rathna Kumar P
1, Venu Priya R
2, Sunil Kumar K
3 , Ranjith Singh.B.Rathore
4
*1Department of Pharmaceutical Analysis, JNTUA - Oil Technological Research Institute, Ananthapuramu, A.P, India.
2Department of Pharmaceutics, JNTUA - Oil Technological Research Institute, Ananthapuramu, A.P, India.
3Department of Pharmacology, Vijaya College of Pharmacy, Hyderabad, A.P, India.
4Department of Pharmacognosy, Vagdevi College of Pharmacy, Nellore, A.P., India.
*Corresponding author: Email: [email protected]
ABSTRACT
The present study investigates the anti-inflammatory activity of ethanolic extract of Canthium Parviflorum,
is a valuable medicinal shrubby and woody plant which has been valued for centuries in ayurvedic medicine.
Phyto-chemical analysis of Canthium parviflorum plant extracts revealed the presence of various bio-chemical
compounds such as flavonoids, glycosides, alkaloids, saponins and terpinoids. Since terpenoids and flavonoids
have remarkable anti-inflammatory activity, our present work aims at evaluating the in-vitro anti-inflammatory
activity of Canthium parviflorum by protein denaturation method. Denaturation of proteins is a well documented
cause of inflammation and rheumatoid arthritis. Several anti-inflammatory drugs have shown dose dependent
ability to inhibit thermally induced protein denaturation. Ability of CPE extract to bring down thermal
denaturation of protein is possibly a contributing factor for its anti-inflammatory activity. The data of our studies
suggests that CPE extract showed significant anti-inflammatory activity. Therefore our studies support the
isolation and use of active constituents of Canthium parviflorum in treating inflammation.
Key Words: Canthium parviflorum, flavanoids, glycosides, phytochemical analysis, inflammation.
INTRODUCTION
Medicinal plants are believed to be an important
source of new chemical substances with potential
therapeutic effects. The research into plants with alleged
folkloric use as anti-inflammatory agents should therefore
be viewed as a fruitful and logical research strategy in the
search for new anti-inflammatory drugs. Inflammation
may be potentially harmful, causing life threatening
hypersensitivity reactions and progressive organ damage
(Robbins, 2008). NSAIDs are reported to possess
prevention of the denaturation of proteins, which act as
antigens and leads to auto-immune diseases (Insel, 1996).
Canthium as herbal medicine is used for the treatment of
diabetes (Ayyanar, 2008), treatment of snake bites
(Mahishi Parinitha, 2005), scabies and the ring worm
infection (Anitha, 2008) antioxidant and diuretic activity
(Mohideen, 2003). Canthium Parviflorum, is a valuable
medicinal shrubby and woody plant which has been
valued for centuries in ayurvedic medicine. Phyto-
chemical analysis of Canthium parviflorum plant extracts
revealed the presence of various bio-chemical compounds
such as flavanoids, glycosides, alkaloids, saponins and
terpinoids. Different parts of Canthium parviflorum, have
been used traditionally for the treatment of variety of
diseases including anaemia, toothache, cough and as a
hypoglycemic agent. Roots and leaves were used to
reduce swellings in inflammation. However, there is no
systematic scientific report published indicating utility of
this plant material in the treatment of inflammation. Thus
the presence of therapeutically active flavonoids as major
constituents was the basis of selection and evaluation
ethanol extract of Canthium parviflorum leaves for their
anti-inflammatory activity.
MATERIALS AND METHODS
Plant material: Fresh leaves of the plant Canthium
parviflorum were collected from Andhrapradesh, India.
The plant material was taxonomically identified by
C.V.S.Bhaskar, Prof. in Botany, Venkatagiri Raja’s
college, SPSR Nellore, Andhra Pradesh, India. A voucher
specimen has been preserved in our laboratory for future
reference. The leaves were dried under shade and then
powdered with a mechanical grinder and stored in airtight
container. The dried powder material of the leaves was
defatted with petroleum ether and subsequently extracted
with ethanol in a Soxhlet apparatus. The solvent was
completely removed under reduced pressure and Ethanol
extract of Canthium parviflorum leaves was obtained
(yield 18.5%). Solution of Canthium parviflorum was
prepared freshly in distilled water and used for the studies.
Chemicals and drugs: Tris amino methane and bovine
Serum Albumin were obtained from Himedia Lab.,
Mumbai India, Ibuprfen from Sigma-Aldrich and all other
chemicals used were of analytical grade. Solvents were
purchased from Sd-Fine Chem Ltd. All other chemicals
used were of analytical grade and purchased locally.
Extract Preparation: Plant parts were air dried at room
temperature for 4 weeks to get consistent weight. The
dried parts were later ground to powder. 100g of dried
samples were extracted with hexane and ethanol using
Karthik et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 730
Soxhlet apparatus. The extracts were concentrated under
reduced pressure by using rota vapour.
Phytochemical analysis: Phytochemical analysis was
carried out for the presence of various phytochemical
constituents i.e. saponins, steroids, phenol, alkaloids and
tannins, flavonoids, glycosides, etc. Phytochemical
screening was performed by employing standard screening
tests and the results are represented in table1.
Table.1.Phyto chemical Screening of Canthium parviflorum extracts
Test Hexane Extract Ethanolic Extract
Alkaloids + +
Saponins + +
Tanins + +
Phlobatanins + +
Steroids - -
Flavonoids + +
Anthraquinones - -
Glycosides + +
Reducing sugars - +
Terpenoids + +
+ve sign indicates the presence and –ve sign indicates the absence
In-vitro anti-inflammatory activity:
Antidenaturation activity: A solution of 0.2% w/v of
BSA was prepared in a Tris Buffer Saline and pH was
adjusted to 6.8 using glacial acetic acid stock solutions of
10,000µg/ml of all the extracts were prepared by using
ethanol as a solvent. From these stock solutions 4 different
concentrations of 1,100, 200 and 500µg/ml were prepared
by using ethanol as a solvent. 50µl (0.05ml) of each
extract was transferred to Eppendorf tubes using 1ml
micropipette. 5ml of 0.2% w/v BSA was added to the
entire above Eppendorf tubes. The control consists of 5ml
of 0.2% w/v BSA solution with 50µl ethanol. The
standard consists of 100µg/ml of Ibuprofen in ethanol
with 5ml 0.2% w/v BSA solution. The test tubes were
heated at 72ºC for 5 minutes and then cooled for 10
minutes. The absorbance of these solutions was
determined by using a UV-VIS Double beam
spectrophotometer (ELICO SL 244) at a wavelength of
660nm. Each experiment was carried out in triplicate and
the mean absorbance was recorded. The percentage of
inhibition of precipitation was determined on a percentage
basis relative to control using the formula.
Percentage of inhibition of denaturation =
controlofabsorbance
extractofabsorbancecontrolofabsorbance ×100
RESULTS AND DISCUSSION
Anti-inflammatory properties - Inhibition of albumin
denaturation: Denaturation of proteins is a well
documented cause of inflammation. As part of the
investigation on the mechanism of the antiinflammation
activity, ability of different solvent plant extract protein
denaturation was studied. It was effective in inhibiting
heat induced albumin denaturation (Table 2). Maximum
percentage of inhibition 67.5 was observed from Ethanol
extract followed by hexane (56.4). All the solvent extracts
inhibited the albumin denaturation, the ethanol extract
stood first compared to hexane extracts. Ibuprofen, a
standard anti-inflammatory drug showed the maximum
inhibition 71.89% at the concentration of 100 μg/ml.
Inflammation is the response of living tissues to injury. It
involves a complex array of enzyme activation, mediator
release, extravasations of fluid, cell migration, tissue
breakdown and repair (Vane, 1995). Denaturation of
proteins is a well documented cause of inflammation and
rheumatoid arthritis (Mizushima, 1966). Several anti-
inflammatory drugs have shown dose dependent ability to
inhibit thermally induced protein denaturation (Grant,
1970). Ability of Canthium parviflorum extract to bring
down thermal denaturation of protein is possibly a
contributing factor for its anti-inflammatory activity. The
anti-inflammatory activity of Canthium parviflorum
extract found may be due to the presence of
therapeutically active flavonoids. The therapeutic
applications of flavonoids on inflammation have
previously been reported (Middleton, 2000;
Havsteen,2002). The data of our studies suggests that
Canthium parviflorum showed significant anti-
inflammatory activity by in vitro methods tested. Further
studies involving the isolation and purification of the
chemical constituents of the plant and the investigations in
the biochemical pathways may result in the development
of a potent anti-inflammatory agent with a low toxicity
and better therapeutic index.
Karthik et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 730
Table.2.Anti denaturation of BSA in presence of Canthium parviflorum extracts
Type of sample Concentration(μg/ml) %Inhibition
Ethanolic 1 67.5±0.07
Ethanolic 100 46.6±0.03
Ethanolic 200 23.7±0.06
Ethanolic 500 12.2±0.09
Hexane 1 56.4±0.03
Hexane 100 39.4±0.07
Hexane 200 27.8±0.02
Hexane 500 10±0.06
Ibuprofen 100 71.89±0.07
CONCLUSION Canthium parviflorum is a valuable medicinal
shrubby and woody plant which has been valued for
centuries in ayurvedic medicine. Phyto-chemical analysis
of Canthium parviflorum plant extracts revealed the
presence of various bio-chemical compounds such as
flavonoids, glycosides, alkaloids, saponins and terpenoids.
Since glycosides and flavonoids have remarkable anti-
inflammatory activity, our present work aims at evaluating
the in-vitro anti-inflammatory activity of Canthium
parviflorum by protein denaturation method. Denaturation
of proteins is a well documented cause of inflammation
and rheumatoid arthritis. The data of our studies suggests
that Canthium parviflorum extract showed significant anti-
inflammatory activity. Therefore our studies support the
isolation and use of active constituents of Canthium
parviflorum in treating inflammation.
ACKNOWLEDGEMENT
The authors are thankful to Prof.Dr.N.Devanna,
Director, Oil Technological Research Institute, JNTUA,
Ananthapuramu for the encouragement and facilities
provided to carry out this research work.
REFERENCES
Anitha B, Mohan.V.R, Athiperumalsami T and Sudha S,
Ethnomedicinal plants used by the kanikkars of
Tirunelveli District, Tamil Nadu, India to treat skin
diseases, Ethnobotanical Leaflets, 12, 2008, 171-180
Ayyanar M, Sankarasivaraman K., and Ignacimuthu. S,
Traditional Herbal Medicines used or the treatment of
Diabetes among two major tribal groups in south Tamil
Nadu, India, Ethnobotanical Leaflets, 12, 2008, 276-280
Grant NH, Alburn HE, Kryzanauskas C, Stabilization of
serum albumin by anti-inflammatory drugs. Biochem.
Pharmacol, 19, 1970, 715 -722.
Havsteen BH, The biochemistry and medical significance
of the flavonoids, Pharmacol. Ther, 96 (2-3), 2002, 67-
202.
Insel PA, Analgesic-antipyretic and anti-inflammatory
agents and drugs employed in the treatment of gout. In:
Hardman JG Limbird LE, Molinoff PB, Ruddon RW and
Goodman Gilman A, The pharmacological Basics of
Therapeutics. McGraw Hill, New York, ninth edition,
1996, 617-657.
Mahishi Parinitha, Srinivasa B.Ha and Shivanna M.B,
Medicinal plant wealth of local communities in some
villages in Shimoga District of Karnataka, India Journal
Ethno pharmacology, 98 (3), 2005, 307-312.
Middleton E, Kandaswami C, Theoharides TC. The
effects of plant flavonoids on mammalian cells:
implications for inflammation, heart disease and cancer,
Pharmacol. Rev, 52, 2000, 673–751.
Mizushima Y, Screening test for anti-rheumatic drugs,
Lancet, 2, 1966, 443.
Mohideen S, Ilavarasan R, Hemalatha S, Anitha N, and
Sasikala E, Wound healing and diuretic activities of
Canthium parviflorum Lam, Natural Product Sciences, 9
(2), 2003, 102-104.
Robbins, Cotron, Vinay K, Abdul KA, Nelson F,
Pathologic Basis of Disease, Elsevier publication, seventh
edition, 2008, 47-53.
Vane JR, Bolting RM, New insights into the mode of
action of anti-inflammatory drugs, Inflam. Res, 44, 1995,
1–10.
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 731
EVALUATION OF NEPHRO PROTECTIVEACTIVITY OF METHANOLIC
EXTRACT OF SEEDS OF VITIS VINIFERA AGAINST RIFAMPICIN AND
CARBONTETRA CHLORIDE INDUCED NEPHRO TOXICITY IN WISTAR RATS Kalluru Bhargavi,
*N Deepa Ramani, Janarthan M, Durraivel S
Department of Pharmacology, Nimra College of Pharmacy, Vijayawada, India
*Corresponding author: Email: [email protected]
ABSTRACT
The Objective of the study was to investigate the nephroprotective activity of methanolic extract of seeds
of Vitisvinifera (family:vitaceae) against rifampicin induced and carbontetrachloride induced kidney damage in
rats.Male albino wistar rats (150-250gm) were selected and divided in to six groups of six animals each. Group 1
served as normal control, group 2 served as positive control, group 3 served as standard, group 4 was treated with
MEVV (low dose) and group 5 was treated with MEVV (high dose). The same grouping was followed for both
models (rifampicin and carbon tetra chloride). Inducing agents are given 3 days once for two weeks to induce
nephrotoxicity. The results are evidenced on the basis of physical, biochemical and histological parameters. One-
way analysis of variance followed by tukey’s multiple comparison tests were used for statistical
analysis.Rifampicin and carbontetrachloride produced significant changes in physical (decreased liver and body
weight), biochemical (increased levels of total protein, uric acid, urea, and creatinine), and histological parameters
in rats. Pretreatment with MEVV and standard drug cystone significantly prevented the physical, biochemical and
histological changes produced by rifampicin and carbon tetrachloride toxicity. Results of the present study
suggest that MEVV has a significant nephroprotective activity probably by acting against free radicals.
Key words: Vitis vinifera, Nephrotoxicity, Rifampicin, Carbontetrachloride, Biochemical parameters
INTRODUCTION
Nephrotoxicity is one of the most common kidney
problems and occurs when body is exposed to a drug or
toxin. When kidney damage occurs, body unable to rid of
excess urine and wastes from the body and blood
electrolytes (such as potassium and magnesium) will all
become elevated (Ramya, 2011). A number of therapeutic
agents can adversely affect the kidney resulting in acute
renal failure, chronic interstitial nephritis and nephritic
syndrome. Because of the increasing number of potent
therapeutic drugs like aminoglycoside antibiotics,
chemotherapeutic agents and NSAIDS have been added to
the therapeutic arsenal in recent years. Exposure to
chemical reagents like ethylene glycol, carbon
tetrachloride, sodium oxalate and heavy metals like lead,
mercury, arsenic and cadmium also induces
nephrotoxicity which leads to acute kidney injury (AKI).
(Porter, 1981; Hoitsma, 1991, Paller, 1990)
MATERIALS AND METHODS
Materials: All chemicals were of analytical grade and
obtained locally. Creatinine,totalprotein,urea and uric acid
kit were procured from Robonik diagnostics, Hyderabad,
India.
Plant material: The fresh seeds Vitis vinifera was
collected from Kadapa District; A.P. Identification of the
plant was done by Dr. SreedharMurty, Assistant Professor,
Department of Botany, Government College of Arts,
Kadapa, A.P, India.
Animals: Healthy adult male wistar rats weighing
between 150-250gm were used for the present study. The
animals were housed in groups of six and maintained
under standard conditions (27±2ºC, relative humidity 44 -
56% and light and dark cycles of 10 and 14 hours
respectively) and fed with standard rat diet and purified
drinking water ad libitum for 1 week before and during the
experiments.
Preparation of the extract: The dried flowers of
V.viniferawas collected, cleaned, dried and powdered in a
grinder - mixer to obtain a coarse powder and then passed
through 40 mesh sieve. About 1000 gm of powdered drug
was extracted with aqueous methanol by soxhlet
apparatus. The extraction was carried out until the drug
becomes exhausted. The solvent was recovered from their
extract by distillation under reduced pressure. The dried
extract thus obtained was kept in a desicator and was used
for further experiments.
Induction of nephrotoxicity in rats: Rifampicin
(1000mg/kg) was dissolved in distilled water and
administered orally to rats for 14 consecutive days at an
interval of 72 hrs to induce experimental Nephro toxicity
in rats .CCl4 (1ml/kg) was dissolved in olive oil and
injected intraperitoneally to rats for 14 consecutive days at
an interval of 24 hrs to induce experimental Nephro
toxicity in rats.
Experimental design:
Rifampicin induced nephrotoxicity: The experimental
animals were randomly divided in to 5 groups (n= 6) and
treated for duration of 14 days as per the treatment
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 732
schedule given in table.1. Nephrotoxicity was induced by
administration of Rifampicin (1000 mg/kg oral) three days
once for two weeks. Methanolic extract of V. vinifera was
freshly suspended in distilled water and administered to
animals by oral feeding needle.
Carbon tetra chloride induced nephrotoxicity: The
experimental animals were randomly divided in to 5
groups (n= 6) and treated for duration of 15 days as per
the treatment schedule given in table.2. Nephrotoxicity
was induced by injected intraperitoneally of CCl4 (1ml/kg
i.p) with olive oil every day for two weeks. Methanolic
extract of V. vinifera was freshly suspended in distilled
water and administered to animals by oral feeding needle.
PARAMETERS MEASURED
Physical Parameters: The body weight was recorded on
the first day and then last day of the study period in each
group.
Blood Estimations: Levels of creatinine,total
protein,urea,uric acid in blood weredetermined by using
commercial glucometer kit on final day of the experiment
by collecting blood.
Urine Estimations:Levels of creatinine,total
protein,urea,uric acid in urine were determined by using
commercial glucometer kit on final day of the experiment
by collecting urine.
Histopathological studies: For histopathological studies,
tissue obtained from the excised kidney was immediately
fixed in 10% buffered neutral formalin solution. The fixed
tissues were embedded in paraffin and serial sections were
cut. Each section was stained with hematoxylin and eosin
(H & E stain). The sections were examined under light
microscope and photomicrographs were taken.
Statistical analysis: All the data was expressed as mean ±
S.E.M. Statistical significance between more than two
groups was tested using one way ANOVA followed by the
Tukey’s multiple comparison test using computer based
fitting program (Prism graph pad 5.0). Statistical
significance was set accordingly.
Table.1.Treatment schedule for evaluation of nephroprotective activity of V vinifera against Rifapmicin induced
nephrotoxicity in Wistar Rats S.NO Groups Treatment (14 days)
I Normal Vehicle (1% CMC)
II Control Rifampicin (1000mg/kg,p.o.)
III Standard Rifampicin (1000mg/kg,p.o.) + Cystone (500 mg/kg, p.o.)
IV Low dose Rifampicin (1000 mg/kg, p.o.) + VVFE (100 mg/kg, p.o.)
V High dose Rifampicin (1000 mg/kg, p.o.) + VVFE (200 mg/kg, p.o.)
Table.2.Treatment schedule for evaluation of nephroprotective activity of V vinifera against Carbon tetrachoride
induced nephrotoxicity in Wistar Rats S.NO Groups Treatment (15 days)
I Normal Olive oil (5ml/kg.p.o.)
II Control CCl4 (1ml/kg,i.p.)
III Standard CCl4 (1ml/kg,i.p.) + Cystone (500 mg/kg, p.o.)
IV Low dose CCl4 (1ml/kg,i.p.) + VVFE (100 mg/kg, p.o.)
V High dose CCl4 (1ml/kg,i.p.) + VVFE (200 mg/kg, p.o.)
Note: I.P = Intra peritoneal, P.O = Per oral
RESULTS AND DISCUSSION
Effect of plant extract on body and kidney weight:
Carbon tetra chloride treated rats showed significant
(p<0.05) decrease in body and kidney weight compared to
control rats. Pretreatment with test-1, test-2 and standard
significantly (p<0.05) increased body and kidney weights
as compared to carbon tetra chloride treated rats (table 3).
Rifampicin treated rats showed significant (p<0.05)
decrease in body and kidney weight compared to control
rats. Pretreatment with test-1, test-2 and standard
significantly (p<0.05) increased body and kidney weights
as compared to Rifampicin treated rats. (Table.4).
Effect of Plant extract on blood and urine estimations:
Carbon tetra chloride (CCl4) treated rats showed
significant (p<0.05) increase in levels of total Protein,
urea, uric acid and Creatinine in blood and urine as
compared to control rats. Pretreatment with test-1, test-2
and Standard significantly (p<0.05) decreased the elevated
levels of these parameters as compared to CCl4 treated rats
(table.5). Rifampicin treated rats showed significant
(p<0.05) increase in levels of Total Protein, urea, uric acid
and Creatinine in blood and urine as compared to control
rats. Pretreatment with test-1, test-2 and Standard
significantly (p<0.05) decreased the elevated levels of
these parameters as compared to Rifampicin treated rats.
(Table.6).
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 733
Table.3.Effect of extract on body and kidney weight (CCl4 induced)
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where
n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Table.4.Effect of extract on body and kidney weight (Rifampicin induced)
Groups Initial body weight
(gm)
Final body weight
(gm)
Change in body
weight (gm)
Kidney weight
(gm)
Normal 180 200 20±0.62 0.815±0.021
Positive Control 210 180 -30±1.02 0.59±0.024
Standard 250 230 -20±1.21 0.86±0.027
Test-1 190 185 -5±0.39 0.62±0.021
Test-2 200 180 -20±0.66 0.75±0.028
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where
n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Table.5.Effect of plant extract on blood and urine estimations in Carbon tetra chloride induced nephrotoxic rats
Group
Blood Parameters Urine Parameters
Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine
Control 7.355+0.119 22.89+0.8 2.561+0.133 0.603+0.037 41.8+1 25.253+1.302 3.468+0.052 51.95+0.16
Positive control 19.5+0.086* 52.626+0.958* 7.49+0.109 1.85+0.036* 88.93+1.024* 56.75+2* 10.63+0.089* 2.628+0.045*
Standard 7.74+0.084# 41.5+0.081# 3.12+0.173# 0.3+8.975# 43.51+0.097# 35.611+0.112# 8.34+0.043# 0.675+0.029#
Test 1 9.59+0.082# 34.67+0.89# 50.35+0.038# 0.218+0.011# 62.26+0.099# 40.363+2.127# 4.708+0.035# 0.458+0.108#
Test 2 9.05+0.103# 26.21+1.199# 4.26+0.01# 0.413+0.01# 51.95+0.16# 28.9+2.438# 0.458+0.108# 0.348+0.032#
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where
n=6; *when compared with Control; #-when compared with Positive control; *P<0.05 ; ns-no significance
Table.6.Effect of Plant extract on blood and urine estimations in Rifampicin induced nephrotoxic rats
Group
Blood Parameters Urine Parameters
Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine
Control 7.458+0.076 23.96+1.028 2.302+0.06 0.068+0.038 39.46+1.29 26.132+1.507 3.368+0.541 0.822+0.023
Positive control 18.594+0.180* 51.562+1.18* 7.66+0.076* 1.84+0.043* 90.76+1.196* 62.43+1.467* 10.502+0.12* 2.59+0.056*
Standard 7.22+0.079# 40.23+0.049# 3.007+0.168# 0.284+0.0082# 44.346+0.01# 36.6+0.032# 8.274+0.393# 0.644+0.028#
Test 1 9.93+0.177# 33.4+0.079# 5.32+0.023# 0.504+0.273# 61.63+0.007# 35.54+1.546 4.72+0.027# 0.0386+0.123#
Test 2 8.85+0.032# 25.48+1.468# 4.242+0.003# 0.408+0.127# 51.402+0.008# 26.2+0.222# 4.68+0.02# 0.324+0.029#
All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where
n=6; *when compared with Control; #-when compared with Positive control; *P<0.05 ; ns-no significance
Histopathological studies: Histological changes such as
cortical glomerular, peritubular blood vessels congestion,
and interstitial inflammation etc. were observed in the
CCl4 and Rifampicin administered group. Pretreatment
with standard (cystone), low and high dose of Vitis
vinifera extract (VVFE) significantly prevented
histopathological changes towards normal.
Normal Group Positive Control (CCl4)
Groups Initial body
weight (gm)
Final body weight
(gm)
Change in body
weight (gm)
Kidney weight
(gm)
Normal 200 230 +30±1.065 0.95±0.033
Positive Control 210 180 -30±0.866* 0.61±0.029*
Standard 190 180 -10±0.578# 0.72±0.016
#
Test-1 240 210 -30±0.87# 0.82±0.012
#
Test-2 200 190 -10±0.613# 0.79±0.025
#
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 734
Standard Group Low dose Extract
High dose extract Control
Positive Control (Rifampicin) Standard
Low dose extract High dose extract
Note: ET: Extended Tubules; BC = Bowmen’s capsule ; DBC = Distanded bowmen’s capsule; V = Vacules; C = Casts
Percentage change in body weight and increased
the levels of serum and urine markers such as Creatinine,
urea, uric acid, and total protein when compared with
control rats. Pretreatment with VVFE in CCl4
administered rats significantly reduced the elevated levels
of serum and urine markers when compared to positive
control group. It indicates protective effect of VVFE
against rifampicin induced nephrotoxicity in rats.
Histological changes such as cortical glomerular,
peritubular blood vessels congestion, and interstitial
inflammation were observed in the CCl4 and rifampicin
administered group. The VVFE pretreated rats
significantly prevented these histological changes, further
indicating their nephroprotective activity. All the
histological changes observed were in correlation with the
physical and biological parameters of the kidney. From
the present study results, it indicates that VVFE has
protective effect against rifampicin and carbon
tetrachloride induced nephrotoxicity in rats individually.
Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 735
CONCLUSION
In conclusion, Results of the present study suggest
that VVFE provides adequate protection against
rifampicin induced and carbon tetra chloride induced
nephrotoxicity on albino wistar rats as evidenced by
physical, biochemical and histological parameters. The
protective effect of VVFE may be due to its antioxidant
potential. However, further studies are needed to confirm
its clear mechanism of action in nephroprotection and to
characterize the chemical constituents responsible for it.
REFERENCES
Hoitsma AJ., Wetzels JF and Koene RA, Drug induced
nephrotoxicity. Aetiology, clinical features and
management. Drug Saf, 6 (2), 1991, 131-147.
Paller MS, Drug induced nephropathies, Med Clin North
Am, 74 (4), 1990, 909-917.
Porter G. A., Bennett W.M, Nephrotoxic acute renal
failure due to common drugs, American journal of
Physiology, F1-F8, 241(7), 1981, 252-256.
RamyaPydi, IRajalakshmi, S Indumathy, S Kavimani,
Nephroprotective Medicinal Plants - A Review,
International Journal of Universal Pharmacy and Life
Sciences, (2), 2011, 266-281.
Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 736
ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF ESTIMATION
METHOD FOR SOTALOL HYDROCHLORIDE TABLETS BY USING RP-HPLC
G Abirami*, K Anand Kumar, T.Veterichelvan, Arunateja Muvva
Department of Pharmaceutical Analysis, Adhiparasakthi College of Pharmacy, Melmaruvathur, Tamil Nadu, India
*Corresponding author: Email:[email protected], Phone +91- 9444884490
ABSTRACT
The present investigation describes about a simple, economic, selective, accurate, precise Reverse phase
High performance liquid chromatographic method for the estimation of Sotalol Hydrochloride in pharmaceutical
dosage forms. Sotalol Hydrochloride was well eluted using a C18 column of dimension 100 × 4.6, 5µm and
Mobile phase consisting of Acetonitrile: 20 mM Ammonium acetate buffer (pH-6): Methanol in the ratio of
10:75:15 v/v/v at the flow rate 1 ml/min and the detection was carried out at 229 nm with UV detector. The
Retention time for Sotalol Hydrochloride was found to be 3.314. The developed method was validated for
recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully
applied to Sotalol Hydrochloride pharmaceutical dosage form.
KEY WORDS: RP-HPLC, Sotalol Hydrochloride, Accuracy, Precision.
1. INTRODUCTION
Sotalol Hydrochloride ((RS)-N-{4-[1hydroxy2
(propan2ylamino) ethyl] phenyl} methane sulfonamide) is
an antiarrhythmic drug with Class II (beta-adrenoreceptor
blocking) and Class III (cardiac action potential duration
prolongation) properties. Sotalol hydrochloride has both
beta-adreno receptor blocking (Vaughan Williams Class
II) and cardiac action potential duration prolongation
(Vaughan Williams Class III) antiarrhythmic properties.
Sotalol hydrochloride is a racemic mixture of d- and l-
sotalol. Both isomers have similar Class III antiarrhythmic
effects. The chemical structure of Sotalol Hydrochloride
was shown in Fig.1.
Literature survey revealed that very few methods
have been reported for the analysis of Sotalol
Hydrochloride dosage form which includes UV
spectroscopy, Reverse Phase High performance Liquid
Chromatography methods (Gluth, 1988; Läer, 1996;
Rbeidaa, 2003; Poirier, 1986; Robert, 1991;
Banerjee, 1991). The present study illustrate
development and validation of simple, economical,
selective, accurate, precise RP-HPLC method for the
determination of Sotalol Hydrochloride in Pharmaceutical
dosage form as per ICH guidelines.
The goal of this study is to develop rapid,
economical HPLC method for the analysis of Sotalol
Hydrochloride dosage form using most commonly
employed column (C18) and simple mobile phase
preparation. In the present proposed work a successful
attempt had been made to develop a method for the
estimation of Sotalol Hydrochloride pharmaceutical
dosage form and validate it. From the economical point of
view and for the purpose of routine analysis, it was
decided to develop a more economical RP-HPLC method
with simple mobile phase preparation for the estimation of
Sotalol Hydrochloride dosage form. Thus, the paper
reports an economical, simple and accurate RP-HPLC
method for the above said pharmaceutical dosage form.
2. MATERIALS AND METHODS
Quantitative HPLC was performed on a Shimadzu
HPLC system connected with UV Detector. The drug
analysis data were acquired and processed using Lab
Solutions software running under Windows XP and C18
column of dimension 100 × 4.6, 5µm particle size. In
addition to an analytical balance (Shimadzu AUX- 220),
digital pH meter, a sonicator (Soltec - Sonica Ultrasonic
Cleaner - Model 2200 MH) was used in this study.
Standards and chemicals used: Pharmaceutical grade
Sotalol Hydrochloride was kindly supplied as a gift
sample by KOCH Laboratories, Vijayawada, India.
Methanol, Acetonitrile and water of HPLC grade were
purchased from Qualigens India Pvt. Limited, Mumbai.
Ammonium acetate was analytical reagent grade supplied
by Fischer Scientific Chemicals. Sotalol Hydrochloride
Tablets available in the market as SOTALAR 40 which
contains 40 mg of Sotalol Hydrochloride.
Preparation of mobile phase: 1.5416 gm of Ammonium
acetate was accurately weighed and dissolved in sufficient
quantity of water and made up to 1000 mL with the same
to get 20 mM Ammonium acetate buffer (pH-6) and
filtered through 0.45µ membrane filter. Mobile phase is
prepared by mixing Methanol: Acetonitrile: 20 mM
Ammonium acetate buffer (pH-6) (15: 10:75) v/v/v and
degassed by sonication.
Standard stock solution preparation: Weighed
accurately about 10 mg of Sotalol hydrochloride working
standard and transferred into a 25 mL volumetric flask.
Added about 15 mL water to dissolve it completely and
made up to the volume with the same. Further 2.5 mL of
this solution was diluted to 25 mL with mobile phase.
Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 737
Preparation of Calibration graph: In this progression,
the aliquots of stock solution of Sotalol hydrochloride (1
to 6 mL) individually were transferred into a series of six
10 mL volumetric flasks and made up to the mark with
mobile phase. The solutions contain the concentrations of
4-24 µg/mL. All the solutions were injected and the
chromatograms were recorded at 229 nm. The above
concentration range was found to be linear and obeys
Beer’s law. The procedure was repeated for three times.
The peak areas were plotted against concentration and the
calibration curve was constructed.
Quantification of formulation: Estimation of Sotalol
hydrochloride in tablet formulation by RP – HPLC was
carried out using optimized chromatographic conditions.
Ten tablets of formulation (SOTALAR 40) were weighed
accurately. The average weight of tablets was found and
powdered. The tablet powder equivalent to 60 mg of
Sotalol hydrochloride was weighed and transferred into
100 mL volumetric flask and added about 80 mL of water
to dissolve the substance and made up to the volume with
the same (600 g/mL). The solution was sonicated for 15
minutes, centrifuged at 200 rpm for 15 minutes and
filtered through Whatmann filter paper No. 41. From the
clear solution, further dilutions were made by diluting 2.5
mL into 25 mL with mobile phase. Further 2 mL of this
solution is diluted to 10 mL with mobile phase to obtain
the expected concentration of 12 g/mL solution. A
steady base line was recorded with optimized
chromatographic conditions. After the stabilization of base
line for 30 minutes, the test solutions were injected and
recorded the chromatograms. The concentration of each
test solution was determined by using slope and intercept
values from the calibration graph.
Recovery studies
Preparation of raw material stock solution: 240 mg of
Sotalol hydrochloride was accurately Weighed and
transferred in to a 10 mL volumetric flask, dissolved in
water and made up to the mark with water to get a
concentration of 24 mg/mL of Sotalol hydrochloride
Recovery procedure: To determine the accuracy of the
method, recovery study was performed by standard
addition method. The recovery experiment was done by
adding known concentrations of Sotalol hydrochloride
working standard to the pre analyzed formulations. To the
50% of pre-analysed formulation solution, known
quantities of standard drug that is 80, 100, and 120 % of
quantification concentration (2 mL, 2.5 mL and 3 mL of
Sotalol hydrochloride raw material stock solution) were
added into a series of 100 mL volumetric flasks, diluted
with water and sonicated for 15 minutes. After sonication
the solution was made up to 100 mL with water. The
solutions were filtered through Whatmann filter paper No.
41. From each solution, 1 mL of clear filtrate was
transferred into a series of 50 mL volumetric flasks and
made up to the volume with mobile phase. The solutions
were injected and the chromatograms were recorded. The
quantity of drug recovered was calculated by using slope
and intercept values from the calibration graph. The
procedure was repeated for three times for each
concentration.
System suitability studies: The system suitability studies
conceded as per ICH guidelines and USP. The parameters
like capacity factor, tailing factor, asymmetry factor, and
number of theoretical plates were calculated.
Validation of Developed Method:
Linearity: A calibration curve was plotted with
concentration versus the peak area. The linearity range
was checked for in the concentration range of 4 - 24
µg/mL of Sotalol hydrochloride. The drug was found to be
linear in the specified concentration range.
Precision: The repeatability of the method was checked
by repeated analysis of the formulation for six times with
the same concentration. The amount of drug present in the
formulation was calculated. The percentage RSD value
was calculated.
Accuracy: Accuracy of the method was confirmed by
recovery studies. To the pre-analyzed formulation a
known quantity of the standard drug solution was added
and the amount of drug recovered was calculated. The
percentage RSD value was calculated.
LOD and LOQ: The linearity study was carried out for
three times. The LOD and LOQ were calculated based up
on the calibration curve method. The LOD and LOQ were
calculated using the average of slope and intercept.
Figure.1.Chemical Structure of Sotalol Hydrochloride
Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 738
3. RESULTS AND DISCUSSION
Reverse phase HPLC method was preferred for
the determination of Sotalol Hydrochloride. Preliminary
experiments were carried out to achieve the best
chromatographic conditions for the determination of the
drug substance. C18 column with a 4.6 mm inner diameter
and 5µm particle size was chosen. The detection wave
length was selected as 229 nm with UV detector.
Chromatographic conditions were optimized by changing
the mobile phase composition and buffers used in mobile
phase. Different experiments were performed to optimize
the mobile phase but adequate elution of the drug could
not be achieved. By altering the pH of buffer results a
good elution. Different proportions of solvents were
tested. Eventually the best elution was obtained by the
isocratic elution system using a mixture of Methanol:
Acetonitrile: 20 mM Ammonium acetate buffer (pH-6) in
the proportion of 15: 10:75 v/v/v at a flow rate of 1
ml/min. Under these conditions Sotalol Hydrochloride
was eluted at 3.314 minutes with a run time of 7 minutes.
The representative chromatogram of this estimation was
shown in Fig. 2.
The Methanol: Acetonitrile: 20 mM Ammonium
acetate buffer (pH-6) in the proportion of 15: 10:75 v/v/v
was chosen as the mobile phase. The run time of the
HPLC procedure was 7 minutes at flow rate of 1ml/min
was optimized which gave sharp peak, minimum tailing
factor. The system suitability parameters were shown in
Table 1 were in within limit, hence it was concluded that
the system was suitable to perform the assay. The method
shows linearity between the concentration ranges of 4-24
µg/ml. The experimental results were shown in Table 2
and Fig.4. The precision of the method was confirmed by
repeatability of the formulation. The percentage purity of
Sotalol hydrochloride present in formulation was found to
be 99.3314 % ± 1.0697. The % RSD value was found to
be 1.0769. It indicates that the method has good precision.
The values are shown in Table 3 and Fig.3. The %
recovery of Sotalol Hydrochloride was found to be in the
range of 100.131 – 101.696 and the recovery data was
shown in Table 4. As there was no interference due to
excipients and mobile phase, the method was found to be
specific.
Table.1.System suitability parameters for proposed method
Parameter Sotalol Hydrochloride Standard limit
Retention time 3.314 -
Tailing Factor 1.39 <2
Asymmetrical Factor 1.51 <2
Theoretical Plates 2533 >2000
Table.2: Optical characteristics of Sotalol Hydrochloride
Parameters Sotalol Hydrochloride
Beers law limit (μg/mL) 4 – 24
Correlation Coefficient (r) 0.99902
Regression Equation (y=mx+c) y=3652.6339x + 900.3928
Slope (m) 3652.6339
Intercept (c) 900.3928
LOD (μg/mL) 0.164485
LOQ (μg/mL) 0.498439
Standard Error 1524.76594
Table.3: Results of Precision study
Labelled amount
(mg/tab)
Amount
found(mg)
%
Obtained
Average*
S.D %RSD SE
40 39.8511 99.6277 99.3314 1.0697 1.0769 0.0297
40 40.5202 101.3005
40 39.6941 99.2352
40 39.3301 98.3252
40 39.4315 98.5787
40 39.5685 98.9212
Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 739
Table.4.Recovery data of Sotalol Hydrochloride Drug % Level Amount
present
(µg/mL)
Amount
added
(µg/mL)
Amount
estimated
(µg/mL)*
Amount
recovered
(µg/mL)*
%
Recovery
Average(%)
±S.D
%
R.S.D
S.E
Sotolol 80 11.9197 9.6 21.5870 9.6673 100.1010 100.396
±
1.1693
1.1647 0.1299
11.9197 9.6 21.4337 9.514 99.1041
11.9197 9.6 21.6574 9.7327 101.3822
100 11.9197 12 23.9450 12.0253 100.2108 100.131
±
0.8116
0.8106
0.0901
11.9197 12 23.8336 11.9139 99.2885
11.9197 12 24.0277 12.108 100.9
120 11.9197 14.4 26.6987 14.779 102.6319 101.696
±
0.8172
0.8036
0.0908
11.9197 14.4 26.4818 14.5621 101.1256
11.9197 14.4 26.5111 14.5914 101.3291
Fig.2: Optimized chromatogram of Sotalol Hydrochloride
Fig.3: Chromatogram of Sotalol Hydrochloride in marketed formulation
Fig.4.Linearity of Sotalol Hydrochloride
0
16844
30851
44874
57897
72237
90421
0
20000
40000
60000
80000
100000
0 5 10 15 20 25 30
PE
AK
AR
EA
CONCENTRATION [µg/mL]
SOTALOL HYDROCHLORIDE LINEARITY
Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 740
4. CONCLUSION
A new validated RP-HPLC method has been
developed for the Quantitative and Qualitative
determination of Sotalol Hydrochloride in tablet dosage
form. The method was completely validated shows
satisfactory results for all the method validation
parameters tested and method was free from interferences
of the other active ingredients and additives used in the
formulation. Infact results of the study indicate that the
developed method was found to be simple, reliable,
accurate, linear, sensitive, economical and reproducible
and have short run time which makes the method rapid.
Hence it can be concluded that the proposed method was a
good approach for obtaining reliable results and found to
be suitable for the routine analysis of Sotalol
Hydrochloride Pharmaceutical formulations.
ACKNOWLEDGEMENT
The authors wish to thank Sakthi Arul Thiru
Amma and Thirumathi Amma ACMEC Trust,
Melmaruvathur for providing facilities to do the work in
successful manner. The authors would like to thank
KOCH Laboratories, Vijayawada for providing samples
for completing this project work successfully.
REFERENCES
Anonymous, http://en.wikipedia.org/wiki/Sotalol
Anonymous, http://www.drugs.com/pro/sotalol.html
Anonymous, The Merck Index, An Encyclopedia of
Chemicals, Drugs and Biologicals, 14th Edition, Merck
Research Laboratories, a division of Merck and Co. Inc.,
NJ, USA, 2006, 8725.
Boutagy J, Shenfield GM, Simplified procedure for the
determination of sotalol in plasma by high-performance
liquid chromatography, J Chromatogr, 565(1-2), 1991,
523-8.
Clarkes Analysis of Drugs and Poisons (in
Pharmaceutical, body fluids and postmortem material),
Third Edition, 2004, 1565.
Code Q2A, Text on Validation of Analytical Procedures,
ICH Harmonized Tripartite Guidelines, Geneva,
Switzerland, and 27th October, 1-5, 1994.
Code Q2B, Validation of Analytical Procedures and
Methodology, ICH Harmonized Tripartite Guidelines,
Geneva, Switzerland, 1-8, 1996.
Dogrukol D, Dal AG, Tunçel M, Determination of Sotalol
in Tablets and Serum by CZE, Chromatographia, 66(1),
2007, 159-163.
Gluth WP, Sörgel F, Gluth B, Braun J, Geldmacher-von
Mallinckrodt M. Determination of Sotalol in human body
fluids for pharmacokinetic and toxicokinetic studies using
high-performance liquid chromatography,
Arzneimittelforschung, 38(3), 1988, 408-11.
Läer S, Neumann J, Scholz H, Uebeler P, Zimmermann
N.Determination of Sotalol in human cardiac tissue by
high-performance liquid chromatography, J Chromatogr B
Biomed Appl, 681(2), 1996, 291-8.
Lloyd R Snyder, Practical HPLC Method Development,
2nd
edition, John Wiley and sons, New York, 180-182,
1997.
Poirier JM, Jaillon P, Cheymol G.Quantitative liquid
chromatographic determination of Sotalol in human
plasma, Ther Drug Monit, 8(4), 1986, 474-7.
Rbeidaa O, Christiaensa B, Chiapa P, Huberta Ph, Lubdab
D, Boosc K S, Crommena J, Fully automated LC method
for the determination of sotalol in human plasma using
restricted access material with cation exchange properties
for sample clean-up, Journal of Pharmaceutical and
Biomedical Analysis, 32(4–5), 2003, 829–838.
Robert A. Carr, Robert T. Foster, Nadeem H. Bhanji.
Stereospecific High-Performance Liquid Chromatographic
Assay of Sotalol in Plasma, Pharmaceutical Research,
8(9), 1991, 1195-1198
Shimadzu Instruction Manual AX-200 Digital balance,
Shimadzu Corporation, Kyoto, Japan, 42, 2001.
Shimadzu LC-10 ATVP High Performance Liquid
Chromatography Instruction Manual, Shimadzu
Corporation, Kyoto, Japan, 11-2, 2001.
Shimadzu SPD-10 ATVP High Performance Liquid
Chromatography Instruction Manual, Shimadzu
Corporation, Kyoto, Japan, 11-2, 2001.
SK Banerjee, R Mashru. A rapid colorimetric
determination of Sotalol-hydrochloride in bulk and dosage
form, Indian journal of pharmaceutical sciences, 53(6),
1991, 243-244.
Zarghi A, Foroutan SM, Shafaati A, Khoddam
A.Development an ion-pair liquid chromatographic
method for determination of Sotalol in plasma using a
monolithic column, J Pharm Biomed Anal, 41(4), 2006,
1433-7.
Durga Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 741
A STUDY ON ROLE OF DEMOGRAPHIC FACTORS IN SMALL INVESTORS’
SAVINGS IN STOCK MARKET Durga Rao P V
*1, Chalam G V
1 and Murty T N
2
1. Dept. of Commerce & Business Admn., Acharya Nagarjuna University, Guntur, India
2. Nimra College of Business Management, Vijayawada, India
*Corresponding Author: E Mail:[email protected]
ABSTRACT
Stock market helps to channelize household savings to the corporate sector which in turn utilize for the
development of industrial and service sector. An equity share is a part of the ownership capital of a company and
the holder of such a share is a member of the company eligible to share many benefits of the company. One
invests in shares keeps it for some time depending upon the stock price. When the rate of share price increases,
the investor sells the securities to another party. Investment in shares will fetch better returns compared to any
other forms of investment. Whenever the inflation rate is high, the stock market has given higher rates of return
to the investors.
Key Words: Investment, Share, Securities, Demography
1. INTRODUCTION
Stock market helps to channelize household
savings (Retail) to the corporate sector which in turn
utilize for the development of industrial and service
sector. An equity share is a part of the ownership capital
of a company and the holder of such a share is a member
of the company eligible to share many benefits for the
company. Share trading helps the corporate to raise
additional funds for expansion by creating demand for the
securities. The liquidity that an exchange provides gives
the investors the ability to quick and easy selling of
securities. This is an attractive feature of stock market
investment. Stock trading is done only though brokers.
Demographic factors influencing in small Investors’
investment in stock market are Residence, Age, Sex,
Marital status, Education, Occupation, Family Size,
Earning members in the Family, Family Income, Type of
Investor, and Category of Investor.
The objectives of the present study are to study
the demographic factors of the respondents, to identify the
investment pattern of small investors based on
demographic factors and to make valuable suggestions to
the small investors in stock market.
MATERIALS AND METHODS The study is on primary and secondary data. The
primary data relating to the retail equity investors were
collected by interviewing the equity investors
(respondents are 500) with the help of the interview
schedule. The secondary data relating to the study like the
capital market developments and the trends in retail
investor participation in India were obtained from various
published and unpublished records, annual reports,
manuals, bulletins, booklets, journals, magazines, etc.,
RESULTS AND DISCUSSION
Investment objectives of the retail equity investors
based on the following Demographic variables: Place of
Residence, Age, Gender, Marital Status, Educational
Level, Occupation, Family Size, No. of Earning Members
in the Family, Monthly Family Income, Type of Investor,
Category of Investor, Type of Market Operated and
Market Experience.
Residence: Investors’ place of residence has been broadly
classified into eight categories such as Guntur town,
Tenali, Narasaraopet, Piduguralla, Ponnur, Sattenapalli,
Repalle and Guntur and Tenali Rural. Out of 500 sample
investors 60% (300) are from Guntur town, 8% (40) are
from Narasaraopet, 9% (45) are from Piduguralla, 12%
(60) are from Tenali, 2% (10) are from Ponnur, 5% (25)
are from Sattenapalli, 2% (10) are from Repalle and 2%
(10) are from Tenali and Guntur rural.
Age: Investors have been divided into three categories
based on their age as ‘Young’ (20 – 40 years), ‘Middle
aged’ (40 – 60 years) and ‘Old’ (60 years and above). Out
of 500 sample investors, 70% (350) are Young investors,
25% (125) are Middle aged investors and 5% (25) are Old
investors.
Sex: Investors have been divided into two groups based on
their gender as ‘Male’ and ‘Female’. Out of 500 sample
investors, 85% (425) are Male investors and 15% (75) are
Female investors.
Marital Status: Investors have been placed into two
groups based on their marital status as ‘Married’ and
‘Unmarried’. Out of 500 sample investors 70% (350) are
Married investors and 30% (150) are Unmarried investors.
Education: Investors have been classified into four
categories based on their educational level as ‘School
Education’, ‘College Education’, ‘Professionals’ and
‘Others’. Out of 500 sample investors, 10% (50) are
investors with School education, 60% (300) are investors
Durga Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 742
with College education, 27% (135) are investors with
Professional education and 3% (15) investors belong to
the others category.
Occupation: Investors have been divided into four groups
based on their occupation as ‘Salaried’, ‘Professionals’,
‘Business’ and ‘Others’. Out of 500 sample investors,
50% (250) belong to the Salaried category, 12% (60)
belong to the Professional category, 35% (175) of the
investors are Businessmen and 3% (15) belong to the
Others category.
Family Size: Investors have been classified into three
categories based on their family size as ‘Small’ (less than
4 members), ‘Medium’ (4 – 6 members) and ‘Huge’ (6 &
above members). Out of 500 sample investors, 52% (260)
belong to Small family, 44% (220) belong to Medium
family and 4% (20) belong to Huge family.
Earning Members in the family: Investors have been
classified into three categories based on the number. of
earning members in their family as ‘1’, ‘2’, and ‘3’ &
above’. Out of 500 sample investors, 34% (170) investors
have 1 earning member in their family, 55% (275)
investors have 2 earning members in their family and 11%
(55) investors have 3 & above earning members in their
family.
Family Income: Investors have been classified into three
categories based on their monthly family income as ‘Low’
(below Rs20,000), ‘Medium’ (Rs.20,000 – Rs.40,000) and
‘High’ (Rs.40,000 and above). Out of 500 sample
investors, 45% (225) have Low monthly family income,
41% (205) Medium family income and 14% (70) have
High family income.
Type of Investor: Investors have been classified into two
types based on their nature as ‘Hereditary Investor’ and
‘New Generation Investor’. Out of 500 sample investors,
20% (100) are Hereditary investors and 80% (400) are
New generation investors.
Category of Investor: Investors have been classified into
three categories based on their period of holding stock as
‘Long-term investor’, ‘Day trader’ and ‘Both’. Out of 500
sample investors 45% (225) are Long-term investors,11%
(55) are Day traders and 44% (220) are both long-term
investors as well as day traders.
Type of Market Operated: Investors have been divided
into three groups based on the type of market operated by
them as operators in ‘Primary market’, ‘Secondary
market’ and ‘Both’. Out of 500 sample investors, 12%
(60) deal in Primary market alone, 50% (250) deal in
Secondary market alone and 38% (190) deal in both
primary and secondary markets.
Market Experience: Investors have been classified into
three categories based on their market experience as
‘Low’ (less than 1 year) ‘Moderate’ (1 – 3 years) and
‘High’ (3 years and above). Out of 500 sample investors,
20% (100) have Low market experience, 30% (150) have
Moderate market experience and 50% (250) have High
market experience.
Findings: Guntur town people are participating 60%
(300) and more in the share investment. Young people are
investing more than 70% (350) in shares as they may take
risk. Men are participating about 85% (425). Men are
more than women as retail investors. Married and college
education level people participating more in this
investment. Salaried, small size family people are
participating more. New Generation investors and low
level income people are participating more. Long term
investors are more and investing more in secondary
market. High experience i.e. 3 years and above investment
experience people are more than others.
Suggestions: It is suggested that it is better to bring
the government or regulatory bodies like SEBI to create
a lot of awareness and encourage in retail investors in
equities to become greater part of development of
economic system for making investment on long term
basis.
Social Relevance: Society consists of several groups of
people with different demographic factors, understanding
their investment influencing factors based on socio
economic factors may help serve the better to the society
through proper investment procedure.
Scope for further Research: The Present study is
confined to Guntur District only; there is scope for further
research in other districts in Andhra Pradesh and different
areas in financial management.
CONCLUSION
The bitter experiences are facing participants from
the Indian Capital market due to the dramatic change in
the attitude of the investor. The investor can make the
share trading as a beneficial investment area. It is purely
based upon the investor’s awareness towards share
trading. When the investor gets more and more accurate
information on the right time, then he/she can enjoy the
taste of success from the share trading. The authorities
should implement more training and awareness
programmes for the investors.
REFERENCES
Gupta L.C, Geographic Distribution of Equity and Bond
Ownership, Fortune India, 5(9), 1987, 9-11.
Jawaharlal, Understanding Indian Investors, Global
Business Press, 1992, New Delhi
Durga Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 743
Radha V, A study on investment behaviour of investors in
corporate securities, Doctoral Dissertation at Allgappa
University, 1995.
Gupta. L.C, What Ails the Indian Capital Markets?
Economic and Political Weekly, 32(29), 1998, 1961 –
1966.
Panda K, Tapan NP and Tripathi, Recent Trends in
Marketing of Public Issues: An Empirical Study of
Investors Perception, Journal of Applied Finance, 7(1),
2007, 1-6
Santi Swarup K, Role of Mutual Funds in Developing
Investor confidence in Indian Capital Markets, Sajosps,
2(2), 2008, 58-60.
Narayan and Chandrashekar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 744
MORBIDITY PATTERN AMONG THE ELDERLY POPULATION IN A SOUTH
INDIAN TERTIARY CARE INSTITUTION: ANALYSIS OF A RETROSPECTIVE
STUDY Narayan V
1, Chandrashekar R*
2
1. Department of Community Medicine, Father Muller Medical College, Kankanady, Mangalore,India
2. Department of Pharmacology, Yenepoya Medical College, Yenepoya University, Deralakatte, Mangalore, India.
*Corresponding author: Email: [email protected], Ph. No. +919483787982
ABSTRACT A retrospective study of the morbidity profiles among the elderly and an assessment of the related factors are
required to plan an appropriate geriatric health care service. The present study also sought to determine the
relationships between morbidity and socio-demographic and health characteristics in Yenepoya Hospital,
Derlakatte, Mangalore, India. A hospital based retrospective study was undertaken between January to April
2009. The total number of admissions between January to April 2009 was 1307. Mean age of geriatric patients
during study period was 67 years and maximum age of patient admitted was 90 years. Out of them 332 were of
age 60 years and above. More number of males (65.9%) was admitted when compared to the females (34.1%).
Religion wise distribution showed that majority of the elderly admitted to the hospital belonged to the Muslim
religion (66.5%). Religion sex distribution of the geriatric patients showed that (Table 3 & Figure 3) there were
(11.0%) females and (9.2%) males belongs to Christian religion. Among Hindus about (28.8%) were females and
(21.1%) were males. Among Muslims about (60.2%) were females and 159 (69.7%) were males. Average number
of illnesses per person was 1.32. Majority of the elderly patients suffered from chronic obstructive pulmonary
disease (COPD) (20.72%), Ischaemic heart disease IHD (19.6%), cataract & diminished vision (13.9%), arthritis
(6.2%), diabetes mellitus (4.32%), cancer (3.2%), hemiplegia (3%) & a host of miscellaneous diseases (29.15%).
Highest number of cases (20.72%) were of COPD. More number of males (23.2%) suffered from COPD when
compared to the females (11.9%).
KEYWORDS: Geriatrics, Morbidity Profile
INTRODUCTION
The two extremes of life child and elderly always
need a special care. Elderly life is full of problems
concerned to physical, social and economic. Usually
ageing of the population is essentially a simple
phenomenon and its consequences are multiple and not
always well recognized. According to famous quote by Sir
James Sterling Ross- “You do not heal old age, you
protect it, you promote it, you extend it” (Pathak, 1975).
The elderly are afflicted by the process of ageing which
causes a general decline in health.
Certain diseases are more frequently seen among
elderly population than that of the young generations like
degeneration diseases of heart and blood vessels, cancer,
accidents, diabetes, diseases of locomotor system,
respiratory illness, genito-urinary tract diseases. Even
though in India the percentage of aged persons to the total
population is low; nevertheless, the absolute size of the
aged population is considerate. Elderly population with
disability resulting from chronic diseases appears to be at
a high risk of acute illness and injuries although Primary
Health Centers (PHCs) along with their sub- centres are
distributed all over the country. They are not able to avail
complete facilities at the PHC or its sub-centres owing to
lack of transport, geographical distance, or physical
disabilities or for want of funds and physical help for
travel. Always there is a ample of scope for research into
the degeneration and other diseases of elderly and their
treatment in hospital and general practice and family into
preventive geriatrics and the epidemiology affecting the
elderly (Jadhav, 2012).
MATERIAL AND METHODS
A hospital based retrospective study was
undertaken between January to April 2009. The total
number of admissions between Januarys to April 2009
was 1307. Mean age of geriatric patients during study
period was 67 years and maximum age of patient admitted
was 90 years. Out of them 332(25.40%) were of age 60
years and above.
RESULTS AND DISCUSSION Religion wise distribution: Data was analyzed to know
religion wise distribution concerned to morbidity profile.
Religion wise distribution (Table 1 & Figure) showed that
majority of the elderly admitted to the hospital belonged
to the Muslim religion 346 (66.5%).
Sex wise distribution: Data was analyzed to know sex
wise distribution concerned to morbidity profile. Sex wise
distribution (Table 2) showed that number of males 228
(65.9%) was more admitted to hospital when compared to
the females 118 (34.1%).
Religion wise sex distribution: Religion sex distribution
of the geriatric patients showed that (Table 3 & Figure 3)
Narayan and Chandrashekar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 745
there were 13(11.0%) females and 21(9.2%0 males
belongs to Christian religion. 34 (28.8%) females and 48
(21.1%) males belongs to Hindu religion. 71 (60.2%)
females and 159 (69.7%) males belongs to Muslim
religion.
Distribution of aged persons according to different
morbidity & icd-10 classification (WHO, 1992):
Majority of the elderly patients (Table 4 & Figure 4)
suffered from COPD 91 (20.72%), IHD 86 (19.6%),
cataract & diminished vision 6 (13.9%), arthritis 27
(6.2%), diabetes mellitus 19 (4.32%), cancer 14 (3.2%),
hemiplegia 13 (3%) & a host of miscellaneous diseases
128 (29.15%). Highest number of cases 91 (20.72%) was
chronic obstructive pulmonary disease (COPD). More
number of males 53 (23.2%) suffered from COPD when
compared to the females 14 (11.9%).
According to WHO, the geriatric population of 65
years and above should be considered (WHO, 1995). But
we have considered the age group of 60 and above years
according to Indian scenario. A study carried out in
Southern part of India reported results that show a
prevalence of 82.9% in the age group of 60 years and
above5. In India, over the past few decades the proportion
of 60 years and above has grown up to 7.8 % according to
recent census from Govt of India. The contribution of
elderly population to demographic figures is increasing
day by day. Increasing problems of healthcare,
psychosocial, personal and socio-economic factors
associated with the elderly further overwhelm this. The
present study also sought to determine the relationships
between morbidity and socio-demographic and health
characteristics.
It was observed that average number of illness per person
was 1.32. Other studies among elderly in South and North
India reported it as 2.426 and 2.62
6 respectively. Religion
wise distribution showed that there were more Muslims
(66.5%) when compared to Hindus (23.7%) and Christians
(9.8%). Religion wise sex distribution of the geriatric
patients showed that (Table 3 & Figure 3) there were
(11.0%) females and (9.2%) males belongs to Christian
religion. Among Hindus, about (28.8%) were females and
(21.1%) were males and among Muslims, about (60.2%)
were females and 159 (69.7%) were males (Table 3 &
Figure 3).
In our study we found that majority of the elderly
patients (Table 4 & Figure 4) suffered from COPD 91
(20.72%), IHD 86 (19.6%), cataract & diminished vision 6
(13.9%), arthritis 27 (6.2%), diabetes mellitus 19 (4.32%),
cancer 14 (3.2%), hemiplegia 13 (3%) & a host of
miscellaneous diseases 128 (29.15%). Highest number of
cases 91 (20.72%) was chronic obstructive pulmonary
disease (COPD). More number of males 53 (23.2%)
suffered from COPD when compared to the females 14
(11.9%).
Table.1.Religion wise Distribution Table.2.Sex wise Distribution Religion Frequency Percent
Christian 34 9.8
Hindu 82 23.7
Muslim 230 66.5
Total 346 100.0
Gender Frequency Percent
Female 118 34.1
Male 228 65.9
Total 346 100.0
Table.3.Religion wise Sex Distribution
Religion Sex (%Count within Sex)
Total Female Male
Christian 13(11.0%) 21(9.2%) 34(9.8%)
Hindu 34 (28.8%) 48(21.1%) 82(23.7%)
Muslim 71(60.2%) 159 (69.7%) 230(66.5%)
Table.4.Distribution of aged persons according to different morbidity & ICD-10 classification
Disease ICD-10 Frequency Percent
COPD J44.9 91 20.72
IHD 120-125 86 19.6
Cataract & diminished H 26.9 61 13.9
Arthritis M 13.9 27 6.2
Diabetes E 14 19 4.32
Cancer C 80 14 3.2
Hemiplegia G81.9 13 3.0
Miscellaneous 128 29.15
Narayan and Chandrashekar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 746
Figure.1.Religion wise distribution Figure.2.Sex wise Distribution
Figure.3.Religion wise Sex Distribution
Figure.4.Distribution of aged persons according to different morbidity & ICD-10 classification
0
10
20
30
40
50
60
70
CHRISTIAN HINDU MUSLIM
0
5
10
15
20
25
30
35
Hemiplegia Cancer Diabetes Arthritis Cataract & Diminished
vision
IHD COPD Others
Narayan and Chandrashekar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 747
CONCLUSION
There is a growing need for interventions to
ensure the health of this vulnerable group & to create a
policy to meet the care & needs of the disabled elderly.
Further research, especially qualitative research, is needed
to explore the depth of the problems of the elderly.
ACKNOWLEDGEMENT
The author is thankful to Dr. Radha Y Aras, HOD,
Department of Community Medicine, Yenepoya Medical
College, Yenepoya Univeresity, Mangalore, for providing
support and Medical Record Department, Yenepoya
Medical College, Yenepoya Univeresity, Mangalore for
providing the necessary data for doing this study.
REFERENCES
Jadhav V.S, Mundada V.D, Gaikwad A.V, Doibale
M.K, Kulkani A.P.A Study Of Morbidity Profile Of
Geriatric Population In The Field Practice Area Of
Rural Health Training Centre, Paithan Of Govt.
Medical College, Aurangabad, IOSR Journal of
Pharmacy, 2(2), 2012, 184-188.
Niranjan GV, Vasundhra MK, A study of health status of
aged persons in slums of urban field practice area,
Bangalore, Indian J Com Med, 21, 1996, 1-4.
Padda AS, Mohan V, Singh J, Health profile of aged
persons in urban and rural field practice area of medical
college Amritsar, Indian J Com Med, 23, 1998, 72-76.
Pathak JD, Inquiry into Disorders of the Old, Ind Jour
of Community Med, 1-54, 1975.
WHO, Epidemiology and prevention of cardiovascular
diseases in elderly people, Technical report series, 1995,
853, 5, 2-3,21.
World Health Organisation, ICD-10 Classifications
of Mental and Behavioural Disorder: Clinical
Descriptions and Diagnostic Guidelines. Geneva,
World Health Organisation, 1992.
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 748
TESTICULAR GENE EXPRESSION PROFILING OF PHENYTOIN TREATED
ALBINO RATS USING cDNA MICROARRAY Rajkumar R
1*, Vathsala Venkatesan
2, Sriram Thanigai
3
1. Research Scholar, Bharath University,Chennai-600073
2. Department of Anatomy, Sri Balaji Medical College &Hospitals, Chennai- 600044.
3. Department of Orthopedics, SRM.Medical college, and Research Centre Kattankulathur 603203.
* Corresponding Author E-mail: [email protected]
ABSTRACT
To propose Testicular gene expression profiling of phenytoin treated albino rats using cDNA microarray
analysis. Phenytoin is a commonly used antiepileptic. Phenytoin controls the abnormal brain activity observed in
seizure by decreasing electrical conductance among brain cells by stabilizing the inactive state of voltage-gated
sodium channels. Phenytoin may alter the secretion and functions of different hormones which may attribute to
sexual dysfunction In order to evaluate the effects of phenytoin on the reproductive system of rats at molecular
level in detail, cDNA microarray analysis was used in which about 44000 genes of test and control samples were
analysed for differential regulation by comparing test with control samples. In this study, the albino rats were
divided into two groups, control and test. The test group was given 120mgs/kg /body weight of phenytoin orally
and equal amount of normal saline was given for the control group. After 45 days with the rat under deep
anaesthesia, the testis were removed from the scrotum and stored in liquid nitrogen. The stored specimens of testis
of control and tests group were subjected to cDNA microarray analysis and also small quantity of the tissue was
subjected for Histopathological examination. This study showed the differential expression of genes in test group
when compared with the control group. Out of 44000 genes analysed, 2273 were up regulated and 4430 genes
were down regulated and further gene cluster analysis was performed to identify testis specific differentially
regulated genes and the histopathological examination also revealed histopathological changes in the Test group.
Key words: Testicular gene expression, Phenytoin, DNA probe, Microarray
INTRODUCTION
Phenytoin is an antiepileptic drug. It is useful to
treat partial seizures and generalized tonic-clonic seizures
but not primary generalized seizures such as absence
seizures or myoclonic seizures. Phenytoin can reduce
sexual interest and impair the quality of sexual
experiences. In fact, in a recent study, researchers found
that phenytoin can decrease testosterone levels in men,
which in turn can diminish libido (sexual drive) and may
impair sexual function.
DNA Probe: DNA microarray are very useful to study the
expression of large number of genes simultaneously in an
organism It is a particular series of small spots fixed on a
solid surface to detect and screen mRNAs and genomic
DNAs in samples. In one chip about 4x44000 probes are
fixed in an area of 12 cm2. Therefore DNA chips can be
used to detect around 44000 genes of four different
samples. The probe DNAs are isolated separately from
open reading frames (orfs) of the genome. They are
amplified by PCR technique. All these DNA probes are
filled in separate test tubes and the tubes are kept in a
proper order. The duplex DNAs are denatured into single
strands by alkali treatment. The solid surface of glass slide
is coated with polyacrylamide. The DNA probes are then
spotted as small dots on the solid surface with the help of
a robot arm called Microarrayer. The glass slide thus
prepared is called microarray. The objective of the study
to explore Testicular Gene Expression Profile of
phenytoin treated albino rats using cDNA microarray.
MATERIALS AND METHODS
Animal treatment and sample collection: Male adult
albino rats were segregated into control and test groups.
The test groups were treated with phenytoin 120mgs/kg
body weight/day orally for 45 days similarly control
groups were given equal amount of normal saline. In life
study protocols, including animal housing, dosage,
sacrifice and tissue harvesting were as per IAEC
guidelines. After 45 days the tissue samples from test and
control were collected in Rnase free tubes and snap
frozen in liquid nitrogen .Frozen tissues were stored in
RNA later solution at-70 c until processed for RNA
extraction. RNAlater® solution is an aqueous, nontoxic
tissue storage reagent that rapidly permeates tissues to
stabilize and protect cellular RNA. RNAlater® solution
minimises the need to immediately process tissue samples
or to freeze samples in liquid nitrogen for later processing.
Tissue pieces can be harvested and submerged in
RNAlater® solution for storage without damaging the
quality or quantity of RNA obtained after subsequent
RNA isolation and also small quantity of the tissue was
subjected for Histopathological examination.
RNA isolation and DNA microarray hybridization and
analysis:
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 749
RNA Isolation, cDNA Synthesis and Fluorescent Dye
Tagging: RNA was extracted from the testis by Trizol
method preserved in RNA later solution and checked for
purity and concentration using spectrophotometer. In
order to determine gene expression profiles associated
with phenytoin exposure, testis total RNA have been
pooled following the specified dose and period of
phenytoin exposure. To reduce variability in the level of
gene expressions of control and test groups have been
pooled and used for hybridizations. The mRNA isolated
from test and control samples were converted cDNAs by
reverse PCR separately. The cDNAs of control samples
were labeled with green fluorescent dye (CY3) and the
cDNAs of test samples were labeled with red fluorescent
dye (CY5).These two preparations were mixed together
before hybridization
Microarray Hybridization: Hybridisation performed in a
device called hybridization cassette.A hybridization buffer
is poured in
C over
night to establish hybridization. The fluorescent
complementary strands in the sample underwent base
pairing with probe DNAs to form duplex DNA which are
called Hybrid DNAs. These Hybrid DNAs emitted
fluorescence. After hybridization Microarray was washed
with a wash buffer to remove fluorescent DNAs which did
not take part in hybridization.
Microarray Scanning: The Microarray was inserted into
the slide port of the Microarray Scanner The scanner emits
a laser beam on the Microarray spots and captured the
fluorescence emitted from the spots with the photo
multiplier tube coupled with a confocal microscope. The
scanned image of the microarray was captured in the
computer screen. Fluroscent spots indicated the presence
of corresponding DNA in the sample, whereas no
fluorescence indicated that the particular gene was not
expressed in the samples. The level of gene expression
was analysed from the individual spots. The intensity of
the fluorescence corresponds to rate of expression of the
gene.
Comprehensive Data Analysis:
Principle: The signals emitted from green dye (control)
and red dye (Test) were measured and recorded
automatically. The ratio of green to red dye was calculated
by the computer, if the signals of green and red dyes are in
equal proportions, the ratio is 1:1 and the expression of the
gene is equal in both test and control samples. If the
signals of green dye exceed red dye the expression of the
gene in the control is relatively higher than that in the test
sample. If the signals of red dye exceed the green dye the
expression of the gene in the test sample is relatively
higher than that in the control sample. Data analysis
includes automated feature extraction using Agilent
feature extraction Software. Data analysis has been done
using GeneSpring GX version 12.0 and Microsoft Excel.
Normalisation and statistical analysis:
Normalization: The normalization was done using Gene
Spring GX 12.0 Software.
Normalization Method Used: Percentile Shift
Normalization
Percentile shift normalization is a global normalization,
where the locations of all the spot intensities in an array
are adjusted. This normalization takes each column in an
experiment independently, and computes the percentile of
the expression values for this array, across all spots (where
n has a range from 0-100 and n=75 is the median). It
subtracts this value from the expression value of each
entity. Analysis is done with respect to control samples.
Pathway Genelist: Biointerpreter - Biological Annotation
Report
Significant pathways for differentially regulated genes
were generated using Biointerpreter.
About Biointerpreter: Biointerpreter is a user-friendly
web-based Biological interpretation tool developed by
Genotypic for any microarray data. It significantly reduces
the biological analysis time from weeks to hours. Helps
derive full value of Microarray study. Automated
biological analysis of Microarray data saves weeks
without compromising on depth of information Web-
based, easy to use tool. It is Specially designed for the
users who are most likely to be biologist. It is the Only
tool providing curated gene expression data. It has the
flexibility to query with more than 15 gene identifier
types. Provides more than 15 biological views of the genes
viz. function, pathway, disease.It is Biologist friendly and
so Advanced Excel and database skills not required
Gene Annotation: The suggestions and requirements of
microarray users worldwide have been translated to a user
friendly product. It contains comprehensive and verified
annotations from sequence and annotation databases.
Contains microarray data tables from over hundreds of
publications and is constantly growing. Data curated from
over 500,000 Pubmed abstracts and topic specific
databases are used to index genes for Disease, function,
drug associations and other150 classes. The database is
updated every month.
RESULTS
Microarray: O g ’ m 44k
microarray which contains 44000 rat genes. The results
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 750
obtained from microarray analysis revealed significant
gene expression changes and brought out expression
changes and biological function relationships. Out of
44000 genes analysed 2273 genes were up regulated and
4430 genes were down regulated in test group of rat testis
when compared with control group of rat testis samples.
Samples hybridized Up Down
Testis 2273 4430
Histopathological: Histopathological examinations
I L g’ , m g
Sertoli cells were damaged in phenytoin treated Test
groups.
Discussion: Microarray technology has been used to
examine the effects of phenytoin exposure in a variety of
organisms. Although phenytoin regulated gene expression
has been documented, in many organ system, there is
inadequate information regarding the genome response to
this antiepileptic drug in testis. In the present study out of
44000 genes analysed 2273 genes were up regulated and
4430 genes were down regulated in test group of rat testis
when compared with control group of rat testis samples.
After identifying the group of genes involved in
differential expression of phenytoin treated group Genelist
pathway analysis was done which sub categorised the
group of genes which are similar in function .After
determining a list of genes involved in a given biological
process the next step is to map these genes to known
pathways/Gene Ontology terms and determine which
pathways are overrepresented in a given set of genes.
Gene Cluster Analysis: Cluster analysis was performed
to identify testis specific differentially regulated genes
following phenytoin exposure to pick the candidates for
RT-PCR analysis
Clusters for differentials: Genes with similar expression
patterns functions clustered together, which helps in
further understanding of the genes. Algorithm used is
Hierarchical. The most similar expression profiles are
joined together to form a group. These are further joined
in a tree structure, until all data forms a single group.
Clustering is based on Average- Distance between two
clusters is the average of the pair-wise distance between
entities in the two clusters. Similarity measure clustering
algorithm based on Pearson correlation coefficient
measures the similarity (difference) between entities or
condition.
Table.1.Functinal classification of Down regulated genes of phenytoin treated test samples. GO
ACCESSION
GO Term p-value Count in
Selection
% Count in
Selection
Count in
Total
3798 GO:0005488 binding 4.6E-18 1978 73.2864 10728
13189 GO:0030695 GTPase regulator activity 3.71E-14 102 3.779177 295
27210 GO:0060589 nucleoside-triphosphatase regulator activity 2.55E-13 102 3.779177 303
14996 GO:0032559 adenyl ribonucleotide binding 1.51E-12 304 11.26343 1264
13066 GO:0030554 adenyl nucleotide binding 1.85E-12 320 11.85624 1347
1106 GO:0001882 nucleoside binding 2.31E-12 328 12.15265 1390
3819 GO:0005524 ATP binding 2.58E-12 298 11.04113 1239
1107 GO:0001883 purine nucleoside binding 3.49E-12 325 12.0415 1379
14992 GO:0032555 purine ribonucleotide binding 1.35E-11 360 13.33827 1574
Table.2.Functional classification of Up regulated genes of phenytoin treate test samples GO ID GO
ACCESSION
GO Term p-value Count in
Selection
% Count in
Selection
Count in
Total
3839 GO:0005576 extracellular region 4.29E-29 316 14.15771 1265
20284 GO:0044421 extracellular region part 3.29E-23 198 8.870968 725
1562 GO:0002376 immune system process 1.02E-19 193 8.646954 741
3875 GO:0005615 extracellular space 1.09E-19 151 6.765233 527
4960 GO:0006950 response to stress 5.97E-19 319 14.29211 1457
4961 GO:0006952|
GO:0002217|
GO:0042829
defense response 5.69E-18 122 5.46595 405
6839 GO:0009617
|GO:0009618
|GO:0009680
response to bacterium 2.78E-16 87 3.89785 259
6831 GO:0009607 response to biotic stimulus 1.49E-14 111 4.973118 390
25208 GO:0051239 regulation of multicellular
organismal process 2.3E-14 242 10.84229 1107
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 751
Figure.1.Full view cluster
Figure.2.Microarray scanned image-test sample
Figure.3.Testis control H&E
Stain 10X Magnification
Figure.4.Testis control H&E Stain
40x Magnification
Figure.5.H&E Tesis Test Phenytoin
treated H&E Stain 40X Magnification
Figure.6.Testis Control Trichrome Stain
40X Magnification
Figure.7.Testis Test Phenytoin treated Trichrome Stain
40X Magnification
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 752
CONCLUSION
Histopathological examination: Phenytoin directly affect
brain regions that mediate sexuality. It changes the
concentrations of sex steroid hormones. It also causes
histopathological changes in testis which causes
disturbances in spermatogenesis. It causes sexual
dysfunction by inducing secondary effects on reproductive
hormones. Testis is externally covered by Tunica
albuginea and within tunica albuginea many lobules are
present. Each lobule contains many convoluted tubules
called seminiferous tubule. Each seminiferous tubule
contains various generations of spermatogenic cells that
gives rise to spermatozoans and sertoli cells that supports,
nourishes and protects the spermatozoans.Between the
m I L g’
L g’
secretion. Many research works have proved that
phenytoin decreases the testosterone secretion, which
decreases sexuality and libido. In our study
Histopathological examination by Haemotoxylon and
E g m ’ m g
method showed necrotic changes like pyknotic nucleus
and shrunken cytoplasm., in spermatogenic cells, sertoli
cells and Leydig cells of phenytoin treated test group,
whereas control group presented normal histological
picture.
cDNA Microarray Analysis: In our study about 2273
genes were up regulated and about 4430 genes were down
regulated in the test group of animals.
Functional Classification of Upregulated Genes of
Testis Samples: The majority of the up regulated genes
were represented by extracellular region, extracellular
region part, immune system process, extracellular space,
response to stress, defense response, response to
bacterium, response to biotic stimulus, which are
concerned with immunity and secretions of extracellular
substances secreted by testis which suggests there is an
increased immune response or hypersensitivity to
phenytoin treatment in test group of animals, when
compared to control group.
Functional Classification of Downregulated Genes of
Testis Samples: The majority of the down regulated
genes were represented by Binding, GTPase regulator
activity ,nucleoside-triphosphatase regulator activity,
adenyl ribonucleotide binding, adenyl nucleotide binding,
nucleoside binding, ATP binding, purine nucleoside
binding ,purine ribonucleotide binding genes which are
concerned with protein synthesis ,metabolism and
molecular functions suggesting disturbances in hormone
synthesis by testis and cytodifferentiation during
spermatogenesis by meiosis and mitosis in the test group
when compared to control group.
Gene Cluster Analysis: In Cluster analysis for testis
specific differentially regulated genes showed about 51
genes were differentially regulated out of which about 17
genes were up regulated and about 34 genes were down
regulated. TheTEX15 TESK2 and Crh genes showed
significant down regulation by more than-2.5 folds and
Stat5a genes and pate4 genes were up regulated by more
than 3 folds. Among the down regulated genes TEX15
genes by-3.02 folds, TESK2 genes by -2.72 folds and Crh
genes by -5.87 folds respectively and Stat5a genes by 3.82
folds and pate4 genes by 4.18 folds up regulated
respectively.
TEX15 Gene: During meiosis, homologous chromosomes
undergo synapsis and recombination. It is identified in
earlier studies that TEX15 as a novel protein which is
required for chromosomal synapsis and meiotic
recombination. Loss of TEX15 function causes early
meiotic arrest in males but not in females. Specifically,
TEX15-deficient spermatocytes exhibit a failure in
chromosomal synapsisin .In our study pate4 gene was
down regulated by-3.02 folds in phenytoin treated test
group, suggesting that phenytoin disturbs spermatogenesis
by interfering in its meiotic activity.
TESK2 Gene: TESK2 is expressed predominantly in non
germinal Sertoli cells, the TESK2 along with TESK1 are
two Protein kinases which are expressed exclusively
during the cytodifferentiation of late spermatids to sperms,
the TESK2 is involved in various stages of
spermatogenesis, predominantly in the control of meiosis.
In our study pate4 gene was down regulated by-2.72 folds
in phenytoin treated test group which explains that TESK2
disturbs normal spermatogenesis by interfering
spermiogenesis, the process of production of sperms from
spermatids.
CRH Gene: CRH is synthesized in the testis and is
present in Leydig cells, it is likely that locally produced
CRF could exert negative autocrine modulation on the
stimulatory action of luteinizing hormone on Leydig cell
function. CRH acts as an antireproductive hormone and as
a major local inhibitory regulator of Leydig cell function.
In our study it was proved histopathologically that the
leydig cells which contains crh were damaged in
phenytoin treated test group which is responsible for down
regulation of crh genes by-5.87 folds.
Stat5 Gene: Stat5 is considered as pleotropic gene which
is a single gene that can influence multiple functions.
Stat5 is concerned with cellular functions of proliferation,
differentiation and apoptosis with relevance to processes
of hematopoiesis and immune regulation, reproduction,
and lipid metabolism. The exact function and status in
phenytoin treated test group can only be explained by
gene knock out technology studies.
Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 753
Hexb Gene: Hexb gene is responsible for the secretion of
beta hexaminidase which is a kind of lysosomal enzyme
which plays important role in cell apoptosis and also
tumor cell necrosis, in our study as there is increased
cellular damage due to phenytoin administration these
genes are up regulated by 3 folds.
ACKNOWLEDGEMENT
The authors are to acknowledge Dr.
A.K.Munirajan and his Research scholars of university of
Madras for sample preparation and. M/SGenotypic
Technology (P) Ltd, Bangalore, India, for Gene
microarray analysis .
REFERENCES
Fang Yang, Sigrid Eckardt, N. Adrian Leu K. John
McLaughlin, and Peijing Jeremy Wang Mouse TEX15 is
essential for DNA double-strand break repair and
chromosomal synapsis during male meiosis Journal of
Cell Biology, 18, 2008, 4673-679.
Grimley PM, Dong F, Rui H.Stat5a and Stat5b: fraternal
twins of signal transduction and transcriptional activation,
Cytokine Growth Factor Reviews, 10(2), 1999, 131-57.
Groner B, Fritsche M, Stöcklin E, Berchtold S, Merkle C,
Moriggl R, Pfitzner E Regulation of the trans-activation
potential of STAT5 through its DNA-binding activity and
interactions with heterologous transcription factors,
Growth Hormone & IGF Research, 10, 2000, 15-20.
Jung JW, Park JS, Hwang JW, Kang KS, Lee YS, Song
BS, Lee GJ, Yeo CD, Kang JS, Lee WS, Jeon KS, Um
CH, Kim YS, Oh MJ, Youn JP, Li P, Park JE, Hwang SY,
Lin JX, Leonard WJ, The role of Stat5a and Stat5b in
signaling by IL-2 family cytokines, Oncogene, 19(21),
2000, 2566-76.
Jung JW, Park JS, Hwang JW, Kang KS, Lee YS, Song
BS, Lee GJ, Yeo CD, Kang JS, Lee WS, Jeon KS, Um
CH, Kim YS, Oh MJ, Youn JP, Li P, Park JE, Hwang SY,
Gene expression analysis of peroxisome proliferators- and
phenytoin-induced hepatotoxicity using cDNA
microarray, The Journal of Veterinary Medical Science,
66(11), 2004, 1329-33.
Margalit M, Yogev L, Yavetz H, Lehavi O, Hauser R,
Botchan A, Barda S, Levitin F, Weiss M, Pastan I,
Wreschner DH, Paz G, Kleiman SE Involvement of the
prostate and testis expression (PATE)-like proteins in
sperm-oocyte interaction. Human Reproduction, 27(5),
2012, 1238-48.
Mariotti V, Melissari E, Amar S, Conte A, Belmaker RH,
Agam G, Pellegrini S. Rajesh A, Yenugu S.Genomic
organization, tissue distribution and functional
characterization of the rat Pate gene cluster, PLoS One,
7(3), 2012, 633.
Mariotti V, Melissari E, Amar S, Conte A, Belmaker
RH, Agam G, Pellegrini S Effect of prolonged phenytoin
administration on rat brain gene expression assessed by
DNA microarrays, Experimental Biology and Medicine,
235(3), 2010, 300-10.
Swamy SM, Tan P, Zhu YZ, Lu J, Achuth HN,
Moochhala S.Role of phenytoin in wound healing:
microarray analysis of early transcriptional responses in
human dermal fibroblasts, Biochemical and Biophysical
Research Communication, 13, 2004, 314(3):661-6.
Toshima J, Ohashi K, Okano I, Nunoue K, Kishioka M,
Kuma K, Miyata T, Hirai M, Baba T, Mizuno
KIdentification and characterization of a novel protein
kinase, TESK1, specifically expressed in testicular germ
cells, The Journal of biological chemistry, 270(52), 1995,
31331-7.
Manikanta and Narendra Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 754
FORMULATION AND IN-VITRO EVALUATION OF LORNOXICAM IMMEDIATE
RELEASE AND DICLOFENAC SODIUM SUSTAINED RELEASE BILAYERED
TABLETS B. Manikanta Anil*, K. Narendra Kumar reddy
College of Pharmacy, Mother Theresa educational society group of institutions, Nunna,Vijayawada(Rural) , india.
*Corresponding author: E.Mail: [email protected]
ABSTRACT
The aim of the present work is to prepare bilayered tablet of Lornoxicam and Diclofenac sodium for
treatment of rheumatoid arthritis. The bilayered tablet of which Lornoxicam is immediate layer and Diclofenac
sodium is sustained release layer was prepare by direct compression due to good flow properties of the prepared
blend. Initially drug is release from immediate release layer and loading dose is provideded by slow release of
drug from sustained layer.the sustained release of drug is attained by the use of polymers like HPMC k100,
metolose, manucol among this three polymers metolose shows better drug release. The prepared tablets were
evaluated for post compression studies like thickness, hardness, friability, drug content, weight variation and
invitro dissolution studies which show satisfactory results all are within the limits. The in-vitro dissolution studies
were carried out by using type-2USP dissolution apparatus using 0.1N hydrochloric acid and 7.4 pH phosphate
buffer as dissolution mediums for lornoxicam and diclofenac sodium. Among all the formulations f7 shows better
drug release in intial hours and sustained drug action upto 12hrs.The drug release from optimized formulation
followed zero-order, Higuchi model which indicates drug release from bilayered was Fickian diffusion. In
conclusion, results indicate that prepared bilayered tablet could perform therapeutically better than conventional
and sustained tablets with improved efficacy and better patient compliance.
Key words: Diclofenac sodium, Lornoxicam, Rheumatoid arthritis
INTRODUCTION
Lonoxicam and diclofenac sodium are non
steroidal anti-inflammatory drugs with analgesic, anti-
inflammatory and anti-pyretic properties. lornoxicam is
potent inhibition of prostaglandin biosynthesis through the
inhibition of both cox-1 and cox-2 and Diclofenac sodium
is potent non-selective cyclooxygenase inhibitor. Both
these drugs are used for treatment of rheumatoid arthritis
(Wadher S J., 2008).
MATERIALS AND METHODS
Lornoxicam and Diclofenac sodium were gift samples
from richer pharmaceuticals, Hyderabad. Metolose,
Manucol, Hpmck100, MCC, crospovidone, sodium starch
glycolate were gift samples from Otto chemicals,
Mumbai.
Formulation of bilayer tablets by direct compression
method: The ingredients in the formula are weighed
accurately and mixed to form a homogeneous blend of
drug and excipients separately for both layers. First
compressed the Sustained release layer and followed by
immediate release layer using Manstey 16 station
machine to produce round tablets weighing 300mg (flat
punch 12mm).( Patel A., 2011)
Table.1.Formulation table of Bilayer tablets of Lornoxicam and Diclofenac sodium Ingridients Immidiate Ralease Layer
Formulation code F1 F2 F3 F4
Lornoxicam 4 4 4 4
S.S.G --- 3 --- 6
MCC 91 91 88 88
Crospovidone 3 --- 6 ---
Aerosil 0.5 0.5 0.5 0.5
Magnesium stearate 1.5 1.5 1.5 1.5
Ingridients Sustained Release Layer
Formulation code F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
Diclofenac sodium 50 50 50 50 50 50 50 50 50 50 50 50
Metolose 60 --- --- 20 --- --- 10 5 -- 5 --- --
HPMCK100M --- --- 60 - -- --- 20 --- --- 5 5 --- 10
Manucol --- 60 --- --- 20 --- --- 5 5 --- 10 ---
PVPK30 10 10 10 10 10 10 10 10 10 10 10 10
D.C.P 76 76 76 116 116 116 126 126 126 126 126 126
Aerosil 1 1 1 1 1 1 1 1 1 1 1 1
Magnesium stearate 3 3 3 3 3 3 3 3 3 3 3 3
Manikanta and Narendra Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 755
Post compression studies: All the prepared formulations
were tested for Physical parameters like Hardness,
thickness, Weight Variation, Friability and found to be
within the Pharmacopoeias limits. The results of the tests
were tabulated. The drug content of all the formulations
was determined and was found to be within the
permissible limit. This study indicated that all the
prepared formulations were good (Kumar A, 2003).
Weight variation and Thickness: The weight variation
of bi-layer tablets was found to be in the range of 299 to
301 mg and the thickness of bi-layer tablets was found to
be in the range of 6.506±0.04to 6.86 ± 0.03mm for all the
formulations (F1 TO F12).
Hardness and friability: Hardness was affecting the
release of drug from formulations. The hardness of bi-
layer tablets was found to be in the range of 6.7±0.5
kg/cm2 to 7.3± 0.5 kg/ cm
2 and friability of bi-layer tablets
was found in the range of 0.19% to 0.46% for all the
formulations (F1 TO F12). (Young Hoon Kim, 2007)
Drug content: Drug content of bi-layer tablets was
estimated by assay using UV method. The amount of was
found to be in the range of 97.23% to 101.3%for all the
formulations (F1 TO F12).
In-vitro Drug Release Studies: The in vitro drug release
study was performed for the Bilayered tablets using USP
Type II dissolution apparatus of rpm -50, at a temperature
37±0.5 ºC, using 0.1N Hcl, 7.4 pH phosphate buffer as
dissolution mediums. At predetermined time intervals
samples (5 ml) were collected and replenished with same
volume of fresh media. The drug content in the samples
was estimated using UV-spectrophotometer at 373 nm,
276nm (Wang Z, 1993).
Table.2.Physical parameters of Bilayer tablets of Lornoxicam and Diclofenac sodium
Table.3.Cumulative percentage drug release of Lornoxicam immediate release layer
Table.4.Cumulative percentage drug release of Diclofenac sodium sustained release layer Time
(Hours)
Cumulative percentage drug release
F1 F2 F3 F4 F5 F6 F7 F11 F12
0 0 0 0 0 0 0 0 0 0
1 2.337369 1.947807 1.168684 3.603444 1.704331 2.191284 8.326877 2.264326 2.4835
2 2.873016 2.045198 1.801722 4.187786 2.386064 3.019101 10.46946 3.311273 4.0417
3 8.132096 4.187786 5.405165 21.43132 7.255582 6.330374 26.68496 10.66425 31.603
4 11.05381 6.232984 8.667743 30.23971 11.88162 7.499058 33.89146 21.91283 37.641
5 12.1738 8.034705 11.05381 34.86575 15.43637 8.765133 43.57946 32.47969 43.679
6 15.33898 10.1286 13.78074 39.83266 17.82244 9.398171 51.75946 55.41512 46.601
7 17.62766 11.88162 16.94592 44.79957 22.69196 32.18752 57.15946 55.41512 58.093
8 20.69545 13.78074 19.2346 57.75249 38.95615 44.94566 68.89946 60.28464 65.397
9 22.59457 15.97202 22.05892 64.56981 45.62739 60.96637 73.26946 64.6672 79.519
10 28.63277 17.53027 27.80495 72.36104 59.84638 74.60102 86.9209 73.43234 87.310
11 34.03793 19.38068 35.30401 81.61313 66.66371 81.41835 93.73823 78.78881 94.127
12 39.68658 24.2502 38.90745 85.50874 70.07237 84.82701 99.82513 82.68442 96.952
Formulation code Weight variation
(mg)(n=10)
Hardness
(kg/cm2)(n=3)
Thickness
(mm)(n=3)
Friability
(%)
Assay
(%)
F7 300.2±1.19 7.1±0.5 6.68±0.05 0.30 101.3
Time (Minutes) Cumulative percentage drug release
F1 F2 F3 F4
0 0 0 0 0
5 5.8538±0.16 20.195±0.67 23.415±0.27 38.049±0.81
10 17.561±0.45 49.757±0.44 46.830±0.53 55.61±0.125
15 20.488±0.36 52.684±0.35 58.538±0.16 76.099±0.61
20 26.342±0.17 64.391±0.98 67.318±0.89 96.587±0.97
25 29.26±0.908 70.24±0.58 93.66±0.106 99.807±0.57
30 35.12±0.29 76.099±0.61 99.807±0.57
40 40.976±0.71 81.953±0.43
50 52.684±0.35 84.88±0.34
60 61.46±0.507 87.807±0.24
Manikanta and Narendra Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 756
Drug excipient compatibility studies:
Fourier Transform Infrared (FTIR) Spectroscopy: The Fourier transform infrared (FTIR) spectra of samples
were obtained using FTIR spectrophotometer (Perkin
Elmer). Pure drug, individual polymers and optimised
formulations were subjected to FTIR study. About 2–3
mg of sample was mixed with dried potassium bromide of
equal weight and compressed to form a KBr disk. The
samples were scanned from 400 to 4000 cm−1
.
Figure.1.FTIR of Lornoxicam immediate release layer
Figure.2.FTIR of Diclofenac sodium sustained release layer
CONCLUSION
Solubility studies showed Lornoxicam is soluble
in 0.1N HCL & methanol but poorly soluble in water.
Solubility studies showed Diclofanac sodium is soluble in
7.4PH & methanol but sparingly soluble in water. FTIR
studies showed no incompatibility between drug, polymer
and various excipients used in the formulations.
Precompressional studies were separately conducted for
both the layers separately, gave satisfactory results.
Bilayer formulations of Lornoxicam & Diclofenac sodium
were successfully prepared with super disintegrates like
SSG, CP and hydrophilic polymers like HPMC K100M,
Metolose and Manucol by simple direct compression
method. Formulated tablets gave satisfactory results for
various evaluation parameters like hardness, weight
variation, friability, content uniformity, and in-vitro drug
release. Other parameters like hardness, thickness, assay,
friability were found within limits and well satisfactory.
The kinetic study results suggest that, the best linearity
was found in Higuchi’s equation plot (r2 =0.989)
indicating the release of drug from matrix fallow Higuchi
model kinetics i.e, Fickian diffusion. The drugs release
pattern from the optimized formulations (F7) was Fickian
transport, obeying Higuchi equation. Bilayer tablet
showed an initial burst effect to provide the loading dose
of the drug followed by sustained release for 12hr,
indicating a promising in patient compliance. It can be
concluded that, the formulation retained for longer periods
of time in the GI tract and provides controlled release of
the drug. Hence, improve the therapeutic effect of the drug
may lead to increasing its bioavailability and reduce
patient compliance.
REFERENCES
Fijalek Z, Wyszecka‐Kaszuba E, Warowna‐Grzeskiewicz
M, HPLC with amperometric detection for the
determination of 4‐ aminophenol, the main impurity of
Paracetamol in multicomponent analgesic preparation, J
Pharm Boimed Anal, 32, 2003, 1081‐1086.
Ghada M, Hadad, Samy Emara, Waleed, Mahmand M M,
Stability indicating RP‐HPLC method for determination of
Paracetamol with dantrolene and Cetrizine and
Pseudoephedrine in two pharmaceutical dosage forms,
Talanta, 79, 2009, 1360‐1367.
Manikanta and Narendra Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 757
Ibrahim Çetin, Nisa Koçak, Sule Aycan, Polarographic
determination of lornoxicam in pharmaceutical
formulations, C B U J Sci, 5(1), 2009, 11-18.
Lotfi Monser, Frida Darghouth, Simultaneous LC
determination of Paracetamol and related compound in
pharmaceutical formulation using carbon based column, J
of Pharm Biomed Anal, 27, 2002, 851‐860.
Patel A, Sahoo U, Patel N et al. Development and
Validation of Analytical Methods for the Simultaneous
Estimation of Lornoxicam and Paracetamol from their
Pharmaceutical Dosage Forms. Current pharma research,
1(2), 2011, 140-144.
Shulin Zahao, Dan Xiao, Wenling Bai, Hongyan Yuan,
Capillary electrophoresis with chemiluminescence
detection of Paracetamol, Anal Chim Acta, 559, 2006,
195‐199.
Subramanian G, Vasudevan M, Ravishankar S, Suresh B,
Validation of RP‐HPLC method for simultaneous
determination of Paracetamol, Methocarbamol, Diclofenac
potassium in tablets, Indian J Pharm Sci, 67(2), 2005,
260‐263.
Udupa N, Karthik A, Subramanian G, Ranjith Kumar A,
Simultaneous estimation of Paracetamol and
Domperidone by HPLC method, Indian J Pharm Sci,
69(1), 2007, 140‐144.
Vasudevan M, Ravisankar S, Ravibabu T, Nagarajan,
Estimation of acetaminophen, dextropropoxyphene and
oxyphenbutazone in combined dosage form by HPLC
method, Indian J Pharm Sci, 62(2), 2000, 122‐125.
Wadher S J, Pathankar P R, Puranik M, Simultaneous
spectrophotometric estimation of Paracetamol and
Metoclopromide HCl in solid dosage form, Indian J of
Pharm Sci, 70(3), 2008, 393‐395.
Divya et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 758
FORMULATION AND EVALUATION OF CEFPODOXIME PROXETIL SUSTAINED
RELEASE MATRIX TABLETS Divya Palparthi*, K. Narendra Kumar Reddy
College of Pharmacy, Mother Theresa educational society group of institutions, Nunna,Vijayawada(Rural), India.
*Corresponding author: E.Mail: [email protected]
ABSTRACT
Formulation of Cefpodoxime proxetil extended release matrix tablets. The aim of the present study is to
develop a pharmaceutically stable, once a day robust formulation which will have similar clinical efficacy as that
of twice a day formulation of 200mg strength and can reduce dosage frequency. Cefpodoxime proxetil is used in
the treatment of respiratory and urinary tract infections. In the present study, the polysaccharides guargum and
xanthum gum were evaluated as carriers for colon targeting by formulating matrix tablets of cefpodoxime
proxetil with different concentrations (5%,10%,20%,40%) of the above polysaccharides. Tablets were prepared
by wet granulation method. Formulation containing 40% guargum is considered as optimized formulation as it
releases less amount of drug in first 2 hours compared to other formulations. The optimized formulation was
subjected to stability studies as per ICH guidelines at accelerated condition for 3 months and was found to be
stable.
Key words: Cefpodoxime Proxetil, Sustained Release, Polysaccharides, Drug Release
INTRODUCTION
Oral drug delivery is the most desirable and
preferred method of administering therapeutic agents for
their systemic effects. Oral delivery can be classified into
three categories, immediate release is designed for
immediate release of drug for rapid absorption, sustained
release pharmaceutical products which are designed on the
basis of spansule coating technology for extended
absorption and sustained release systems include any drug
delivery system that achieves slow release of drug over an
extended period of time. The onset of its pharmacologic
action is often delayed and the duration of its therapeutic
effect is sustained.
Matrix tablets: Matrix tablet has given a new
breakthrough for novel drug delivery system in the field of
pharmaceutical technology. It excludes complex
production procedures such as coating and pelletization
during manufacturing and drug release rate from the
dosage form is controlled mainly by the type and
proportion of polymer used in the preparations. These are
the type of controlled drug delivery systems, which
release the drug in continuous manner by dissolution
controlled as well as diffusion controlled mechanisms.
The drug is dispersed in swellable hydrophilic substances,
an insoluble matrix of rigid swellable hydrophobic
materials or plastic materials. The materials most widely
used in preparing matrix systems include both hydrophilic
and hydrophobic polymers. Commonly available polymers
include hydroxyethyl cellulose, hydroxy propyl methyl
cellulose, hydroxyl propyl cellulose, xanthan gum, sodium
alginate, polyethylene oxide and cross linked
homopolymers and copolymers of Acrylic acid.
Cefpodoxime is a broad spectrum oral third
generation cephalosporin antibiotic. Cefpodoxime proxetil
is a prodrug of cefpodoxime. It is well tolerated and is one
of the third generation cephalosporins to be available in
oral form. Cefpodoxime is bactericidal and acts by
inhibition of bacterial synthesis. It passes through ion
channels in the bacterial cell wall and binds to the
penicillin binding proteins (PBP) in the cell membrane
causing acylation of membrane bound transpeptidase
enzymes; this prevents cross linkage of peptidoglycan
chains, which is necessary for bacterial cell wall strength
and rigidity. This leads to reduced synthesis of
peptidoglycans and result in damage to cell wall.
Cefpodoxime is stable in the presence of beta-lactamase
enzymes.
MATERIALS AND METHODS Guar Gum, Xanthan Gum, Lactose, Magnesium Stearate,
Talc and Cefpodoxime proxetil
Preparation of matrix tablet by Wet granulation
method: The ingredients were weighed accurately and
mixed thoroughly. Granulation was done with a solvent
blend of water and methanol (1:1). The wet mass was
passed through sieve no.12 for the preparation of granules.
The granules were dried in a conventional hot air oven at
40 c. The dried granules were subjected to dry screening
by passing through mesh no.22, blended with a mixture of
talc and magnesium stearate and compressed into tablets
using 6 station rotary tablet punching machine. The total
weight of each tablet was 500mg.
Table.1. Composition of matrix tablets of Cefpodoxime proxetil
Ingredients (mg) F4
Cefpodoximeproxetil 200
Guar gum 200
Xanthan gum -
Lactose 80
Magnesium stearate 10
Talc 10
Divya et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 759
RESULTS AND DISCUSSION
Evaluation of precompression parameters:
Angle of repose: The height and the radius of the pile
were measured and the angle of repose was calculated
using the equation, θ = tan-1
(h/r); where θ is the angle of
repose, h and r are the height and radius of the pile.
Bulk density and tapped density: The bulk density and
tapped density were calculated by the following formula:
Bulk density (ρb) = Weight of granules (g)/Bulk volume
(ml) (Vb)Tapped density (ρt) = Weight of granules
(g)/tapped volume (ml) (Vt)Where (Vb) is bulk volume of
the powder and (Vt) is tapped volume of the powder.
Carr’s index and Hausner’s ratio: Carr’s index and
hausner ratio are calculated by using following formula:
Carr’s index = [(Tapped density – Bulk density)/(Tapped
density)] * 100
Hausner’s ratio = ρt / ρb Where ρt is tapped density, ρb is
bulk density
Evaluation of tablets: Tablets were tested for hardness
using Monsanto hardness tester,thickness using
verniercalipers,friability using roche friabilator ,weight
variation usinga electronic balance .
Estimation of drug content: Ten tablets from each
formulation were powdered. The powder equivalent to
100mg of cefpodoxime proxetil was weighed and
transferred into 100ml volumetric flask. The powder was
dissolved in ph 6.8 phosphate buffer. The solution was
filtered and suitable dilutions were prepared and the
solution was analysed spectrophotometrically at 236nm
using uv visible spectrophotometer.
Swelling behavior of matrix tablets: Percent weight gain
by the tablet was calculated using formula:
S.I = {(Mt –M0) / M0} x 100Where S.I is swelling index,
Mt is weight of tablet at time t and M0 is weight of tablet
at time t=0
In-vitro drug release studies: Dissolution studies of all
the batches were performed employing USP type II
Dissolution testing apparatus (LABINDIA DS 8000). The
dissolution test was performed using 900 ml of 0.1 N
HCL(for 2hrs) followed by phosphate buffer pH 6.8 up to
24 hrs at 37oC ±0.5
oC and 50 rpm. A 5ml aliquot of the
sample was withdrawn periodically at suitable time
intervals andvolume replaced with an equivalent amount
of the dissolution medium. The samples were analyzed
spectrophotometrically at 236nm using UV Visible
spectrophotometer.
Table.2. In-vitro drug release data of formulation F4
Time (Hours) Cumulative % Drug Release ± SD of
Formulation 4
1 15.25±0.26
2 23.00±0.15
3 31.42±0.34
4 34.46±0.28
5 38.28±0.21
6 42.20±0.13
7 50.72±0.41
8 52.12±0.15
9 53.28±0.39
10 54.78±0.34
11 56.78±0.27
12 57.71±0.34
14 62.32±0.16
16 67.52±0.31
20 73.77±0.24
24 79.80±0.15
Table.3. Characterization of drug release from Cefpodoxime proxetil matrix tablets
Formulation
Code
Correlation Co-efficient (r) value Korsmeyer - Peppas
Zero order First order Higuchi Hixon crowell r value n value
F4 0.868 0.977 0.989 0.952 0.985 0.533
The angle of repose was found to be in the range
of 21.43 ± 0.32 to 27.82 ± 2.14 having good flow
property.The bulk density and tapped density were found
to be in the range of 0.31 ± 0.01 to 0.40 ±0.02 gm/cc and
Divya et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 760
0.34 ± 0.02 to 0.44± 0.02 gm/cc respectively. The
compressibility index and hausner’s ratio were found to be
6.23 ± 2.08 to 13.02 ± 2.53 and 1.07 ± 0.02 to 1.15 ±
0.03.All the results of precompression parameters were
within the prescribed limits indicating good flow
properties of granules. The thickness of the tablet ranged
from 2.70 ± 0.10 to 2.90 ± 0.10 mm showed uniform
thickness. The hardness of the tablet was found between
4.17 ± 0.29 to 5.33 ± 0.29 kg/cm2. The friability was
found to be 0.30±0.06 to 0.49 ± 0.36%, which indicates
satisfactory mechanical resistance of tablets. The drug
content estimation values range of 97.57±0.12 to 100.01 ±
0.39% which reflects good uniformity in drug content.
The in-vitro drug release studies it was observed
that increasing the amount of gum in the formulation,
resulted in slower rate and decreased amount of drug
release from the tablet. The formulations containing low
concentration of gums failed to control the drug release in
first 2hrs in ph 1.2.The formulations F4, F8, F12
containing polymer in the concentration of 40% succeeded
in the drug release up to 24hrs. However formulation F4
containing 40% Guar gum is considered as optimized
formulation as it released less amount of drug in first 2hrs
in ph 1.2 compared to other formulations. This shows that
Guar gum is capable of protecting the drug from being
completely released in the physiological environment of
stomach.
CONCLUSION
The present study was aimed to develop once a
day formulation which will have similar clinical efficacy
as that of twice a day formulation of 200mg strength and
can reduce dosage frequency which proved to be an ideal
formulation, F4 containing polymer in the concentration
of 40% succeeded in sustaining the drug release upto
24hrs. Therefore the formulation F4 was found to be
stable.
REFERENCES
Brahma N. Singh, Kwon H. Kim, Drug delivery - oral
route, Encyclo Pharm Tech, 2002, 886-900.
Charles S.L. Chiao and Joesph R. Robinson, Sustained -
release drug delivery systems, Remington’s
Pharmaceutical Sciences, 19th ed., Mac Publishing
Company, 1999, 1660-3.
Mathiowitz E, Encyclopedia of controlled drug delivery,
Johnwiley and Sons, Canada, 1999, 493-543.
Mc Conville JT, Recent trends in oral drug delivery, Dru
Del Re, 2005, 24-2.
Shalin A. Modi, P. D. Gaikwad, V. H. Bankar, S. P.
Pawar, Sustained release drug delivery system: A review,
IJPRD, 2(12), 2011, 147-160
Wise D.L., Handbook of Pharmaceutical Controlled
Release Technology, New York: Marcel Dekker, Inc; First
ed. Indian reprint, 2005, 211,431.
Yie W. Chein, Oral drug delivery and delivery systems,
2nd
ed. Marcel Dekker – Inc, New York, 1992, 139-1.
Yie W. Chein, Rate controlled drug delivery systems, Ind.
J. Pharm.Sci, 1988, 63-5.
Hingmire and Sakarkar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 761
FORMULATION AND DEVELOPMENT OF SUSTAINED RELEASE MATRIX
TABLET USING NATURAL POLYMERS L. P. Hingmire
*, D. M. Sakarkar
Dept. of Pharmacy, Jagdish Prasad JhabarmalTibrewala University,Chudela, Dist.Jhunjhunu, Rajasthan, India
*Corresponding author: E-mail: [email protected], phone no. +91-9422169470
ABSTRACT
In the present investigation, an attempt has been made to increase therapeutic efficacy, reduce
frequency of administration, and improve patient compliance, by developing sustained release matrix tablets of
diclofenac sodium using natural polymers such as Xanthan gum, locust bean gum, sodium alginate. Sustained
release matrix tablets of diclofenac sodium, were developed by using different drug: polymer ratios, such as
1:0.5; 1:1 and 1:1.5. Xanthan gum, locust bean gum, sodium alginate, combination of locust and xanthan,
locust and sodium alginate were used as matrix former, the tablets were compressed by direct compression
method using 8 mm flat faced punches. Compressed tablets were evaluated for uniformity of weight, content
of active ingredient, friability, hardness, thickness, swelling index & in vitro dissolution using paddle method,
and swelling index. All the formulations showed compliance with pharmacopoeial standards. Among these
formulations, formulation containing combination of locust bean gum and Xanthan gum (6:4) showed
sustained release of drug for 12 hours with release of 98.95 %. Optimized formulation was subjected
toaccelrated stability studies. Thus, locust bean and Xanthan gum combination can be used as an effective
matrix former, to extend the release of diclofenac sodium.
KEYWORDS: Sustained release, Xanthan gum, locust bean gum, Sodium alginate, diclofenac sodium.
INTRODUCTION
Matrix system is the most innumerable method
used in the development of Sustained release
formulations. It is the release system, which prolongs
and control release of drug that is dissolved or dispersed.
In fact, a matrix is defined as a well-mixed composite of
one or more drugs with a gelling agent i.e. hydrophilic
polymer. The natural polymers are been extensively used
in the field of drug delivery because they are readily
available, cost effective, eco-friendly, capable of
multitude of chemical modifications, potentially
degradable and compatible due to their natural origin.
Past research was done on various natural gums like agar
agar, guar gum, chitosan, for potential pharmaceutical
and biomedical applications.
Diclofenac sodium is a most widely used
NSAID, useful in the treatment of rheumatic disorders,
and is characterized by rapid systemic clearance, and
thus warrants the use of a Sustained Release formulation
for prolonged action, and to improve patient compliance.
Various experimental reports such as solubility, ph, half-
life, indicated diclofenac sodium as a good candidate for
SR formulation. Few SR formulations of diclofenac
sodium (100 mg) are also available commercially. In this
study locust, Xanthan gum, Sodium alginate were used
alone and combination of locust bean gum with xanthan
and sodium alginate were used as a hydrophilic matrix
polymers for controlling release of sparingly water
soluble diclofenac sodium was studied, together with
different factors affecting drug release, from the
hydrophilic matrix tablets.
MATERIAL AND METHODS
Diclofenac sodium (DS) was obtained as gift
sample from Alkem Laboratories Mumbai. The Locust
bean gum, Xanthan gum, was obtained from Crystal
colloids Ltd. Mumbai. Sodium alginate Sulbha gums
Bangalore other materials used was of analytical grade,
and procured from commercial sources..
Determination of Viscosity of combination of
different gums by brook field viscometer: Before
using the combination of gums the viscosity of 0.5%w/v
solution of gums indivisiuals &in combinations were
determined, Using brook field viscometer with spindle
No.3 at 37 o C. The highest viscosity combination was
considered suitable for good polymer for dosage form.
(FIG.1)
Preparation of sustained release matrix tablet using
natural gums: Matrix tablets were prepared by direct
compression method. Tables No. 1 shows composition
of each tablet formulation .The formulations are
composed of various concentrations of natural gum in
the ratios as drug and polymers 1: 0.5, 1: 1 and 1: 1.5 in
various percentages. The drug and excipients weighed
separately and passed through 100- mesh sieve. Drug
was added to the lactose and the polymer mixture and
then blended for 20 min. at last the lubricants were
added & subjected to compression using 8 mm standard
flat punch (single punch tablet machine) in to tablets.
Evaluation of post compression parameters: All
prepared matrix tablets were evaluated for uniformity of
Hingmire and Sakarkar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 762
weight and drug content, as per I.P. Friability, hardness,
thickness, was determined.
In-vitro dissolution study: In-Vitro drug release studies
for all formulations as well as marketed formulation was
carried out using dissolution test apparatus USP Type-II
at 50 rpm. The dissolution medium consisted of 900 ml
of Standard buffer pH 1.2 for the first 2 hrs, followed by
pH 6.8 for remaining period of time. Temperature
maintained at 370C ± 0.5
0C. Aliquots of 5ml were
withdrawn at predetermined time intervals & an
equivalent amount of fresh dissolution fluid equilibrated
at the same temperature was replaced. Aliquots
withdrawn were diluted up to 50 ml with buffer, filtered
and analyzed by measuring the absorbance at 278 nm.
Kinetic treatment to dissolution data: In order to
investigate the mode of release from tablets, the release
data of optimized formulation was analyzed with the
following mathematical models: Q = Kot (Zero order
kinetic), ln (100-Q) = lnQo-K 1 t (First order kinetic)
and Q = Kptn (Korsmeyer and Peppas equation), where,
Q is the percent of drug released at time t and Ko and K
1 are the coefficients of the equations. Kp is constant
incorporating structural and geometric characteristics of
the release device, and n is the release exponent
indicative of mechanism of drug release.
Swelling study: As the release of drug is proportionate
to matrix form, the swelling index was determined by
equilibrium weight gain method. The study was carried
out in the USP/NF dissolution Apparatus I. The polymer
matrices were accurately weighed, placed in dissolution
baskets, immersed in pH 6.8 phosphate buffers and
maintained at 37± 0.50C in the dissolution vessels. At
regular intervals of 2, 4, 6, 8, 10 and 12 hours, the pre-
weighed basket matrix system was withdrawn from the
dissolution vessels, lightly blotted with a tissue paper to
remove excess test liquid and re-weighed. The swelling
index was estimated at each time point using following
equation:
Where, Ws is the weight of the swollen matrix at time t,
Wi is the initial weight of matrix.
Accelerated Stability Study: For determination of
stability of prepared different formulations, accelerated
stability studies were carried out on optimized
formulation. Tablets were stored at 40 ± 20
C/75 ± 5 %
RH for duration of one month. After completion of one
month sample was withdrawn and tested for different
tests such as thickness, hardness, drug content and in-
vitro drug release (Fassihi R., 1997).
RESULTS AND DISCUSSION
The formulated matrix tablets met the
pharmacopeial requirement of uniformity of weight. All
the tablets conformed to the requirement of assay, as per
I.P. Hardness, % friability, and thickness, drug content
were well within acceptable limits
In-vitro dissolution study: All the formulations were
subjected to in-vitro dissolution studies and results are
shown in Figure 3-7. From dissolution study it revealed
that the formulation F1, F2 and F3 containing Xanthan
gum alone showed 101.05±0.65 for 7 hours,
102.43±0.32 for 9 hours and 98.12±0.45 for 10 hours
respectively. This showed that as concentration of
natural gum as release modifier increases the rate of drug
release from tablet decreases.
This may be because of an increase in polymer
concentration causes an increase in the viscosity of the
gel as well as the formation of gel layer with a longer
diffusional path. This may cause as decreased in the
effective diffusion co - efficient of the drug and therefore
a reduction in the drug release rate.Similarly formulation
F4, F5 and F6 containing Locust bean gum alone
showed 94.37±0.12, 92.67±0.52 and 87.34±0.21 in 12
hours respectively. Formulation F7, F8 and F9
containing Sodium alginate alone showed 102.34±0.78
for 9 hours, 99.24±0.78 for 9 hours and 104.74±0.96 for
11 hours respectively.
From this result it was found that Locust bean
gum retard more drug as compared to Xanthan gum and
Sodium alginate. Hence drug release retardation from
these three gums was found to be in following order.
Locust bean gum>Sodium alginate>Xanthan gum:
Results also showed that, formulation F10, F11 and F12
containing combination of Locust bean gum and
Xanthan gum in the ratio of 6:4 showed 103.85±0.15 for
11 hours, 98.95±0.42 for 12 hours and 87.64±0.85 for 11
hours. Similarly, formulation F13, F14 and F15
containing combination Locust bean gum and Sodium
alginate in the ratio of 9:1 showed 107.64±0.23 for 11
hours, 90.24±0.42 for 12 hours and 85.12±0.17 for 12
hours. This showed that combination of Locust bean
gum and Xanthan gum showed more drug retardation
than that of combination of Locust bean gum and
sodium alginate. Hence drug release retardation from
these combinations of gums was found to be in
following order
(Locust bean gum+ Xanthan gum) > (Locust bean
gum+ Sodium alginate): In-vitro drug release of all
formulations (F1-F15) was also compared with the
marketed preparation. The results showed that the drug
release profile of formulation F11 resembles with that of
Hingmire and Sakarkar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 763
marketed formulation. Hence formulation F11
containing combination of Locust bean gum and
Xanthan gum in the ratio of 6:4 was considered as
optimized formulation used for further study.
The kinetic treatment reflected that release data
of F11 showed R2 value of 0.9542 and 0.9920for first
order, and zero order equation respectively, indicating
that release of drug follows zero order kinetic Further
Korsmeyer and Peppas equation resulted into the value
of n = 0.3490, which is close to 1, indicating that the
drug release was approaching zero order kinetics.
Accelerated stability study on F11 formulation showed
that there was no considerable change in thickness,
hardness and drug content also there was no any
difference found between dissolution profile before and
after stability. Hence tablet prepared by using natural
gums as release modifier was found to be stable.
Table.1. Matrix tablet Formulation table Ingredients
(mg)
Drug Xanthan
Gum
Locust Bean
gum
Sodium
Alginate
Locust+
Xanthan
Gum(6:4)
Locust
+Sodium
Alginate (9:1)
Lactose Magnesium
Stearate
Total Wt
F1 100 50 - - - - 147 3 300
F2 100 100 - - - - 97 3 300
F3 100 150 - - - - 47 3 300
F4 100 - 50 - - - 147 3 300
F5 100 - 100 - - - 97 3 300
F6 100 - 150 - - - 47 3 300
F7 100 - - 50 - - 147 3 300
F8 100 - - 100 - - 97 3 300
F9 100 - - 150 - - 47 3 300
F10 100 - - - 50 - 147 3 300
F11 100 - - - 100 - 97 3 300
F12 100 - - - 150 - 47 3 300
F13 100 - - - - 50 147 3 300
F14 100 - - - - 100 97 3 300
F15 100 - - - - 150 47 3 300
Figure.1.Viscosity of various gums in combination with Locust
bean gum, AA: Agar agar, SA: Sodium alginate, GG: Guar gum,
GGh: Gum Ghutti
Figure.2.Viscosity of various gums in combination with Locust
bean gum, GA: Gum Acacia, GT: Gum tragacanth, XG: Xanthan
gum, GK: Gum karaya
Figure.3.Dissolution profile of formulation F1, F2, F3 and
marketed product
Figure.4.Dissolution profile of formulation F4, F5, F6
marketed product
Hingmire and Sakarkar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)
IJRPB 1(5) www.ijrpb.com September – October 2013 Page 764
Figure.5.Dissolution profile of formulation F7, F8, F9
marketed product
Figure.6.Dissolution profile of formulation F10, F11, F12
and marketed product
Figure.7.Dissolution profile of formulation F13, F14, F15 and marketed product
CONCLUSION
The Dissolution profile of formulation F10, F11, F12
and marketed product are compared and found satisfied with
norms as per dissolution profile so can be taken as ideal
product formulation and confirmed for further tablet studies.
REFERENCES
Behl A K, Dhake A.S, Formulation and Release
characteristics of sustained release Ofloxacin tablets,
Indian Drugs, 42 (5), 2005, 316-318.
Chien YW, Novel drug delivery system, Informa
Healthcare, 2nd edition revised and expanded, 50, 2010,
139-140.
Costa P, Lobo JM, Review-modeling and comparison of
diffusion profiles, Eur. J. Pharm. Sci, 13, 2001, 123-133.
Cremer K, Pharmaceutical application of layer tablet,
AAPS Pharm Sci Tech, 1, 2001, 1-10.
Dandgi P M, Mastiholimath V S, Studies Development
and evaluation of theophylline and salbutamol sulphate
sustained release matrix tablet, I. J. Pharm. Sci, (67)5,
2005, 598-602.
Durga prasad pattanayak, Subash C dinda, Bilayer tablet
formulation of metformin hydrochloride and
glimepiride: anovel approach toimprove therapeutic
efficacy, international journal of drug discovery and
herbal res earch, ijddhr, 1(1), 2011, 1-4.
Fassihi R, Yang L, Venkatesh G. Compaction simulator
study of a novel triplelayer tablet matrix for industrial
tableting, Int. J. Pharm, 1997; 152, 45-52.
Kavitha K, Rakesh K Deore and Theetha G
Tamizhmani, Preparation and Evaluation of Sustained
Release Matrix Tablets of Tramadol Hydrochloride
Using Compritol 888 ATO by Melt Granulation
Technique, Research Journal of Pharmaceutical,
Biological and Chemical Sciences, 1(3), 2010 , 431.
KPRChowdary, Murali KMN, Synthesis and evaluation
of starch-urea-borate as rate controlling matrix for
controlled release, Int. J. Pharm. Sci. Nano Tech, 1(2),
2008, 167-170.
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Mobile: 00 91 9490717845 Email:[email protected]
MEMBERSHIP APPLICATION Dear Editor,
I/We wish to be Annual member of INDIAN JORNAL OF RESEARCH IN PHARMACY AND
BIOTECHNOLOGY from the year_____________ month_______________
1. Name in full/ Name of the organization:
2. Academic Qualifications and experience:
3. Corresponding Address:
4. Phone: E-mail:
Membership Fees per one year
(6 issues) from the date of
subscription
India Foreign
Individual/ Institution 2000 Indian Rupees
100 USD
Rs. / $/ ________________________________ remitted by Bank Draft No. Cheque No. /Cash / M.O. Receipt No.
________________Date ________________Banker’s Name___________________
Place: ____________________
Date: _____________________
(Signature of the applicant)
Note: DD should be drawn in favour of BADA PRAGATI KUMAR, payable at Vijayawada, Andhra Pradesh, India.
Kindly send the DD/ Cheque /M.O to the following address:
F.NO:501, PARAMESWARI TOWERS,
WEST IBRAHIMPATNAM,
IBRAHIMPATNAM MANDAL,
KRISHNA DISTRICT,
ANDHRA PRADESH, INDIA.
PINCODE: 521456
MOBILE: 00 91 9490717845