Indian journal of research in pharmacy and biotechnology issue 5

IJRPB 1(5) www.ijrpb.com September – October 2013

Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)

Editor B.Pragati Kumar, M.Pharm, Assistant Professor,

Nimra College of Pharmacy

Consulting editor

Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy

Associate Editors

Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy

Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy

Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy

Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy

Editorial Advisory Board

Dr.Y.Narasimaha Reddy, M. Pharm., Ph D.

Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal.

Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy),

Kerala

Dr.V.Gopal, M. Pharm., Ph D.

Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6

Dr. M.Umadevi, M.Sc. (Agri), Phd Research Associate, Tamil Nadu Agricultural

University, Coimbatore

Dr. J.Balasubramanium, M. Pharm., Ph D. General Manager, FR&D

R A Chem Pharma Ltd., Hyderabad

Dr. V.Prabhakar Reddy, M. Pharm., Ph D.

Principal, Chaitanya College of Pharmacy Education & Research, Warangal

Dr.P.Ram Reddy, M. Pharm., Ph D.

General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad

Dr. S.D.Rajendran, M. Pharm., Ph D.

Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad


INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY

Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication

provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the

review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t

copy and paste the article content from internet or other sources like e-books etc. Authors are the sole

responsible persons for the article, article content; results of the research conducted and copy right issues

if any. The editor and the editorial board are not entitled to change the article content, results and

diagrammatic representations which are given by authors. The article will be published only after getting

the approved galley proof from the authors.

Kindly follow the below guidelines for preparing the manuscript:

1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any

decorative borders anywhere in the text including the title page.

2. Don’t leave any space between the paragraphs.

3. Divide the research article into

a. Abstract

b. Introduction

c. Materials and Methods

d. Results

e. Discussion

f. conclusion

g. References

4. References should include the following in the same order given below

a) Author name followed by initials

b) Title of the book/ if the reference is an article then title of the article

c) Edition of the book/ if the reference is an article then Journal name

d) Volume followed by issue of the journal

e) Year of publication followed by page numbers

5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it

after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post

or scanned attachment to [email protected].

6. Keep in touch with the editor through mail or through phone for further clarifications as well as

for timely publication of your article.

Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna

District, Andhra Pradesh, India-521456 Printed at:

F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456

Visit us at www.ijrpb.com

Contact us/ send your articles to: Email: [email protected]

Phone no: 9490717845; 9704660406

http://www.ijrpb.com/

mailto:[email protected]

http://www.ijrpb.com/


ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology

Information regarding Indexing/ abstracting of our journal IJRPB The following is the list of organizations confirmed Indexing/ abstracting of our journal IJRPB

Index Copernicus Value (ICV) is 5.43 given by Index Copernicus

International, Poland

CHUNG YUAN CHRISTIAN UNIVERSITY, CHINA

ISSN No: 2321- 5674 (Print) ISSN No: 2320-3471(Online)

Indian Journal of Research in Pharmacy and Biotechnology

Electronic Journals Library

SCIENCE NET, CHINA

PUBHUB, USA Advanced Science Index Saarbrücken, Germany

OCLC, Worldcat Knowledge Base, Canada

NEWJOUR, USA

http://rzblx1.uni-regensburg.de/ezeit/index.phtml?bibid=AAAAA&colors=7&lang=en

http://rzblx1.uni-regensburg.de/ezeit/index.phtml?bibid=AAAAA&colors=7&lang=en


Volume 1 Issue 5 www.ijrpb.com September – October 2013

S.No. Contents Page No.

1 Evaluation of the association of rs8052394 of metalothionein-1a gene with type 2 diabetes mellitus in

Nepalese population

Surya Prasad Sharma, Bishal Khatiwada, Binita Dhakal, Uddhav Timilsina

570-575

2 a novel RP- HPLC method development and validation of atorvastatin and fenofibrate in bulk and

pharmaceutical dosage forms

Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna

576-582

3 Analytical method development and validation for the simultaneous estimation of Lamivudine,

Zidovudine and Efavirenz by RP-HPLC in bulk and pharmaceutical dosage forms

Sindhura D, Nanda Kishore Agarwal

583-588

4 Novel RP-HPLC method development and validation of Losartan potassium and Amlodipine drugs in

pure and pharmaceutical dosage forms

Kumari Jyothsna, Chandana N, Vinjam Swathi

589-596

5 Formulation and In-Vitro evaluation of Ornidazole gastroretentive tablets by using low density swellable

polymers

Abeda Aqther, B. Pragati kumar, Peer Basha

597-601

6 Formulation and evaluation of Fenofibrate tablets prepared by employing bioavailability enhancement

technique

Siva kothapally, Pragati Kumar Bada, Harish G

602-608

7 Formulation and e valuation of famotidine fast dissolving tablets by direct compression method

B.Venkateswarlu, B.Pragati Kumar, Debjit Bowmik 609-613

8 Formulation and evaluation of matrix floating tablets of Ofloxacin and Tinidazole combination

Syed Peer Basha, Pragati Kumar B, Duraivel S, Abeda Aqther 614-620

9 Formulation and In-Vitro evaluation of Terbutaline sulphate sustained release tablets

Rajeswari Kola, Deepa Ramani N, Pragati Kumar B 621-624

10 Evaluation of antidiabetic activity of Methanolic extract of flowers of Cassia siamea in Alloxan induced

diabetic rats of basal diet and maida mixed diet

Pushpavathi P, Janarthan M, Firasat Ali

625-628

11 Formulation and evaluation of transdermal patches of anti-hypertensive drug metoprolol succinate

Koteswararao P, Duraivel S, Sampath Kumar KP, Debjit Bhowmik 629-634

12 Neuropharmacological screening of ethanolic extract of Nelumbo nucifera gaertner seeds

Sirisha Chowdary G 635-642

13 A review on use of genetically engineered microorganisms for bioremediation of environmental

pollutants and heavy metals

Mariz Sintaha

643-648

14 Hepatoprotective effect of hydroalcoholic extract of Ocimum gratissimum leaves on Rifampicin-Isoniazid

induced rats

Sreenu Thalla,Venkata Ramana K, Delhiraj N

649-654

15 Analytical method development and validation of Amitriptyline hydrochloride and Chlordiazepoxide in

tablet by RP-HPLC

Neeli Sujatha, K Haritha Pavani

655-659

16 Evaluation of hepatoprotective activity of Sapindus emarginatus vahl pericarp extract against anti

tubercular drugs induced liver damage in rats

Shoba Rani J, Janarthan M, Firasat Ali

660-663

17 Evaluation of anti-diabetic and hepato protective activity of 95% methanolic extract of Terminalia

tomentosa bark by using albino rats

Srilakshmi P, Janarthan M, Zuber Ali M

664-667

18 Formulation of mouth dissolving tablets of Naproxen

Rajesh Reddy K, Nagamahesh Nandru, Desam Asha Latha, Srinivasa Rao Chekuri 668-671

19 Preparation of immediate release Atorvastatin and sustained release matrix tablets of Gliclazide using

retardant hydroxypropyl methyl cellulose

Vinod Raghuvanshi, Jayakar B, Debjit Bhowmik, Harish G, Dureivel S

672-675

20 Phytochemical sreening and antidiabetic antioxidant effect of Ecbolium ligustrinum flowers extracts

Ranjitsingh B Rathor, Rama Rao D, Prasad Rao 676-678

21 Development and validation of assay method for meloxicam tablets by RP-HPLC

K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy

679-681

22 RP-HPLC development and validation of assay and uniformity of dosage units by content uniformity

for in house lamivudine and abacavir combined tablet

K. Ranjith, M.V.Basaveswara Rao, T.E.G.K.Murthy

682-685

23 Validation of a simple and rapid HPLC method for the determination of Metronidazole and Norfloxacin

in combined dosage form

SK Asma Parveen, Chandana Nalla

686-691


Volume 1 Issue 5 www.ijrpb.com September – October 2013

24 Analytical method development and validation for the estimation of olmesartan medoxomil by RP-UPLC

in bulk and pharmaceutical dosage forms

Farhana pattan, K.Haritha Pavani, A.Kiran Kumar, N.Sunny Babu, K.V.Kalyan Kumar, Chandana N

692-696

25 Formulation development and evaluation of Gliclazide gel using water soluble Sodium carboxy methyl

cellulose polymer

Vaibhav Kumar Mishra, Shashi Shekhar Tripathi

697-700

26 Analytical method development and validation of Gemifloxacin and Ambroxol in solid dosage form by

reverse phase high performance liquid chromatography

Md Haseena Begum, Nanda Kishore Agarwal and Duraivel S

701-706

27 Evaluation of the anti hyperglycemic activity of methanolic extract of root of heliotropium indicum in

streptozotocin and alloxan induced diebetic rats

Aqheel MA , Janardhan M, Durrai vel S

707-710

28 Novel RP-HPLC method development and validation of Metformin and Pioglitazone drugs in pure and

pharmaceutical dosage forms

Alekhya Pallapolu, Aneesha A

711-716

29 Carbon nano tube: a review

K.Shailaja, Tahseen Sameena, S.P.Sethy, Prathima Patil, Md. Owais Ashraf 717-719

30 Stability indicating RP-HPLC method for the simultaneous determination of Candesartan cilexetil and

hydrochlorothiazide in bulk and dosage forms

Veeranjaneyulu D, Aneesha A, Nandakishore Agarwal

720-724

31 A review on enhancement of solubility and disolution rate of bcs class-ii drug by solid dispersion and

nonaqeous granulation technique

Chakravarthi V, Duraivel S

725-728

32 Evaluation of anti-infl ammatory activity of Canthium parviflorum by In-Vitro method

Kandikattu Karthik, Bharath Rathna Kumar P, Venu Priya R, Sunil Kumar K , Ranjith Singh.B.Rathore 729-731

33 Evaluation of nephro protectiveactivity of methanolic extract of seeds of Vitis vinifera against Rifampicin

and Carbontetra chloride induced nephro toxicity in wistar rats

Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Durraivel S

732-735

34 Analytical method development and validation of estimation method for Sotalol hydrochloride tablets

by using RP-HPLC

G Abirami, K Anand Kumar, T.Veterichelvan, Arunateja Muvva

736-740

35 A study on role of demographic factors in small investors’ savings in stock market

Durga Rao P V, Chalam G V and Murty T N 741-743

36 Morbidity pattern among the elderly population in a south Indian tertiary care institution: analysis of a

retrospective study

Narayan V, Chandrashekar R

744-747

37 Testicular gene expression profiling of Phenytoin treated albino rats using cdna microarray

Rajkumar R, Vathsala Venkatesan, Sriram Thanigai 748-753

38 Formulation and in-vitro evaluation of Lornoxicam immediate release and Diclofenac sodium sustained

release bilayered tablets

B. Manikanta Anil, K. Narendra Kumar reddy

754-757

39 Formulation and evaluation of cefpodoxime proxetil sustained release matrix tablets

Divya Palparthi, K. Narendra Kumar Reddy

758-760

40 Formulation and development of sustained release matrix tablet using natural polymers

L. P. Hingmire, D. M. Sakarkar 761-764

Sharma et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

IJRPB 1(5) www.ijrpb.com September – October 2013 Page 570

EVALUATION OF THE ASSOCIATION OF rs8052394 OF METALOTHIONEIN-1A

GENE WITH TYPE 2 DIABETES MELLITUS IN NEPALESE POPULATION

Surya Prasad Sharma1,2*

,Bishal Khatiwada1,2

, Binita Dhakal1,2

, Uddhav Timilsina1

1. Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal

2. Department of Biotechnology, Sikkim Manip al University, Gangtok, Sikkim

*Corresponding author: [email protected]

ABSTRACT

Polymorphisms in metallothionein-1A gene associated with the risk of type 2 diabetes mellitus and its

complications. Metallothioneine (MT) as a potent antioxidant can affect energy metabolism. The present study

was undertaken to investigate the association between MT gene polymorphism and type 2 diabetes mellitus.

Polymorphism in rs8052394 of Metallothioneine 1A gene at lys51Arg is the most prevalent mutation in T2DM.

Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) has been found to be a

reliable and effective tool to identify the specific gene alteration that is responsible for the development of T2DM

and its complication. The aim of study was to identify the mutation in specific part of rs8052394 of MT1A gene

(lys51Arg substitution) in diabetic population by PCR-RFLP technique. All together 62 diabetic samples were

collected and DNA extraction was performed according to protocol of D.K. Lahari et al. Amplification of

fragment with MT1A gene at 51th position of amino acid performed in a XP Thermocycler using primers

Forward: 5’-ACTAAGTGTCCTCTGGGGCTG 3’ and Reverse: 5’-AATGGGTCACGGTTGTATGG 3’ of

MT1A gene cleaved by pstI enzyme. The restriction fragments obtained were electrophoreses in a 2% agarose gel

and were visualized using transilluminator. Mutation of MT1A gene was present in 40.32% of 62 patients, out of

which 19.35%was of ≤50 yrs of age group. On comparing the mean age of two category of genotype (AA and

AG/GG, correlation is statistically significant with p=0.044 (CI=95%).This is the first time that the mutation

positions in MT1A gene Lys51Arg substitution have been studied in Nepalese population with Type II diabetic.

Since Nepal is geographically located between two countries (India and China) with around 30% of world’s total

diabetic cases, researches in this subject seems to be of a rationale work.

Keywords: Diabetes Mellitus type II, SNP, rs8052394, Metallothioneine 1A, PCR-RFLP

INTRODUCTION

Diabetes mellitus is a metabolic disorder in which

person is characterized by the high blood sugar either

because the body does not produce enough insulin, or

because cells do not use the insulin that is produced

(World Health Organisatio, 1999). The classical

symptoms of diabetes are polyuria (frequent urination),

polydipsia (increased thirst) and polyphagia (increased

hunger) (Cooke, 2008). Almost one in 10 of the world

population already has this condition, or can be expected

to develop it during their lifetime, with prevalence rates

forecast to double within the next 15 years (Florence,

2003). According to WHO (2000A.D.), at least 171

million people worldwide suffer from diabetes, or 2.8% of

the population (Wild, 2004).

Metallothionein 1A (MT1A), mRNA: Metallothionein

(MT) is a sulfhydryl- and cysteine-rich protein found in

microorganisms, plants and all invertebrate and vertebrate

animals. Metallothioneins are a group of ubiquitous low-

molecular-weight proteins that have functional roles in

cell growth, repair and differentiation. These are those

family of proteins with low molecular mass and high

affinity to certain metal ions (Cai, 2007). They are

implicated primarily in metal ion detoxification, in that

they are essential for the protection of cells against the

toxicity of cadmium, mercury and copper (Higashimoto,

2009). In general the MT is known to modulate three

fundamental processes:

1) The release of gaseous mediators such as hydroxyl

radical or nitric oxide;

2) Apoptosis, and

3) The binding and exchange of heavy metals such as

zinc, cadmium or copper.

Metallothionein and Its Relationship with Diabetes:

Metallothioneins (MTs) are a group of intracellular metal-

binding and cysteine-enriched proteins and are highly

inducible in many tissues in response to various types of

stress. Although it mainly acts as a regulator of metal

homeostasis such as zinc and copper in tissues, MT also

acts as a potent antioxidant and adaptive (or stress) protein

to protect cells and tissues from oxidative stress. Diabetes

affects many Americans and other populations, and its

development and toxic effect on various organs have been

attributed to increased oxidative stress. Studies showed

that zinc-induced or genetically enhanced pancreatic MT

synthesis prevented diabetes induced by chemicals such as

streptozotocin and alloxan, and zinc pretreatment also

prevented spontaneously developed diabetes. Since

diabetic complications are the consequences of organ

damage caused by diabetic hyperglycemia and

hyperlipidemia through oxidative stress, whether MT in

nonpancreatic organs also provides a preventive effect on


http://en.wikipedia.org/wiki/Polyuria

http://en.wikipedia.org/wiki/Polydipsia

http://en.wikipedia.org/wiki/Polyphagia



diabetic toxicity has been recently investigated. It has

been demonstrated that overexpression of cardiac MT

significantly prevented diabetes-induced cardiomyopathy.

Likewise, over expression of renal MT also prevented

diabetes-induced renal toxicity. In addition, it was found

that MT as an adaptive protein is over expressed in several

organs in response to diabetes. Therefore, the biological

importance of diabetes-induced MT in diabetic

complications and subsequent other pathogenesis was

further explored. This polymorphism is the result of a

nucleotide change A to G at position 55231329 of

chromosome 16. Similarly 225 number position of mRNA

sequence, and it results in the substitution of Lysine (k) by

Arginine (r) at 51 position of the MET1A protein. In the

wild type, codon AAA codes for Lysine but in mutated

type, codon AAA changes to AGA hence it codes for

different amino acid Arginine.

After analysis by MUpro we found that protein

structure stability was decrease due to this polymorphism.

Among the seven identified SNPs: rs8052394,

rs11076161, rs8052334, rs964372, rs7191779, rs708274

and rs10636. Significant associations of MT1A rs8052394

(G alteration) with T2DM and decreased serum SOD

activity were established. The other six SNPs were not

significantly associated with T2DM. However, SNPs

rs964372 and rs10636 were found to be significantly

associated with increased serum triglyceride and

neuropathy among T2DM individuals. It is a restriction

enzyme isolated from an E. coli strain that carries the PstI

gene from Providencia stuartii 164 (ATCC 49762).

According to Nepal Diabetic Association, the number of

people suffering from diabetes above 40 years in urban

areas has climbed up to 19% of special note is that there

will be a 67% increase in prevalence of diabetes in

developing countries from 2010-2030 (Shaw, 2010).

According to UN, 246 million people in the world

are suffering from diabetes and approximately half of that

fall in Nepal, India, China and other Asian countries.

Increase in the incidence of diabetes mellitus is the 4th

leading cause of death in world. Each year 3.8 million

people die from diabetes and its related complication like

cardiomyopathy, stroke, nephropathy, neuropathy, eye

disease etc and the gene metallothionein 1A may be

responsible for such complications. It has also been found

that polymorphism in metallothionein 1A gene may be

responsible for even inducing diabetes not only its

complications. Polymorphism in single nucleotide in

metallothionein 1A leads for to decrease in level of SOD

which may be due to the death of pancreatic β cells

(Grarup, 2007). Metallothionein (MT) isoforms I and II

are polypeptides with potent antioxidative and anti-

inflammatory properties (Lina, 2008) and once occur

polymorphism; it causes in the alteration in the normal

function of the protein and causes different complications

like aging, neuropathy, retinopathy, stroke etc. Since

diabetes and its complications are the 4th leading cause of

death, it needs to be diagnosed soon. The most rapid

results could be achieved by using molecular methods

including real-time PCR, single-strand-conformation

polymorphism analysis (SSCP) (Lina, 2008) multiplex-

allele-specific PCR (MAS- PCR), mass

spectrophotometry, Allele-Specific Hybridization etc. But

the PCR-RFLP approach has several advantages of being

cheap, robust and simple to both perform and interpret,

basically requiring PCR and electrophoresis set up. Genes

significantly associated with developing type 2 diabetes,

include TCF7L2, PPARG, FTO, KCNJ11, NOTCH2,

WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and

HHEX (Lina, 2008; Shoelson, 2006). Within all these

family, Metallothionine and its different isoforms have a

relationship with T2DM and other disease like

neuropathy, hyperlipidemia etc. Among different MT, the

isoform MT 1A with SNP rs8052394 is found to have a

significant relationship with T2DM (Lina, 2008). The

magnitude and trends in diabetes and the polymorphism in

MT1A gene at rs8052394 are epidemiologically important

to monitor, the estimation of the burden of disease is

programmatically relevant in shaping policies for

screening and treatment.

METHODS

Study Population: 63 diabetic subjects (Male: 30 Female:

32) were randomly selected within Kathmandu Valley

Population. Samples collected were reported as T2DM

from Kathmandu Model Hospital, Bhrikutimandap

Samjhana Laboratory, Mangalbazzar.

Study Design: A cross sectional study was designed to

explore the polymorphism in rs8052394 of MT 1A gene in

T2DM patients.

Study Site: Department of Biotechnology, College for

Professional Studies, Kathmandu, Nepal.

Selection of Sample: Samples reported as T2DM

according to WHO criteria 2006

Criteria to Confirm T2DM

1) Age above 40 years

2) Fasting Blood Glucose: >110mg%

3) Post-prandial Glucose: >140mg%

Data Processing and Analysis: Data will be analyzed

manually as well as using SPSS and interpreted according

to frequency distribution and percentage. The statistical

tool chi-square and t test will be applied to analyze the

data. Data will be presented in tables and figures.

Clinically and epidemiologically relevant information

from each patient including, age, sex, dietry habits was

obtained.

DNA extraction from T2DM samples:

D.K Lahiri et.al method: 1% Agarose Gel

Electrophoresis of Extracted DNA: 1% agarose gel was

http://en.wikipedia.org/wiki/TCF7L2

http://en.wikipedia.org/wiki/PPARG

http://en.wikipedia.org/wiki/FTO_gene

http://en.wikipedia.org/wiki/KCNJ11

http://en.wikipedia.org/wiki/NOTCH2

http://en.wikipedia.org/wiki/WFS1

http://en.wikipedia.org/w/index.php?title=CDKAL1&action=edit&redlink=1

http://en.wikipedia.org/wiki/IGF2BP2

http://en.wikipedia.org/wiki/SLC30A8

http://en.wikipedia.org/wiki/JAZF1

http://en.wikipedia.org/wiki/HHEX



prepared with 0.5 µg/ml if Ethidium Bromide (EtBr) in it.

6 µl if each extracted DNA sample and the loading dye

mixed in the ratio 5:1 was loaded on the wells and run for

an hour at 80-90 Volt on Tris Acetate EDTA (TAE)

buffer. The DNA bands were observed under UV trans-

illuminator.

PCR Amplification of rs8052394 Specific Exon

Fragment of MT1A Gene: The primary task for

performing the PCR is to standardize the reaction mixture

and to optimize the PCR conditions for the reaction to

occur accurately so that the DNA is amplified efficiently.

The reaction and the PCR programme were standardize to

precisely amplify the rs8052394 specific Exon fragment

of MT1A gene in the DNA sample by PCR using the

primers to get a 283 bp amplified product.

Forward: 5’ACTAAGTGTCCTCTGGGGCTG 3’

Reverse: 5’AATGGGTCACGGTTGTATG3’

2% Agarose gel electrophoresis of PCR amplified

products: To check if the specific DNA segments have

been amplified or not, the PCR products were

electrophoresed on 2% agarose gel(0.8gm of

agarose+40ml of 1X TAE buffer+0.5µg/ml of EtBr) in 1X

TAE buffer along with 100bp DNA ladder(Fermentas) for

1 hour at 90 volt.

Since the specific PCR primers amplified a 283bp PCR

product, single DNA band was observed lying in between

200 and 300bp as indicated by DNA marker when viewed

on UV transilluminator. The PCR amplified products were

stored at 4°C.

Restriction Digestion of PCR amplified

Products

Steps:

Incubation at 37°C for 3 hours

Heat Inactivation at 65°C for 20 minutes

Holding at 4°C forever.

RESULTS

Genomic DNA was extracted from blood cells.

The extracted DNA was run through 1% agarose gel

electrophoresis. PCR product was run through 2% agarose

gel electrophoresis. Finally digested product was run

through 3% agarose gel electrophoresis. Further the

incubation of the reaction mixture was carried out in the

thermocycler and the following program was used; Then

the digested product was analyzed by agarose gel

electrophoresis.

3%Agarose gel Electrophoresis of digested products:

After digestion of the 283bp fragment obtained by PCR, to

check for three possible genotypes, 15µl of digested

products were mixed with 3µl of loading dye and loaded

on the wells of 3%agarose gel in 1XTAE buffer along

with 100bp DNA ladder for 1 hour at 90 volts. The result

was viewed under UV transilluminator for number of

DNA fragments obtained. The amplified product was

subjected to digestion by PstI restriction enzyme. After

digestion of the 283 bp fragment by PCR, 165bp, 283bp

the restriction enzyme digested fragment was run on 3%

agarose gel electrophoresis. The gel picture below depicts

the band pattern for genotypes. Genotypic distribution was

in accordance with Hardy-Weinberg Equilibrium when

analysed by PopGene.S2

software with χ2=1.7494, df=1

and P>0.05.

Table.1. PCR reaction mixture with component and volume

Reagent Stock Final Concentration Volume/ Reaction

10XPCR buffer 2.5µl

25mM Mgcl2 1.5mM 2.0µl

10 µM (Each) dNTPs 200 µM 0.5µl

100 µM Reserve primer 0.4 µM 1.0µl

5 units/ µl.Taq polymerase 0.4 µM 0.2µl

Nuclease free D/W 1 Units/ µl 12.8µl

Total Master Mix 20 µl

DNA extract 5 µl

Total 25 µl



Table.2.The following program was standardized for the amplification reaction

Step Temperaure (oC) Time

Initial Denaturation 95 5 Minutes

Denaturation 95 1 minutes

Primer Annealing 55.7 45 seconds

Extension 72 45 seconds

Cycle repeat from step 2 (35 cycles)

Final extension 72 7 minutes

Holding 4 Forever

End

Table.3.The reaction mixture for restriction digestion

Master Mix for Restriction Digestion

Pst I 0.5 µl

10X Buffer ‘O’ 1.5 µl

Nuclease free distilled water 3.0 µl

PCR product 10 µl

Table.4.Genotype Distribution in Nepalese Population

Table.5. Distribution of genotypic frequency of SNP rs8052394

SNP Group CASE no

62

Genotype X2 P

Rs8052394 Case GG GA AA 1.7494 0.79035

1 24 37

Table6: Agewise distribution in accordance to mutation

Figure.1.WHO distributions of diabetic people Figure.2.Outline of mechanisms by which MT

coordinate with Zn prevents diabetes development and

diabetic complications rs8052394 of MET1A gene

Allotypes GG GA AA

Band Patterns 118 118 -

165 165 -

- 283 283

Frequency 1 24 37

Total sample (a) 62

Age < 50 51-60 61

Percentage 33.87 22.58 43.55

Total Number 21 14 27



Figure.3.Gender wise distribution of patients

Figure.6. 3% Agarose Gel Electrophoresis of digested product by PSTL restriction enzymes

DISCUSSION

The present study revealed an association of MT

genes with T2DM. SNP rs8052394 detected in this study

was highly polymorphic. The χ2 goodness-of-fit test

showed that the genotypic distribution of rs8052394 SNP

was not deviated from the Hardy- Weinberg equilibrium

(P >0.05), suggesting the suitability of this sample pool

for genetic analysis. The allelic frequency distribution

analysed by PopGene software showed that ‘G’ allele

(p=0.79035) is high in Nepalese Population whereas ‘A’

allele (q=0.20965) is less in frequency. The gender wise

distribution of rs8052394 of MT1A gene mutated and wild

type or differently mutated strains. Among male subjects

30 (48.39%) weresuffering from diabetes and 32(51.61%)

were from female subjects. This shows no any significant

relationship between the prevalence of diabetes mellitus

and gender.

Agewise distribution of the T2DM patient: Agewise

distribution of the patient shows that 33.87% people were

less than 50 years, 22.58 were between 51-60 and 43.55

%were >61. In a given diabetic population, the chance of

alteration on different genes are possible which are

responsible for the induction of T2DM (Shoelson, 2006;

Lyssenko, 2008). But the role of MT1A is most widely

studied due to the importance of this gene. The mutation

in MT1A gene is a major mechanism for the

development of diabetes and its complications. The most

common mutation is the Lys51Arg substitution in MT1A

gene, which is present in approximately 36.13% of the

diabetic population and is associated with relatively high

level induction of the diabetes and its complication (Lina,

2008). But however it should be remembered that at

normal condition MTIA gene acts as antioxidant therefore

prevents diabetes (Papouli, 2000). The most frequent

mutation patterns of diabetic patient of MT1A gene occurs

at rs8052394 fragment at aminoacid51 (36.13%) of

MT1Agene. But mutation in MT1A gene occurs in a

higher frequency than any other gene and is regarded as to

be most important in diagnosing diabetes (Lina Yang,

2008).

CONCLUSION

The study of genotype frequency distribution for

the MT1A polymorphism in rs8052394 in Nepalese

population from Nepal for the first time will definitely

serve as a major achievement in understanding the

molecular level of mechanism and effects of the gene

mutation which varies in different geographical region of

world. We found that rs8052394 of MT1A gene mutation

at amino acid 51 accounted 40.3% among which the

mutation is more commonly found on the age group less



than 50years. To the best of our knowledge frequency of

the MT1Agene lys51arg mutation has not been previously

determined in Nepalese diabetic population. The higher

percentage (40.3%) of common mutation in MT1A

definitely highlights the importance of the 51st amino acid

for development of diabetes and its complication.

BIBLIOGRAPHY

American diabetes association, Report: Type 2 diabetes in

children and adolescents. Diabetes care 2000, 23:381-9

Cai L, Diabetic cardiomyopathy and its prevention by

metallothionein: experimental evidence, possible

mechanisms and clinical implications, Curr Med Chem,

14, 2007, 2193–2203.

Cooke DW, Plotnick L, Type 1 diabetes mellitus in

pediatrics, Pediatr Rev Nov, 29 (11), 2008, 374–384.

Florence Demenais, Timo Kanninen, Cecilia M. Lindgren,

A meta-analysis of four European genome screens (GIFT

Consortium) shows evidence for a novel region on

chromosome 17p11.2–q22 linked to type 2 diabetes,

Human Molecular Genetics, 12(15), 2003, 1865–1873.

Grarup N, Andersen G, Gene-environment interactions in

the pathogenesis of type 2 diabetes and metabolism.

Current Opinion in Clinical Nutrition & Metabolic Care,

10, 2007, 420–426.

Higashimoto Minoru, Isoyama Naohiro, Ishibashi Satoshi,

Inoue Masahisa, Takiguchi Masufumi, Suzuki Shinya,

Ohnishi Yoshinari, Sato Masao:Tissue dependent

preventive effect of metallothionein against DNA damage

in dyslipidemic mice under repeated stresses of fasting or

restraint, Life Sciences, 84, 2009, 569-575

J. E. Shaw, R. A. Sicree, and P. Z. Zimmet, Global

estimates of the prevalence of diabetes for 2010 and 2030.

Diabetes Research and Clinical Practice, 87(1), 2010, 4–

14.

Lahari D. K., Steve Bye, Nurenberger Jr J. J., Mario E.,

Hondes D. and Crisp M, A non organic and non enzymatic

extraction methods gives high yields of genomic DNA

from whole blood samples than do nine other methods

tested, J. Biochem. Biophys Methods, 25, 1992, 193–205

Li X, Cai L, Feng W, Diabetes and Metallothionein, Mini

Rev Med Chem, 7, 2007, 761–768.

Lina yang, Polymorphisms in metallothionein-1 and -2

genes associated with the risk of type 2 diabetes mellitus

and its complications, Am J Physiol Endocrinol Metab,

294, 2008, 987-992.

Lyssenko V, Jonsson A, Almgren P, Clinical risk factors,

DNA variants, and the development of type 2 diabetes,

The New England Journal of Medicine, 359 (21), 2008,

2220–2232.

Mikkel Faurschou1, Milena Penkowa, Claus Bøgelund

Andersen, Henrik Starklint4 and Søren Jacobsen: The

renal metallothionein expression profile is altered in

human lupus nephritis. Arthritis Research & Therapy, 10,

2008, 761.

Papouli E, Defais M, Larminat F, Over expression of

metallothionein-II sensitizes rodent cells to apoptosis

induced by DNA cross-linking agent through inhibition of

NF-kappaβ activation, J Biol Chem, 277, 2000, 4764-

4769.

Shoelson SE, Lee J, Goldfine AB, Inflammation and

insulin resistance, J Clin Invest, 116 (7), 2006, 1793–801

Wild S, Roglic G, Green A, Sicree R, King H, Global

prevalence of diabetes: estimates for 2000 and projections

for 2030, Diabetes Care, 2004, 27(5), 1047–1053.

World Health Organisation & Department of Non

communicable Disease Surveillance (1999). Definition,

Diagnosis and Classification of Diabetes Mellitus and its

Complications.

http://en.wikipedia.org/wiki/The_New_England_Journal_of_Medicine

http://www.ncbi.nlm.nih.gov/pubmed/16823477


http://en.wikipedia.org/wiki/World_Health_Organisation

http://whqlibdoc.who.int/hq/1999/WHO_NCD_NCS_99.2.pdf



Swathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A NOVEL RP- HPLC METHOD DEVELOPMENT AND VALIDATION OF ATORVASTATIN AND

FENOFIBRATE IN BULK AND PHARMACEUTICAL DOSAGE FORMS

Vinjam Swathi, Nanda Kishore Agarwal, Kumari Jyothsna

Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India

*Corresponding author: Email: [email protected], Phone +91-9490776192

ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise reverse phase high

performance liquid chromatographic method for the simultaneous estimation of Atorvastatin and Fenofibrate in

pure and pharmaceutical dosage forms. Atorvastatin and Fenofibrate were well separated using a Thermohypersil

BDS C18 column of dimension 100 × 4.6, 5µm and Mobile phase consisting of Methanol: Water (Adjusted with

orthophosphoric acid to pH-2) in the ratio of 40:60v/v at the flow rate 1 ml/min and the detection was carried out

at 274nm with PDA detector. The Retention time for Atorvastatin and Fenofibrate were found to be 1.438, 2.949

respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity

according to ICH guidelines. The method was successfully applied to Atorvastatin and Fenofibrate combination

pharmaceutical dosage form.

KEY WORDS: RP-HPLC, Atorvastatin, Fenofibrate, Accuracy, Precision.

1. INTRODUCTION

Atorvastatin ((3R, 5R)-7-[2-(4-

fluorophenyl)-3-phenyl-4-(phenylcarbamoyl)-5-propan-2-

ylpyrrol-1-yl]-3, 5-dihydroxyheptanoic acid) is a member

of the drug class known as statins. It is used for lowering

cholesterol. Atorvastatin is a competitive inhibitor of

hydroxymethylglutaryl-coenzyme-A (HMG-CoA)

reductase, the rate-determining enzyme in cholesterol

biosynthesis via the mevalonate pathway. HMG-CoA

reductase catalyzes the conversion of HMG-CoA to

mevalonate. It acts primarily in the liver. Decreased

hepatic cholesterol levels increases hepatic uptake of

cholesterol and reduces plasma cholesterol levels.

Fenofibrate (propan-2-yl 2-{4-[(4-

chlorophenyl) carbonyl] phenoxy}-2 methyl propanoate)

is a drug of the fibrate class. It is mainly used to reduce

cholesterol levels in patients at risk of cardiovascular

disease. Like other fibrates, it reduces low-density

lipoprotein (LDL) and very low density lipoprotein

(VLDL) levels, as well as increasing high-density

lipoprotein (HDL) levels and reducing triglycerides level.

It is used alone or in conjunction with statins in the

treatment of hypercholesterolemia and

hypertriglyceridemia. It lowers lipid levels by activating

peroxisome proliferator-activated receptor alpha (PPARα).

PPARα activates lipoprotein lipase and reduces apoprotein

CIII, which increases lipolysis and elimination of

triglyceride-rich particles from plasma.

Literature survey revealed that very few methods

have been reported for the analysis of Atorvastatin and

Fenofibrate combinational dosage forms which include

UV spectroscopy, Reverse Phase High performance

Liquid Chromatography, Densitometric method, HPTLC

methods. The present study illustrate development and

validation of simple, economical, selective, accurate,

precise RP-HPLC method for the determination of

Atorvastatin and Fenofibrate in bulk and Pharmaceutical

dosage forms as per ICH guidelines.

The goal of this study is to develop rapid, economical

HPLC method for the analysis of Atorvastatin and

Fenofibrate in combined dosage form using most

commonly employed column (C18) and simple mobile

phase preparation.

In the present proposed work a successful attempt

had been made to develop a method for the simultaneous

estimation of Atorvastatin and Fenofibrate pharmaceutical

dosage form and validate it. From the economical point of

view and for the purpose of routine analysis, it was

decided to develop a more economical RP-HPLC method

with simple mobile phase preparation for the estimation of

Atorvastatin and Fenofibrate combinational dosage form.

The method would help in estimate of drugs in single run

which reduces the time of analysis and does not require

separate method for each drug. Thus, the paper reports an

economical, simple and accurate RP-HPLC method for the

above said pharmaceutical dosage forms.

2. MATERIALS AND METHODS

Quantitative HPLC was performed on a high

performance liquid chromatograph -Waters e2695Alliance

HPLC system connected with PDA Detector 2998 and

Empower2 Software. The drug analysis data were

acquired and processed using Empower2 software running

under Windows XP on a Pentium PC and Thermohypersil

BDS C18 column of dimension 100 × 4.6, 5µm particle

size. In addition an analytical balance (DENVER 0.1mg

sensitivity), digital pH meter (Eutech pH 510), a sonicator

(Unichrome associates UCA 701) were used in this study.

Standards and chemicals used: Pharmaceutical grade

Atorvastatin and Fenofibrate were kindly supplied as a gift

sample by Dr.Reddy’s Laboratory, Hyderabad, and

Andhra Pradesh, India. Methanol was of HPLC grade and

Purchased from E. Merck, Darmstadt, Germany. Ortho



Phosphoric Acid was analytical reagent grade supplied by

Fischer Scientific Chemicals. Water HPLC grade was

obtained from a Milli-QRO water purification system.

Atorvastatin and Fenofibrate Tablets available in the

market as Lipicure-TG (intas pharmaceuticals, Sikkim,

India.) in composition of Atorvastatin (10mg),

Fenofibrate (150mg).

Preparation of mobile phase: Transfer water into

1000ml of beaker dissolve and diluted volume with water.

Then adjust its pH to 2 with Ortho Phosphoric Acid

(OPA). The Water adjusted pH to 2 with OPA: Methanol

(60:40 v/v) and filtered through 0.45µ membrane filter

and degassed by sonication.

Preparation of calibration standards: 10mg

Atorvastatin and 16mg Fenofibrate was taken into a 10, 50

ml of volumetric flask and add 10ml of Diluent and

sonicated for 10 minutes and made up with Diluent. It was

further diluted to get stock solution of Atorvastatin and

Fenofibrate (To get 0.02 ppm and 0.32 ppm solution

respectively). This is taken as a 100% concentration.

Working standard solutions of Atorvastatin and

Fenofibrate was prepared with mobile phase. To a series

of 10 ml volumetric flasks, standard solutions of

Atorvastatin and Fenofibrate in the concentration range of

0.01-0.03µg/ml and 0.16-0.48µg/ml were transferred

respectively.

System suitability: System suitability are an integral part

of chromatographic system. To ascertain its effectiveness,

certain system suitability test parameters were checked by

repetitively injecting the drug solutions at 100%

concentration level for Atorvastatin and Fenofibrate to

check the reproducibility of the system. At first the HPLC

system was stabilized for 40 min. One blank followed by

six replicate analysis of solution containing 100% target

concentration of Atorvastatin and Fenofibrate were

injected to check the system suitability. To ascertain the

system suitability for the proposed method, a number of

parameters such as theoretical plates, peak asymmetry,

and retention time were taken and results were presented

in Table 1.

Recommended procedure:

Calibration curves for Atorvastatin and Fenofibrate: Replicate analysis of solution containing 0.01-0.03µg/mL,

0.16-0.48µg/mL of Atorvastatin and Fenofibrate sample

solutions respectively were injected into HPLC according

to the procedure in a sequence and chromatograms were

recorded. Calibration curves were constructed by plotting

by taking concentrations on X-axis and ratio of peak areas

of standards on Y-axis and regression equation were

computed for both drugs and represented in Table .6

Analysis of marketed formulation: The content of ten

tablets was weighed accurately. Their average weights

were determined. Powder of tablets equivalent to one

tablet weight (521.1mg) were weighed and taken in a 50

ml volumetric flask, dissolved in diluents, shaken and

sonicated for about 20 minutes then filtered through 0.45µ

membrane filter. The filtered solution was further diluted

(5 to 50ml) in the diluents to make the final concentration

of working sample equivalent to 100% of target

concentration. The prepared sample and standard solutions

were injected into HPLC system according to the

procedure. from the peak areas of Atorvastatin and

Fenofibrate the amount of the drugs in the sample were

computed. The contents were calculated as an average of

six determinations and experimental results were

presented in Table 4. The representive standard and

sample chromatograms were shown in fig.2 and fig.3.

Validation study of Atorvastatin and Fenofibrate: An

integral part of analytical method development is

validation. Method validation is the process to confirm

that the analytical procedure employed for a specific test

is suitable for its intended use. The newly developed RP-

HPLC method was validated as per International

Conference on Harmonization (ICH) guidelines for

parameters like specificity, system suitability, accuracy,

linearity, precision (repeatability), limit of detection

(LOD), limit of Quantification (LOQ) and robustness.

Specificity: The effect of wide range of excipients and

other additives usually present in the formulation of

Atorvastatin and Fenofibrate in the determination under

optimum conditions were investigated. The specificity of

the RP-HPLC method was established by injecting the

mobile phase and placebo solution in triplicate and

recording the chromatograms. The common excipients

such as lactose anhydrous, microcrystalline cellulose and

magnesium state have been added to the sample solution

injected and tested.

Precision: precision study of sample (Losartan potassium

and Amlodipine) was carried out by estimating

corresponding responses 6 times on the same day for the

100% target concentration. The percent relative standard

deviation (%RSD) is calculated which is within the

acceptable criteria of not more than 2.0.

Linearity: The linearity graphs for the proposed assay

methods were obtained over the concentration range of

0.01-0.03µg/ml and 0.16-0.48µg/ml (50-150%)

Atorvastatin and Fenofibrate respectively. Method of least

square analysis is carried out for getting the slope,

intercept and correlation coefficient, regression data

values and the results were presented in Table 2. The

representative chromatograms indicating the sample were

shown in fig.2&3. A calibration curve was plotted

between concentration and area response and statistical

analysis of the calibration curves were shown in fig. 6&7.



Accuracy (Recovery studies): The accuracy of the

method is determined by calculating recovery of

Atorvastatin and Fenofibrate by the method of addition.

Known amount of Atorvastatin and Fenofibrate at 50%,

100%, 150% is added to a pre quantified sample solution.

The recovery studies were carried out in the tablet in

triplicate each in the presence of placebo. The mean

percentage recovery of Atorvastatin and Fenofibrate at

each level is not less than 99% and not more than 101%.

Robustness: The robustness is evaluated by the analysis

of Atorvastatin and Fenofibrate under different

experimental conditions such as making small changes in

flow rate (±0.2 ml/min), λmax (±5), column temperature

(±5), mobile phase composition (±5%), and pH of the

buffer solution.

LOD and LOQ: Limit of detection is the lowest

concentration in a sample that can be detected but not

necessarily quantified. Under the stated experimental

conditions. The limit of quantification is the lowest

concentration of analyte in a sample that can be

determined with acceptable precision and accuracy. Limit

of detection and limit of quantification were calculated

using following formula LOD=3.3(SD)/S and

LOQ=10(SD)/S, where SD= standard deviation of

response (peak area) and S= average of the slope of the

calibration curve.

Table 1: optimized chromatographic conditions and system suitability parameters for proposed method

S.NO Parameter Chromatographic conditions

1. Instrument Waters e2695 Alliance HPLC with Empower2 software

2. Column thermohypersil C18, (5μ, 150 x 4.6mm)

3. Detector PDA Detector 2998

4. Diluents Methanol

5. Mobile phase Water(adjusted pH 2.0 with OPA): methanolo (60:40 v/v)

6. Flow rate 1ml/min

7. Detection wavelength 274nm

8. Temperature 35°c

9. Injection volume 5µl

10. Retention time

Atorvastatin 1.438

Fenofibrate 2.949

11. Theoretical plate count

Atorvastatin 2552

Fenofibrate 3000

12. Tailing factor

Atorvastatin 1.17

Fenofibrate 1.59

13. Resolution factor 9.38

Table 2: Specificity study

S.NO. Name of the solution Retention time in min

1. Blank No peaks

2. Atorvastatin 1.438

3. Fenofibrate 2.949



Table 3: results of precision study

S.NO Sample Injection number Precission

RT Peak area

1.

Atorvastatin

1 1.443 2054782

2 1.438 2054809

3 1.442 2065165

4 1.382 2060368

5 1.441 2041300

6 1.444 2043795

Mean 2053370

%RSD(NMT 2.0) 0.50

2.

Fenofibrate

1 2.977 3515822

2 2.961 3503597

3 2.973 3509064

4 2.970 3507668

5 2.973 3511717

6 2.877 3513906

Mean 3510296

%RSD(NMT 2.0) 0.1

Table 4: Recovery data of the proposed Atorvastatin and Fenofibrate

S.NO Sample Spiked Amount

(µg/ml)

Recovered Amount

(µg/ml)

%Recovered %Average

recovery

1.

Atorvastatin

10.04 10.02 100.16

100% 19.983 19.94 100

29.937 29.85 99.3

2.

Fenofibrate

158.47 158.82 100.33

100.33% 316.538 317.59 100.33

474.20 476.32 100.33

Table 5: Robustness results of Atorvastatin and Fenofibrate

S.NO sample parameters Optimized Used RT Peak area Plate count

1.

Atorvastatin

Flow rate

(±0.2)

1ml/min

0.8 1.799 2187263 3021

1 1.436 6100287 2723

1.2 1.209 1639328 2856

Temperature

(±5°C)

35°C

30 1.357 1565593 2943

35 1.438 2043083 2552

40 1.211 1639328 2734

2.

Fenofibrate

Flow rate

(±0.2)

1ml/min

0.8 2.508 3198139 3037

1 2.940 3507208 3234

1.2 2.495 2378287 2810

Temperature

(±5°C)

35°C

30 2.488 2519528 2853

35 2.949 3527161 3222

40 3.684 2643655 2958



Table 6: linearity data of the Atorvastatin and Fenofibrate

Table.7: Limit of Detection and Limit of Quantification

Parameter Atorvastatin Fenofibrate

Limit of detection(LOD) 0.00013µg/mL 0.00210µg/mL

Limit of Quantification(LOQ) 0.00046µg/mL 0.0070µg/mL

Fig.3: Chromatogram of Blank solution Fig. 4: Typical Chromatogram of standard

Fig. 5: Typical chromatogram of Atorvastatin and Fenofibrate in marketed formulation

S.NO sample Linearity level

(µg/ml)

Peak area Slope Y-intercept r²

1.

Atorvastatin

0.1 1024859

20379

1640.2

0.999 0.15 1530720

0.2 2028343

0.25 2552721

0.3 3061292

2.

Fenofibrate

0.01 1756257

34837

15635

0.999 0.015 2634474

0.02 3501613

0.025 4352056

0.03 5252030

Fig.1: Structure of Atorvastatin Fig.2 Structure of Fenofibrate



Fig. 6: Linearity of Atorvastatin Fig. 7: Linearity of Fenofibrate

3. RESULTS AND DISCUSSION

Reverse phase HPLC method was preferred for

the determination of Atorvastatin and Fenofibrate.

Preliminary experiments were carried out to achieve the

best chromatographic conditions for the simultaneous

determination of the drug substances. Several column

types and lengths were tried considering other

chromatographic parameters. C18 column with a 4.6 mm

inner diameter and 5µm particle size was chosen. The

detection wave length was selected as 274nm with PDA

detector. Chromatographic conditions were optimized by

changing the mobile phase composition and buffers used

in mobile phase.

Different experiments were performed to optimize

the mobile phase but adequate separation of the drugs

could not be achieved. By altering the pH of buffer results

a good separation. Different proportions of solvents were

tested. Eventually the best separation was obtained by the

isocratic elution system using a mixture of water (adjusted

the pH to 2 with OPA): methanol (60:40, v/v) at a flow

rate of 1 ml/min. a typical chromatogram for simultaneous

estimation of the two drugs obtained by using a above

mentioned mobile phase. Under these conditions

Atorvastatin and Fenofibrate were eluted at 1.438min and

2.949minutes respectively with a run time of 5 minutes.

The representative chromatogram of this simultaneous

estimation shown in fig. 3 & 4 and results were

summarized in Table 1.

The Methanol and water (pH 2 with OPA) (40:60,

v/v) was chosen as the mobile phase. The run time of the

HPLC procedure was 5 minutes at flow rate of 1ml/min

was optimized which gave sharp peak, minimum tailing

factor. The system suitability parameters were shown in

Table 1 were in within limit, hence it was concluded that

the system was suitable to perform the assay. The method

shows linearity between the concentration range of 0.01-

0.03µg/ml for Atorvastatin and 0.16-0.48µg/ml for

Fenofibrate.

The experimental results were shown in table 6

and fig.6&7. The % recovery of Atorvastatin and

Fenofibrate was found to be in the range of 99.5 to 100 %

& 99 to 100.33% respectively. As there was no

interference due to excipients and mobile phase, the

method was found to be specific. As both compounds

pass the peak purity, the method was found to be specific.

The method was robust and rugged as observed from

insignificant variation in the results of analysis by

changes in Flow rate, column oven temperature, mobile

phase composition and wave length separately and

analysis being performed by different analysts.

The results were shown in Table 5. The LOD and

LOQ values were calculated based on the standard

deviation of the response and the slope of the calibration

curve at levels approximately the LOD and LOQ. The

limit of detection was obtained as 0.00013µg/mL for

Atorvastatin and 0.00210µg/mL for Fenofibrate. The limit

of quantitation was obtained as 0.00046µg/mL for

Atorvastatin and 0.0070µg/mL for Fenofibrate which

shows that the method is very sensitive. The results were

shown in Table. 7.

4. CONCLUSION

A new validated RP-HPLC method has been developed

for the quantitative and Qualitative determination of

Atorvastatin and Fenofibrate in tablet dosage forms in

bulk and pharmaceutical dosage forms was established.

The method was completely validated shows satisfactory

results for all the method validation parameters tested and

method was free from interferences of the other active

ingredients and additives used in the formulation. Infact

results of the study indicate that the developed method

was found to be simple, reliable, accurate, linear,

sensitive, economical and reproducible and have short run

time which makes the method rapid. Hence it can be

concluded that the proposed method was a good approach

y = 20379x + 1640.2

r² = 0.999

0

1000000

2000000

3000000

4000000

0 100 200

AR

EA

CONC.

ATORVASTATIN

Area

Linear (Area)

y = 34837x + 15635

r² = 0.999

0

2000000

4000000

6000000

0 100 200

AR

EA

CONC.

FENOFIBRATE

Area

Linear (Area)



for obtaining reliable results and found to be suitable for

the routine analysis of Atorvastatin and Fenofibrate in

Bulk drug and Pharmaceutical formulations.

5. ACKNOWLEDGEMENT

The authors would like to thank beloved parents

and all my well wishers, one and all who have helped me

directly and indirectly in completing this project work.

REFERENCES

D A Shah, KK Bhatt, RS Mehtha, MB Shankar, TR

Gandhi, Development and validation of a RP-HPLC

method for determination of Atorvastatin calcium and

Aspirin in a capsule dosage form, Indian Journal of

Pharmaceutical Sciences, 69(4), 2007, 546-549.

Deepti Jain, N Jain, R Raghuwanshi,Development and

validation of RP-HPLC method for simultaneous

estimation of Atorvastatin calcium and Fenofibrate in

tablet dosage forms, Indian Journal of Pharmaceutical

Sciences,70(2), 2008, 263-265.

Gadewar CK, Mundik MB, Chandekar NA, Mahajan NM,

Telgoti PD,RP-HPLC Method for Simultaneous

Estimation of Atorvastatin Calcium Ezetimibe in

Pharmaceutical Formulation, Asian Journal of Research in

Chemistry, 3(2), 2010, 485-490.

Hirave Rupali. V, Bendgude Ravindra.D, Maniyar

Mithun.G, Kondavar Manish.S, Patil Sandeep.B,

Spectrophotometric method for Simultaneous estimation

of Atorvastatin Calcium & Fenofibrate in tablet Dosage

Form, International Journal of Drug Development &

Research, 5(1), 2013, 38-42.

ICH-Q2A, Text on Validation of Analytical Procedures,

ICH Harmonized Tripartite Guideline, Geneva, 1995, 2-3.

ICH-Q2B, Validation of Analytical Procedures:

Methodology, ICH Harmonized Tripartite Guideline,

Geneva, 1996, 1-8.

Krishna R. Gupta, Sonali S.Askarkar, Prashanth R.Rathod,

Sudhir G.wadodkar, Validated spectrophotometric

determination of Fenofibrate in Formulation, Der

Pharmacia Sinica, pelagia research library, UK, 1(1),

2010, 173-178.

Linda LN: Reviewer guidance-Validation of

chromatographic methods, Center for drug evaluation and

research, 1994, 1-30.

Lloyd R.Synder, Joseph J.Kirkland, Joseph L.Glajeh,

Practical HPLC method development, 2nd

Edition. 1997,1-

14.

Nagavalli D, Balipaka Srinivas, Kalyan Chakravarthy C,

A validation analytical method development for the

simultaneous estimation of Metformin hydrochloride and

Fenofibrate in pure and in tablet dosage form,

International research journal of pharmacy, 2(12), 2011,

146-149.

Onkar S. Havele, Shweta S.Havele, Simultaneous

Determination of Atorvastatin calcium and Pioglitazone

hydrochloride in Its Multicomponent Dosage Forms by

UV Spectrophotometry, International Journal of Pharmacy

and Pharmaceutical Science Research, 1(2), 2011, 75-79.

P. N. Dhabale, D.S.Gharge, Simultaneous

spectrophotometric estimation of Atorvastatin and

Fenofibrate in bulk drug and dosage form by using

simultaneous equation method. International Journal of

ChemTech Research, 2 (1), 2010, 325-328.

R.J.Hamilton and Swell, Introduction to HPLC, 2nd

Edition, 2-94.

Rajasekaran A, Sasikumar R, Dharuman J, Simultaneous

RP-HPLC method for the stress degradation studies of

Atorvastatin calcium and Ezetimibe in multicomponent

dosage form, Ars Pharmaceutica, Spain,US.52(3), 2011,

12-18.

Rupali Hirave, S.D.Bhinge, S.M.Malipatil, A.S.Savali,

RP-HPLC method for simultaneous estimation of

Atorvastatin Calcium and Fenofibrate in tablet dosage

forms, Journal of PharmacyResearch, 3 (10), 2010, 2400.

T.Depan, K Paul Ambethkar, G.Vijaya Lakshmi,

M.D.Dhanaraju, Analytical Method Development And

Validation of RP-HPLC For Estimation of Atorvastatin

Calcium And Fenofibrate in Bulk Drug and Tablet Dosage

forms, European Journal of Applied sciences, 3 (2), 2011,

35-39.

Sindhura and Agarwal et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


ANALYTICAL METHOD DEVELOPMENT AND VALIDATION FOR THE

SIMULTANEOUS ESTIMATION OF LAMIVUDINE, ZIDOVUDINE AND

EFAVIRENZ BY RP-HPLC IN BULK AND PHARMACEUTICAL DOSAGE FORMS

Sindhura D*, Nanda Kishore Agarwal

Department of pharmaceutical analysis, Nimra College of Pharmacy

*Corresponding Author: [email protected], Phone no: 9951089007

ABSTRACT

A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was developed for

the determination of Lamivudine, Zidovudine and Efavirenz in bulk and pharmaceutical dosage forms. The

quantification was carried out using Symmetry C18 (250 X 4.6 mm, 5 µm) column run in isocratic way using

mobile phase comprising of methanol and water in the ratio of 65:35 v/v and a detection wavelength of 250nm,

and injection volume of 20µL, with a flow rate of 1.0mL/min. The retention times of Lamivudine, Zidovudine and

Efavirenz was found to be 2.519, 3.015 and 24.103. The method was validated in terms of linearity, precision,

accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed

method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 80% to 120% and with correlation

coefficient of r2=0.9995,0.9994 and 0.9993 for Lamivudine, Zidovudine and Efavirenz. The assay of the proposed

method was found to be 99.98%, 99.96% and 100.14%. The recovery studies were also carried out and mean %

Recovery was found to be 100.7%, 100.28%, 100.45%. The % RSD from reproducibility was found to be <2%.

The proposed method was statistically evaluated and can be applied for routine quality control analysis of

Lamivudine, Zidovudine and Efavirenz in bulk and in Pharmaceutical dosage form.

Key Words: Lamivudine, Zidovudine, Efavirenz, RP-HPLC, Symmetry C18, Tablets, Validation.

1. INTRODUCTION

Lamivudine is 4-amino-1-[(2R, 5S)-2-

(hydroxymethy1)1, 3- oxathiolan-5-yl]-1, 2- dihydro

pyramidine-2-one.The molecular weight is 229.26,

molecular formula is C8H11N3O3S. It is an enantiomer of

dideoxy analogue of cytidine. Zidovudine is 3' azido-3'-

deoxythymidine. The molecular weight is 267.24,

molecular formula is C10H13N5O4.It is a thymidine

analogue. Both Lamivudine and Zidovudine inhibits the

HIV reverse transcriptase enzyme competitively and acts

as a chain terminator of DNA synthesis and is used in the

treatment of both types of HIV I and HIV II virus and

chronic hepatitis B.Efavirenz is chemically (S)-6-chloro-

4-(cyclopropylethynyl)-1,4-dihydro4-(trifluoromethyl)-

2H-3,1- benzoxazin-2-one. The molecular weight is

315.67, molecular formula is C14H9ClF3NO2.It diffuses

into the cell where it binds adjacent to the active site of

reverse transcriptase. This produces a conformational

change in the enzyme that inhibits function.

Literature review reveals very few methods are

reported for the assay of Lamivudine, Zidovudine and

Efavirenz in Tablet dosage forms using RP-HPLC

method. The reported HPLC methods were having

disadvantages like high flow rate, more organic phase and

use of costly solvents. The proposed RP-HPLC method

utilizes economical solvent system and having advantages

like better retention time, less flow rate, very sharp and

symmetrical peak shapes. The aim of the study was to

develop a simple, precise, economic and accurate RP-

HPLC method for the estimation of Lamivudine,

Zidovudine and Efavirenz in Tablet dosage forms.

Figure.1.Structure of

Lamivudine

Figure.2. Structure of Zidovudine Figure.3.Structure of

Efavirenz

Page 583





UV-3000 LABINDIA double beam with UV win

5software UV-VISIBLE spectrophotometer with 1cm

matched quartz cells. Schimadzu HPLC equipped with

SPD 20A UV-VIS detector and the column used was

SYMMETRY C18 (250*4.6mm, 5µ). The data acquisition

was performed by using LC solutions software.

2.1. Chemicals and reagents: Lamivudine, Zidovudine

and Efavirenz pure samples were obtained from Mylan

Laboatories, Hyderabad, India and dosage form “Duovir-

E” marketed by CIPLA was purchased from local

pharmacy. Other chemicals all are of HPLC grade.

2.2. Preparation of mobile phase: A suitable quantity of

degassed mixture of methanol and water in the ratio of

65:35 v/v was prepared and filtered through 0.45µ filter

under vacuum filtration.

2.3. Preparation of standard solution: Standard

solution of Lamivudine, Zidovudine and Efavirenz

(600μg/ml, 150 μg/ml,300μg/ml) was prepared by

dissolving 60mg of Efavirenz, 15mg of Lamivudine and

30mg of Zidovudine working standard in 50ml of diluent

with sonication and made up to 100ml with the same

diluent.

2.4. Preparation of sample solution: Five tablets were

weighed and finely powdered and a powder quantity

equivalent to 150mg Lamivudine, 300mg of Zidovudine

and 600mg of Efavirenz were accurately weighed and

transferred to a 100ml volumetric flask and 50ml of

diluent was added to the same. The flask was sonicated for

30 min and volume was made up to the mark with diluent.

Transferred 5ml of solution into a 50ml volumetric flask

and dilute up to the mark with diluent so as to obtain a

concentration of 150,300,600 μg/mL mixed well and

injected. The amount present in each tablet was calculated

by comparing the area of standard Efavirenz, Lamivudine,

Zidovudine and tablet sample.

2.5. Method optimization: The chromatographic

separation was performed using Symmetry C18

(250×4.6mm, 5µm) column. For selection of mobile

phase, various mobile phase compositions were

observed for efficient elution and good resolution.

The mobile phase consisting of methanol and water

in the ratio of 65:35v/v was found to be the optimum

composition for efficient elution of analyte. The

mobile phase was injected to the column at a flow

rate of 1.0 ml/min for 35min. The column

temperature was maintained at 30oC. The analyte was

monitored at 250 nm using UV-detector. The

retention time of the drugs was found to be 2.519,

3.015 and 24.103min. Mobile phase was used as

diluent during the standard and test samples

preparation.

3. RESULTS

3.1. Method Validation

3.1.1. System suitability: System suitability tests are an

integral part of method validation and are used to ensure

adequate performance of the chromatographic system.

Retention time (RT), number of theoretical plates (N) or

column efficiency and tailing factor (T) were evaluated for

five injections of standard solution at a solution of

100µg/ml of Lamivudine, Zidovudine and Efavirenz. The

results are tabulated in the table no-2 and the

chromatogram was shown in the figure no- 4.

3.1.2. Specificity: Specificity is the ability of analytical

method to measure accurately and specifically the analyte

in the presence of components that may be expected to be

present in the sample. The specificity of method was

determined by spiking possible impurities at specific level

to standard drug solution (100ppm). The diluent and

placebo solutions were also injected to observe any

interference with the drug peak. The results are tabulated

in the table no-3 and the chromatogram was shown in the

figure no- 5, 6.

3.1.3. Linearity: Linearity is the ability of the method to

produce results that is directly proportional to the

concentration of the analyte in samples with given range.

The linearity of Lamivudine, Zidovudine and Efavirenz

was in the concentration range of 80-120%.From the

linearity studies calibration curve was plotted and

concentrations were subjected to least square regression

analysis to calculate regression equation. The regression

coefficient was found to be 0.9995 for Lamivudine,

0.9994 for Zidovudine and 0.9993 for Efavirenz and

shows good linearity for three drugs. The results are

tabulated in the table no-4 and the chromatogram was

shown in the figure no- 7, 8, 9.

3.1.4. Accuracy: Accuracy is the closeness of results

obtained by a method to the true value. It is the measure of

exactness of the method. Accuracy of the method was

evaluated by standard addition method. Recovery of the

method was determined by spiking an amount of the pure

drug (80%,100% ,120%) at three different concentration

levels in its solution has been added to the pre analyzed

working standard solution of the drug. The results are

tabulated in the table no-5, 6, 7.

3.1.5. Precision: The precision of the analytical method

was studied by analysis of multiple sampling of

homogeneous sample. The Precision expressed as

standard deviation or relative standard deviation.

Page 584



3.1.6. System precision: System precision was performed

by injecting a standard solution of Lamivudine,

Zidovudine and Efavirenz at working concentrations five

times. The results are tabulated in the table no-8.

3.1.7. Method precision: Method precision was

performed by analyzing a sample solution of Lamivudine,

Zidovudine and Efavirenz by injecting six replicates of the

same sample preparations at a concentration of

100ppm/mL. The results are tabulated in the table no-9.

3.1.8. Robustness: Robustness shows the reliability

of an analysis with respect to deliberate variations in

method parameters. If measurements are susceptible

to variations in analytical conditions, the analytical

conditions should be suitably controlled or a

precautionary statement should be included in the

procedure.

Table.1.Optimized chromatogram conditions for Lamivudine, Zidovudine and Efavirenz

Column Symmetry C18 (250*4.6mm,5µ)

Mobile phase Methanol: Water(65:35)

Flow rate 1.0 ml/ min

Wavelength 250 nm

Injection volume 20 l

Column temperature 30o C

Run time 35 min

Table.2. System suitability Data for Lamivudine, Zidovudine and Efavirenz

S.No Lamivudine

Peak area

Zidovudine

Peak area

Efavirenz

Peak area

1 2027423 1501204 3138895

2 2025853 1500977 3142519

3 2026576 1501113 3150529

4 2025030 1501308 3154259

5 2027292 1502391 3158911

Average 2026435 1501399 3149023

SD 1005 568 8251

%RSD 0.05 0.04 0.26

Theoretical plates 6615 7512 4500

Tailing factor 1.25 1.32 1.12

Retention time 2.519 3.015 24.103

Table.3.Specificity Data for Lamivudine, Zidovudine and Efavirenz

Peak Name Retention Time (Minutes) RT ratio

Lamivudine 2.541 1.00

Zidovudine 3.001 1.18

Efavirenz 22.403 8.82

Table.4. Linearity Data for Lamivudine, Zidovudine and Efavirenz

Lamivudine Zidovudine Efavirenz

Level Con. (mg/ml) Peak area Con.(mg/ml) Peak area Con.(mg/ml) Peak area

80% 0.07959 1576950 0.08005 1169205 0.08095 2521629

90% 0.08855 1761010 0.09010 1299358 0.08846 2753981

100% 0.10350 2040551 0.10360 1504208 0.10290 3198155

110% 0.10810 2121575 0.10850 1565537 0.10853 3342493

120% 0.11950 2357552 0.12015 1735081 0.11925 3701006

Slope 19338642.0219 14201079.1883 30526500.1606

Intercept 40602.8714 27753.3632 50253.3069

Correlation coefficient 0.9997 0.9997 0.9997

R square 0.9995 0.9994 0.9993

Page 585



Table.5. System precision of Lamivudine, Zidovudine and Efavirenz (8)

S.No Lamivudine Zidovudine Efavirenz

Area RT Area RT Area RT

1 2027423 2.540 1501204 3.044 3138895 25.192

2 2025853 2.540 1500977 3.043 3142519 25.100

3 2026576 2.544 1501113 3.045 3150529 25.061

4 2025030 2.541 1501308 3.043 3154259 24.954

5 2027292 2.542 1502391 3.042 3158911 24.559

Average 2026435 - 1501399 - 3149023 -

SD 1005 - 568 - 8251 -

% RSD 0.05 - 0.04 - 0.26 -

Table.6. Method precision of Lamivudine, Zidovudine and Efavirenz(9)

S.No Lamivudine Assay

(%)

RT

Zidovudine

Assay (%)

RT

Efavirenz

Assay (%)

RT

1 99.5 2.539 99.3 3.019 99.3 22.841

2 100.5 2.539 99.6 3.019 100.4 22.869

3 99.5 2.541 99.4 3.024 99.3 22.940

4 99.6 2.539 99.8 3.020 99.8 22.941

5 99.8 2.537 99.5 3.020 99.9 22.889

6 100.0 2.540 99.9 3.021 99.9 22.941

Average 99.8 - 99.6 - 99.8 -

SD 0.4 - 0.2 - 0.4 -

% RSD 0.4 - 0.2 - 0.4 -

Table.7. Variation in flow rate, column temperature and buffer for Lamivudine (10)

Parameter

Lamivudine

Flow (mL/min) Temperature(oC) Buffer

Low High Low High Low High

%RSD 0.05 0.12 0.30 0.03 0.05 0.25

Retention time 3.094 2.556 2.814 2.808 2.809 2.821

Plate count 5.54 6.10 5124 5029 5954 4054

Tailing factor 1.20 1.21 1.20 1.26 1.32 1.22

Table.8.Variation in flow rate, column temperature and buffer for Zidovudine (11)

Parameter

Zidovudine



%RSD 0.14 0.17 0.19 0.06 0.04 0.18

Retention time 3.598 3.000 3.316 3.310 3.291 3.351

Plate count 4818 6010 4523 6842 4898 5818

Tailing factor 1.14 1.21 1.18 1.18 1.27 1.25

Table.9.Variation in flow rate, column temperature and buffer for Efavirenz(12)

Parameter

Efavirenz



%RSD 0.43 0.17 0.23 0.15 0.31 0.23

Retention time 25.251 20.889 23.399 23.677 21.621 26.840

Plate count 4558 5518 5326 5692 5558 4558

Tailing factor 1.32 1.18 1.23 1.32 1.31 1.31

Page 586



Figure.4.Standard chromatogram Figure.5.Sample chromatogram

Figure.6.Chromatogram for Specificity Figure.7. Linearity plot for Lamivudine

Figure.8.Linearity plot for Zidovudine Figure.9.Linearity plot for Efavirenz

4. DISSCUSSION

4.1. System suitability: From the system suitability

studies it was observed that retention time of Lamivudine,

Zidovudine and Efavirenz was found to be 2.519, 3.015

and 24.103 min. % RSD of peak area was found to be

0.05.0.04 and 0.26. Theoretical plates were found to be

more than 4000. USP tailing factor was found to be 1.25,

1.32 and 1.12 for Lamivudine, Zidovudine and Efavirenz.

All the parameters were within the limit.

4.2. Specificity: The Chromatograms of Standard and

Sample are identical with nearly same Retention time.

There is no interference with blank and placebo to the

drugs. Hence the proposed method was found to be

specific. 4.3. Linearity: From the Linearity data it was

observed that the method was showing linearity in the

concentration range of 80-120μg/ml for Lamivudine,

Zidovudine and Efavirenz. Correlation coefficient was

found to be 0.9995, 0.9994 and 0.9993 for three

compounds.

Page 587



4.4. Accuracy: The recoveries of pure drug from the

analyzed solution of formulation were in the range of

99.3%-101.6%, which shows that the method was

accurate.

4.5. Precision

4.5.1. System precision: The percentage relative standard

deviation (RSD) for the peak area of Lamivudine,

Zidovudine and Efavirenz were 0.05, 0.04 and 0.26.

4.5.2. Method precision: The percentage relative

standard deviation for the assay values of Lamivudine,

Zidovudine and Efavirenz were 0.4, 0.2 and 0.4.

4.6. Ruggedness: Comparison of both the results obtained

for two different Analysts shows that the method was

rugged for Analyst-Analyst variability. The %RSD for

intermediate precision for Lamivudine, Zidovudine and

Efavirenz was found to be 0.4, 0.2 and 0.4.

4.7. Robustness

As the % RSD of retention time and asymmetry

were within limits for variation in flow rate (± 0.1

ml). Hence the allowable flow rate should be

within 0.9 ml to 1.1 ml.


were within limits for variation (+ 20C) in column

oven temperature. Hence the allowable variation

in column oven temperature is + 20C.


were within limits for variation (+ 2 %) in

composition of mobile phase. Hence the allowable

variation in mobile phase composition is ± 2 %.

All the system suitability parameters are within

limits for variation (±2nm) in wavelength. Hence

the allowable variation in wavelength is ± 2nm.

The results obtained were satisfactory and are in

good agreement as per the ICH guidelines.

4.8. Acknowledgement: The authors thankful to Mr. K.

Srinivasa Rao (AGM), Mr. Jyothibasu Director, Mylan

Laboratories for providing necessary facilities to carry out

the research work.

5. CONCLUSION

Finally it concludes that all the parameters are

within the limits and meet the acceptance criteria of ICH

guidelines for method validation. The proposed method

was simple, accurate, specific, precise, robust, rugged and

economical. Hence this method is validated and can be

used for routine sample analysis

REFERENCES

Balamuralikrishna K, Mahendra K. And B. Syama

Sundar, RP-HPLC method for the simultaneous estimation

of Efavirenz, Lamivudine and Zidovudine in tablet dosage

forms, Journal of Pharmacy Research, 4(10), 2011, 3766-

3768.

Pishawikar SA, Jadhav SD, Bhatia M.s and Thamake SL,

UV spectrophotometric method for the estimation of

Lamivudine, Zidovudine and Nevirapine in pure and tablet

formulation, Asian Journal of Research in Chemistry

Issue, 4(3), 2010, 1-3.

M. Kumar, B. Jayakar, C. Saravanan and M. V.

Kumudhavalli, RP-HPLC method for simultaneous

estimation of Lamivudine and Zidovudine in pure and

tablet formulation, J. Chem. Pharm. Res, 1(2), 2010, 478-

481.

Palani Venkatesh, M.Ruthu and Y.Padmanabha Reddy,

Normal phase HPTLC method for the simultaneous

analysis of Lamivudine and Zidovudine in fixed dose

combination tablets, Journal of Pharmaceutical Analysis,

2(2), 2012, 152-155.

Sigonda, Yogendra Singh and Rajiv Sharma, Normal

phase HPTLC method for the simultaneous analysis of

Lamivudine, Stavudine and Nevirapine in fixed dose

combination tablets, Journal of Pharmaceutical and

Biomedical Analysis, 54(3), 2010, 445-450.

Hemanth Kumar and Anil Bhandari, Reverse-phase high

performance liquid chromatographic method for

simultaneous determination of plasma zidovudine and

nevirapine with UV detection at 260 nm, Journal of

Pharmaceutical and Biomedical Analysis, 29(6), 2002,

1081-1088.

Sindhuri and Versha Parcha, High performance liquid

chromatographic method was developed for the

simultaneous estimation of lamivudine, zidovudine and

nevirapine in pharmaceutical dosage forms, Journal of

Chromatography, 7(2) 2013, 353-362.

Jacqueline De Souza, Eunice Kazue Kano, Eunice Emiko

Mori Koono, Simone Grigoleto Schramm, Valentina Porta

and Sílvia Storpirtis, LC–UV Methodology for

Simultaneous Determination of Lamivudine and

Zidovudine in Plasma by Liquid–Liquid Extraction,

Chromatographia, 2(69), 2009, 231-235.

Ashok Peepliwal, Sagar D. Vyawahare and Chandrakant

G. Bonde, Quantitative analysis of Zidovudine containing

formulation by FT-IR and UV spectroscopy, Anal.

Methods, 11, 2010, 1756-1763.

Beckett AH, Stenlake JB, Practical pharmaceutical

chemistry. Vol. II. New Delhi: CBS Publisher and

Distributors, 1986, 13-17.

Skoog, DA Holler, FJ Nieman, T.A. Principles of

instrumental analysis, Thomson Brooks/Cole, Fifth

edition. 1998, 329-335.

Page 588

Page 589

Jyothsna et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


NOVEL RP-HPLC METHOD DEVELOPMENT AND VALIDATION OF LOSARTAN

POTASSIUM AND AMLODIPINE DRUGS IN PURE AND PHARMACEUTICAL

DOSAGE FORMS Kumari Jyothsna, Chandana N, Vinjam Swathi

Nimra College of Pharmacy, Vijayawada, A.P, India


ABSTRACT

A fast, robust and accurate RP-HPLC method was developed and validated for simultaneous determination of

Losartan potassium and Amlodipine in tablets. The mobile phase was mixture of aqueous Tri ethyl amine with pH

2.0 and Acetonitrile(70:30), effluent flow rate monitored at 1.0 ml/min. the stationary phase was C18 column,

3µm(4.6×250mm). The solutions of standard and the sample were prepared in methanol. The retention times was

found to be 2.916min and 5.214min for Losartan potassium and Amlodipine respectively at 246nm. Calibration

graphs constructed at their wavelengths of determination were linear in the concentration range of 50-150µg/ml.

The percentage assay for Losartan potassium and Amlodipine were found to be 101% and 100%respectively. The

method was validated and it was found to be accurate, precise, linear and reproducible as per ICH guidelines.

Keywords: RP-HPLC, Losartan potassium, Amlodipine, Accuracy, Precision, Linearity.

1. INTRODUCTION

Losartan potassium is a [2-butyl-4-chloro-1-({4-

[2-(2H-1,2,3,4-tetrazol-5-yl)phenyl]phenyl}methyl)-1H-

imidazol-5-yl]methanol monopotassium salt. It

competitively inhibits the binding of angiotensin II to AT1

in many tissues including vascular smooth muscle and the

adrenal glands. Inhibition of angiotensin II binding to AT1

inhibits its AT1-mediated vasoconstrictive and

aldosterone-secreting effects and results in decreased

vascular resistance and blood pressure. Losartan

potassium is 1,000 times more selective for AT1 than

AT2. Inhibition of aldosterone secretion may increase

sodium and water excretion while decreasing potassium

excretion. It is effective for reducing blood pressure and

may be used to treat left ventricular hypertrophy and

diabetic nephropathy.

Amlodipine (3-ethyl 5-methyl 2-[(2-

aminoethoxy)methyl]-4-(2-chlorophenyl)-6-methyl-1,4-

dihydropyridine-3,5-dicarboxylate) decreases arterial

smooth muscle contractility and subsequent

vasoconstriction by inhibiting the influx of calcium ions

through L-type calcium channels. Calcium ions entering

the cell through these channels bind to calmodulin.

Calcium-bound calmodulin then binds to and activates

myosin light chain kinase (MLCK). Activated MLCK

catalyzes the phosphorylation of the regulatory light chain

subunit of myosin, Inhibition of the initial influx of

calcium decreases the contractile activity of arterial

smooth muscle cells and results in vasodilation. The

vasodilatory effects of amlodipine result in an overall

decrease in blood pressure. Another possible mechanism

is that amlodipine inhibits vascular smooth muscle

carbonic anhydrase I activity causing cellular pH increases

which may be involved in regulating intracelluar calcium

influx through calcium channels.


have been reported for the analysis of Losartan potassium

and Amlodipine combinational dosage forms which

include UV spectroscopy, High performance Liquid

Chromatography, HPTLC methods. The present study

illustrate development and validation of simple, selective,

accurate, economical precise RP-HPLC method for the

determination of Losartan potassium and Amlodipine in

bulk and Pharmaceutical dosage forms as per ICH

guidelines.

The aim of this study is to develop rapid,

economical HPLC method for the analysis of Losartan

potassium and Amlodipine in combined dosage form

using most commonly employed column (C18) and simple

mobile phase preparation. In the present work a successful

attempt had been made to develop a method for the

simultaneous estimation of Losartan potassium and

Amlodipine pharmaceutical dosage form and validate it.

The method would help in estimation of drugs in single

run which reduces the time of analysis and does not

require separate method for each drug. Thus, the paper

reports an economical, simple and accurate RP-HPLC

method for the above said pharmaceutical dosage forms.


Equipments used: Quantitative HPLC was performed on

a high performance liquid chromatography -Waters

e2695Alliance HPLC system connected with PDA

Detector 2998 and Empower2 Software. The drug analysis

data were acquired and processed using Empower2

software running under Windows XP on a Pentium PC

and Agilent Zorbax C18, (3μ, 250 x 4.6mm). In addition

an analytical balance (DENVER 0.1mg sensitivity), digital

pH meter (Eutech pH 510), a sonicator (Unichrome

associates UCA 701) were used.




Losartan potassium and Amlodipine were kindly supplied

as a gift sample by Dr.Reddy’s Laboratory, Hyderabad,

India. Acetonitrile and methanol was of HPLC grade,

Purchased from E. Merck, Darmstadt, Germany.

Triethylamine was analytical reagent grade supplied by



Losartan potassium and Amlodipine Tablets available in

the market as Losar-A (Unichem pharmaceuticals,

Himachal pradesh, India.) in composition of Losartan

potassium (50mg) Amlodipine (5mg).



Then adjust its pH to 2.0 with Trithylamine. The Water

adjusted pH to 2 with Triethylamine: acetonitrile (70:30

v/v) and filtered through 0.45µ membrane filter and

degassed by sonication.

Preparation of calibration standards: 10mg Losartan

potassium and 10mg Amlodipine was taken into a 50, 10

ml of Volumetric flask and add 10ml of Diluent and

sonicated for 10 minutes and made up with Diluent.It was

further diluted to get stock solution of Losartan potassium

and Amlodipine (To get 0.2 ppm and 0.02 ppm solution

Respectively). This is taken as a 100% concentration.

Working standard solutions of Losartan potassium and

Amlodipine was prepared with mobile phase. To a series

of 10 ml volumetric flasks, standard solutions of Losartan

potassium and Amlodipine in the concentration range of

0.1-0.3µg/ml and 0.01-0.03µg/ml were transferred

respectively.

System suitability: System suitability is an integral part

of chromatographic system. At first the HPLC system was

stabilized for 40 min. One blank followed by six replicate

analysis of solution containing 100% target concentration

of Losartan potassium and Amlodipine were injected to

check the system suitability. To ascertain the system

suitability for the proposed method, a number of

parameters such as theoretical plates, retention time were

taken and results along with optimized chromatographic

conditions were presented in Table 1.


Calibration curves for Losartan potassium and

Amlodipine: Replicate analysis of solution containing

0.1-0.3µg/ml and 0.01-0.03µg/ml of Losartan potassium

and Amlodipine sample solutions respectively were

injected into HPLC according to the procedure in a

sequence and chromatograms were recorded. Calibration

curves were constructed by plotting by taking

concentrations on X-axis and ratio of peak areas of

standards on Y-axis and regression equation were

computed for both drugs and represented in Table 2.

Analysis of marketed formulation: The content of Ten

tablets were weighed accurately. Their average weights

were determined. Powder of tablets equivalent to two

tablets weight(600.04mg) were weighed and taken in a 50


sonicated for about 20 minutes then filtered through

0.45µ membrane filter. The filtered solution was further

diluted (5 to 50ml) in the diluent to make the final

concentration of working sample equivalent to 100% of

target concentration. The prepared sample and standard

solutions were injected into HPLC system according to the

procedure. From the peak areas of Losartan potassium and

Amlodipine the amount of the drugs in the sample were



presented in Table 3. The representive standarad and

sample chromatograms were shown in fig. 4and fig.5.

Validation study of Losartan potassium and

Amlodipine: An integral part of analytical method

development is validation. Method validation is the

process to confirm that the analytical procedure employed

for a specific test is suitable for its intended use. The

newly developed RP-HPLC method was validated as per

International Conference on Harmonization (ICH)

guidelines for parameters like specificity, system

suitability, accuracy, linearity, precision (repeatability),

limit of detection(LOD), limit of Quantification(LOQ)

and robustness.



Losartan potassium and Amlodipine in the determination

under optimum conditions were investigated. The

specificity of the RP-HPLC method was established by

injecting the mobile phase and placebo solution in

triplicate and recording the chromatograms. The common

excipients such as lactose anhydrous, microcrystalline

cellulose and magnesium state have been added to the

sample solution injected and tested.

Precision: precision study of sample (Losartan potassium

and Amlodipine) was carried out by estimating

corresponding responses 6 times on the same day for the

100% target concentration. The percent relative standard

deviation (%RSD) is calculated which is within the

acceptable criteria of not more than 2.0.



0.1-0.3µg/ml and 0.01-0.03µg/ml (50-150%) Losartan

potassium and Amlodipine respectively. Method of least

square analysis is carried out for getting the slope,



intercept and correlation coefficient, and the results were

presented in Table 2. A calibration curve was plotted

between concentration and area response and statistical

analysis of the calibration curves were shown in fig 6,7.


method is determined by calculating recovery of Losartan

potassium and Amlodipine by the method of addition.

Known amount of Losartan potassium and Amlodipine at

50%, 100%, 150% is added to a pre quantified sample

solution. The recovery studies were carried out in the

tablet in triplicate each in the presence of placebo. The

mean percentage recovery of Losartan potassium and

Amlodipine at each level is not less than 99% and not

more than 101%.


of Losartan potassium and Amlodipine under different


flow rate (±0.2 ml/min), column temperature (±5).



necessarily quantified, under the stated experimental


concentration of analyte in asample that can be determined

with acceptable precision and accuracy. Limit of detection

and limit of quantification were calculated using following

formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD=

standard deviation of response (peak area) and S= average

of the slope of the calibration curve.



the determination of Losartan potassium and Amlodipine.

Preliminary experiments were carried out by changing the

mobile phase composition and buffers used in mobile

phase. Different experiments were performed to optimize

the mobile phase. By altering the pH of buffer results a

good separation. Different proportions of solvents were

tested. Eventually the best separation was obtained by the

isocratic elution system using a mixture of water (adjusted

the pH to 2 with Triethyl amine): acetonitrile (70:30, v/v)

at a flow rate of 1 ml/min. Several column types and

lengths were tried considering other chromatographic

parameters. C18 column with 250 x 4.6mm length, inner

diameter and 3µm particle size was chosen. The detection

wave length was selected as 246nm with PDA detector. A

typical chromatogram for simultaneous estimation of the

two drugs obtained by using a above mentioned mobile

phase. Under these conditions Losartan potassium and

Amlodipine were eluted at 2.916min and 5.216min

respectively with a run time of 6 minutes. The

representative chromatogram of this simultaneous

estimation shown in fig. 3,4,5 and system suitability

results along with optimized chromatographic conditions

were summarized in Table 1.

The method shows linearity between the

concentration range of 0.1-0.3µg/ml for Losartan

potassium and 0.01-0.03µg/ml for Amlodipine. The

experimental results were shown in table 6 and fig 6, 7.

The % recovery of Losartan potassium and Amlodipine

was found to be in the range of 99.5 to 100 % & 99 to

100.33% respectively, the results wer shown in Table 4.

As there was no interference due to excipients and mobile

phase, the method was found to be specificresults were

shown inTable 2 and fig 3,4,5. The precssion obtained

was within the limits i.e., RSD<2 which would indicate

that the proposed method was quite precise and

reproducible and results were shown in Table 3. The

method was robust and rugged as observed from

insignificant variation in the results of analysis by

changes in Flow rate, column oven temperature. The

results were shown in Table 5. The LOD and LOQ values

were calculated based on the standard deviation of the

response and the slope of the calibration curve at levels

approximately the LOD and LOQ. The limit of detection

was obtained as 0.000633µg/mL for Losartan potassium

and 0.000069µg/mL for Amlodipine. The limit of

quantitation was obtained as 0.0021µg/mL for Losartan

potassium and 0.00023µg/mL for Amlodipine which

shows the method is very sensitive.



Table.1. Optimized chromatographic conditions and system suitability parameters for proposed method

Parameter Chromatographic conditions

Instrument Waters e2695 Alliance HPLC with Empower2 software

Column Agilent Zorbax C18, (3μ, 250 x 4.6mm)

Detector PDA Detector 2998

Diluents Methanol

Mobile phase Aqueous triethylamine(Ph 2.0): acetonitrile (70:30 v/v)

Flow rate 1ml/min

Detection wavelength 246nm

Temperature Ambient(35°c)

Injection volume 5µl

Retention time

Losartan potassium 2.91

Amlodipine 5.21

Theoretical plate count

Losartan potassium 8216

Amlodipine 8081

Tailing factor


Amlodipine 1.43

Resolution factor 12.25

Table.2. Specificity study

Name of the solution Retention time in min

Blank No peaks


Amlodipine 5.21

Table.3. Results of precision study

Sample Injection number Precision

RT Peak area

Losartan potassium

1 2.920 6126639

2 2.919 6167905

3 2.916 6160774

4 2.919 6188024

5 2.915 6138705

6 2.917 6127062

Mean 6156494

%RSD(NMT 2.0) 0.40

Amlodipine

1 5.216 9971154

2 5.214 9966863

3 5.212 9970936

4 5.214 9990844

5 5.207 9954087

6 5.207 9963155

Mean 9969177

%RSD(NMT 2.0) 0.12



Table.4. Recovery data of the proposed Losartan potassium and Amlodipine

Sample SpikedAmount

(µg/ml)

RecoveredAmount

(µg/ml)

%Recovered %Average

recovery

Losartan

potassium

49.5 49.95 101

101% 99 100.26 101

148.5 149.56 101

Amlodipine

4.95 4.94 100

100.33% 9.9 9.93 101

14.85 14.96 100

Table 5: Robustness results of Losartan potassium and Amlodipine

Table.6.Linearity data of the Losartan potassium and Amlodipine

Table.7.Limit of Detection and Limit of Quantification

S.NO Sample LOD LOQ

1. Losartan potassium 0.000633µg/ml 0.0021µg/ml

2. Amlodipine 0.000069µg/ml 0.00023µg/ml

sample parameters Optimized used RT Peak area Plate count

Losartan

potassium

Flow rate

(±0.2)

1ml/min

0.8 3.408 5159863 7861

1 2.916 6100287 7868

1.2 2.910 6134592 7958

Temperature

(±5°C)

35°C

30 3.408 5159863 7794

35 2.916 6100287 7868

40 2.908 6141851 7862

Amlodipine

Flow rate

(±0.2)

1ml/min

0.8 5.933 8217887 7746

1 5.214 9833918 7660

1.2 5.166 9942019 7764

Temperature

(±5°C)

35°C

30 5.953 8217887 7751

35 5.214 9833918 7660

40 5.167 9954276 7765

S.NO sample Linearity level

(µg/ml)


1.

Losartan

potassium

0.1 3053242

19288

99780.88

0.9999 0.15 4539421

0.2 6105323

0.25 7616656

0.3 9188085

2.

Amlodipine

0.01 4913960

16616

61387.68

0.9999 0.015 7471465

0.02 9978009

0.025 12408307

0.03 19972978



Fig 1: Structure of Losartan potassium Fig 2: Structure of Amlodipine

Fig.3: Chromatogram of Blank solution

Fig 4: Chromatogram of standard solution

Fig 5: Chromatogram of marketed formulation



Fig. 6: Linearity of Losartan potassium

Fig. 7: Linearity of Amlodipine

4. CONCLUSION

A new validated RP-HPLC method has been

developed for the quantitative and Qualitative

determination of Losartan potassium and Amlodipine in

tablet dosage forms in bulk and pharmaceutical dosage

forms was established. The developed HPLC technique is

precise, specific, robust and accurate. Results of analysis

of pharmaceutical formulations reveal that the proposed

methods are suitable for their analysis with virtually no

interference of the usual additives presented in

pharmaceutical formulations. This method is simple,

reliable, accurate, linear, sensitive, economical and

reproducible. Hence it can be concluded that the proposed

method was a good approach for obtaining reliable results

and found to be suitable for the routine analysis of

Losartan potassium and Amlodipine in Bulk drug and

Pharmaceutical formulations.

5. ACKNOWLEDGEMENT




REFERENCES

AV Kasture and Madhuri Ramteke, Simultaneous UV-

spectrophotometric method for the estimation of atenolol

and amlodipine besylate in combined dosage form, Indian

J Pharm Sci, 68, 2006, 394-6

Chaudhari BG, Patel NM and Shah PB, Stability

indicating RP-HPLC method for simultaneous

determination of atorvastatin and amlodipine from their

combination drug products, Chem Pharm Bull (Tokyo),

55(2), 2007, 241-6.

D. N. Vora and A. A. Kadav, Development and validation

of a simultaneous HPLC method for estimation of

Bisoprolol Fumarate and Amlodipine besylate from

tablets, Indian J Pharm Sci, 70(4), 2008, 542–546

0

2000000

4000000

6000000

8000000

10000000

12000000

14000000

16000000

0 50 100 150 200

AR

EA

CONC%

AMLODIPINE

LINEAR

r²=0.9999

Y=16616X+61387.68

0

2000000

4000000

6000000

8000000

10000000

0 50 100 150 200

AR

EA

CONC%

LOSARTAN POTASSIUM

LINEAR

Y=19288X+99780.8

r²=0.9999



ICH, Q2A validation of analytical procedure:

Methodology International Conference on Harmonization,

Geneva, October 1994.

ICH, Q2B Validation of analytical procedure:

Methodology International Conference on Harmonization,

Geneva, March 1996.

Loyd R. Snyder, Practical HPLC Method Development,

4th ed, A-Wiley-inter Science publication, 1997, 234-

265.

R. Sharma, S. Khanna and G. P. Mishra, RP-HPLC

method for simultaneous estimation of atenolol,

hydrochlorothiazide and losarton in tablet dosage form

Chem Sci Trans., 2013, 2(S1), S1-S6.

Ramya Gavini, S. B. Puranik, G. V. S. Kumar and K. A.

Sridhar, Simultaneous estimation of Amlodipine and

Losartan by UV-method in bulk drug and tablet dosage

formulation, Archives of Applied Science Research, 4 (5),

2012, 2206-2212.

Abeda et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND IN-VITRO EVALUATION OF ORNIDAZOLE GASTRORETENTIVE

TABLETS BY USING LOW DENSITY SWELLABLE POLYMERS Abeda Aqther

*, B. Pragati kumar, Peer Basha

Nimra College of Pharmacy, Vijayawada, India

*Corresponding author: Email:[email protected]

ABSTRACT

Gastro retentive drug delivery systems have shown to be of better significance in controlling release rate for

drugs having site specific absorption. The present study was an attempt to develop floating tablets of ornidazole

which on oral administration prolongs its gastric residence time there by increasing bioavailability. Ornidazole an

oral antiprotozoal having narrow absorption window in the upper and lower part of gastrointestinal tract, floating

matrix tablet using gas generating agent sodium bicarbonate and hydrophilic polymer Hydroxy propyl methyl

cellulose by wet granulation technique. Preformulation studies were carried out to optimize the required quantity

for HPMC K4M(10%), Eudragit(8%) was used. formulations were prepared using either HPMC k50, HPMC

k100, HPMC k4, Xanthan gum, Ethyl cellulose with carbopol 934P. For F1 to F8 formulation HPMC

concentration was increased to control the release of drug from the dosage form and for F11 formulation Eudragit

concentration was increased to obtain viscosity. Fourier transform Infrared spectroscopy confirmed the absence of

any drug/polymers/excipients interactions. F11 Formulations showed in-vitro buoyancy 9 hrs. The concentration

of HPMC K4 was increased to control the release of drug from the dosage form for F11 , the concentration was

increased for Eudragit to increase the binding nature . The cumulative % drug release of F11 formulation was

found to be Ornidazole (92.8%) at the end of 9th hr. The formulation containing HPMC k4m and Eudragit showed

better results compared to other formulated batches. Further Stability studies studies can be performed to ensure

the efficacy of the formulated floating tabets.

KEYWORDS: Ornidazole, HPMC, Floating lag time, swelling index, in-vitro buoyancy, Hrdro dynamically

balanced systems, Gastro intestinal tract.

INTRODUCTION

The idea of gastro retention systems from the need

to localize drugs at specific region of Gastro intestinal

tract such as stomach in the body. Often, the extent of

drug absorption is limited by the residence time of the

drug at absorption site (Bardonn et al.2006). The

therapeutic window of many drugs is limited by their short

circulating half-life and absorption via a defined segment

of the intestine. Such pharmacokinetic limitations lead in

many cases to frequent dosing of these medications to

achieve the required therapeutic effect. The phenomenon

of absorption via a limited part of the Gastro intestinal

tract has been termed the "narrow absorption window”;

once the dosage form passes the absorption window, the

drug will be neither bioavailable nor effective (Streubel et

al.2006). A rational approach to enhance bioavailability

and improve pharmacokinetic and pharmacodynamic

profiles is to retain the drug reservoir above its absorption

area, i.e., in the stomach and to release the drug in a

controlled manner, so as to achieve a zero order kinetics

(i.e., "oral infusion") for a prolonged period of time

(Stithit et al.1988).

MATERIALS AND METHODS

Marerials : Ornidazole, Indian Drugs, HYD. HPMC K4,

Qualikens, Vadodara. Eudragit, SD Fine Chem .Ltd.

Mumbai. sodium bicarbonate, Merck, Mumbai. citric acid

Finar reagents, Ahmedabad.

Method of Preparation of Ornidazole Gasro retentive

tablets: Granules were prepared by using wet granulation

technique. Drug and Eudragit were weighed and taken in

to motor. Finally the active ingredient was mixed

homogeneously according to geometric proportions. (2%)

HPMC 5CPS solution acts as granulating agent.The

coherent mass was thoroughly sieved through 16 mesh

and then dried in hot air oven at 50ºC for 45 min. The

dried granules were passed through sieve no 20 to get

uniform granules.To this calculated amount of Magnesium

Stearate (1%) and Talc (1%) were added as a lubricant.

Citric acid and sodium bicarbonate were incorporated as a

gas-generating agent.

Evaluation of floating tablets: Pre-formulation studies

were performed on the drug and excipients which includes

bulk density, tapped density, corr’s index, Hausner’s ratio

and compatability studies.The formulated tablets were

evaluated for its Thickness, hardness, friability, weight

variation,in-vitro buoyancy, swelling index, floating lag

time, in-vitro dissolution studies (Ramesh Bomma et al.

2009).



bulk density, tapped density, corr’s index, Hausner’s ratio


evaluated for its Thickness, hardness, friability, weight


time, in-vitro dissolution studies (Ramesh Bomma et al.

2009).



Table.1.Composition of Floating Tablets Containing Ornidazole

Ingredients (Mg) F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

Ornidazole 500 500 500 500 500 500 500 500 500 500 500 500

Hpmc5cps -- -- -- 60 60 60 30 60 50 40 40 40

HPMCK4 -- -- -- -- -- -- -- -- -- -- 40 --

HPMCK15 50 50 70 70 70 -- -- -- -- -- -- 40

HPMCK100 50 -- -- -- --- --- --- -- 50 50 30 --

Ethyl Cellulose 30 60 60 80 -- -- -- 60 -- -- -- --

Eudragit -- -- -- -- -- -- -- -- -- -- -- --

Xanthungum -- -- -- -- -- -- -- -- 50 70 -- 80

Carbopol934 50 70 50 -- -- -- -- -- -- -- -- --

Sod..Bicarbonate 40 40 40 30 20 70 50 60 50 50 50 50

Citricacid 30 30 30 20 10 30 50 50 30 30 30 30

TOTAL (Mg) 750 750 750 750 750 750 750 750 750 750 750 750

RESULTS AND DISCUSSION

Construction of calibration curve of Ornidazole: The

standard calibration curve yields a straight line, which

shows that the drug follows Beer’s law in the

concentration range of 5- 25 μg. The solutions were

scanned in U.V/Visible double beam spectro photometer

against ethanol as a blank.at 302 nm a standard graph was

plotted by keeping the known concentration on X – axis

and obtained absorbance on Y – axis.

Drug –Polymer Compatibility Studies By FTIR: Drug

polymer compatibility studies were performed by FTIR

(Fourier transform infrared spectroscopy). FTIR

absorption spectra of Ornidazole, HPMCK4,

HPMC5cps,Eudragit, xanthan gum and the combination of

drugs, polymers and excipients showed no significant

interaction between Ornidazole and polymer.

Pre-formulation studies: The formulated batches were

evaluated for Preformulation studies that are Angle of

repose, Carr’s index and Hausner’s ratio, the values

obtained for that studies are tabulated in Table no 2.The

values were found to be in the range from 25.64˚±0.01 to

31.3˚±0.05, 9.37±0.01 to12.5±0.01, 1.07±0.01

to1.14±0.01% respectively. This indicates good flow

property of the granules for compression.

Physical properties: The formulations were evaluated for

physicochemical parameters like hardness, thickness,

weight variation, friability, floating lag time and swelling

index. The values obtained for that studies are tabulated in

Table no 3. Floating properties from the evaluation results

it was observed that the tablets containing Eudragit and

HPMC K4M, F11 showed greater in vitro buoyancy time

and when compared to other prepared formulation.

Swelling index of floating tablets showed significant

differences in their swelling index due to the presence of

low density swellable polymers.

In-vitro drug release studies of Ornidzole: Formulations

F1, F2, F3 and F4 containing HPMC alone and

Combination of HPMC and Carbopol. The Formulations

F1 has shown release 83.6% at the end of 9th

h,

Formulations F2 has shown release 74.9% at the end of 9th

h, Formulations F3 has shown release 82.4% at the end of

9th

h, Formulations F4 has shown release 69.7% at the end

of 9th

h.

Formulations F5, F6, F7, F8, F10, and F12

containing Combination of HPMC5cps and HPMC K50

were prepared. The Formulations F5 has shown release

85.2% at the end of 9th

h, Formulations F6 has shown

release 80.6% at the end of 9th

h, Formulations F7 has

shown release 83.2% at the end of 9th

h, F8 has shown

release 77.1% at the end of 9th h, Formulations F9 has

shown release 82.4% at the end of 9th h, Formulations F12

has shown release 88.7% at the end of 9th h. Formulations

F10 and F11 containing Combination of HPMC and

Xanthan gum, Eudragit. The Formulations F10 and F11

have shown release 92.6% and 95.3% respectively at the

end of 9thh. the values obtained for that studies are

tabulated in Table no 4.

In-Vitro Buoyancy: In-vitro buoyancy which was greater

than 9 hrs, for formulation F11. In vitro Buoyancy of the

formulations F10, 11 is increased, which may be due to

high concentration of HPMC. The values of In vitro

Buoyancy for All formulations were given in Table no.5.

Kinetics of drug release: Based on mathematical models, it was concluded that for

mulation F11,the regression(r=0.99) value was found to

be 0.99 fitted into zero order release kinetics.The slope

value for peppas model was found to be with in 0.45-0.89

hence it is folllows non fickens diffussion. Non fickens

diffision refers to combination of both diffusion and

erossion controlled.



Figure.1. FTIR Spectra Data for Pure Ornidazole Figure.2.FTIR Spectra of Drug+ Polymers +Excipients

Figure.3. FTIR Spectra of Polymers+ Excipients Figure.4. Standard Curve of Ornidazole.

Table.2. Results for Derived and Flow properties

Formulation

code

Derived Properties Flow Properties

Bulk density

(mean±SD) g/ml

Tapped density

(mean±SD) g\ml

Angle of repose

(mean±SD)

Carr’s index

(mean±SD)

Hausner’s ratio

(mean±SD)

F1 0.29±0.01 0.33±0.04 26.5±0.01 12.1±0.01 1.137±0.01

F2 0.29±0.03 0.32±0.03 28.8±0.03 9.37±0.01 1.103±0.02

F3 0.35±0.01 0.39±0.01 27.02±0.04 10.2±0.02 1.114±0.03

F4 0.42±0.02 0.45±0.03 27.02±0.01 10.6±0.01 1.071±0.01

F5 0.35±0.01 0.39±0.01 27.1±0.05 10.2±0.01 1.114±0.02

F6 0.28±0.04 0.32±0.02 25.64±0.02 12.5±0.01 1.142±0.01

F7 0.34±0.03 0.37±0.02 27.2±0.04 12.4±0.01 1.088±0.04

F8 0.30±0.01 0.33±0.01 31.3±0.01 9.7±0.03 1.1±0.01

F9 0.37±0.02 0.42±0.04 29.2±0.03 11.9±0.02 1.135±0.02

F10 0.38±0.01 0.41±0.03 27.4±0.01 10.3±0.01 1.078±0.01

F11 0.35±0.04 0.39±0.01 27.02±0.05 10.4±0.01 1.114±0.01

F12 0.28±0.01 0.32±0.04 25.64±0.01 12.5±0.02 1.142±0.02



Table.3. Physico chemical parameters of all formulations

Formulations Thickness

(mm)

Hardness

(Kg/cm2)

Friability

(%)

Weight

variation (mg)

Floating lag

time (Sec)

Swelling index (%)

F1 3.4 2.9 0.93 958 - 207.5

F2 3.4 3.7 0.86 964 - 192.8

F3 3.8 2.9 0.78 943 - 279.2

F4 3.2 3.4 0.92 947 - 348.6

F5 3.4 2.8 0.81 739 - 316.8

F6 3.2 2.8 0.72 742 - 184.3

F7 3.4 3.1 0.67 756 - 175.4

F8 3.5 2.6 0.91 763 - 262.5

F9 3.7 3.1 0.75 749 - 300.4

F10 3.4 2.9 0.89 743 29 324.3

F11 3.8 2.9 0.78 742 37 279.2

F12 3.2 2.8 0.72 768 26 184.3

Table.4. In-Vitro Drug Release Profile of F1 – F12

Time

(hrs)

Cumulative % drug release (%)

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

0 0 0 0 0 0 0 0 0 0 0 0 0

1 19.6 18.9 15 12.9 23 21.2 23.7 17.2 15.8 19.2 18.1 15.3

2 28.2 26.4 22.2 20.2 30.3 28.7 33.8 23.7 21.6 28.6 29.8 27.1

3 38.4 33.4 29.2 27.1 38.3 35.8 41.5 29.9 33.8 39.4 37.1 38.6

4 45.6 39.9 35.4 33.3 45.4 42.2 52.1 37.2 41.8 51.7 48.3 49.8

5 56.4 46.9 42.6 40.4 52.6 49.8 58.6 44.2 49.7 63.9 59.8 57.4

6 67.2 54.6 49.6 47.1 59.9 57.2 64.9 51.4 57.8 74.3 67.4 64.8

7 76.1 61.1 55.8 53.2 68.1 64.3 71.7 58.7 64.7 82.7 81.9 74.4

8 79.2 66.6 62.8 60.2 76.5 71.4 79.2 65.3 73.7 86.3 88.3 81.1

9 83.6 74.9 86.4 69.7 85.2 80.6 83.8 77.1 82.4 92.6 95.3 88.7

Figure.5.Cumulative % Drug Releae Profile of F1-F12.

Table.5. In-Vitro buoyancy

Formulations In vitro buoyancy(hrs) Formulations In vitro buoyancy(hrs)

F1 - F7 -

F2 - F8 -

F3 - F9 -

F4 - F10 08

F5 - F11 09

F6 - F12 <6

0

20

40

60

80

100

120

0 5 10

Cu

mu

lati

ve

% d

rug

rele

ase

Time(hrs)

Cumulative % drug release of

F1-F12

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11



Figure.6.Ornidazole Drug Releae Profile of F11 Showing

Zero Order Kinetics

Figure.7.Ornidazole Drug Releae Profile of F11 Showing First

Order Kinetics

CONCLUSSION

The present study was aimed at developing an oral

floating system for Ornidazole using combination of

polymers like HPMCK4 and Xanthan gum and Eudragit

the floating tablets were prepared by using wet granulation

technique. Granules were evaluated for Preformulation

studies that are Angle of repose, Carr’s index and

Hausner’s ratio This indicate good flow property of the

granules for compression. The floating tablets of

Ornidazole were evaluated for physicochemical

characteristics like thickness, hardness, weight variation,

friability, floating lag time and swelling index. The in-

vitro buoyancy studies, in-vitro drug release studies,

results were found that the optimized formulation F11

(9hrs) has better in vitro release profiles due to the

presence of low density swellable polymers in the

formulation and these polymers were also control the drug

release rate for long period of time .

REFERENCES

Bardonn P.L, Faivre, Pugh, Piffaretti Falson,

Gastroretentive dosage forms: Overview and special case

of Helicobacter pylori, J.Control. Re, 111, 2006, 1-18.

Shweta Arora, Javed Ali, Alka Ahuja, Roop K. Khar

and Sanjula Baboota, Floating Drug Delivery Systems: A

Review, AAPS Pharm Sci Tech, 6, 2005, 372-390.

Streubel A, Siepmann J, Bodmeier R, Drug delivery to the

upper small intestine window using Gastroretentive

technologies, Curr Opin Pharmacol, 6, 2006, 501-508.

Sasak.K, Nageswara Rao, Manavalan.R, and Rama Rao.P,

Development and in vitro Evaluation of an oral floating

matrix tablet formultion of ciprofloxacin, Indian J. Pharm.

Sci, 66, 2004, 313-316

Streubel A, Siepmann J, Floating matrix tablets based on

low density foam powder: effects of formulation and

processing parameters on drug release, European Journal

of Pharmaceutical Sciences, 18, 2003, 37–45.

Ramesh R, Putheti, Mahesh C, Patil, Pharmaceutical

Formulation and development of Floating and Swellable

sustained drug delivery systems: a review. e-Journal of

Science & Technology, 4 (2), 2009, 1-12.

Mayavanshi S.S, Gajjar, Floating drug delivery systems to

increase gastric retention of drugs: A Review. Research J.

Pharm. and Tech, 1(4), 2008, 345-348.

Stithit .S, Chen .W, Price J. C, Development and

characterization buoyant theophylline microspheres with

near zero order release kinetics, Microencapsulation, 15,

1988, 725-737.

Ramesh Bomma, Rongala Appala, Swamy Naidu,

Development and evaluation of gastro retentive

norfloxacin floating tablets, Acta Pharm, 59, 2009, 211–

221.

Indian Pharmacopoeia, The Controller of Publications:

Delhi, 2, 1996, 734-36.

Talukder and Fassihi R, Gastroretentive Delivery Systems

A Mini Review. Drug Development and Industrial

Pharmacy, 30 (10), 2004, 1019–1028.

Fell J. T, Whitehead L, Collet H, Prolonged

Gastricretention using floating dosage forms, Pharm

Technol, 2000; 24(3), 2000, 82-90.

Sauzet C. Claeys-Bruno M, An innovative floating gastro

retentive dosage system: Formulation and in vitro

evaluation, International Journal of Pharmaceutics, 378,

2009, 23–29.

y = 10.361x + 5.9273

R² = 0.9913

0

20

40

60

80

100

120

0 1 2 3 4 5 6 7 8 9 10

% C

um

ula

tive

Dru

g

Rel

ease

Time (hr)

Zero Order

y = -83.042x + 92.951

R² = 0.9174

0

10

20

30

40

50

60

70

80

90

100

0 0.2 0.4 0.6 0.8 1 1.2 % D

rug R

elea

se

Rem

ain

ing

Log Time

First Order

Siva et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND EVALUATION OF FENOFIBRATE TABLETS PREPARED BY

EMPLOYING BIOAVAILABILITY ENHANCEMENT TECHNIQUE Siva kothapally, Pragati Kumar Bada, Harish G

Nimra College of Pharmacy, Jupudi, Ibrahimpatnam, Vijaywada, India

*Corresponding author:[email protected]

ABSTRACT

Developing novel methods to increase the bioavailability of drugs that inherently have poor aqueous

solubility is a great challenge to solid dosage form formulators. Although numerous methods are available to

improve the solubility and/or dissolution rate of poorly soluble drugs, the most promising method for promoting

dissolution is the formation of solid dispersions. The aim of the present study was to prepare and evaluate

Fenofibrate tablets by using a combined approach of Solid dispersion technique and direct compression with

super disintegrant. The tablets were evaluated for weight variation, friability, hardness, in vitro disintegration

time, in vitro drug release profile .And there is no interactions find in FTIR studies. The obtained results showed

that low weight variation. Good hardness, acceptable friability. All the formulation disintegrated within 10-60

seconds and the drug release shows 98.8%. The formulation containing Povidone and superdisintegrants showed

better performance in disintegration and drug release profile.

Key words: Fenofibrate, Bioavailability, Solid dispersion

INTRODUCTION

The proper design and formulation of a dosage

form requires consideration of the physical, chemical and

biological characteristics of all the drug substances and

pharmaceutical ingredients to be used in fabricating the

product. An important physicochemical property of a drug

substance is solubility, especially aqueous system

solubility. A drug must possess some aqueous solubility

for therapeutic efficacy. From an economical point of

view low oral bioavailability results in wasting of a large

portion of an oral dose and adds to the cost of drug

therapy especially when the drug is an expensive one.

Although most of the drugs have encouraging

experimental data obtained in vitro, the in vivo results

have been disappointing. The attributes include

Poor absorption, rapid degradation, and lamination

(peptides and protein) resulting in insufficient

concentration,

Drug distribution to other tissues with high drug toxicities

(anticancer drugs),

Poor solubility of drugs, and

Fluctuations in plasma levels owing to unpredictable

bioavailability.

Solubility is defined in quantitative terms as the

concentration of solute in a saturated solution at a certain

temperature, and in a qualitative way, it can be defined as

the spontaneous interaction of two or more substances to

form a homogeneous molecular dispersion. Statements of

solubilities are indicated by a descriptive phrase and are

intended to apply at 20-300C. The following table

indicates the meaning of the terms used in statements of

approximate solubilities (Brahmankar, 1999).


Materials:Fenofibrate was obtained as a gift sample from

Micro labs, Bangalore, Povidone, β- Cyclodextrin,

Sodium starch glycolate was obtained from Signet

Chemical Corp, Cross cormellose sodium, Manitol,

Aspartame, Microcrystalline cellulose, Magnesium

Stearate and Talc were obtained from Nice Chemicals

Laboratory, Cochin.

Methods:

Drug - Polymer Compatibility Studies By FTIR:

Fourier-transform infrared (FT-IR) spectra were obtained

by using an FT-IR spectrometer-430 (Perkin Elmer FTIR

spectrophotometer) by potassium bromide (KBr) pellet

method. The samples(Fenofibrate and β-Cyclodextrin,

Povidone combination)were previously ground and mixed

thoroughly with potassium bromide, an infrared

transparent matrix, at 1:5 (Sample: KBr) ratio,

respectively. The KBr discs were prepared by

compressing the powders at a pressure of 5 tons for 5

minutes in a hydraulic press. Scans were obtained at a

resolution of 4 cm-1

, from 4000 to 450 cm-1

Preparation of Fenofibrate tablets by solid dispersion

method

Preparation of solid dispersions by solvent evaporation

(1:1) Fenofibrate: β-cyclodextrine and Povidone K30: The SD of Fenofibrate with β-cyclodextrine and povidone

K 30 simultaneouslyin 1:1ratio was prepared by solvent

evaporation technique, the drug is weighed of 3gm it was

dissolved in the chloroform of 20 ml in a beaker of 50 ml

and kept a side then the 3gmof β-cyclodextrine/ povidone

was weighedand dissolved in 20 ml methanol and stirred

well in the 50 ml beaker. Then drug solution is poured into

the china dish then the polymer solution was added to it



and stirred well. Then the mixed solution was kept in the

incubator for drying and avoids contamination for 3 to 4

days after drying the dried particles were scraped out from

the china dish and weighed and stored (Tejas patel, 2010).

Preparation of Fenofibrate tablets by direct

compression (Usui, 1998): The amount of complex

equivalent to 40mg of drug were taken and then mixed

with directly compressible diluents and superdisintegrants

in a plastic container. Mg. stearate and talc were passed

through sieve no.60, mixed and blended with the initial

mixture in the plastic container followed by compression

of the blend. Compression was performed on a Cadmach

16 station tablet compression machine using 8mm

punches.


Post compression properties

Thickness: The Fenofibrate tablets showed thickness in

the range of 3.1 – 3.8mm and no significance difference in

the weight of individual formulations. From the average

value was observed and variations within the limits.

Hardness: The difference in the hardness did not affect

the release of the drug from hydrophilic matrices which is

2.8–3.7 kg/cm2.

Weight variation: The weight variation was found in all

designed formulations in the range 343 to 354 mg. The

mean weight variation test results are tabulated in Table

no 8. All the tablets passed weight variation test as the

average percentage weight variation was within 7.5% i.e.

in the pharmacopoeia limits.

Friability: Tablet strength was tested by Roche

Friabilator. The friability of all formulations in limits is

below 1%. The friability of all formulations was observed

within the range of 0.45±0.1 - 0.61±0.2. The values were

given in table no 8.

Wetting time: Wetting time is closely related to the inner

structure of the tablet. The results of wetting time are

shown in Table no 8. The wetting time of Fenofibrate

tablets prepared by solid dispersion method were found to

be in the range of 12.62 to 86.75 sec.

Compatibility Studies: IR spectra of Fenofibrate pure

drug, FP1 Formulation illustrated in Table.5, Figure.2.

Characteristic peaks of Fenofibrate at 2213.46 cm-1

(O-H

stretching), 3533.59 cm-1

(O-H stretching), 2944.61 cm-1

(O-H stretching), 1518.15 cm-1

(C=O stretching) 1592.36

cm-1

(N-H bending), 1542.03 cm-1

(N-H bending), 1382.93

cm-1

(O-H bending) were observed. For the determine the

drug-compatability studies. The drug and drug-excipients

are kept in Desicator for one month,after one month it was

observed that,there is no colour change and Degradation

of compound, this study were conclud there is no

compatability between drug and excipient.the results were

shown in the Table no:6.

Formulations FB1, FB2, FB3, FB4 were made by

using increasing concentrations of β- Cyclodextrin with

40mg of Fenofibrate. The details of the formula were

given in Table no:1 .The formula mixtures were evaluated

for tests such as bulk density, tapped density, angle of

repose,cars index, hausners ratio. The results were shown

in the Table.7. The compressed Tablets were tested for

weight variation, thickness, hardness, friability, and

Wetting time, the results were shown in the Table no: 8. In

vitro disintegration time study was observed for the

formulation FB1,FB2,FB3,FB4 it was found to be in the

range of 31.67-43.82 sec The results were shown in

Table.9. Drug release profiles of formulations FB1, FB2,

FB3, FB4 were conducted for about 35min. The results

were shown in Table.10.

Formulations FP1, FP2, FP3, FP4 were made by

using increasing concentrations of Povidone with 40mg of

Fenofibrate. The details of the formulae were given in

Table no:2 The formula mixtures were evaluated for tests

such as bulk density, tapped density, angle of repose,cars

index, hausners ratio. The results were shown in the Table

no:7. The compressed Tablets were tested for weight

variation, thickness, hardness, friability, and wetting time

of dosage units, the results were shown in the Table.8. In

vitro disintegration time study was observed for the

formulation FP1,FP2,FP3,FP4 it was found to be in the

range of 22.63-35.65 sec The results were shown in

Table.9. Drug release profiles of formulations FP1, FP2,

FP3, FP4 were conducted for about 35min. The results

were shown in Table.10.

Based on mathematical models, the

formulation FP1, the regresion(r=0.99) value was found to

be 0.99 fitted into first order release kinetics , the results

were shown in the Table no:11.The slope value for first

order Kinetics of FP1 formulation was found to be with in

0.45-0.99 hence it is folllows non fickens diffussion.

The comparative in-vitro dissolution study of best

formulation (FP1) shows maximum drug release 98.83%

of Fenofibrate at the end of 35min and the marketed

product conventional tablet (FENOGLIDE) shows

maximum drug release 96.51% of at the end of 45min.The

values were given in Table.12. The represented graph

presented in Fig.4.

Drug-excipients compatibility studies by observing

physical appearance: The drug and drug-excipients are

kept in Desicatorn for one month, after one month it was

observed that, there is no colour change and Degradable of

compound, this study were conclude there is no

compatibility between drug and excipient.



Preformulation studies: The flow properties and other

derived properties evaluated for all the 8 formulations

were proved to be within limits showing good flow

properties. The physical properties like bulk density,

tapped density, angle of repose, compressibility index, and

Hausner’s ratio were calculated and tabulated in Table.7.

In-vitro disintegration time: The time taken to undergo

complete disintegration. Rapid disintegration within

several minutes was observed in all the formulations. The

in-vitro disintegration time of Fenofibrate fast dissolving

tablets prepared by Solid dispersion method were found to

be in the range of 22.63 to 43.82seconds.

In-vitro drug release studies: In-vitro drug release

studies were performed for all the prepared formulation by

using Phosphate buffer (pH 6.4) as dissolution medium

and measuring drug concentration UV- Spectrophoto

metrically at 287 nm.

Table.1.Preparation of solid dispersion of Fenofibrate with β-cyclodextrine

Formulation Drug and Polymer Drug to polymer ratio Methods

FB1 Fenofibrate(3gm)

and

β-cyclodextrine

1:1 Solvent

evaporation FB2 1:2

FB3 1:3

FB4 1:4

Table.2.Preparation of solid dispersion of Fenofibrate with povidone

Formulation Drug and Polymer Drug to polymer ratio Method

FP1 Fenofibrate(2gm)

and

Povidone

1:1 Solvent

evaporation FP2 1:2

FP3 1:3

FP4 1:4

Table.3.Composition of tablets contain Fenofibrate with β-cyclodextrine

Ingedients FB1(1:1) FB2(1:2) FB3(1:3) FB4(1:4)

Amount of complex equivalent

to 40 mg of Fenofibrate

80mg 120mg 160mg 200mg

Croscarmellose sodium 20 20 20 20

Sodium starch glycolate 15 15 15 15

MCC 60 60 60 60

Mannitol 155 115 75 35

Talc 10 10 10 10

Mg stearate 10 10 10 10

Total 350mg 350mg 350mg 350mg

Table.4.Composition of tablets contain Fenofibrate with povidone

Ingedients FP1(1:1) FP2(1:2) FP3(1:3) FP4(1:4)

Amount of complex equivalent

to 40 mg of Fenofibrate

80mg 120mg 160mg 200mg

Croscarmellose sodium 20 20 20 20

Sodium starch glycolate 15 15 15 15

MCC 60 60 60 60

DC-Mannitol 155 115 75 35

Talc 10 10 10 10

Mg stearate 10 10 10 10

Total 350mg 350mg 350mg 350mg



Figure.1.FTIR Study of Fenofibrate (Pure Drug) Figure.2.FTIR Study of Fenofibrate and povidone(FP)

Figure.3. FTIR Study of Fenofibrate and β-cyclodextrine(FB)

Table.5.FTIR Spectra Data for Fenofibrate

Frequency cm-1

Group Assigned

1763 O – H Stretching

2130 C – H Stretching

1647 C =C Stretching

1465 CH3 Bending

1320 C =O Stretching, OH Bending

946 C – O – C Ring Stretching

Table.6.Drug-Excipients compatibility studies

Excipient Ratio Description

initial After one month

Fenofibrate 1:0 light yellow powder No change

Fenofibrate + β-Cyclodextrin 1:1 White powder No change

Fenofibrate + Povidone 1:1 light yellow powder No change

Fenofibrate +S.S.G 1:1 light yellow powder No change

Fenofibrate + C.C.S 1:1 White to light yellow powder No change

Fenofibrate +Manitol 1:1 White to light yellow powder No change

Fenofibrate + MCC 1: 1 White to light yellow powder No change

Fenofibrate + MgStearate 1:1 White to light yellow powder No change



Table.7.Results for derived and flow properties

Formulation

Code

Derived properties Flow properties

Bulk density

(mean±SD) g/ml

Bulk density

(mean±SD) g/ml

Angle of repose

(mean±SD)

Carr’s index

(mean±SD)

Hausner’s ratio

(mean±SD)

FB1 0.51±0.002 0.62±0.01 23.32±1.52 17.18±1.0 1.24±0.02

FB2 0.53±0.005 0.64± 0.01 27.08±1.20 16.12±1.52 1.25±0.04

FB3 0.54±0.003 0.67±0.02 30.21±1.70 16.66±1.20 1.24±0.03

FB4 0.56±0.008 0.63± 0.03 30.11±0.88 15.62± 1.31 1.17±0.03

FP1 0.55± 0.007 0.61± 0.02 28.43±1.46 19.04± 1.13 1.11±0.06

FP2 0.52±0.009 0.63±0.02 31.38±1.31 18.03± 0.93 1.14±0.07

FP3 0.53±0.002 0.65± 0.31 36.03±1.40 15.87± 1.42 1.26±0.11

FP4 0.52±0.005 0.67± 0.02 25.10± 1.13 16.92± 1.10 1.16±0.09

Table.9. In-vitro disintegration time study of FB1 – FP4

Formulations In-vitro disintegration time(sec)

FB1 31.67

FB2 33.43

FB3 41.20

FB4 43.82

FP1 22.63

FP2 26.87

FP3 29.20

FP4 35.65

Table.10.In-vitro cumulative% drug release study of formulation FB1- FP4

Time

(min)

Cumulative % Drug Release

FB1 FB2 FB3 FB4 FP1 FP2 FP3 FP4

5 26.23 23.67 26.39 23.91 25.92 26.92 24.43 23.82

10 45.43 42.82 46.37 43.21 48.32 47.92 45.91 43.01

15 67.56 69.73 66.49 64.32 68.56 67.34 65.93 63.31

20 85.82 82.91 85.82 82.03 81.32 84.21 77.42 72.10

25 91.71 87.52 90.45 86.21 89.68 88.43 84.32 80.34

30 94.71 92.38 93.89 89.01 94.73 93.42 90.02 89.34

35 96.52 95.36 95.62 93.42 98.83 97.32 95.12 94.81

Table.11.Kinetics of drug release studies of FB1-FP4

Formula Zero order First order

K0

Ro2 K

1 R12

FB1 9.015 0.9357 0.696 0.846

FB2 6.207 0.871 0.464 0.959

FB3 6.897 0.777 0.436 0.976

FB4 6.134 0.944 0.159 0.99

FP1 9.21 0.91 0.92 0.99

FP2 12.59 0.785 0.572 0.946

FP3 11.48 0.934 0.591 0.902

FP4 5.473 0.885 0.152 0.988



Table.12.Comparision of drug release study of marketed product and formulation FP1

Time(min) Cumulative % drug release of FP1 Cumulative % drug release of

Marketed product

0 0 0

5 25.92 20.32

10 48.32 36.72

15 68.56 44.31

20 81.32 56.61

25 89.68 67.31

30 94.73 79.38

35 98.83 83.91

40 91.63

45 96.51

Figure.4.Comparision of drug release study of marketed product and formulation FP1

CONCLUSION

All the formulations of solid dispersions were

successfully prepared and Fenofibrate tablets are prepared

and evaluated for solubility and dissolution rate. Each

examined carrier was effective, even though at different

degrees, in improving drug dissolution properties. The

saturation solubility of drug was found to be more in the

solid dispersions as compared to the phase solubility

achieved in the presence of hydrophilic carriers in the

dissolution media. This may be due to drug carrier

interaction or change in property of drug in the solid

dispersion formulations.Highest solubilizing power of

Povidone towards Fenofibrate was shown by dissolution

studies. From FTIR spectroscopy studies, it was

concluded that there was no defined chemical interactions

between FenofibrateandPovidone. It can provide a

promising way to enhance its solubility and dissolution

rate.

Based on mathematical models, it was concluded t

hat formulation FP1,the regresion(r=0.99) value was found

to be 0.99 fitted into first order release kinetics.The slope

value for first order Kinetics of FP1 formulation was

found to be with in 0.45-0.99 hence it is folllows non

fickens diffussion.Experience with solid dispersions

indicates that this is a very fruitful approach to improve

the release rate and oral bioavailability of poorly soluble

drugs. The most frequent concerns with solid dispersions

have been the ability to scale-up the manufacturing

method, the physical stability of the dispersion and the

amount of carrier needed to facilitate the required increase

in the release rate.

References

Ammar. H.O, Salama. H.A, Ghorab. M, and Mahmoud.

A.A, Formulation and biological evaluation of

glimepiride-cyclodextrin-polymer systems, International

Journal of Pharmaceutics, 309(1-2), 2006, 129-138.

Anguiano-Igea. S, Otero-Espinar. F.J, Vila-Jato. J.L, and

Blanco-Mendez, J. Improvement of Clofibrate dissolution

by complexation with cyclodextrin, International Journal

of Pharmaceutics, 135, 1996, 161-166.

Brahmankar. D.M, and Jaiswal. S.B, Absorption of Drugs

In: Biopharmaceutics and Pharmacokinetics A treatise, 1st

(edn), Vallabhprakashan, 1999, 20-27.

Chang. R.K, and Shojaei. A.H. The effect of

hydroxypropyl β- cyclodextrin on drug solubility in water-

0

20

40

60

80

100

120

0 20 40 60

%C

um

ula

tive

Am

ou

nt

of

Dru

g R

ele

ase

Time(min)

FP1



propylene glycol mixtures, Drug development and

industrial pharmacy, 30(3), 2004, 297–302.

Chauhan. B, Shimpi. S, and Paradkar. A. Preparation and

characterization of Etoricoxib solid dispersions using lipid

carriers by spray drying technique, AAPS PharmSciTech,

6(3), 2005, Article 50.

Usui. F, Maeda. K, Kusai. A, Ikeda. M, Nishimura. K,

Yamamoto. K, Dissolution improvement of RS-8359 by

the solid dispersion prepared by the solvent method. Int.

J.Pharm, 170, 1998, 247-256.

Cirri. M, Mura. P, Rabasco. A.M, Gine´s. J.M, Moyano.

J.R, and Go`nzalez-Rodriguez. M.L, Characterization of

Ibuproxam binary and ternary dispersions with

hydrophilic carriers, Drug development and industrial

pharmacy, 30(1), 2004, 65–74.

Craig. D.Q.M, The mechanisms of drug release from solid

dispersions in water-soluble polymers, International

Journal of Pharmaceutics, 231(2), 2002, 131-144.

Dressman. J.B, Kunath. K and Vogt. M, Dissolution

enhancement of nevirapine by micronization, cogrinding

and spray-drying: Comparison with commercial

preparations, European Journal of Pharmaceutics and

Biopharmaceutics, 68, 2008, 283-288.

El-Zein. H, Riad. L, and El-Bary. A.A. Enhancement of

carbamazepine dissolution: in vitro and in vivo evaluation,

International Journal of Pharmaceutics, 168(2), 1998, 209-

220.

Tejas patel, Sunil makwana, Enhancement of dissolution

of fenofibrate by solid dispersion techniqyue, int.

j.res.pharm.sci, 1(2), 2010, 127-132.

Venkateswarulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND E VALUATION OF FAMOTIDINE FAST DISSOLVING

TABLETS BY DIRECT COMPRESSION METHOD B.Venkateswarlu

*, B.Pragati Kumar, Debjit Bowmik


*Corresponding author:Email:[email protected]

ABSTRACT

Fast dissolving tablets were highly accepted drug delivery system. Fast dissolving tablets were dissolved/

disintegrated in the mouth within a matter of few seconds without need of water. The aim of the present study was

to prepare and evaluate fast dissolving tablets of Famotidine using a combined approach of complexing agent and

super disintegrant.Fast dissolving tablets were prepared by direct compression technique .The prepared tablets

were dried under oven for evaporate the complexing agent and drug release. The tablets were evaluated for weight

variation, friability, hardness, in vitro disintegration time, in vitro drug release profile .And there is no

interactions find in Ftir studies .The obtained results showed that weight variation. Good hardness, acceptable

friability. All the formulation disintegrated within 10-60 secondsand the drug release shows 99.3%. The

formulation containing complexing agent and superdisintegrants showed better performance in disintegration and

drug release profile.

KEY WORDS: Famotidine, Fast dissolving Tablet, Cross carmalose sodium, Dissolution Time

INTRODUCTION

Solid dosage forms are widely prevalent due to

their age-old application. Especially, oral solid

formulations hold a high potential as they serve to be most

convenient for the administration of drugs. These have

been developed into a wide range of formulations from

conventional dosage forms for immediate release of the

drug to controlled release dosage forms for the constant

rate of drug release. Oral route is the most convenient and

commonly used method of drug delivery. More than 50%

of drug delivery systems available in the market are oral

drug delivery systems. They offer convenience and ease of

administration, greater flexibility in dosage form design

and ease of production and low cost. These dosage forms

are designed either for improving the physical and

mechanical properties of materials during manufacture

and/or for providing a desired drug delivery system. The

tablets and capsules can be made directly from powders or

from granules and pellets, or from film coated multiple

units

(Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Fast

dissolving tablets: A novel drug delivery system, Phrma.

Times, 2003, 35, 3-10.)


Materials: Famotidine,Indian Drugs ,HYD.Plasidone,β-

Cyclodextrin,Sodium starch glycolate,Cross carmalose

sodium,Mannitol, Signet chemicals ,Mumbai.Aspartame

Lobachemicl Mumbai.Cardamom flavour,Microcrystalline

cellulose Nice Chemicls Laboratory,Cochin.

Preparation of Solid Dispersions by solvent

evaporation (1:1) Famotidine:β-cyclodextrin: The Solid

Dispersion of Famotidine with β-cyclodextrin of ratio 1:1

was prepared by solvent evaporation technique, the drug is

weighed of 2 gm it was dissolved in the chloroform of 20

ml in a beaker of 50 ml and kept a side then the 2 gm β-

cyclodextrin is weighed it was dissolved in 20 ml

methanol and stirred well in the 50 ml beaker. Then drug

solution is poured into the china dish then the polymer

solution was added to it and stirred well. Then the mixed

solution was kept in theincubator for drying and avoids

contamination for 3 to 4 days after drying the dried

particles were scraped out from the china dish and

weighed and stored.

Total 4 Formulations (1:1, 1:2, 1:3, 1:4) were prepared

with Famotidine and β-cyclodextrin.

Preparation of fast dissolving tablets by direct

compression: The amount of complex equivalent to

20mg of drug were taken and then mixed with directly

compressible diluents and superdisintegrants in a plastic

container. Mg.stearate and talc were passed through

sieve No.60, mixed and blended with the initial mixture

in the plastic container followed by compression of the

blend. Compression was performed on a 16 station tablet

compression machine using 8mm punches.


Preformulation studies: The flow properties and other

derived properties evaluated for all the 8 formulations

were proved to be within limits showing good flow

properties. The physical properties like bulk density,

tapped density, angle of repose, compressibility index, and

Hausner’s ratio were calculated and tabulated in table

no:3.The values were found to be within the range of

0.51±0.002 to 0.53±0.005,0.64±0.01 to

0.65±0.02,23.32º±1.52 to 25.10±1.13º,17.18±1.0 to

16.92±1.10,1.22±0.02 to 1.26±0.09



Physical properties: The formulated batches were

evaluated for physicochemical parameters like hardness,

thickness, weight variation, friability, content uniformitity,

Wetting Time ,Water absorption ratio. The values

obtained for that studies are tabulated in Table no 4. From

the compatibility studies for drug and excipients it was

observed that there was no interaction between drug and

excipients.

In-vitro drug release studies: In-vitro drug release

studies were performed for all the prepared formulation by

using Phosphate buffer (pH 6.2) as dissolution medium

and measuring drug concentration UV- Spectrophoto

metrically at 210 nm. The comparative in vitro dissolution

study of best formulation (FC1 AndFP1) and the marketed

product fast dissolving tablet (AMFOMAX), shows

maximum drug release 98.43% at the end of 45 min And

FP1 Showing 99.73% of Famotidine at the end of

30min.The values were given in table no:5

Kinetics of Drug Release: Based on mathematical models, it was concluded that for

mulation FP1,the regression(r=0.99) value was found to






Table.1. Composition of fast dissolving tablets contains Famotidine with β-cyclodextrin

Ingedients FC1(1:1) FC2(1:2) FC3(1:3) FC4(1:4) Amount of complex equivalent

to 20 mg of Famotidine 40mg 60mg 80mg 100mg

Croscarmellose sodium 15 15 15 15 Sodium starch glycolate 15 15 15 15 MCC (Avicel PH-102) 20 20 20 20

DC-Mannitol 140 120 1000 80 Talc 10 10 10 10

Mg stearate 10 10 10 10 Total 250mg 250mg 250mg 250mg

Table.2.Composition of Fast dissolving tablets contain Famotidine with PlasdoneK-32

Ingedients FP1(1:1) FP2(1:2) FP3(1:3) FP4(1:4) Amount of complex equivalent

to 20 mg of Famotidine 40mg 60mg 80mg 100mg

Croscarmellose sodium 15 15 15 15 Sodium starch glycolate 15 15 15 15 MCC (Avicel PH-102) 20 20 20 20

DC-Mannitol 140 120 1000 80 Talc 10 10 10 10

Mg stearate 10 10 10 10 Total 250mg 250mg 250mg 250mg

Table.3.Results for derived and flow properties

Formulation

code

DERIVED PROPERTIES FLOW PROPERTIES

Bulk density

(mean±SD) g/ml Tapped density (mean±SD) g\ml

Angle of repose (mean±SD)

Carr’s index (mean±SD)

Hausner’s ratio (mean±SD)

FC1 0.51±0.002 0.64± 0.01 23.32± 1.52 17.18± 1.0 1.22±0.02 FC2 0.52±0.005 0.62± 0.01 27.08± 1.20 16.12± 1.52 1.15±0.04 FC3 0.58±0.003 0.66±0.02 30.21± 1.70 16.66± 1.20 1.24±0.03 FC4 0.53±0.008 0.64± 0.03 30.11± 0.88 15.62±1.31 1.17±0.03 FP1 0.57± 0.007 0.63± 0.02 28.43±1.46 19.04± 1.13 1.21±0.06 FP2 0.54±0.009 0.61± 0.02 31.38± 1.31 18.03± 0.93 1.24±0.07 FP3 0.51±0.002 0.63± 0.31 36.03± 1.40 15.87± 1.42 1.16±0.11 FP4 0.53±0.005 0.65± 0.02 25.10±1.13 16.92±1.10 1.26±0.09



Table.4.Physico chemical parameters of all formulations

Formulation code

Thickness (mm)

Hardness (Kg/cm

2) Friability

(%) Weight

variation(mg) Wetting

time (sec) Water

absorption ratio FC1 3.2 2.8 0.52 248 76.12 75.82 FC2 3.4 2.9 0.58 247 75.89 77.64 FC3 3.4 3.1 0.54 254 86.72 64.02 FC4 3.4 3.7 0.56 246 82.54 67.45 FP1 3.5 2.6 0.61 247 14.32 59.12 FP2 3.8 2.9 0.58 253 13.87 58.45 FP3 3.7 3.1 0.45 248 13.48 57.32 FP4 3.2 3.4 0.52 243 12.62 54.48

Table.5. In-Vitro Cumulative % drug release study of formulation FC1- FP4

Time (min)

Cumulative % Drug Release FC1 FC2 FC3 FC4 FP1 FP2 FP3 FP4

0 0 0 0 0 0 0 0 0 5 26.23 23.67 26.39 23.91 25.92 26.92 24.43 23.82 10 45.43 42.82 46.37 43.21 48.32 47.92 45.91 43.01 15 67.56 69.73 66.49 64.32 68.56 67.34 65.93 63.31 20 85.82 82.91 85.82 82.03 86.32 84.21 82.42 82.10 25 93.71 92.52 93.45 90.21 92.68 91.43 91.32 90.34 30 97.71 96.38 95.89 95.01 99.73 98.42 98.02 97.34

Figure.1.FTIR spectra of Famotidine Figure.2.FTIR Spectra of Drug +β cyclodextrin

Figure.3.FTIR spectra of β-Cyclodextrin Figure.4.FTIR Spectra for Formulation FC1



Figure.5.FTIR Spectra For Formulation FP1

Figure.6.In-vitro Cumulative %Drug release study of Formulation FC1-FP4

Figure.7.Famotidine Drug Release Profile of FC1showing Zero Order Kinetics

CONCLUSION

Fast dissolving tablets dissolves in the saliva

within a few seconds .among the eight formulations

Tablets containing Palasadone agents shows better results

than β-Cyclodextrinformulation. All formulated batches

showed disintegration with in 45 sec.Fast dissolving

tablets by and superdisintegrent solved the problems

encountered in the administration of drug by oral route.

0

20

40

60

80

100

120

0 10 20 30 40

Cu

mu

lati

ve %

Dru

g R

ele

ase

Time(min)

Cumulative%Drug Release of FC1-FP4

FC1

FC2

FC3

FC4

FP1

FP2

FP3

FP4

y = 3.3622x + 9.7854

R² = 0.9522

0

20

40

60

80

100

120

0 5 10 15 20 25 30 35 % C

um

ula

tive

Dru

g

Rel

ease

Time (min)

Zero Order



The results showed low weight variation .good hardness

and acceptable friability. The release profile relieved that

optimized formulation showed greater released than the

marketed formulation.

REFERENCES

Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Fast


Times, 35, 2003, 3-10.

Lailla, J.K., Sharma, A.H., Freeze-drying and its

applications, Indian Drugs, 31, 1993, 503-513.

Seager, H., Drug delivery products and zydis fast

dissolving dosage form, J. Pharm. Phamacol, 50, 1998,

375-382.

Kuccherkar, B.S., Badhan, A.C., Mahajan, H.S., Mouth


Times, 35, 2003, 3-10.

Lachmann, L., Liebermann, H.A., Kiang, J.L., The theory

and practice of Industrial Pharmacy, 3rd

Ed., Varghese

Publishing House, Bombay, 1998, 430-440.

Kaushik, D, Dureja, H, Saini, T. R., Mouth Dissolving

Tablets: A review. Indian Drugs, 41(4), 2004, 187-193.

Bhaskaran, S., Narmada, G.V., Orally disintegrating

tablets, Indian Pharmacist, 2002, 1(2), 9-12.

Mishra B., Panigrahi D., Mouth dissolving tablets: an

overview of preparation techniques, evaluation and

patented technologies, J. Pham. Res., 2005, 4(3), 33.

Shah, U., Augsburger, L., Evaluation of the functional

equivance of crospovidone NF from different sources:

standard performance test, Pharmaceutical development

and technology, 6, 2001, 419-430.

Swarbrick, J., Boylan, J., Encyclopedia of Pharmaceutical

technology, 2nd

Ed., Marcel Dekker, NY, 2002, 2623-

2638.

Peer Basha et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND EVALUATION OF MATRIX FLOATING TABLETS OF

OFLOXACIN AND TINIDAZOLE COMBINATION Syed Peer Basha

*, Pragati Kumar B, Duraivel S, Abeda Aqther

Nimra College of Pharmacy, Vijyawada, India


ABSTRACT Floating matrix tablets of Ofloxacin and tinidazole were developed to prolong gastric residence time and

increase drug absorption further increasing the bioavailability. Ofloxacin chosen as a choice of drug because it is

well absorbed from stomach and Tinidazole is well absorbed in stomach and upper part of small intestine. Pre-

formulation studies were carried out to optimize the required quantity for HPMC (K4M). Xanthan gum (5%),

carbopol 934P (10%) was used in Fourier transform Infrared spectroscopy confirmed that absence of any

drug/polymers/excipients interactions. Formulations were prepared using HPMC K50, HPMC K100, HPMC K4,

Xanthan gum with carbopol 934P at Different Ratios. F12 Formulations showed in-vitro buoyancy 11 hrs. The

concentration of HPMC K4 was increased to control the release of drug from the dosage form for F9 to F12

batches; the concentration was increased for Xanthan gum to increase the binding nature. The cumulative %

drug release of F12 formulation was found to be Ofloxacin (95.8%), Tinidazole (92.8%) at the end of 11th hr. The

formulation containing HPMC k4m and Xanthan gum (1:1) showed better results compared to other formulated

batches. Further Stability studies and IVIVC correlation studies can be performed to ensure the efficacy of the

formulated floating tablets

KEY WORDS: Ofloxacin, Tinidazole, HPMC, Floating lag time, swelling index, in-vitro buoyancy.

INTRODUCTION

Oral controlled release dosage forms have been

developed over the past three decades due to their

considerable therapeutic advantages such as ease of

administration, patient compliance and flexibility in

formulation. The relatively short gastric emptying time in

humans this normally averages 2-3 hrs. Through the major

absorption zone, i.e., stomach and upper part of the

intestine can result in incomplete drug release from the

drug delivery system leading to reduced efficacy of the

administered dose. After oral administration, such a

dosage forms would be retained in the stomach and

release the drug there in a controlled and prolonged

manner, so that the drug could be supplied continuously to

its absorption sites in the upper gastrointestinal tract.

Gastro retentive dosage form can remain in the gastric

region for several hours and hence significantly prolong

the gastric residence time of drugs. Prolonged gastric

retention improves bioavailability, reduces drug waste,

and improves solubility of drugs that are less soluble in a

high pH environment. It is also suitable for local drug

delivery to the stomach and proximal small intestines.

Gastroretention helps to provide better availability of new

products with suitable therapeutic activity and substantial

benefits for patients (Kamalakanan, 2012) (Kulkarni,

2009).

MARERIALS AND METHODS

Marerials: Tinidazole, Ofloxacin, Indian Drugs, HYD.

HPMC K4, Qualikens, Vadodara. Xanthan gum, SD Fine

Chem.Ltd. Mumbai, Sodium bicarbonate, Merck,

Mumbai, Citric acid Finar reagents, Ahmedabad.

Preparation of floating matrix tablets of Ofloxacin and

Tinidazole. Tablets were prepared by using wet

granulation technique. Ofloxacin and Tinidazole was

mixed with required amount of polymers and other

excipients. All the excipients were passed through # 60

mesh , mixed and granulated with 10% solution of HPMC

5CPS in water. The wet mass was passed through #16

mesh and dried at 45˚C for 1 hrs. Dried granules were

passed through #24 mesh and mixed with magnesium

stearate and talc. And finally add the required quantity of

sod. Bicarbonate and citric acid was mixed with granules.

Granules were compressed into tablets using 16 punch

single station tablet compression machine (Cadmach).



bulk density, tapped density, corr’s index, Hauser’s ratio


evaluated for its Thickness,hardness, friability, weight


time, in-vitro dissolution studies.


Pre-formulation studies: The formulated batches were

evaluated for Preformulation studies that are Angle of

repose, Carr’s index and Hausner’s ratio, the values

obtained for that studies are tabulated in Table no 2.The

values were found to be in the range from 25.64˚±0.01 to

31.3˚±0.05, 9.37±0.01 to12.5±0.01, 1.07±0.01

to1.14±0.01% respectively. This indicates good flow

property of the granules for compression.

Physical properties: The formulated batches were

evaluated for physicochemical parameters like hardness,



thickness, weight variation, friability, drug content,

floating lag time and swelling index. The values obtained

for that studies are tabulated in Table no 3. Floating

properties from the evaluation results it was observed that

the tablets containing Xanthan gum and HPMC K4M, F12

showed greater in vitro buoyancy time and when

compared to other prepared formulation. Swelling index

of floating tablets showed significant differences in their

swelling index in the order of Xanthan Gum > HPMCK4

> Ethyl cellulose>Carbopol934. From the compatibility

studies for drug and excipients it was observed that there

was no interaction between drug and excipients.

In-vitro drug release studies of Ofloxacin: Formulations

F1, F2, F3 and F4 containing HPMC alone and

Combination of HPMC and Carbopol. The Formulations

F1 has shown release 78.4% at the end of 11hrs,

Formulations F2 has shown release 75.3% at the end of

1hrs, Formulations F3 has shown release 72.2% at the end

of 11 hrs, Formulations F4 has shown release 75.4% at the

end of 11hrs.


containing Combination of HPMC5cps and HPMC K50 .

The Formulations F5 has shown release 76.8% at the end

of 11 hrs, Formulations F6 has shown release 78.9% at the

end of 11 hrs, Formulations F7 has shown release 80.4%

at the end of 11 hrs, F8 has shown release 79.3% at the

end of 11 hrs, Formulations F10 has shown release 81.4%

at the end of 11 hrs, Formulations F11 has shown release

83.4% at the end of 11 hrs.

Formulations F9, and F12 containing Combination of

HPMC and Xanthan gum. The Formulations F9 and F12,

have shown release 92.8% and 95.8% respectively at the

end of 11hrs, the values obtained for that studies are

tabulated in Table no 4.

In-vitro drug release studies of Tinidazole: Formulations F1, F2, F3 and F4 containing HPMC alone

and Combination of HPMC and Carbopol. The

Formulations F1 has shown release 76.3% at the end of

11hrs, Formulations F2 has shown release 74.3% at the

end of 11hrs, Formulations F3 has shown release 71.6% at

the end of 11hrs, Formulations F4 has shown release

73.3% at the end of 11 hrs.


containing Combination of HPMC5cps and HPMC K50

were done. The Formulations F5 has shown release 74.2%

at the end of 11 hrs, Formulations F6 has shown release

78.2% at the end of 11 hrs, Formulations F7 has shown

release 81.3% at the end of 11 hrs, F8 has shown release

76.1% at the end of 11 hrs, Formulations F10 has shown

release 79.6% at the end of 11 hrs, Formulations F11 has

shown release 80.1% at the end of 11 hrs. Formulations

F9, and F12 containing Combination of HPMC and

Xanthan gum. The Formulations F9 and F12, have shown

release 88.4% and 92.8% respectively at the end of 11hrs,

the values obtained for that studies are tabulated in Table

no 5.

Kinetics of drug release: Based on mathematical models, it was concluded that for

mulation F12,the regression(r=0.99) value was found to






Table.1.Composition of floating tablets containing combination of Ofloxacin and Tinidazole Ingredients

(Mg)

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

Ofloxacin 200 200 200 200 200 200 200 200 200 200 200 200

Tinidazole 300 300 300 300 300 300 300 300 300 300 300 300

Lactose 120 120 70 70 __ __ __ __ __ __ __ __

HPMC5CPS 60 60 60 60 60 60 30 60 50 40 40 40

HPMCK4 __ __ __ __ __ __ __ __ 50 __ __ 40

HPMCK15 __ 100 __ __ 70 __ __ __ __ __ 40 __

HPMCK50 __ __ __ __ __ 70 100 __ __ __ ___ __

HPMCK100 __ __ __ __ __ __ __ __ __ 50 30 __

Ethyl Cellulose 150 __ 100 __ __ __ __ 60 __ __ __ __

Eudragit __ __ __ 100 __ __ __ __ __ __ 50 __

Xanthungum __ __ __ __ __ __ __ __ 70 70 __ 80

Carbopol 934 50 100 150 150 __ __ __ __ __ __ __ __

Sod.Bicabonate 50 50 50 50 50 70 50 60 50 50 50 50

Citricacid 50 50 50 50 50 30 50 50 30 30 30 30

Total (Mg) 1000 1000 1000 1000 750 750 750 750 750 750 750 750



Table.2.Results for derived and flow properties Formulation

Code

Derived Properties Flow Properties

Bulk density

(mean ±SD) g/ml

Tapped density

(mean ±SD) g\ml

Angle of repose

(mean ±SD)

Carr’s index

(mean ±SD)

Hausner’s ratio

(mean ±SD)

F1 0.28±0.01 0.32±0.04 25.64±0.01 12.5±0.01 1.14±0.01

F2 0.29±0.03 0.33±0.03 26.5±0.03 12.1±0.01 1.13±0.02

F3 0.34±0.01 0.37±0.01 27.02±0.04 12.4±0.02 1.08±0.03

F4 0.29±0.02 0.32±0.03 28.88±0.01 9.37±0.01 1.10±0.01

F5 0.30±0.01 0.33±0.01 31.3±0.05 9.7±0.01 1.1±0.02

F6 0.35±0.04 0.39±0.02 27.02±0.02 10.2±0.01 1.11±0.01

F7 0.37±0.03 0.42±0.02 29.2±0.04 11.9±0.01 1.13±0.04

F8 0.42±0.01 0.45±0.01 27.02±0.01 10.6±0.03 1.07±0.01

F9 0.338±0.02 0.41±0.04 27.4±0.03 10.3±0.02 1.07±0.02

F10 0.35±0.01 0.39±0.03 27.1±0.01 10.2±0.01 1.11±0.01

F11 0.37±0.04 0.37±0.01 27.02±0.05 12.4±0.01 1.08±0.01

F12 0.39±0.01 0.39±0.04 27.02±0.01 10.2±0.02 1.11±0.02

Table.3. Physico chemical parameters of all formulations Formulations Thickness

(mm)

Hardness

(Kg/cm2)

Friability

(%)

Weight

variation (mg)

Floating lag

time (Sec)

Swelling

index (%)

In vitro

buoyancy(hr)

F1 3.2 2.8 0.72 958 - 184.3 -

F2 3.4 2.9 0.93 964 - 207.5 -

F3 3.4 3.1 0.67 943 - 175.4 -

F4 3.4 3.7 0.86 947 - 192.8 -

F5 3.5 2.6 0.91 739 - 262.5 -

F6 3.8 2.9 0.78 742 - 279.2 -

F7 3.7 3.1 0.75 756 - 300.4 -

F8 3.2 3.4 0.92 763 - 348.6 -

F9 3.4 2.9 0.89 749 32 324.3 10

F10 3.4 2.8 0.81 743 - 316.8 08

F11 3.4 3.1 0.67 742 27 175.4 06

F12 3.8 2.9 0.78 768 35 279.2 11

Table.4. In-Vitro Cumulative% Drug Release study Of F1- F12 (Ofloxacin)

Time

(hrs)

Cumulative % drug release of Ofloxacin

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

0 0 0 0 0 0 0 0 0 0 0 0 0

1 19.6 18.1 15.2 14.3 17.6 18.1 19.7 17.2 15.8 19.2 20.3 17.2

2 26.3 24.3 21.3 19.4 24.3 25.7 26.3 23.7 20.2 25.1 27.2 24.3

3 32.2 29.8 27.4 24.3 29.1 31.1 33.8 29.9 37.2 32.3 34.1 33.1

4 39.8 34.3 32.5 32.3 36.9 38.8 40.2 37.2 45.1 39.4 40.3 40.9

5 45.7 39.1 38.6 39.4 43.1 44.3 46.1 44.2 59.3 45.6 47.9 57.6

6 51.3 43.4 43.4 47.3 51.4 52.2 53.1 51.4 68.2 52.1 54.3 68.4

7 57.3 48.8 49.8 54.4 56.7 58.3 59.1` 58.7 77.2 59.3 60.4 79.2

8 65.4 55.3 55.3 60.4 61.4 63.4 65.2 65.3 80.2 66.4 67.3 85.7

9 69.8 61.4 62.2 67.2 65.3 68.3 72.3 72.1 87.8 73.7 72.3 89.8

10 74.3 62.3 67.4 71.2 71.6 73.5 76.7 75.3 90.1 77.3 78.4 93.5

11 78.4 79.3 72.2 75.4 76.8 78.9 80.4 79.4 92.8 81.4 83.4 95.8



Table No: 5: In Vitro Cumulative% drug release study of F1- F12 (Tinidazole) Time

(hrs)

Cumulative % drug release of Tinidazole

F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

0 0 0 0 0 0 0 0 0 0 0 0 0

1 14.2 15.9 18.3 12.9 15.2 14.2 15.2 17.2 15.8 13.6 18.4 16.2

2 19.8 21.4 26.2 20.2 21.4 19.8 22.8 23.7 20.2 19.6 27.5 21.3

3 27.4. 29.4 31.2 28.1 29.2 27.4. 29.4. 29.9 27.2 26.9 34.6 29.1

4 34.6 36.9 37.4 33.3 36.9 34.6 36.6 35.2 32.1 31.2 42.4 34.9

5 42.4 43.9 42.6 40.6 43.5 42.4 43.4 41.2 37.3 39.7 49.2 45.6

6 49.2 50.6 49.6 46.1 50.6 49.2 49.2 48.4 48.2 46.5 54.5 51.4

7 56.1 55.1 56.8 53.2 55.0 56.1 56.1 55.7 56.2 53.6 60.9 59.2

8 62.2 59.6 62.8 59.2 59.6 62.2 64.2 61.3 65.1 60.2 66.3 65.7

9 69.6 65.9 67.2 64.3 65.9 68.6 69.6 66.1 74.8 67.2 71.9 73.8

10 72.8 70.8 71.3 68.6 70.8 73.8 75.8 72.1 81.3 73.5 76.1 84.9

11 76.3 74.3 74.6 73.3 74.2 78.3 81.3 76.1 89.4 79.6 80.1 92.8

Figure.1. FTIR spectra data for pure Ofloxacin Figure.2.FTIR spectra data for pure Tinidazole

Figure.3.FTIR Spectra of Drug (O+T) + Polymers

+Excipients. Figure.4.FTIR Spectra of Polymers+ Excipients



Figure no. 5: Cumulative % Drug Releae Profile of F1-F12

(Ofloxacin) Figure no. 6: Cumulative % Drug Releae Profile of

F1-F12 (Tinidazole)

Figure.7.Ofloxacin Drug Releae Profile of F12 Showing

Zero Order Kinetics Figure.8.Ofloxacin DrugReleae Profile of F12 Showing

First Order Kinetics

Figure.9.Ofloxacin drug releae profile of F12 showing

Hiuchi model. Figure.10.Ofloxacin drug releae profile of F12 showing

Peppas Model.

0

20

40

60

80

100

120

0 5 10 15 Cu

mu

lati

ve

% d

rug

rele

ase

Time(hrs)

Cumulative % drug release of Ofloxacin

of F1-F12

F1

F2

F3

F4

F5

F6

F8

F9

F10

F11

F12

0

20

40

60

80

100

0 5 10 15 Cu

mu

lati

ve

% d

rug

rele

ase

Time(hrs)

Cumulative % drug release of

Tinidazole of F1-F12 F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

y = 7.9311x + 4.2872

R² = 0.9942

0

10

20

30

40

50

60

70

80

90

100

0 2 4 6 8 10 12 % C

um

ula

tive

Dru

g

Rel

ease

Time (hr)

Zero Order

y = -73.794x + 98.708

R² = 0.8705

0

20

40

60

80

100

120

0 0.2 0.4 0.6 0.8 1 1.2

% D

rug R

elea

se

Rem

ain

ing

Log Time

First Order

y = 28.293x - 12.785

R² = 0.9341

-20

0

20

40

60

80

100

0 0.5 1 1.5 2 2.5 3 3.5

Cu

mu

lati

ve

% R

elea

se

Squar root of time

Higuchi Equation

y = 0.5x

R2 = 1

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8

1.0

1.2

0 0.2 0.4 0.6 0.8 1 1.2 log o

f cu

mu

lati

ve

%

dru

g r

elea

se

log time

Peppas equation



CONCLUSION

From the above experimental results it can be

concluded that, formulated tablets gave satisfactory results

for various physicochemical characteristics like thickness,

hardness, weight variation, friability, drug, floating lag

time and swelling index. Sodium bicarbonate has

predominant effect on the buoyancy lag time, while

HPMC K4M and xanthan gum has predominant effect on

total floating time and drug release xanthan gum shows

significant effect on drug release. In vitro drug release rate

studies showed that the maximum drug release was

observed in F12 formulation up to 11 hrs. FT-IR studies

revealed that there was no interaction between drug and

polymers used. From the study it is evident that a

promising controlled release floating tablets of Ofloxacin

and Tinidazole can be developed to increase gastric

residence time. Further detailed investigation is required

to establish efficacy of these formulations and fix the

required dose.

REFERENCES

Kamalakanan, M. Karthikraja, K. Ravi, M. Kathikeyan, K.

G.S. Arul Kumran, A Arunachalam, Formulation and

invitro evaluation of tinidazole effervescent floating

tablets, 5(4), 2012, 2321-2325.

Padmavathy D, Saravanan D, Rajesh, Formulation And

Evaluation Of Ofloxacin Floating Tablets Using HPMC,

3(1), 2011, 170-173.

Sonia Dhiman, Thakur Gurjeet Singh, Design and

optimization of floating matrix tablets of famotidine by

central composite design, 5(1), 2012, 45-49.

Basawaraj S.Patil, Sandeep J. Sonawane, Upendra

Kulkarni, Hariprasanna R.C, Formulation and in-vitro

evaluation of captopril floating matrix tablets using

HPMC 50cps, 2(3), 2012, 97-102.

Kulkarni A, Bhatia M. Development and evaluation of

regioselective bilayer floating tablets of Atenolol and

Figure no.11: Tinidazole Drug Releae Profile of

F12 Showing Zero Order Kinetics. Figure no.12: Tinidazole DrugReleae Profile of F12

Showing First Order Kinetics

Figure no.13: Tinidazole DrugReleae Profile of

F12 Showing Higuchi Model. Figure no. 12: Tinidazole Drug Releae Profile of F12

Showing Peppas Model.

y = 7.9311x + 4.2872

R² = 0.9942

0

10

20

30

40

50

60

70

80

90

100

0 2 4 6 8 10 12

% C

um

ula

tive

Dru

g

Rel

ease

Time (hr)

Zero Order

y = -73.794x + 98.708

R² = 0.8705

0

20

40

60

80

100

120

0 0.2 0.4 0.6 0.8 1 1.2

% D

rug R

elea

se

Rem

ain

ing

Log Time

First Order

y = 28.293x - 12.785

R² = 0.9341

-20

0

20

40

60

80

100

0 0.5 1 1.5 2 2.5 3 3.5

Cu

mu

lati

ve

%

Rel

ease

Squar root of time

Higuchi Equation

y = 0.5x

R2 = 1

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8

1.0

1.2

0 0.2 0.4 0.6 0.8 1 1.2

log o

f cu

mu

lati

ve

%

dru

g r

elea

se

log time

Peppas equation



Lovastatin for biphasic release profile. Iranian J Pharm, 8,

2009, 15-25.

Dinesh Dhamecha, Amit A Rathi. Development and In

Vitro Evaluation of Oral Floating Matrix Tablet

Formulation of Ranitidine Hydrochloride. Research J.

Pharma, Dosage Forms and Tech, 1(1), 2009, 41-44.

Ravi Kumar, M. B. Patil, Formulation and Evaluation of

Effervescent Floating Tablet of Famotidine. Int. J. Pharm

Tech Res, 1(3), 2009, 574-563.

Rajesh Kaza, E. Usharani, Design and Evaluation of

Sustained release Floating tablets for thetreatment of

Gastric Ulcers. J. Pharm. Sci. & Res, 1(4), 2009, 81-87.

Rajeswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND IN-VITRO EVALUATION OF TERBUTALINE SULPHATE

SUSTAINED RELEASE TABLETS Rajeswari Kola*, Deepa Ramani N, Pragati Kumar B

Department of Pharmaceutics, Nimra College of Pharmacy, Vijayawada

*Corresponding author: E.Mail: [email protected]

ABSTRACT

Sustain release formulation maintain a constant level plasma concentration of drug so that multiple and night

dosing can be avoided. Terbutaline sulphate is a β2 stimulant drug which is having a very short half life of less

than 4 hours. It is available in conventional dosage form in thrice a day formulation. Being half life less there is

always a need for dosing frequency. Decreasing dosing frequency will increase the patient compliance for

asthmatic patients and thus avoiding dosing at odd hours. Terbutaline sulphate is available in market in different

immediate release dosage forms. After some time plasma concentration level decreases below MEC. So the

necessity of producing the drug in sustained release formulation. So an attempt is made to formulate terbutaline

sulphate in sustained release formulation with different concentrations of HPMC K15 and HPMC K4M polymers

so that it can provide effective drug release up to 12 hours. The powder blend is subjected to pre compressional

parameters. The prepared tablets were subjected to post compressional parameters. The results of the present

study showed that the polymer ratio used in the formulation F5 showed enhanced result and released the drug up

to 12 hours with 99 % drug release.

Key words: Asthma,Terbutaline sulphate, β2-adrenergicagonists, Sustained release

INTRODUCTION

Asthma is the predeposition to chronic

inflammation of the lungs in which the bronchi are

narrowed. It is most common in childhood and occurs in

approximately 10% of the pediatric population(S.P. Vyas

et.al,2004).. People with asthma have extra sensitive or

hyper responsive airways. The airways react by narrowing

or obstructing when they become irritated. There are two

factors that provoke asthma. Triggers result in tightening

of the airways and other would be inflammation of the

airways due to allergens (Harish NM, 2011). Probably 75-

80% of young asthmatics are allergic. It affects children

varying degree from very mild to very severe. There is a

general trend of increased deaths and hospitalization from

asthma recorded in an entire all the industrialized

countries of the world (Ranabir Chandaa, 2010, Ibrahim

Khattab, 2009).Terbutalinesulphate is an effective broncho

dilator and relatively short acting β2-

adrenergicagonistsused in the treatment of bronchial

asthma, chronic bronchitis and emphysema. It has shorter

biological half life of 3-4hours.The usual does of TBS for

oral adults is 5mg taken every 6 hours 3 times a day. In

children 12 to 15 year age the used does is 2.5 mg 3 times

a daily.Terbutaline is incompletely absorbed from the GIT

and also subject to extensive first pass metabolism by

sulphate conjugation in the liver and possibly by the gut

wall. However due to short biological half life and low

bioavailability of the drug high frequency dosing is

necessary for the effective therapy (NandvishalV.Deore

et.al,1012). Its short biological half life and thus frequent

administration create necessity to development of long

acting formulation is desirable to improve not only the

treatment of lung disorder but also the patients

compliance. In the present investigation it was tried to

develop long acting formulation of terbutalinesulphate to

improve itself.Attempt was made to prepare sustained

release tablets of terbutalinesulphate using different

concentrations of sustained release polymers.(Naresh

B.Rajgor, 2010)


Terbutaline sulphate was obtained from Darwin

laboratories,Vijayawada,HPMC K15and HPMC K 4Mwas

obtained from Coloron Asia Pvt.Ltd,Goa, Ethyl cellulose

was obtained from Loba Cheme Pvt.Ltd ,Mumbai ,Iso

propyl alcoholwas obtained from Finar

reagents,Ahmedabad, lactosewas obtained from Loba

cheme pvt.ltd,Mumbai, PVP K 30was obtained from

Qualikens,Vadodara, Magnesium stearate and Talc was

obtained from Sd.Fine Chemicals Ltd.Mumbai.

Preformulation studies: The powder blend was subjected

to preformulation studies like bulk density, tapped

density,Angle of repose, Carr’s compressibility

index,Hausner’s ratio.( RaghavendraRao, 2012)

Drug-excipient Compatability Study: The IR absorption

spectra of the pure drug and with different excipients were

taken in the range of 4000-450 cm-1

using KBr disc

method. (Sahin, 2009)

Formulation of 7.5mg Terbutalinesulphate sustained

release tablets: Tablets containing 7.5 mg of

Terbutalinesulphatewere prepared with a total tablet

weight of 120 mg considering the Preformulation studies

and the literature survey, the excipients were selected and

an attempt was made to produce sustained release tablets

maintaining the basic tablet properties.




Procedure: Granules were prepared by using wet

granulation technique. Ingredients were weighed and

taken in to motor. Finally the active ingredient was mixed

homogeneously according to geometric proportions.

Selected polymers are added. All the ingredients are made

into a mass with alcoholic 3% solution of PVP K30.

The coherent mass was thoroughly sieved through

16 mesh and then dried in hot air oven at 50ºC for 45 min.

The dried granules were passed through sieve no 20 to get

uniform granules. To this calculated amount of

Magnesium Stearate and Talc were added as a lubricant.

Then the prepared granules were evaluated in the

following parameters bulkdensity, tapped density, angle of

repose, compressibility index and Hausner’s ratio.

Post formulation studies:The formulated tablets were

subjected to post formulation parameters like Thickness,

Hardness, Weight variation, Friability(Harish NM

et.al,2011).Invitro dissolution and stability

studies.(USP,2010)


Drug-excipients compatibility studies by observing

physical appearance: The pure drug and along with

formulation excipients were subjected to

compatibilitystudies and studies were carried out by

mixing definite proportions of drug andexcipients and

kept on glass vials which are stored in desiccator for one

month.

Drug- Excipients compatibility studies by Infrared

spectroscopy: Infrared spectra were recorded on a Fourier

transform Infrared (FTIR) spectrophotometer using KBr

dispersion method. All samples were recorded in the range

of 4000-400 cm-1

.From IR Spectra’s it was found that

there was no drug-excipients interaction.

Pre compressional studies: The powder blend was

subjected to pre formulation parameters like Bulk density,

Tapped density,A ngle of repose,Compressibility index,

Hausner’s ratio.

Post-compression parameters: The tablets of different

formulations were physically characterized by parameters

like Thickness, Average Weight, Hardness and Friability,

Uniformity of weight, In-vitro dissolution studies.

Table.1.Formulation of Terbutaline sulphate tablets with sustained release polymers

Ingredients (mg) F1 F2 F3 F4 F5 F6 F7 F8 F9 F10

Terbutaline sulphate 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5

HPMC K 15 30 55 25 - 40 35 30 - 20 15

HPMC K4M 30 - 25 45 - - - 25

Ethyl cellulose 30 35 40 45 50 55 60 65 70 75

Isopropyl Alcohol Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S Q.S

Lactose 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5

PVP K 30 5 5 5 5 5 5 5 5 5 5

Magnesium stearate 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5

Talc 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5

Total 120 120 120 120 120 120 120 120 120 120

Table.2.Pre-compression parameters

Powder blend Angle of

Repose (°)

bulk density

(g/cc)

Tapped

density (g/cc)

Compressibility

index (%)

Hausner ratio

F1 22.4 0.463 0.529 18.2 1.18

F2 26.5 0.457 0.538 19.22 1.22

F3 25.66 0.466 0.505 15.58 1.22

F4 23.99 0.525 0.669 17.18 1.16

F5 24.3 0.501 0.648 18.1 1.20

F6 28.97 0.453 0.575 19.12 1.21

F7 24.84 0.432 0.55 17.17 1.19

F8 21.99 0.525 0.52 19.78 1.23

F9 29 0.501 0.669 16.61 1.24

F10 28.97 0.451 0.648 20.73 1.26



Table.4.Post-compression parameters

Formulations Average Weight (mg) Friability (%) Hardness (Kg/cm2) Thickness (mm)

F1 120±.01 0.38±0.02 3±0.2 4.22

F2 120±0.13 0.545±0.03 3.5±0.65 4.32

F3 120±0.24 0.676±0.52 4±0.25 4.38

F4 120±0.05 0.432±0.032 4.5±0.17 4.44

F5 120±0.6 0.298±0.01 5±0.15 4.18

F6 120±0.20 0.156±0.020 4±0.62 4.1

F7 120±0.25 0.478±0.6 5±0.38 4.32

F8 120±0.28 0.436±0.32 4.5±0.35 4.32

F9 120±0.65 0.529±0.07 4±0.45 4.38

F10 120±0.71 0.683±0.030 4.5±0.30 4.44

Fig.7.Cumulative %drug release of formulations F1to F10

CONCLUSION

The experimental work was carried out to prepare

sustained release tablets of long acting turbutaline

sulphate. Terbutalinesulphate is a class II drug according

to BCS with a half life of 3-4 hours. It is administered

thrice a day which results in ineffective therapy. Being

half life less there is always a need for dosing frequency.

Decreasing dosing frequency will increase the patient

compliance for asthmatic patients and thus avoiding

dosing at odd hours. Terbutaline sulphate is available in

market in different immediate release dosage forms. After

some time plasma concentration level decreases below

MEC. So the necessity of producing the drug in sustained

release formulation. So attempt is made to formulate

terbutaline sulphate in sustained release formulation with

different ratios of HPMC K15 polymer so that it can

provide effective drug release up to 12 hours. The results

of the present study showed that the polymer ratio used in

the formulation F5 showed optimized result and released

the drug up to 12 hours. The Terbutaline sulphate

sustained release tablets containing polymer HPMC K 15

showed better release based on the drug release which

showed percent drug release approximately 99 % within 8

- 12 hours.

REFERENCES

Chanda R, Ghosh A, Biswas S and Chowdhury SR.

Formulation of oral mucoadhesive tablets of terbutaline

sulphate using some natural materials and in-vitro and in-

vivo evaluation. Journal of Pharmaceutical Research and

Health Care, 2010, 2 (1), 32-45.

Dr.N.G.RaghavendraRao, Harishpanchal and mohd abdul

Hadi, Formulation and evaluation of biphasic drug

delivery system of Terbutaline sulphate for chronotherapy,

Int J Pharm Bio Sci, 2012, 3(3), 626 – 637.

Ibrahim Khattab, Farzana Bandarkar1, Ahmed

Lila,Formulation and optimization of sustained release

0

20

40

60

80

100

120

0 2 4 6 8 10 12 14

%d

rug

rele

ase

Time(hrs) F1 F2 F3 F4 F5

F6 F7 F8 F9 F10



terbutaline sulfate microspheres using response surface

methodology, DrugDiscovTher, 2009, 3(3), 123-135

Jovanvic M, Jovicic G, Duvic Z, Agbaba D, Nikolic

L.Effect of fillers and lubricants on acetylsalicylic acid

release kinetics from Eudragit matrix tablets. Drug Dev

Ind Pharm. 1997; 23:595-602.

Kim CK, Kim MH. Preparation and evaluation of

sustained release microspheres of terbutaline sulfate. Int J

Pharm, 1994; 106:213-219.

Mathew T, Agrawal S. Design and development of fast

Melting Tablets of Terbutaline Sulphate, Research Journal

of Chemical Sciences, 2011; 1(1), 60-63.

NandvishalV.Deore, Vinod M. Thakare, Bharat W.Tekade,

Vijay R. Patil. Formulation and evaluation ofTerbutaline

sulphate pulsatile drug delivery system,,2012 September;

1(3):(p)1004-1015.

Naresh B.Rajgor1, Manish Patel, Viral M. Shah, VH

Bhaskar, Ganesh C.Rajput Preparation and

Characterization of Terbutalin Sulphate Microsphere,

2010, 2(5): 450-459.

Qureshi J, Amir M, Ahuja A, Baboota S, Ali J,

Chronomodulated drug delivery system of salbutamol

sulphate for the treatment of nocturnal asthma, Indian J.

Pharm. Sci. 2008; 70(3), 351-356.

Ranabir Chandaa, AmitRoyb, SanjibBahadurb,

SumanSahab, SujoyDasc, AnantaChoudhury,Formulation

of terbutaline sulphate mucoadhesive sustained release

oral tablets from natural materials, Asian Journal of

Pharmaceutical Sciences 2010, 5 (4), 168-174.

S.P. Vyas, R.K. Khar, Targeted and controlled drug

delivery, CBS publishers, New Delhi,2004, 459 – 463.

Sahin S, Selek H, Ponchel G, Ercan MT, Sargon M,Hincal

AA, Kas HS. Preparation, characterization andin vivo

distribution of terbutaline sulfate loaded albumin

microspheres, J Control Release, 2002, 82, 345-358.

United States Pharmacopoeia 32 NF 27, United States

Pharmacopoeial Convention,Rockville, 2009, 6381.

Vaidya VM, Manwar JV, Mahajan NM, and Sakarkar DM.

Design and In-vitro Evaluation of Mucoadhesive Buccal

Tablets of Terbutaline Sulphate. Int. J. Pharm Tech

Research, 2009; 1(3): 588-597.

Pushpavathi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF ANTIDIABETIC ACTIVITY OF METHANOLIC EXTRACT OF

FLOWERS OF CASSIA SIAMEA IN ALLOXAN INDUCED DIABETIC RATS OF BASAL

DIET AND MAIDA MIXED DIET Pushpavathi P*, Janarthan M, Firasat Ali.

Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India *Corresponding author: Email: [email protected], Phone +91-9966974478

ABSTRACT

This study was carried out to evaluate the antihyperglycemic effect of the Methanol extracts of the flowers of C.

siamea on alloxan induced rats of normal diet and maida mixed diet. The extracts were orally administered daily

at 200 and 400 mg kg-1

body weight for three weeks. The effects of the extracts on Fasting Blood Glucose (FBG)

level were determined weekly. All rats in the diabetic groups (both basal diet and maida mixed diet) had FBG

levels well within the diabetic range (>150 mg dL-1

) at the initial stage of the experiment but after three weeks of

treatment with extracts or metformin. The FBG significantly dropped in dose-dependent manner, and also correct

the lipid profile and liver enzymes. The results suggest that the Methanol extracts of the flowers of Cassia siamea

restored the metabolic changes in alloxan-induced diabetic rats.

Key words: Cassia siamea, Metformin, Alloxan, Maida, Anti diabetic activity

1. INTRODUCTION

Diabetes mellitus is a metabolic disorder initially

characterized by a loss of glucose homeostasis with

disturbances of carbohydrate, fat and protein metabolism

resulting from defects in insulin secretion, insulin action,

or both. Studies have demonstrated that, in some

countries, diabetes affects up to 10% of the population

aged 20 years and older. Plant derived substances has

obtained greater attention in the recent years to prevent

and cure human diseases. In present study Cassia siamea

flower was selected for anti diabetic activity because it is

having anti oxidant property. Diabetes induced by alloxan,

it produce oxidative free radicals. This free radicals

damage the β-Cells of pancreas. Maida also having

alloxan in it, as smoothening agent. It also causes diabetes

hence it was given as feed for one model of animals. Due

to anti oxidant property of flowers of Cassia siamea, the

oxidative species were reduced so that β-Cells were

recovered (1, 2)

.


Collection and authentication of plant material: The

Cassia siamea(Fabaceae) flowers were collected during

the march-2013 from Chinnamunagala, Near Khammam

(Dist),Andhra Pradesh and authenticated from Dr K

Madhava chetty, Assistant professor, Department of

Botany, srivenkateswara, university, Thirupathi.

Preparation of extract: The shad dried flowers were

collected and powdered. The powdered plant material

(100gms) was extracted with methanol (90%v/v) by using

soxhlet apparatus. The extract was air dried to evaporate

solvent (4)

.

Animals: The male wister albino rats (200-250g) were

obtained from the central animal house of Sigma institute

of clinical research & administration PVT LTD,

Hyderabad. The animals were housed at room temperature

(22-28 ºC) for 12 hrs dark light cycles. Given standard

laboratory feed and water ad-libitum for alloxan induced

group and Maida mixed diet and water ad-libitum for

alloxan induced group of maida mixed diet animals.

Institutional Animal Ethics Committee

(769/2010/CPCSEA) approved the study.

Sample Collection: Blood samples were collected by the

retro-orbital plexus puncture method from overnight

fasted rats under light ether anesthesia and blood glucose

levels were estimated using Glucometer ( Gluco check

(Aspen Diagnostic (P) LTD, Delhi).

Acute Toxicity Study: toxicity studies were performed

according to OECD-423guidelines.

Anti hyperglycemic activity: The plant extract of Cassia

siamea exhibited significant anti diabetic activity. As in

the alloxan treated group of basal diet and maida mixed

diet the blood glucose level (BGL) high due to cytotoxic

effect of alloxan on the β-cells of islets of langarhans.

Present study has confirmed that the treatment of

methanolic extract of cassia siamea for a period of

3weeks caused a significant decreased in BGL of diabetic

rats. 200&400 mg/kg of plant extract were screened for

anti diabetic activity against alloxan induced diabetic rate

of basal diet and maida mixed diet. It produced significant

anti diabetic activity in a dose dependent manor. The

animals treated with alloxan and maida mixed diet has

high BGL than animals treated with alloxan and basal diet.

The anti diabetic activity exhibited by extract was

compared with that of standard drug (Metformin).

http://www.scialert.net/asci/result.php?searchin=Keywords&cat=&ascicat=ALL&Submit=Search&keyword=diabetic+rats



Treatment design:

Alloxa +Basal diet Alloxan + Maida mixed diet

Group I Normal rats 0.5 ml of 5% Tween-80 in

distilled Water orally Group I Normal rats 0.5 ml of 5% Tween-80 in

distilled Water orally

Group II Diabetic rats received alloxone

(180mg/kg) Group II Diabetic rats received alloxone

(180mg/kg)+Maida mixed diet.

Group III Diabetic rats treated orally with CS 200

mg/kg Group III Diabetic rats treated orally with CS 200

mg/kg+Maida mixed diet

Group IV Diabetic rats treated orally with CS 400

mg/kg Group IV Diabetic rats treated orally with CS 400

mg/kg+Maida mixed diet

Group V Diabetic rats treated orally with

Metformin 14.2mg/kg Group V Diabetic rats treated orally with Metformin

14.2mg/k+Maida mixed diet

Evaluation of anti diabetic activity of methanolic

extract of flowers of Cassia siamea on alloxan

induced diabetic rats of basal diet.

1. The male wister albino rats (200-250g) were

obtained from the central animal house of Sigma

institute of clinical research & administrationPVT

LTD, Hyderabad.

2. The rats were fasted for 18hrs and water was

given ad libitum.

3. After 18hrs the fasting blood sample were

collected by retro orbital puncture (ROP) Or tail

picking.

4. The initial fasting BGL was estimated by using

glucometer. The animals show high >150mg/dl or

low <75mg/dl were discarded and the animals

showing optimum BGL 75-120mg/dl were

selected.

5. They were injected with alloxan(150mg/kg) i.p

6. After 72hrs of alloxan injection the blood sample

was withdrawn by ROP or tail picking method

and BGL were estimated by glucometer.

7. The animals that show BGL above 200mg/dl and

below 450mg/dl were selected for study.

8. The drug was prepared and administrate orally

according to body weight of animals.

9. Blood sample were withdrawn from all the

animals at 0,1,2,3 weeks by ROP or tail picking

method and BGL was estimated by glucometer.

10. Change BGL, average and SD were calculated

and tabulated.

Evaluation of anti diabetic activity of methanolic

extract of flowers of Cassia siamea on alloxan induced

diabetic rats of maida diet: The procedure was same as

above but the animals fed with maida mixed diet.

Preparation of maida mixed diet showed in the table

Analysis of blood samples: The serum glucose levels

measured in order to calculate their decreased serum

glucose and percentage. After the 1 hrs of treatment with

Cassia siamea flowers extract on 21st day the blood were

collected from retro-orbital plexus under light ether

anesthesia for glucose estimations. On 21st day the animals

are sacrifice under anesthesia the animals blood samples

were collected and serum was separated. The serum stored

at 2-8°C, stored at freezer for one day for the estimations

of ALT, AST, ALP, total cholesterol, triglycerides, HDL

cholesterol and LDL cholesterol, using kit manufactured

by Robonin(india)PVT.LTD, Navi Mumbai, India. The

instrument used for this was autoanalyser Robonin (india)

PVT.LTD, Navi Mumbai, India.

3. RESULTS

Anti diabetic activity of CS flower extract on diabetic

rats fed with basal diet: In an alloxan induced diabetic

rats (Gr. II) significantly increased serum glucose level at

0th (P<0.001), 1

st (P<0.001), 2

nd (P<0.001), and 3

rd

(P<0.001) weeks were shown in the Table No.1.

Administration of CS 200 and 400 mg/kg orally reduced

significantly serum glucose level at 0th week (P>0.001),

(P>0.001), at 1st week (P<0.05), (P<0.001), at 2

nd week

(P<0.001), (P<0.001) and after 3rd

week (P<0.001),

(P<0.001) when compared to (Gr. II) control respectively.

Metformin at an oral dose 14.2 mg/kg reduced serum

glucose level at 0th week (P>0.001) at 1

st week (P<0.001),

at 2nd

week (P<0.001), and after 3rd

week (P<0.001),

significantly when compared with control respectively.

Anti diabetic activity of CS flower extract on diabetic

rats fed with maida mixed diet: In an alloxan induced

diabetic rats (Gr. II) significantly increased serum glucose

level at 0th (P<0.001), 1

st (P<0.001), 2

nd (P<0.001), and 3

rd



(P<0.001) weeks were shown in the Table No.2.

Administration of CS 200 and 400 mg/kg orally reduced

significantly serum glucose level at 0th week (P>0.05),

(P>0.001), at 1st week (P<0.001) , (ns), at 2

nd week

(P<0.001), (ns) and after 3rd

week (P<0.01), (P<0.05)

when compared to (Gr. II) control respectively. Metformin

at an oral dose 14.2 mg/kg reduced serum glucose level at

0th week (P>0.001) at 1

st week (P<0.001), at 2

nd week

(P<0.001), and after 3rd

week (P<0.001), significantly

when compared with control respectively.

Table.1. Effect of CS flower extract on serum glucose levels on Alloxan induced diabetic rats

All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of

Variance(ANOVA)fallowed by dunnett’s multiple comparison tests,*p<0.05,**p<0.01,***p<0.001 as compared to

control and a p<0.001.

b p<0.01,

c p<0.05 as compared with normal group

Table.2. Effect of CS flower extract on serum glucose levels on Alloxan induced diabetic rats fed with maida mixed

diet

Treated groups Blood glucose levels(mg/dl)

0 week 1st week 2nd week 3rd week

Normal 87.17±4.38 81.67±2.62 80.83±2.67 79.00±1.39

Control(allox150mg/kg+maida

diet

400.2±0.94a 201.2±1.01

a 104.0±0.89

a 94.17±1.30

a

STD(Met14.2mg/kg+maida diet) 215.4±3.85*** 131.8±4.09*** 86.0±0.57*** 73.17±1.74***

CS(200mg/kg) 388.2±0.94* 266.8±0.60*** 131.2±0.83*** 98.33±0.88**

CS(400mg/kg) 310.5±0.76*** 196.7±1.22ns

108.8±0.703ns

89.33±0.61*

Table.3.Effect of CS flower extract on liver enzyme levels on Alloxan induced diabetic rats

Table.4.Effect of CS flower extract on liver enzyme levels on Alloxan induced diabetic rats fed with maida mixed

diet

Treated groups SGOT(iu/l) SGPT(iu/l) ALP(iu/l)

Normal 37.30±0.805 51.35±0.659 92.66±0.707

Control(allox150mg/kg+maida diet 69.07±0.647a

98.48±0.427a

188.65±0.616a

CS(200mg/kg) 43.65±0.764*** 33.08±0.666* 166.39±0.579*

CS(400mg/kg) 40.58±0.595*** 62.16±0.670* 154.28±0.874**

STD(Metf14.2mg/kg+maida diet) 39.46±0.551*** 50.48±0.574** 140.87±0.635***

Note: All values are expressed as a mean ± SEM, n=6, ns= not significant; One-way Analysis of



b p<0.01,


Treated groups Blood glucose level(mg/dl)

0 week 1st week 2nd week 3rd week

Normal 76.83±0.68 77.83±0.36 73.0±0.52 74.66±0.60

Control(allox 150mg/kg) 239.83±0.92a 217.16±1.13

a 137.83±0.86

a 82±0.70

a

Standard(Met(14.2mg/kg) 220.66±0.64*** 175.83±0.54*** 103.66±0.64*** 78±0.66***

CS(200mg/kg) 318.50±0.69*** 220.50±0.77* 185.83±0.54*** 100.33±0.64***

CS(400mg/kg) 487.50±0.69*** 307.00±0.88*** 191.66±1.01*** 92±0.77***

Treated groups SGOT(iu/l) SGPT(iu/l) ALP(iu/l)

Normal 37.30±0.805

51.35±0.659 92.66±0.707

Control(Alloxan 150mg/kg) 48.05±0.969a

86.88±0.740a

175.82±0.808a

CS(200mg/kg) 40.64±0.626*** 54.23±1.202*** 154.10±1.015***

CS(400mg/kg) 33.99±0.738*** 62.25±0.823*** 144.21±1.008***

Standard(Metformin(14.2mg/kg) 43.21±0.963*** 49.68±0.865*** 143.23±1.49***



Table.5.Effect of CS flower extract on lipid profile on Alloxan induced diabetic rats

Treated groups TC(mg/dl) HDL(mg/dl) LDL(mg/dl) TG(mg/dl) VLDL(mg/dl)

Normal 70.04±1.87 21.52±0.46 37.64±1.15 77.08±0.66 15.41±0.13

Control(allox 150mg/kg) 124.9±0.73a

17.18±0.26a

91.85±1.00a

159.85±1.62a

31.97±0.32a

CS(200mg/kg) 82.36±2.37*** 22.33±0.61*** 26.06±0.87*** 100.43±0.49*** 20.09±0.09***

CS(400mg/kg) 58.92±0.38*** 25.35±0.52*** 13.08±0.28*** 102.40±0.83*** 20.48±0.15***

STD(Met(14.2mg/kg) 68.67±0.47*** 28.81±0.45*** 11.38±0.71*** 142.35±0.61*** 28.47±0.12***




b p<0.01,


Table.6.Effect of CS flower extract on lipid profile on Alloxan induced diabetic rats fed with maida mixed diet TREATED GROUPS T C(mg/dl) HDL(mg/dl) LDL(mg/dl) TG(mg/dl) VLDL(mg/dl)

Normal 70.03±1.87 21.52±0.46 37.64±2.09 77.08±0.66 15.41±0.13

Control(alx150mg/kg+maida diet 140.98±0.52a

17.11±0.74a

78.81±1.73a

203.2±6.50a

40.64±1.30a

CS(200mg/kg) 86.72±0.75*** 21.52±0.46*** 45.76±1.05*** 97.16±0.43*** 19.43±0.08***

CS(400mg/kg) 76.17±0.53*** 24.51±0.55ns

12.09±0.16*** 197.76±0.66*** 27.20±5.59**

STD(Met14.2mg/kg+maida diet) 68.66±0.75*** 28.81±0.45** 13.79±0.87*** 130.80±3.05*** 26.15±0.60**




b p<0.01,


4. DISCUSSIONS

In order to establish a scientific basis for the

utilization Cassia siamea extracts in the treatment of

diabetes, it was decided to evaluate the anti-diabetic effect

in Alloxan-induced diabetic rats of basal diet and maida

mixed diet.

5. CONCLUSION

The Cassia siamea flower extract, possesses anti-

diabetic activities in alloxan diabetic rats of basal diet and

maida mixed diet. The Cassia siamea flower extract,

showed a consistent effect on the Alloxan induced changes

in the blood sugar level and the beta-cell population in the

pancreas. From the above discussion it conclude that the

Cassia siamea flower extract at high doses (200, 400

mg/kg) exhibited significant anti-hyperglycemic activity. So

it can be used for the treatment of insulin dependent

diabetes mellitus.

6. ACKNOWLEDGEMENT




REFERENCES

Anti diabetic properties and brain shrimp toxicity of the

aqueous extract of the root of Cassia siamea lam E.E

Odason and J A Kolawole, Nigerian journal of

pharmaceutical research, 6(1), 2007, 66-69.

Barcelo A and Rajpathak S, Incidence and prevalence

of diabetes mellitus in the Americas.American Journal

of Public Health,10, 2001, 300-308.

Edwin J, Joshi SB, Jain DC. Antidiabetic activity of

flower buds of Michelia champaca Linn, Indian J

Pharmacol, 40, 2008, 256-60.

Manonmani G, Bhavapriya V, Kalpana S, Govindasamy

S, Apparanantham T. Antioxidant activity of Cassia

fistula flowers in alloxan induced diabetic rats, J

Ethnopharmacol, 97, 2005, 39-42.

Ranganathan S and Sridharan K, Effect of an

Antidiabetic Extract of CatharanthusRoseus on

Enzymic Activities In Streptozotocin Induced Diabetic

Rats, Journal of Ethnopharmacology, 76, 2001, 269-

277.

Swanston-Flat, S.K., Day, C., Bailey, C.J., Flatt, P.R,

Traditional plant treatmentfor diabetes: studies in

normal and streptozotocin diabetic mice, Diabetologia,

33, 1990, 462–464.

Szkudelski T, The Mechanism of Alloxan and

Streptozotocin Action in B Cells of The Rat Pancreas,

Physiological Research, 50(6), 6, 2001, 537-546.

Koteswararao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND EVALUATION OF TRANSDERMAL PATCHES OF ANTI-

HYPERTENSIVE DRUG METOPROLOL SUCCINATE Koteswararao P

1*, Duraivel S

1, Sampath Kumar KP

2, Debjit Bhowmik

3

1. Nimra College Of Pharmacy,Vijayawada, Andhrapradesh

2. Coimbatore Medical College,Coimbatore

3. Karpagam University,Coimbatore

*Corresponding author: Email: [email protected]

ABSTRACT

The present research work is an attempt to develop and evaluate matrix-type transdermal therapeutic system

of metoprolol succinate. It has a relatively greater blocking effect on beta 1-receptors.Transdermal patches of

metoprolol succinate were developed with different ratios of hydrophilic - HPMC and hydrophobic –EC polymer

combinations by solvent evaporation technique. The Fourier transform infrared spectroscopy (FTIR) was used to

confirm compatibility and to rule out any possible interactions between drug and polymers. Ten transdermal patch

formulations consisting HPMC K 15 M and Ethyl Cellulose were prepared. All formulations carried Dimethyl

Sulfoxide as penetration enhancer and Dibutyl Phthalate as plasticizer and dichloromethane and methanol as

solvent system. The prepared patches were evaluated for their physicochemical characteristics such as

weight variation, thickness, folding endurance, percentage moisture absorption, percentage moisture loss,

and drug content and In- vitro drug diffusion studies. Data of In - vitro drug diffusion from patches were fit in to

different equations and kinetic models to explain release kinetics. The Cumulative drug release from Formulation

K10 was found to be (97.36±1.089), after 24 hrs. So the formulation K10 is emerged as ideal formulation for

metoprolol succinate because it showed better release with sustained effect as compared to other formulations.

KEY WORDS: Metoprolol Succinate; HPMC and Ethyl Cellulose, Hypertension, First pass metabolism

INTRODUCTION

Transdermal drug delivery systems are adhesive,

drug containing devices of defined surface area that

deliver a pre-determined amount of drug to the surface of

intact skin at a pre-programmed rate. These systems

provide drug systemically at a predictable rate periods of

time. Currently transdermal drug delivery is one of the

most promising methods for drug application through the

skin to the systemic circulation. Transdermal drug

delivery system Avoidance the first- pass metabolism and

gastro intestinal incompatibility. This Single application

has capacity for multi day therapy, thereby improving

patient compliance and Self medication is possible with

this systems. This is Provides utilization of drugs with

short biological half life, narrow therapeutic window and

avoiding the fluctuations in drug levels. Metoprolol

Succinate dose is (25-200 mg) daily. It used as a treatment

of Hypertension, Angina pectoris and cardiac arrhythmias.

Metoprolol succinate is a greater blocking effect on beta

1-receptors. It is a white crystalline powder. It is freely

soluble in water and soluble in methanol, sparingly

soluble in ethanol, slightly soluble in dichloromethane and

2-propanol. The plasma half-life of Metoprolol Succinate

is 3 to 7 hours and it is indicating about 50% first-pass

metabolism. Only a small fraction of the drug (about 12%)

is bound to human serum albumin. Peak plasma

concentrations are achieved after 2–3 hours is almost

completely absorbed (95%) after oral administration.

Therefore Metoprolol Succinate is an ideal drug

candidate for transdermal drug delivery system.


Metoprolol Succinate was obtained from as gift

sample from Zyduscadila, Ahmadabad, Gujarat. HPMC K

15 M and Ethyl Cellulose obtained from Micro advance

research center, Banglore, Karnataka. Dibutyl phthalate,

Dimethyl sulfoxide and Dichloro methane were purchased

from Merk specialities, pvt.Ltd.Mumbai and methanol

from Jianasuhuaxi International trade co.ltd. Made in

china.

Transdermal patches of metoprolol succinate were

prepared by solvent evaporation method. The polymers

EC, HPMC-K 15M, were taken in required quantity.

About 14ml of solvent mixture of dichloromethane:

methanol (1:1) was added and stirred well and after

complete solubilization of polymers in mixture of solvent,

added required quantity of Dibutyl Phthalate to this

mixture, it is act as a plasticizer. Next weighed quantities

of metoprolol succinate added to the polymer solution and

mixed well and finally add permeation enhancer (Dichloro

Methane). It was set-aside for some time to exclude any

entrapped air and was then transferred into a previously

cleaned Petri plate and then this was kept aside for solvent

evaporation. The rate of solvent evaporation was

controlled by inverting a glass funnel over the Petri plate.

After over night, the dried films were taken out and stored

in desiccators. The compositions of Transdermal Patches

were shown in table.1.




Table.1.Composition of Transdermal Patch Ingredients

(In mg or ml) K1 K2 K3 K4 K5 K6 K7 K8 K9 K10

Metoprolol succinate 25 25 25 25 25 25 25 25 25 25

HPMC-K 15 M 800 - 50 100 150 200 250 300 350 400

Ethyl cellulose - 800 750 700 650 600 550 500 450 400

Dibutyl phthalate 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6

Dimethyl sulfoxide 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1

Methanol:

dichloromethane(1:1) 14 14 14 14 14 14 14 14 14 14

EVALUATION OF TRANSDERMAL PATCHES

FTIR study: The Infrared (IR) spectra were recorded

using an FTIR by the KBr pellet method and spectra

were recorded .The spectra obtained for Metoprolol

Succinate, polymers, and physical mixtures of

Metoprolol Succinate with polymers were compared.

Disappearance of metoprolol succinate peaks or shifting

of peak in any of the spectra was studied.

Thickness: The thickness of films was measured by

digital Verniercalipers with least count 0.01mm.

The thickness uniformity was measured at five different

sites and averages of five readings were taken with

standard deviation.

Folding Endurance: It was determined by repeatedly

folding a small strip of films at the same place till it broke.

The number of times, the films could be folded at the

same place without breaking gave the value of folding

endurance.

Weight variation

The three patches from each batch weighed on electronic

balance for weight variation test. The test was done to

check the uniformity of weight and thus check the batch-

to- batch variation.

Percentage of moisture loss: The percent moisture loss

was carried out to check the integrity of the film at dry

condition. This was carried out in the following

manner. The films were weighed accurately and kept in

the desiccators containing anhydrous calcium chloride.

After 3 days, the films were taken out and weighed.

Percentage of moisture loss formula:

Percentage of moisture loss

Per cent moisture absorption: The patches were

accurately weighed and placed in desiccators contains

humidity condition of 80-90 % RH is maintained by using

saturated solution of potassium chloride. The patches were

kept until uniform weight is obtained then taken out and

weighed. The percentage moisture uptake was calculated

as the difference between final weight (w2) and initial

weight (w1) with respect to initial weight.

Percent moisture absorption formula:

Percent moisture absorption

Drug content Determination: The prepared drug

contained patches specified surface area (1 cm2) were cut

and dissolved in 100ml of pH 7.4 phosphate buffer, and

vigorously shaked for 12hrs, and then sonicated for

15minutes, centrifuged at 5000 rpm for 30 min. Filter the

drug contained polymeric solution through 42 number

whatsman filter paper, then 1ml of the filtrate was taken in

a test tube and dilute it for five times with same solvent by

using double beam UV-Visible spectrophotometer to

determined drug content at max 223 nm. Respected

Placebo patch was taken as a blank solution.

In vitro drug release studies: Franz - diffusion cell was

used in our studies for in-vitro drug release. The cell

consists of two chambers, the donor and the receptor. The

donor compartment is open at the top and is exposed to

the atmosphere. The receptor compartment is surround

contain a water jacket for maintaining the temperature at

37oC ± 2 and is provided with a sampling port. The

diffusion medium was pH7.4 buffer, which was stirred

with magnetic beads used a magnetic stirrer. A semi-

permeable cellophane membrane previously soaked

overnight in 0. 1N HCl was placed between the two

chambers. The diffusion media was stirred to prevent the

formation of concentrated drug solution just beneath the

membrane. Samples from the receptor compartment were

taken at various intervals of time over a period of 24 hours

and the concentration of the drug was determined by UV

Spectrophotometric method using the standard curve.

Amount of drug diffused at various time intervals was

calculated and plotted against time.


Our present work comprises the formulation and

evaluation of Metoprolol Succinate transdermal patches

for sustained or extended release for a prolonged period of

time. Transdermal patches of metoprolol succinate were

prepared by solvent evaporation method. Totally, ten



0

2

4

6

8

10

12

14

16

k1 k2 k3 k4 k5 k6 k7 k8 k9 k10

% m

ois

ture

co

nte

nt

formulation code

Percentage Moisture Content Studies

% moisture

absorption

% moisture

loss

formulation trials (K1 to K10) were done with the aim to

achieve the successful matrix type Metoprolol Succinate

transdermal patches. HPMC K 15 M and controlled

release Ethyl Cellulose polymers in the formulation of

Metoprolol Succinate transdermal patches individually

and in combination. Methanol and Dichloromethane used

as solvents. Dibutyl phthalate used as plasticizer and

dimethyl sulfoxide used as a penetration enhancer.The

compatibility study of the drug with excipients indicate no

characteristic visual changes and no additional peaks were

observed during FTIR studies.

All the patches were evaluated for weight

variation, thickness, percentage moisture absorption,

percentage moisture loss, drug content, folding endurance,

and in-vitro drug release. In this thickness study with the

help of Digital verneircalipers, the thickness of patches

was measured. It was found to be in between 0.15±0.015

to 0.18±0.019. All formulations have good film properties.

The folding endurance of the patches was found between

84.11±5.03 to 131±4.49, the results indicate, as the HPMC

concentration increases the folding endurance of the

patches increases. All formulations from K1 to K10 show

weight variation in between 1.10±0.0013 to 1.25±0.0014 gm. The percentage moisture absorption of the prepared

patches results between 0.99 ± 1.317 to 13.2 ± 1.993,

HPMC K 15 M Alone High Moisture Absorption. The

percentage moisture Loss of the prepared patches are in

following order

K1>K2>K10>K9>K8>K7>K6>K5>K4>K3. The

formulation containing HMPC K 15 M alone shows high

loss of moisture (14±3.30) when compare to other patches.

All formulations show good % drug content in

between 90 to 98. From the results of In - vitro drug

diffusion studies it is observed that, as the

concentration of hydrophilic polymer increases the drug

release from the transdermal patch increases. The

formulation K1 “HPMC alone” showed maximum drug

release of 95.16 ± 1.53 % after 8 hrs, even then the

formulation K1 cannot be considered as ideal formulation

for Metoprolol succinate because it fails to sustain the

drug release for 24 hrs. The formulation K2 showed

lowest drug release of 66.34 ± 0.664 % after 24 hrs.

Increase the hydrophilic polymer increase the % drug

release, formulas K3 to K10 the % drug release shown

order K3 (73.68 ± 1.031), K4 (77.39 ± 0.589), K5 (81.42

± 0.736), K6 (84.76 ± 0.55), K7 (87.13 ± 1.218), K8

(90.36 ± 1.789), K9 (92.58 ± 0.931), K10 (97.36 ± 1.089)

after 24 hrs. The formulation K10 containing HPMC and

EC (400:400) is emerged as ideal formulation for

Metoprolol succinate because it showed better release

with sustained effect as compared to other formulations.

The Cumulative drug release from Formulation K10 was

found to be (97.36±1.089), after 24 hrs. The drug release

kinetics studies showed Non-Fickian diffusion and Zero

order release.

Figure.1.Comparison between moisture loss and moisture absorption

Table.2.Evaluation of Patches Formulation

code

Thickness

(mm)

Folding

endurance

Weight uniformity

(gm)

% moisture loss % moisture

absorption

% drug content

K1 0.17±0.020 150±3.78 1.25±0.0014 14±3.30 13.2±1.993 99±0.25

K2 0.18±0.025 84.11±5.03 1.15±0.0015 12.1±2.01 0.99±1.317 90.11±0.75

K3 0.15±0.015 99.12±4.72 1.10±0.0013 5.50±1.53 2.11±1.514 96.83±0.39

K4 0.16±0.019 106.33±4.5 1.13±0.0012 5.10±1.24 2.151±1.689 97.37±0.48

K5 0.17±0.020 112±5.30 1.11±0.0015 6.13±1.44 3.253±1.734 97.99±0.79

K6 0.16±0.040 117.66±3.1 1.14±0.0013 7.30±2.12 3.514±1.414 98.92±0.39

K7 0.15±0.021 119.47±6.12 1.12±0.0014 8.15±2.33 4.131±1.324 97.91±0.70

K8 0.18±0.019 123±4.30 1.11±0.0015 9.13±1.24 5.32±1.408 97.83±0.52

K9 0.17±0.013 127.66±5.20 1.15±0.0012 9.20±1.75 6.311±1.383 98.95±0.44

K10 0.15±0.031 131±4.49 1.13±0.0013 10.12±2.10 7.123±1.289 98.97±0.43



0

20

40

60

80

100

120

0 10 20 30

cu

mu

lati

ve %

dru

g r

ea

lea

se

time (hr)

In-vitro drug permeation profile k1

k2

k3

k4

k5

k6

k7

k8

k9

k10

Table.3.In-vitro drug permeation of metoprolol succinate (K1 to K5) Time(hr)

0

Cumulative % drug release

K1 K2 K3 K4 K5

1 0 0 0 0 0

2 17.38±0.410 2.67±0.437 3.91±0.660 4.83±0.983 6.15±0.689

3 33.87±0.680 6.17±1.130 7.36±0.794 8.41±1.134 10.36±0.839

4 47.12±0.864 8.11±0.538 10.57±1.514 12.13±1.647 14.18±1.23

5 62.13±0.539 11.28±0.689 13.11±1.086 15.27±1.073 17.56±0.823

6 77.41±1.234 13.37±0.134 16.23±0.631 17.91±0.899 20.39±0.735

7 84.12±1.1 16.15±1.136 19.83±0.935 21.38±2.30 22.87±0.439

8 89.98±0.678 20.11±1.649 23.14±0.789 24.01±1.003 25.43±1.003

9 95.16±1.534 23.55±0.789 25.12±0.730 26.78±1.678 28.78±1.467

10 - 26.98±0.693 27.36±1.033 29.02±0.406 30.12±1.115

11 - 29.13±0.443 29.78±1.004 32.13±1.650 34.36±0.668

12 - 31.17±0.639 32.51±1.464 35.08±0,996 36.14±0.869

24 - 32.61±0.983 34.36±0.87 37.12±0.403 39.83±0.512

- 66.34±0.664 73.68±1.031 77.39±0.589 81.42±0.736

Table.4.In-vitro drug permeation of metoprolol succinate (K6 to K10) Time(hr)

Cumulative % drug release

K6 K7 K8 K9 K10

0 0 0 0 0 0

1 7.21±0.789 7.96±1.238 8.92±0.324 9.53±0.318 9.81±0.998

2 11.16±0.897 11.73±2.014 12.09±0.567 13.04±0.647 12.38±1.413

3 15.31±1.031 15.84±0.539 15.98±0.638 16.28±0.739 16.47±1.021

4 17.83±1.13 18.12±1.321 18.23±0.781 18.59±0.58 20.12±0.681

5 21.79±0.581 21.83±1.230 22.06±1.367 22.87±0.88 25.43±0.92

6 24.31±0.779 24.86±0.937 25.19±0.813 25.64±0.689 29.03±1.003

7 26.58±0.689 27.18±0.560 29.13±1.31 31.85±0.532 34.83±1.089

8 29.38±0.989 30.41±1.811 33.54±1.065 36.28±0.451 38.04±0.918

9 32.73±0.889 34.89±1.189 37.48±0.894 41.16±1.048 43.17±1.144

10 35.34±1.63 38.13±1.147 40.13±1.004 45.73±0.783 48.84±0.989

11 39.71±1.003 42.33±0.589 45.18±1.037 48.76±0.669 54.91±1.235

12 43.12±1.13 46.72±0.789 49.34±0.986 53.52±1.03 59.31±1.025

24 84.76±0.559 87.13±1.218 90.36±1.789 92.58±0.931 97.36±1.089

Figure.2.In- vitro drug permeation profile of Metoprolol succinate



Figure.3.FTIR Spectrum of pure Metoprolol succinate drug Figure.4.FTIR spectrum of ethyl cellulose

Figure.5.FTIR Spectrum of pure Metoprolol succinate drug

with ethyl cellulose Figure.6. FTIR spectrum of HPMC K 15 M

Figure.7.FTIR spectrum of pure Metoprolol succinate drug

with HPMC K 15 M

Figure.12.FTIR spectrum of pure Metoprolol succinate drug

with ethyl cellulose and HPMC K 15 M



CONCLUSION

Metoprolol succinate is a an anti-hypertensive

agent which selected for the preparation of transdermal

delivery system as it complies with physicochemical

properties required to permeate through skin. The pre

formulation studies involving solubility, melting point,

partition coefficient and pH of the drug were found to be

comparable with the standard. The transdermal films of

metoprolol succinate were prepared by solvent

evaporation method and were subjected for evaluation

parameters such as weight variation, thickness, folding

endurance, drug content, percentage moisture

absorption, percentage moisture loss and diffusion studies.

All the parameters showed by the formulations were

within the limits.

The transdermal drug delivery system K1 (HPMC

K 15 M alone) showed the drug release (95.16±1.534), but

lasts only for 8 hrs. The transdermal drug delivery system

K2 (EC alone) showed lowest drug release but

successfully prolonged the release. Thus, formulations K3

to K10 were developed using different ratios of HPMC K

15 M and EC, in order to achieve better release along

with sustained action. All the formulations carried Dibutyl

Phthalate as plasticizer and Dimethyl sulfoxide as

permeation enhancer. The formulation K10 containing

HPMC K 15 M: EC (400:400mg) showed better release

(97.36±1.089) for sufficiently long period, up to 24 hrs

and emerged as ideal formulation for metoprolol

succinate. From this studies improving patient compliance

of metoprolol succinate by development of transdermal

Drug delivery system using HPMC K 15 M and Ethyl

cellulose.

REFERENCES

Ansari Khushbu, SinghaiAkhlesh Kumar, SaraogiGaurav

Kant, PatilSwaraj, Transdermal Drug Delivery of

Salbutamol Sulphate with Different Concentration of

Polymers, International journal of research in pharmacy

and science, 1(3), 2011, 50-65.

Darshan G. Trivedi, Hiren J. Patel, Anand K, Bhandari,

Dushyant A Shah, Preparation and evaluation of

transdermal patch ofdesloratadine, IJBR, 2(6), 2011,

359‐373.

Himansu Bhusan Samal, Suddhasattya Dey, Itishree

Jogamaya Das, Development and characterization of

transdermal patches of metoprolol Succinate, Journal of

Pharmacy Research, 4 (6), 2011, 1644-1647.

J.R.D.Gupta, R.Irchiayya, N.Garud. Formulation and

evaluation of matrix type transdermal patches of

Glibenclamide. International Journal of Pharmaceutical

Sciences Development and Research, 1(1), 2009, 46-50.

Putta Rajesh Kumar, Rajesh Tatavarthi, Mallikarjuna

gouda M, SomashekarShyale, S.M.Shanta Kumar ,

preparation of monolithic transdermal drug delivery

system for arthritis treatment and effect of permeation

enhancers on release kinetics, International Journal of

Pharmaceutical Sciences Review and Research, 6(2),

2011, 56-60.

Shivakumar H R, vishwanathbhat, Sheshapparai K,

ganeshsanjeev, Bhavyab B, Influence of blending of

chitosan and pullulan on their drug release behavior: an

in-vitro study. International Journal of Pharmacy and

Pharmaceutical Sciences, 4(3), 2012, 313-317.

Suvakanta Dash, Kinetic modeling on drug release from

controlled drug delivery systems drug research, 67(3),

2010, 217-223.

Sirisha Chowdary Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


NEUROPHARMACOLOGICAL SCREENING OF ETHANOLIC EXTRACT OF

NELUMBO NUCIFERA GAERTNER SEEDS Sirisha Chowdary G

*

Department of Pharmacology, M.A.M.College of Pharmacy, Guntur, India


ABSTRACT The neuropharmacological activities of the ethanolic extract of Nelumbo nucifera Gaertneer seeds were

screened in mice and rats. The extracts effect on phenobarbitone sodium induced sleep latency and sleeping

time,motor coordination activity,locomotor activity,anxiolytic activity(light-dark model transition in

mice,elevated zero maze),cerebral activator activity(nootropic) were evaluated. The ethanolic extract of Nelumbo

nucifera (50,100 and 200 mg/kg p.o) possess a significant (p<0.05) depression in general behavioral tests, and

potentiation of phenobarbitone induced sleeping time, and also shows anxiolytic action, in dose dependent

manner.The ethanolic extract of Nelumbo nucifera gaertnershows nootropic activity on Conditional avoidance

response, Morri’s water maze for spatial learning, but it weakly acts on acetylcholineesterase enzyme inhibitory

activity.Earlier studies conducted by various workers have revealed that several medicinal plants possess

nootropic activity, but only a few plants like W.somnifera possess both antistress as well as nootropic activity.

Similarly, our studies demonstrate that the plant nelumbo nucifera possesses a combination of activities. As

discussed earlier, these properties are complementary to each other and hence the plant could be a valuable

contribution to the existing armamentarium of nootropic agent having antistress activity.

KEY WORDS: Nelumbo nucifera Gaertner, Nymphaeaceae, Sedative-Hypnotic Activity, Anxiolytic Activity,

Cerebral Activator Activity.

INTRODUCTION

Disorders of the central nervous system (CNS),

including psychiatric disorders and stroke, have a

significant effect on morbidity and mortality. All of us are

aware of the many different states of brain activity,

including

sleep, wakefulness, extreme excitement, and

even different levels of mood such as exhilaration,

depression, and fear. All these states result from different

activating or inhibiting forces generated usually within the

brain itself. Some of the common neurological problems

in human beings are Anxiety, Insomnia, Autism,

Attention-deficit hyperactivity disorder, Tourette’s

disorder, Cognition.

Antipsychotic drugs like fluoxetine, imipramine

and antianxiety drugs like diazepam, alprozolam are used

for the many neurological disorders but the drugs

producing severe adverse effects and withdrawal

symptoms. An herbal medicine overcomes these incidents

traditional medicinal plants show same therapeutic effect

and lesser adverse effects when compared to modern

medicine.

Nelumbo nucifera is one of the aquatic plants

belongs to the family Nymphaeaceae or Nelumbonaceae

and it is called as Indian Lotus. A large aquatic herb with

slender, elongate, branched, creeping stems sending out

roots at the nodes.Alkaloids are reported in leaves, carpels

and rhizomes. The leaves contain three alkaloids, viz.,

Nuciferine (5, 6-dimethoxy aporphine) rosemerine, and

nornuciferine. An alkaloid nelumbine, which acts as a

cardiac poison, has been isolated from petioles.Pedicel

and seed embryo contains Saponin glycosides, Fat-soluble

bioactives etc.The vitamins reported to be present are as

follows (in mg/100gm): Thiamine 0.22, Riboflavin 0.06%

Niacin 2.1, and Ascorbic acid 15. Fresh rhizomes

Contains Water, crude protein, Fat, reducing sugars,

sucrose, starch, fibre, ash, calcium, asparagines. Dried

carpels contains Water, protein, fat, total Carbohydrates

(mostly starch), fibre, and ash, calcium, phosphorus, and

iron, Sucrose, reducing sugars and ascorbic acid etc.

Various phytochemical constituents have been reported in

Nelumbo nucifera Gaertner like fatty acids, carbohydrate,

triterpenes, glycosides, and fat soluble bioactives.

Raffinose and stachyose from rhizomes Nelumboside

0.1% from leaves, characterized as quercetin-3-

glucuronide. Nornuciferine, nuciferine, romaine, dl-

armepavine oxalate, pronuciferine, anonaine, 5-methoxy-

6-hydroxyaporphine, from leaves and seeds.Nornuciferine

characterized as 1-methoxy-2-hydroxyaporphine. A new

base neferine isolated from embryo, a quarternary base

lotusine along with isolienine isolated from embryo N-

nornuciferine, O-nornuciferine, liriodinine, d-

methylcoclaurine, remerine and dl-

armepavine.Methylcorypalline, neferine, isolienine and

lotusine isolated from embryo.

Seeds contain β-sitosterol, palmitic acid and

glucose.Oxoushine and N-norarmepavine isolated from

seeds.Seeds afforded isoliensinine, neferine, armepavine

and 4’-methylcoclaurine, asimilobine and lirinidine

isolated from leaves.Haemostatic activity shown by plant

extract attributed to quercetin which was identified in

receptacle.Rhizomes are used for diarrhea and dysentery,




menorrhagia.Embryo used to reduce high fever, treatment

of cholera, haemoptysis and spermatorhoea.Petals used for

syphilis, Sedative in the uterus, good in thirst, piles,

inflammation and poisoning. Neferine exhibited

antihypertensive activity, asimilobine and lirinidine

inhibited contraction of rabbit isolated aorta induced by

serotonin(1.0µM) Oxoushinsunine showed tumour

inhibitin activity, against nasopharynx cancer

Nelumbo Nucifera was claimed for many neurological

disorders. Screening of this plant will lead to development

of new drug.


Plant material: The dried seeds of Nelumbo nucifera

Gaertner were collected from surrounding areas of

Tirupati and Tirumala hills, was identified and

authenticated by the botanist Dr. K. Madhava Chetty,

Assistant Professor, Department of Botany, S. V.

University, Tirupati. A voucher specimen was deposited

in the herbarium, Department of Botany, S.V. University,

Tirupati and the approximately 1 kg of dried plant

specimen was grinded and stored in air tight container at

room temperature until preparation of the extract.

Animals: Healthy Swiss albino mice of either sex

weighing between 25-30 gm, Wistar albino rats of either

of sex weighing between 150-200gm procured. Animal

Ethical Committee approved experimental protocol and

study was carried out under guidelines of CPCSEA. The

animals were kept for two weeks to acclimatize to

laboratory conditions before starting the experiment. They

were allowed to free access of tap water and standard rat

feed. Animal were housed in a laboratory maintained a 12-

hr light-dark cycle, and controlled room temperature (23

20

C) and relative humidity (50 10%). The animal

received an appropriate diet (rat chow). A restricted

feeding procedure was used for at least 1 week before the

study 150 gm/day/cage (n=6) of feed was given.

Preparation of Nelumbo nucifera Gaertner extract:

About 200gm of coarsed powdered Nelumbo nucifera

Gaertner Dried seeds was subjected to extraction with

petroleum ether solvent (60-80°C) by using Soxhlet

apparatus for 12hrs at , to remove fat material and the

marc was reused for extraction with 70%ethanol at 400C.

It was finally dried at low temperature under reduced

pressure in a rotary evaporator. The extract was

evaporated under reduced pressure until all the solvent had

been removed, obtained an extract sample with a yield of

6.8%. Phytochemicals of the extract were screened with

methods described earlier. Concentrated crude extract was

obtained and dissolved in 2%Tween 80 solution to prepare

50 mg/kg, 100 mg/kg and 200 mg/kg concentrations using

glass distilled water, prepared freshly prior to the

treatment.

Drugs and chemicals: Diazepam 2mg (Natco pharma

Ltd) was used as the standard sedative, and anxiolytic

drug, Tween-80 used as vehicle, Petroleum Ether (60-

800C) (Sisco research laboratories Mumbai), Ethanol

absolute(Hong Yang chemicals corporation China),

Phenobarbitone Sodium(Vulcan laboratories pvt Ltd

Kolkata), Piracetam500mg(Micro labs) , Scopolamine

hydrochloride(Sigma Aldrich Bangalore) and Glass

Distilled water.

PHARMACOLOGICAL SCREENING (In vivo

method)

General behavioral tests: Swiss albino mice were

divided into five groups (6 in each group). The first three

groups were treated with NnG seed extract at different

doses (50, 100 and 200mg/kg p.o), the fourth group was

treated with control vehicle 2% tween 80 (10ml/kg p.o)

and the fifth group received Diazepam (DZP, 2mg/kg p.o.)

which served as standard drug. The activities were

recorded at 30 min intervals in the first hour and at hourly

intervals for the next 4 hrs for the following parameters.

Spontaneous activity, awareness and alertness

were evaluated by placing a mouse in a bell jar. It usually

shows a moderate degree of inquisitive behavior. Mice

normally utter no sound, so that vocalization may point to

a noxious. By this property of mice Sound responses was

evaluated. Touch responses was noted when the animal

was touched with a forceps (or) pencil at various parts (i.e.

on the side of the neck, on the abdomen and on the

groin).Pain response was graded when a small artery

clamp was attached to the base of tail.

Sedative and Hypnotic activity

Phenobarbitone sodium induced sleep latency and

sleeping time: Mice were divided into 5 groups

containing six animals in each. On day of experiment,

mice from all groups will be placed in cages. Control

group will received saline and 2% tween80 10ml/kg/day

p.o. The three test groups will treated with 50mg, 100mg

and 200mg/kg/day Ethanolic extract of Nelumbo nucifera

Gaertner seeds. Reference group will received diazepam 2

mg/kg/day i.p. on the same day of experiment all groups

received

phenobarbitone 40 mg/kg/day i.p after thirty

minutes of the last dose of ethanolic extract of Nelumbo

nucifera Gaertner seeds to the three test groups and, 2%

tween 80 to control group to induce sleep. The animals

were observed for the latent period (time between

pentobarbitone administration to loss of righting reflex)

and the duration of sleep (time between the loss and

recovery of righting reflex).

Motor coordination activity: It was recorded in five

groups of (n=6) to the integrity of motor co-ordination

was assessed with a rota-rod apparatus at a rotating speed



of 8 rpm, by counting the number of falls from the rod in 3

min after 30, 60 and 120 min of treatments. The animals

were placed on a rotating bar (2.5 cm diameter).

Unaclimatised mice were able to remain on the rod for 3

or more min in two successive trials was selected for

testing. 5 Groups of six mice in each were treated with

NnG extract at doses 50mg/kg, 100mg/kg and 200mg/kg

p.o. and 2% tween 80(10 ml/kg p.o.), Diazepam (2mg/kg

i.p).

Locomotor activity: The locomotor activity was

measured using an actophotometer(IM CORP; Ambala,

India). The movement the animal interrupts a beam of

light falling on a photocell, at which a count was recorded

and displayed digitally. Each mouse was placed

individually in the actophtometer for 10 min and basal

activity score was obtained. Subsequently, the animals

were divided into groups, each consisting of six animals.

NnG (50, 100, &200mg/kg), 2% Tween 80, diazepam

(2mg/kg, i.p) was administered and after 30 min the mice

were placed again in the actophotometer for recording the

activity scoring. The locomotor activity count was

expressed in terms of total photo beam counts/ 10 min per

group.

Anxiolytic Activity: Mice were divided into 5 groups

containing six animals in each. On day of experiment,

mice from all groups were placed in cazes. All the drugs

were administered to the respective groups in all the

models for a period of seven days and experiments was

performed one hour after the administration of last dose.

All the experiments were carried in a sound attenuated

dark room. After test with each animal, all the apparatus

was cleaned with 5% alcohol in order to eliminate any

olfactory cues which might modify the behavior of the

next animals

Light-dark model transition test in mice: The light-dark

apparatus consists of two-compartment chamber

(40×60×20cm/h) comprising of a brightly illuminated area

(40×40cm) and a dark area (40×20 cm) separated by a

wall with a round hole (7 cm diameter) was used. Mice

were placed individually in the illuminated part of the

cage and following parameters were recorded during the

test session of 5 min, total no. of crossings between the

light and dark area, total time spent in the illuminated part

of the cage, time spent in the dark part of the cage, no. of

rearings in illuminated part of the cage, no. of rearings in

dark part of the cage, no. of defecation units.

Elevated zero maze: Mice were placed at the entrance of

a closed quadrant in an elevated zero maze (5.5cm width

with a 43cm inner diameter, 70cm high, 2mm thickness),

thickness of the run way edges minimizes the chance of a

mouse slipping off. The total time spent in the two closed

quadrants, which have black walls (20cm high) and two

open quadrants, was recorded for 5 min. The total duration

of time spent in the open quadrants is thought to

negatively reflect anxiety. Room light approximately 30

lux was adjusted (Tang et al. 2002).

Cerebral activator activity (Nootropic): Wistar rats

(160-200g) were divided into following groups each

consisting of six animals. All the drugs were administered

to the respective groups in all the models for a period of

21 days and experiments were performed one hour after

the administration of last dose. All the experiments were

carried in a sound and light attenuated room. All the

groups were received Scopolamine 0.3 mg/kg, only on the

day of experiment, 30 minutes after the administration of

last dose, to induce amnesia.

Morris water maze spatial navigation: Spatial learning

and memory were assessed in the Morris water maze

using established procedures and equipment. Order of

training was: visible platform trials, hidden platform trials

and a final probe trial with the platform removed. Testing

was conducted in a circular pool (120 cm diameter) filled

45 cm deep with tap water rendered opaque with the

addition of non-toxic white paint or milk powder. Visible

and hidden platform training consisted of four trials per

session, with the rat starting facing the pool edge, in a new

quadrant on each trial. During visible training, the

platform was moved to a new quadrant location on each

trial. During hidden platform training, the platform

remained in the same quadrant for all trials across all

sessions. Trials lasted 60 seconds. If a rat did not

successfully locate the platform by the completion of the

trial, it was guided to the platform by the experimenter.

Rat remained on the platform for 15 seconds before being

placed under a warming light for the 30–45 sec intertrial

interval.

Effects of Nelumbo nucifera Gaertner Seed

Extract oral administration on spatial acquisition and

memory were investigated in the Morris water-maze. Rats

were administrated orally with NnG Seed Extract at

different doses 50,100,200mg/kg p.o. and 2% Tween 80,

piracetam for 19 consecutive days, one hour before

training. On day 14 the rats were placed in the water to

swim freely for 2 min to familiarize the environment.

From day 15 to day 19 the rats were given four training

trials per day and the learning/acquisition ability was

measured by the amount of time to locate the hidden

platform. On day 19 a spatial-probe trial was performed

with the platform removed and the rats placed randomly in

the water. CPT (crossing platform times) was measured by

counting the number of times the rats crossed the quadrant

containing the platform within 2 minutes. The CPP

(crossing platform percentage) was calculated as the ratio

of CPT to the total times the mice crossed all quadrants.



10 days later (day 29), the same experiments were

repeated with and without the platform.

Assessment of nootropic activity: The nootropic activity

was assessed using the active avoidance paradigm. The

apparatus consisted of a soundproof experimental chamber

with a grid floor which could be electrified and with a

provision for a buzzer tone. The enclosure had a clear

Perspex front sliding door, through which the animal

could be introduced into the chamber. A wooden pole,

screwed onto the inner surface of the lid of the chamber

acted as the shock free zone. In the assessment of

nootropic activity, the stimulus provided was a foot shock

of 6 mA given for a period of 10s from the electrified grid

floor. Rats were initially trained to escape the foot shock

by climbing on to the pole, i.e., the shock free zone. This

initial trial was carried out by having three trial sessions

interspersed with an interval of 10s. During each of the

initial trials, the rats were allowed to explore the apparatus

for 10s. This was followed by the foot shock for 10s. Only

those rats which were sensitive to the foot shock and could

climb the pole were included in the study. The animals

were divided into six groups, each group containing six

animals. Ethanolic extracts of NnG (50; 100 and 200

mg/kg p.o.) were administered for a period of 7 days

following which the training trial (TT) was conducted.

This consisted of 10 trial sessions interspersed with an

interval of 30s. During each trial, the rats were allowed to

explore the apparatus for 10s, followed by a buzzer tone

of 50 Hz (conditioned stimulus) for 10s. This was

followed by the foot shock for 10s.

The animal learned to associate the buzzer tone

with the impeding foot shock and was capable of avoiding

the foot shock on hearing the buzzer warning. Jumping

onto the wooden pole before the shock period was

constituted an avoidance response (AR) by the animal.

The percent AR for the 10 trials was computed. Twenty-

four hours later, a relearning trial (RT) composed of 10

trials was carried out and the number of ARs in the 10 trial

sessions was noted. Piracetam 100 mg/kg p.o was used as

the standard reference drug for comparison.

Acute Administration of Nelumbo nucifera Gaertner

extract

Rats were give a dose of 2% tween 80, 10ml/kg to the

control group, 50mg/kg, 100mg/kg, 200mg/kg doses were

give to test groups at morning 9:00 a.m . Rat Body

Temperature wsa measured by rectal thermometers.

Statistical analysis: Statistical Analysis: Statistical

analysis was carried out using Instat3 software.All results

were expressed as Mean ± S.E. Data analysis was done

using ANOVA followed by Student-Newman-Keul’s test

for multiple comparisons. A p≤0.05 level of probability

was used as criterion for significance.


In our study, ethanolic extract of Nelumbo

nucifera significantly enhanced duration of the

phenobarbitone sodium -induced hypnotic effect, which

was observed as soon as 15 min after their administration

suggesting a depressant activity on the CNS with an early

beginning. A prolongation of the phenobarbitone effect

could involve a facilitation of some inhibitory systems like

the GABA-ergic. Further investigation would be

necessary to support this supposition.

The ethanolic extracts increased the time spent

in open-sided arms of the zero-maze by the mice in a

range of doses of 50 to 200 mg/kg, producing an anti-

anxiety response similar to that observed at 2 mg/kg of

diazepam. In the extracts, the anti-anxiety response was

partially reverted when doses were increased to 100 and

200mg/kg, respectively, suggesting the presence of

sedative effects. The findings of the present study clearly

indicate that the ethanolic extracts at a dose of 200 mg/kg

significantly improve the acquisition and retention of

memory of the learned task was seen in the increase in the

percent avoidance response, thus demonstrating nootropic

activity. In our studies, the extracts demonstrated

facilitatory effect on learning and memory only after

treatment for a period of 21 days. This probably may be

attributed to the involvement of neurotransmitters since

the building of memory is augmented only when the levels

of neurotransmitters are attenuated on repeated

administration of the extracts. There is ample evidence

that the central cholinergic system has a vital role in these

processes. Nootropics have also been demonstrated to

interfere with serotonergic transmission and also have an

inhibitory effect on noradrenaline function However, con

troversial reports exist with respect to the involvement of

dopamine in learning and memory processes.

An important point is to be noted that, recently the

plus maze model is also being used to study learning and

memory processes in rodents. The impairment of learning

and memory induced by scopolamine, an anticholinergic

agent, was reflected by prolonged transfer latency from

the open arm to the closed arm.There are studies that

indicate that ‘‘stress’’ is one of the factors leading to

cognitive deficits, anxiety and peptic ulcers Prolonged

stress immobilization,extreme heat, cold and other

stressors are associated with neuron cell degeneration in

the hippocampal and other areas of the brain. Earlier

studiesconducted by various workers have revealed that

several medicinal plants possess nootropic activity, but

only a few plants like W.somnifera possess both antistress

as well as nootropic activity. Similarly, our studies

demonstrate that the plant nelumbo nucifera possesses a

combination of activities. As discussed earlier, these

properties are complementary to each other and hence the



plant could be a valuable contribution to the existing

armamentarium of nootropic agent having antistress

activity.

A = 2% Tween 80(control)

B = DZP 2mg/kg

C = NnG 50mg/kg

D = NnG 100mg/kg

E = 200mg/kg

Figure.1. Phenobarbitone induced sleeping time

Table.1.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Motor coordination

Treatment Dose (mean + S.E) Number of falling at

30 min 60min 120 min

2% tween 80 10ml/kg 0.00 0.00 0.00

NnG 50mg/kg 0.00 0.00 0.00

NnG 100mg/kg 0.00 0.00 0.00

NnG 200mg/kg 0.00 0.00 0.00

DZP 2mg/kg 1.16 ± 0.16 2.33 ± 0.21 1.25 ± 0.22

Results are expressed as mean ± SEM, (n=6) (ANOVA) and dunnett’s test

Figure.2.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Locomotor Activity

Table.2.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Locomotor Activity

Treatment Dose Counts/ 10 min (Mean ± S.E)

Basal activity After dose administration

2% tween 80 10ml/kg 398.23 + 2.05 391.5 + 9.09

NnG 50mg/kg 412.78 + 10.9 352.66 + 12.87

NnG 100mg/kg 369.26 + 25.1 299.5 + 14.59**

NnG 200mg/kg 386.5 + 4.89 201.66 + 14.58 **

DZP 2mg/kg 370.3 + 0.28* 193.83 + 5.71

**

Results are expressed as mean ± SEM, (n=6) (ANOVA) and Dunnet’s t-test, F= 55.35 df= 25, 4

The P value is < 0.01**

vs Control, P < 0.05* vs Control



Figure.3.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Light-Dark model transition

chamber

Table.3.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Light-Dark model transition chamber

Treatment Dose Time spent in

Lighted box (S)

No. crossings Time spent in

Dark box (S)

No. crossings

2% Tween 80 10ml/kg 80.0 + 8.4 17.8 ± 1.5

218.0 + 2.4 17.8 ± 1.5

NnG 50mg/kg 83.8 + 6.8 16.8 ± 2.1 215.8 + 4.8 16.8 ± 2.1

NnG 100mg/kg 199.0 + 14.59 **

14.2 ± 1.0 99.0 + 7.59 * 14.2 ± 1.0

NnG 200mg/kg 201.66 + 14.58 **

10.8 ± 1.5**

97.66 + 8.58 * 10.8 ± 1.5

*

DZP 2mg/kg 162.3 + 15.7 * 17.8 ± 1.7

132.3 + 10.7

** 17.8 ± 1.7

n=6; *p< 0.05,

**p <0.01 vs Tween 80 ( one way ANOVA followed by Dunnett’s test)

Figure.4.Effect of 70% ethanolic extract of Nelumbo nucifera Gaertner seeds on Elevated-Zero Maze

Table.4.Effect of 70% ethanolic extract of Nelumbo nucifera Gaertner seeds on Elevated-Zero Maze

Treatment Dose Time spent in

Open arms

No. entries Time spent in

closed arms

No. crossings

2% Tween 80 10ml/kg 50.0 + 6.4 9.3 ± 1.26

245.5 + 8.8 15.8 ± 1.0

NnG 50mg/kg 56.50 + 9.3 8.3± 1.4 243.8 + 8.5 12.5 ± 1.3

NnG 100mg/kg 112.8 + 8.9 10.2 ± 1.3

186.0 + 9.59 * 12.5 ± 1.3

NnG 200mg/kg 204.60 + 7.1* 18.2 ± 1.7

* 95.2 + 8.58

* 11.5 ± 1.0

*

DZP 2mg/kg 162.3 + 15.7 **

22.5 ± 1.9**

162.3 + 15.7 **

17.8 ± 1.7

n=6; *p< 0.05,

**p <0.01 vs Tween 80 (one way ANOVA followed by Dunnett’s test)



Figure.5.Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Acute administration (Regulation

of Body Temperature)

Figure.6. Effect of ethanolic extract of Nelumbo nucifera Gaertner seeds on Morris water maze

Table.5.Effect of extracts of NnG and piracetam on nootropic activity in rats Group Dose(mg/kg.bw) Day15 Day16 Day17 Day18 Day19 Day29

2% Tween80 10mL/kg 76.7±30.0 56.8±20.2 33.9±27.7 31.8±20.3 34.9±16.8 34.8±10.9

NnG 50mg/kg 63.4±33.4 43.2±25.0 34.5±21.6 24.6±12.8 28.1±14.1 17.4±12.4**

NnG 100mg/kg 55.5±31.1 32.6±19.1 33.9±11.8 25.1±12.7 16.6±16.7 16.9±10.3**

NnG 200mg/kg 52.5±30.2 37.6±21.1 33.6±12.9 22.5±13.2 14.6±15.7 14.6±10.1***

Piracetam 100mg/kg 53.5±29.5 39.5±22.3 32.6±10.7 23.6±14.7 15.5±16.4 15.8±11.3**

Values are expressed as mean ± SEM of 6 animals (n=6) **p<0.001 and ***p<0.0001 v/s 2%Tween80, n=6

SUMMARY AND CONCLUSION

The phytochemical study revealed that the

presence of Alkaloids, Carbohydrates, Glycosides,

Phenolic Compounds, Tannins, Proteins, Saponins, Fixed

Oils and Fats, Flavanoids, Triterpenes. The ethanolic

extract of Nelumbo nucifera gaertner possess depression

in general behavioral tests, and potentiation of

phenobarbitone induced sleeping time, and also shows

anxiolytic action, in dose dependent manner. The

ethanolic extract of Nelumbo nucifera gaertnershows

nootropic activity on Conditional avoidance response,

Morri’s water maze for spatial learning, but it weakly acts

on acetylcholineesterase enzyme inhibitory activity.

Further studies is needed for the isolation of an active

compound, and its exact mechanism of action of ethanolic

extract of nelumbo nucifera.

REFERENCES

Ashok D.B. Vaidya, The Status and Scope of Indian

Medicinal Plants Acting On Central Nervous System,

Indian journal of pharmacology, 29, 1997, 340-343.

Bhattacharya SK, Bhattacharya A, Chakrabarti A,

Adaptogenic activity of Siotone, a polyherbal formulation

of Ayurvedic rasayanas, Indian J Exp Biol, 38, 2000, 19–

28.

Bhattacharya SK, Kumar A, Ghosal S. Effects of

glycowithanolides from Withania somnifera on an animal

model of Alzheimer’s disease and perturbate cholinergic



markers of cognition in rats, Phytother Res, 9, 1995,110–

113.

D.C. Rogers B. Costall A.M. Domeney P.A. Gerrard M.

Greener M.E. Kelly, J.J. Hagan A.J. Hunter, Anxiolytic

profile of ropinirole in the rat, mouse and common

marmoset, Psychopharmacology, 2000, 151, 91–97.

Dr Anil Kumar, Protective Effect of St, Johns Wort

(Hypericum Perforatum) Extract On 72-Hour Sleep

Deprivation-Induced Anxiety-Like Behavior and

Oxidative Damaze In Mice, Planta Medica, 73, 2007,

1358-1364.

Jayabalan Nirmal, Chidambaram Saravana Babu,

Thanukrishnan Harisudhan and Muthiah Ramanathan,

Evaluation of behavioural and antioxidant activity of

Cytisus scoparius Link in rats exposed to chronic

unpredictable mild stress, BMC Complementary and

Alternative Medicine, 8, 2008, 8:15

Jennifer R Cracchiolo, Takashi Mori, Stanley J.Nazian,

Jun Tan, Huntington potter, and Gary W.Arendash,

Enhanced Cognitive Activity-Over And Above Social Or

Physical Activity-Is Required To Protect Alzheimers Mice

Against Cognitive Impairment, Reduce A β Desposition,

And Increase Synaptic Immunoreactivity, Neurobiol

Learn Mean, 88(3), 2007, 277-294.

Trease G. E. and Evans W. C, A textbook of

Pharmacognosy, Barliere Tindall and Co: London, XIV

edition, 330-437.

Mariz Sintaha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A REVIEW ON USE OF GENETICALLY ENGINEERED MICROORGANISMS FOR

BIOREMEDIATION OF ENVIRONMENTAL POLLUTANTS AND HEAVY METALS Mariz Sintaha

*

School of Life Sciences, Independent University, Bangladesh (IUB)


ABSTRACT Bioremediation refers to the use of organisms to remove environmental pollutants. Besides identifying

different new plasmids capable of degrading environmental pollutants, many attempts have been taken by the

genetic engineers to enhance the bioremediation potential of different microorganisms. Escherichia coli was

engineered to convert chlorinated solvents such as trichloro ethylene and the highly toxic methyl parathion

(pesticide), to non-toxic form. Escherichia coli was also engineered to remove radioactive waste (uranium) from

environment through precipitation. Pseudomonas fluorescens, Escherichia coli and C. testosterone were

engineered to degrade different Polychlorinated Biphenyls. Deinococcus geothermalis, Escherichia coli and

Ralstonia eutropha were engineered for bioaccumulation of heavy metals to remove it from environment.

Sinorhizobium meliloti and Escherichia coli were engineered for decolorization of azodye. Poly Aromatic

Hydrocarbons and 2,4-dichlorophenoxyacetate (pesticide) degrading plasmids have been identified and

transferred to indigenous bacteria of polluted soil through bioaugmentation which rendered them capable of

degrading respective pollutant effectively.

KEY WORDS: Bioremediation, heavy metals, pollutant, genetic engineering, micro organisms

INTRODUCTION

Due to the various limitations of traditional

process of cleaning environmental pollutants,

bioremediation obtained gradual attention over last

two decade. Extensive research in this field identified

many bacterial strains capable of degrading various

environmental pollutants. Many catabolic pathways

for degrading pollutants have also been identified and

explained. However, the degradative capabilities of

these strains and pathways are often limited by

various factors such as low expression of degradative

enzymes, low growth of the bacterial strains in the

contaminated environment and inability of these

strains to degrade various pollutants by same strain.

Various genetic engineering attempts have been

taken to overcome these limitations. Plasmids

containing biodegradative capabilities have been

isolated from parent strains and transformed into

bacterial strains which can survive well in the

polluted environment. Recombinant bacteria

containing several degradative plasmids have also

been produced capable of degrading various

pollutants simultaneously. The expressions of

enzymes involved in catabolic pathway have been

increased by various processes including creation of

recombinant plasmid. Many bacterial strains have

been engineered to express heavy metal transporter or

heavy metal sequestering protein for removal of

heavy metals from environment. Thus, significant

improvement is done in the field of bioremediation

using genetically engineered microorganisms.

BIOREMEDIATION OF VARIOUS POLLUTANTS

1. Biodegradation of Petroleum: In 1970s Chakrabarty

and colleagues created a bacterial strain capable of

degrading different hydrocarbon of petroleum.

Pseudomonas putida was transformed with four plasmids

CAM, OCT, XYL and NAH capable of degrading

camphor, octane, xylene and naphthalene respectively.

The resulting strain has been called superbug for its

increased metabolic capacity. Suparbug can be used to

remove oil spill from sea which poses serious health risks

to the marine creatures. Most of the engineered

microorganisms transformed to confer degradative

capability were mesophils, the organism that grow at 20-

400 centigrade temperature. However the oceans generally

have temperature below 20o centigrade where only

psychrotrophic microorganisms can grow. Tolune

degrading TOL plasmid from Pseudomonas putida PaW1

was transferred into a psychrotrophic bacteria

Pseudomonas putida Q5, which was capable of degrading

salicylate. The resultant strain was capable of degrading

both toluene and salicylate at temperature as low as 00

centigrade (Kolenc RJ, 1988).

2. Biodegradation of Chlorinated Hydrocarbon (Tri

Chloro Ethylene): Chloro ethylenes such as Tri Chloro

Ethylene (TCE) are persistent environmental pollutants

which is carcinogenic in nature. Toluene dioxygenase

(TolDox) in Pseudomonas putida found to have catalytic

activity against TCE. Pseudomonas pseudoalcaligenes

KF707 contains a multi-component enzyme Biphenyl

dioxygenase (BphDox) which is composed of alpha and




beta subunits, a ferredoxin and a ferredoxin reductase. A

recombinant Escherichia coli was produced containing

BphDox, where alpha subunit of BphDox of Pseudomonas

pseudoalcaligenes KF707 had been replaced with alpha

subunit of toluene dioxygenase from Pseudomonas putid.

It showed higher catalytic activity toward TCE (Maeda T,

2001). In another study Recombinant Escherichia Coli

was created by using Pseudomonas mendocina as donor.

It was capable of reducing the concentration of TCE as

much as 100 folds by converting it to chloride ion, CO2

and water soluble molecule.

3. Biodegradation of PCB: Polychlorinated biphenyls

(PCBs) are widely used in different industries. Since

PCB’s are heat resistant, chemically stable, less soluble in

water and highly soluble in lipid, it easily persists in

environment. PCBs are found in high concentration in soil

around industrial area and used to be removed

traditionally by incineration process. Several soil bacteria

(such as Burkholderia sp. strain LB400) have been found

to have enzymes encoded from bph operon which convert

PCB to chlorobenzoate and 2-hydroxypenta-2, 4-dienoate.

Since Burkholderia sp. strain LB400 cannot survive well

in natural environment, a derivative of Pseudomonas

fluorescens F113 has been transformed with bph operon

Table 1-List of Environmental Pollutants (Vidali, 2001) and Respective Genetically Engineered Microorganism for Bioremediation Class of

contaminants

Specific examples Sources Microorganism Reference

Hydrocarbon of

Petroleum

Naphthalene,

Xylene,

Octane,

Toluene,

Salicylic acid.

Fuel company Pseudomonas putida (Chakrabarty, 1970)

(Kolenc RJ, 1988)

Chlorinated

Solvents

Trichloroethylene,

Perchloroethylene.

Drycleaners,

Chemical manufacture.

Escherichia coli (Maeda T, 2001)

(Robert B. Winter,

1989)

Polychlorinated

Biphenyls (PCB)

4-Chlorobiphenyl,

4,4-Dichlorobiphenyl.

Electrical manufacturing,

Power station,

Railway yards.

Pseudomonas fluorescens,

Escherichia coli,

C. testosterone.

(Erickson BD, 1993)

(Hrywna Y, 1999)

Pesticides Atrazine ,

Carbaryl,

Carbofuran, Coumphos,

Diazinon,

Glycophosphate,

Propham,

2,4-D,Parathion.

Agriculture,

Timber treatment plants,

Pesticide manufacture,

Recreational areas,

Landfills.

Indigenous bacteria of soil (Inoue D, 2012)

(Li L, 2008)

Radioactive

Waste

Uranium

Nuclear reactor Escherichia coli (Nilgiriwala KS,

2008)

Dye Azodye Garment Effluent Sinorhizobium meliloti,

Escherichia coli.

(Schlüter A, 2007)

Poly Aromatic

Hydrocarbons

(PAHs)

Naphthalene, Antracene,

Fluorene,

Pyrene, Benzo(a)pyrene.

Oil production &

storage,

Gas work sites,

Coke plants,

Engine works,

Landfills,

Tar production & storage

oiler ash dump sites,

Power stations.

Indigenous bacteria of soil (Juhasz A. , 1998)

Heavy Metal Iron,

Chromium,

Arsenic,

Cadmium,

Mercury.

Industrial Waste Deinococcus geothermalis,

Escherichia coli,

Ralstonia eutropha.

(Hassan Brim1, 2003)

(Jan Kostal, 2004)

(Kim SK, 2005)

(Wilson, 1997)



under its own promoter. This bacteria use PCB as sole

carbon source and showed greater survival since it resides

in rhizosphere. To increase the expression of bph operon,

bph operon was cloned under Nod promoters since these

promoters have high expression inside Pseudomonas

fluorescens F113. In a separate study, fusion of Nod

promoter created using nodbox 4 alone and the

nodD1 from Sinorhizobium meliloti resulted in three times

higher expression (M. Whelan, 2005). In another study,

shuffled bph A1 gene was produced by recombination

using Pseudomonas pseudoalcaligenes KF707 and

Burkholderia cepacia LB400. The shuffled bphA1 gene

and other genes of bph operon (bphA2A3A4BC) taken

from Pseudomonas pseudoalcaligene KF707 were used to

transform Escherichia coli JM109. The recombinant E.

coli JM109 showed higher degradation of different

biphenyl compounds due to the presence of chimeric

Biphenyl Dioxygenases (Kumamaru T, 1998). The

substrate specificity of PCB was increased when site

directed mutagenesis was used to convert bphA of LB400

to the corresponding sequence of KF707 (Erickson BD,

1993). Other than E. coli, C. testosteroni was also

transformed by using two plasmids pE43 (containing

ortho dechlorination ohb gene) and pPC3 (containing para

dechlorination fcb gene) to produce C. testosterone VP44

capable of degrading both ortho- and para- chlorinated

biphenyl (Hrywna Y, 1999).

4. Biodegradation of Pesticide (2,4 Dichloro

phenoxyacetate and Methyl Parathion): 2,4-

dichlorophenoxyacetate(2,4-D) is the most widely used

herbicide of this world and identified as "possibly

carcinogenic to humans" by the International Agency for

Research on Cancer (IARC) (Lyon, 1987). Pseudomonas

putida or Escherichia coli contain 2,4-D degradative

plasmid pJP4 which was introduced into soil bacteria by

bioaugmentation. Gene bioaugmentation is the process of

receiving a degradative plasmid by indigenous bacteria in

environment from a newly introduced bacteria via

dissemination. Bioaugmentation conferred the indigenous

bacteria the 2.4-D degradation capability without any

irretrievable depressive effects (Inoue D, 2012).

Methyl parathion (MP) is a widely used pesticide

which is found to be highly toxic. Parathion disrupts

the nervous system by inhibiting acetylcholinesterase (S.

Kegley). It is already restricted or banned into many

countries. Even treatment of methyl parathion containing

water may cause release of it in the environment.

Escherichia coli BL21 was genetically modified for high

express methyl parathion hydrolase, which causes

hydrolysis of methyl parathion and release of p-

nitrophenol (PNP). A laboratory-scale bioreactor

containing genetically modified Escherichia coli BL21

and PNP degrading Ochrobactrum sp. strain LL-1 caused

98% removal of MP and 100% removal of PNP (Li L,

2008).

5. Bioremediation of Radioactive Waste: Radioactive

Uranium is highly toxic to heart, renal system,

reproductive system, central nervous system, immune

system and DNA (Craft, Abu-Qare, Flaherty, Garofolo, &

Rincavage, 2004). phoK gene from Sphingomonas sp.

strain BSAR-1 was cloned and over expressed in

Escherichia coli strain BL21(DE3) which showed 13

times higher secretion of alkaline phosphatase in the

extracellular medium than BSAR-1 and quickly

precipitated more than 90% percent added uranium

(Nilgiriwala KS, 2008).

6. Biodegradation of Triphenylmethane Dye: Plasmid

pGNB1 confers resistance to the triphenylmethane dyes

via its tmr gene observed by the decolorization of the dyes

such as crystal violet, malachite green and basic fuchsin to

a non-toxic form. This plasmid was found to be

transferable to Sinorhizobium meliloti and Escherichia

coli. Since pGNB1 was originally found in activated

sludge compartment of a wastewater treatment plant,

bacteria transformed with it, can easily be used to treat

sewage polluted with triphenylmethane dyes (Schlüter A,

2007).

7. Biodegradation of Poly Aromatic Hydrocarbons

(PAHs): Over decades many PAH degrading bacterial

strains have been isolated. But these microorganisms are

not naturally present in the soil which is highly

contaminated with PAHs. Bioaugmentation is the

technique that can be used to overcome this limitation.

PAH degrading capability can be transferred from the

strains found to be capable of degrading PAHs to the soil

bacteria which are newly contaminated with PAHs and

does not have an adapted microbial population through

bioaugmentation (A.L Juhasz, 1996). Five strains of

Burkholderia cepacia have been found to be capable of

using PAHs as sole carbon source (Juhasz A. B., 1997).

The biodegradation capability of these strains was

successfully transferred to indigenous soil bacteria by

bioaugmentation after a lag period (Juhasz A. , 1998).

Though PAH degrading pathways are exist in many

bacterial strains, inability of PAHs to pass bacterial cell

wall limits the degradation of PAHs by these strains.

BIOREMEDIATION OF HEAVY METAL

Deinococcus radiodurans is the best characterized

strain of Deinococcaceae bacterial family. So it had been

transformed with plasmids pMD727 which rendered it

capable of degrading various heavy metals. Deinococcus

geothermalis was isolated from hot spring and was found

to be resistant to ionizing radiation and capable of

http://en.wikipedia.org/wiki/International_Agency_for_Research_on_Cancer

http://en.wikipedia.org/wiki/International_Agency_for_Research_on_Cancer

http://en.wikipedia.org/wiki/Nervous_system

http://en.wikipedia.org/wiki/Acetylcholinesterase



growing at high temperatures around 55°C

(Ferreira, 1997). Where D. radiodurans degrades

waste at temperatures less than 39°C and cannot

grow in nutritionally restricted environment, D.

geothermalis grow in high-temperature and

nutritionally restricted environment without

exogenous amino acids. So D. geothermalis was

transformed with plasmids pMD727 designed for D.

radiodurans yielding strain MD865 which showed

efficient conversion of heavy metals from toxic to

non-toxic form. Following 14 h of incubation with

Hg(II) in a microplate at 32°C strain MD865

showed substantial Hg(0) volatilization. It Reduced

Fe(III)- nitrilotriacetic acid in the presence of

lactate or pyruvate at 45°C, reduced Cr(VI) in

under both aerobic and anaerobic conditions at

40°C and reduced U(VI) only in the presence of the

AQDS at 40°C. Thus D. geothermalis transformed

with pMD727 was metabolically proficient,

extremely radiation-resistant, capable of growing at

high temperature and efficient for bioremediation of

heavy metal & radionuclides (Hassan Brim1, 2003).

Thermus thermophilus HB8 contains arsentie

oxidase capable of oxidizing arsenic from toxic to

non toxic form. The small and large subunits of

arsentie oxidase is encoded by TTHB128 and

TTHB127 genes respectively. These genes were

cloned into broad-host-range vector pBBR1MCS-5

and it was used to transform various

microorganisms rendering them capable of

oxidizing 87.6% arsenite (Yang C, 2010). The

metallo regulatory protein ArsR has high affinity to

arsenite. When it was over expressed in Escherichia

coli, increased bioaccumulation of arsenite occurred

but the cell growth was reduced. When an elastin-

like polypeptide (ELP153) was fused with ArsR, it

showed improved cell growth without altering its

arsenite bioaccumulation ability. Thermus thermophilus HB8 contains arsentie oxidase capable of oxidizing arsenic from toxic to non toxic form. The small and large subunits of arsentie oxidase is encoded by TTHB128 and TTHB127 genes respectively. These genes were cloned into broad- In total the genetically modified cell accumulated 5-

and 60-fold-higher levels of arsenate and arsenite

than control cells (Jan Kostal, 2004).

A heavy metal tolerant species Ralstonia

eutropha was modified so that it expresses mouse

metallothionein on the cell surface. When this was

introduced in the soil contaminated with Cd2+, it

significantly decreased the toxicity symptom of

Cd2+ in model plant (F.Valls M, 2000). An

Escherichia coli transformed with a manganese

transport gene (mntA) and a metal-sequestering

protein (metallothionein or MT) gene showed six

time higher accumulation of Cd2+ ion in an

aqueous phase than control (Kim SK, 2005).

An Hg2+ transport system and metallothionein

was intrudced into Escherichia coli for the

bioaccumulation of Hg2+. When glutathione S-

transferase fusion protein of Saccharomyces

cerevisiae or pea metallothionein was

overexpressed in the same cell, it significantly

increased the bioaccumulation of Hg2+ and also

protected the cell from its harmful effect (Wilson,

1997).

CONCLUSION

During the past 20 years, recombinant DNA

techniques have been studied intensively to improve

the degradation of hazardous wastes under

laboratory conditions. However, relatively few

examples of GEM applications in environmental

ecosystems exist. Unfortunately, the only manner to

fully address the competence of GEMs in

bioremediation efforts is long-term field release

studies. It is therefore essential to performed field

studies to acquire the requisite information for

determining the overall effectiveness and risks

associated with GEM introduction into natural

ecosystems.

REFERENCES

http://mynature-myfuture.blogspot.com/. (2009, August

07). Retrieved from Superbug: solution to the oil

pollution : http://mynature myfuture. blogspot. com

/2009/08/superbug-solution-to-oil-pollution.html

A.L Juhasz, M. B. (1996). Degradation of high

molecular weight polycyclic aromatic hydrocarbons by

Pseudomonas cepacia. Biotechnology Letters, 18, 577–

582.

Bernard R. Glick, J. J. (n.d.). Molecular Biotechnology:

Principles and Applications of Recombinant DNA. ASM

Press.

Copley SD, R. J. (2011, December 20). The whole

genome sequence of Sphingobium chlorophenolicumL-

1: insights into the evolution of the pentachlorophenol

degradation pathway. Genome Biol Evol.



Craft, E. S., Abu-Qare, A. W., Flaherty, M. M.,

Garofolo, M. C., & Rincavage, H. L.-D. (2004).

Depleted and natural uranium: chemistry and

toxicological effects. Journal of Toxicology and

Environmental Health.

Erickson BD, M. F. (1993, November). Enhanced

biodegradation of polychlorinated biphenyls after site-

directed mutagenesis of a biphenyl dioxygenase gene.

Appl Environ Microbiol., 59(11), 3858–3862.

F.Valls M, A. S. (2000). Engineering a mouse

metallothionein on the cell surface of Ralstonia eutropha

CH34 for immobilization of heavy metals in soil. Nat

Biotechno., 18, 661-665.

Ferreira, A. C. (1997). Deinococcus geothermalis sp.

nov. and Deinococcus murrayi sp. nov.,two extremely

radiation-resistant and slightly thermophilic species from

hot springs. Int. J. Syst. Bacteriol., 47, 939-947.

Fu-min menn, J. P. (n.d.). Genetically Engineered

Microorganisms and Bioremediation. Knoxville, TN

37996-1605.

Hassan Brim1, A. V. (2003, August). Engineering

Deinococcus geothermalis for Bioremediation of High-

Temperature Radioactive Waste Environments. Appl.

Environ. Microbiol., 69(8), 4575-4582.

Hrywna Y, T. T. (1999). Construction and

characterization of two recombinant bacteria that grow

on ortho- and para-substituted chlorobiphenyls. Appl.

Environ. Microbiol., 65, 2163–2169.

Inoue D, Y. Y. (2012, April). Impacts of gene

bioaugmentation with pJP4-harboring bacteria of 2,4-D-

contaminated soil slurry on the indigenous microbial

community. Biodegradation., 23(2), 263-76.

Jan Kostal, 1. R. (2004, August). Enhanced Arsenic

Accumulation in Engineered Bacterial Cells Expressing

ArsR. Appl Environ Microbio, 70(8), 4582–4587.

Juhasz, A. (1998). Microbial degradation of high

molecular weight polycyclic aromatic hydrocarbons.

Ph.D. Thesis. Victoria University of Technology,

Melbourne, Australia.

Juhasz, A. B. (1997). Degradation of fluoranthene,

pyrene, benz[a]anthracene and dibenz[a,h]anthracene by

Burkholderia cepacia. Journal of Applied Microbiology,

83(2), 189-198.

Kim SK, L. B. (2005, February). Selective cadmium

accumulation using recombinant Escherichia coli. 99(2),

109-14.

Kolenc RJ, I. W. (1988, March). Transfer and expression

of mesophilic plasmid-mediated degradative capacity in

a psychrotrophic bacterium. Appl Environ Microbiol.,

54(3), 638-41.

Kumamaru T, S. H. (1998, July). Enhanced degradation

of polychlorinated biphenyls by directed evolution of

biphenyl dioxygenase. Nat Biotechnol., 16(7), 663-6.

Li L, Y. C. (2008, March 15). Removal of methyl

parathion from artificial off-gas using a bioreactor

containing a constructed microbial consortium. Environ

Sci Technol., 42(6), 2136-41.

Lyon. (1987). IARC monographs on the evaluation of

carcinogenic risks to humans. Monograph, IARC,

France.

M. Whelan, C. M. (2005, May). Polychlorinated

Biphenyl Rhizoremediation by Pseudomonas fluorescens

F113 Derivatives, Using a Sinorhizobium meliloti nod

System To Drive bph Gene Expression. Appl Environ

Microbiol, 71(5), 26.

Maeda T, T. Y. (2001, August 10). Functional analyses

of Bph-Tod hybrid dioxygenase, which exhibits high

degradation activity toward trichloroethylene. J Biol

Chem., 276(32), 29833-8.

Nilgiriwala KS, A. A. (2008). Cloning and

overexpression of alkaline phosphatase PhoK from

Sphingomonas sp. strain BSAR-1 for bioprecipitation of

uranium from alkaline solutions. Appl Environ

Microbiol., 74(17), 5516-23.

Rattan K, S. R. (1999, October1). Stress Survival of a

Genetically Engineered Pseudomonas in Soil Slurries:

Cytochrome P-450cam-Catalyzed Dehalogenation of

Chlorinated Hydrocarbons. Biotechnol Prog., 15(5),

958-962.

Robert B. Winter, K.-M. Y. (1989). Efficient

Degradation of Trichloroethylene by a Recombinant

Escherichia Coli. Nature Biotechnology, 282 - 285.

S. Kegley, B. H. (n.d.). Parathion - Identification,

toxicity, use, water pollution potential, ecological

toxicity and regulatory information. Retrieved from

Pesticide Action Network North America (PANNA):

http://www.pesticideinfo.org/Detail_Chemical.jsp?Rec_I

d=PC35122

Schlüter A, K. I. (2007, October). IncP-1-beta plasmid

pGNB1 isolated from a bacterial community from a

wastewater treatment plant mediates decolorization of

triphenylmethane dyes. Appl Environ Microbiol, 73(20),

6345-50.

Vidali, M. (2001). Bioremediation. An overview. Pure

Appl. Chem., Vol., 73(7), 1163–1172.



Wilson, S. C. (1997). Construction and characterization

of Escherichia coli genetically engineered for

bioremediation of Hg(2+)-contaminated environments.

Appl Environ Microbiol. .

Yang C, X. L. (2010). Construction of a genetically

engineered microorganism with high tolerance to

arsenite and strong arsenite oxidative ability. J Environ

Sci Health A Tox Hazard Subst Environ Eng., 45(6),

732-7.

Sreenu Thalla et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


HEPATOPROTECTIVE EFFECT OF HYDROALCOHOLIC EXTRACT OF Ocimum

gratissimum LEAVES ON RIFAMPICIN-ISONIAZID INDUCED RATS Sreenu Thalla*,Venkata Ramana K, Delhiraj N

A.S.N Pharmacy College, Tenali, Guntur (dt), Andhra Pradesh, India


ABSTRACT

Ocimum gratissimum leaves used for treatment of jaundice in Ayurvedic medicine. Adult male wistar rats

were rendered hepatotoxicity by Rifampicin-Isoniazid(50mg/kg each) by intraperitonially for 14days while leaf

extract (100mg/kg and 200mg/kg) was administered orally for 14 days. Administration of leaf extract (100mg/kg

and 200mg/kg) resulted in a significant (p<0.01) increased in plasma and hepatic lipid profiles. The extract

suppresses cytochrome P-450 activity. Decreased levels of transaminases indicate stabilization of plasma

membrane and protection of hepatocytes against damage caused by hepatotoxin. The levels of SOD, catalase,

GSH significantly decreased along with concentration of malondialdehyde in these groups indicating increased

lipid peroxidation. Histomorphological findings also supported the biochemical findings. The present study

demonstrates that administration of leaf extract (100mg/kg and 200mg/kg) has significant hepatoprotective

activity as evidenced by the biochemical, functional and histopathological parameters.

KEY WORDS: Hepatotoxicity, Ocimum gratissimum Aspartate transaminase (AST), Alanine transaminase

(ALT), Glutathione (GSH)

1. INTRODUCTION

The world Health Organization (WHO) estimates

that 4 billion people, 80% of the world population,

presently use herbal medicine for some aspect of primary

health care. Herbal medicine is a major component in all

indigenous people’s traditional medicine and a common

element in ayurvedic, homeopathic, naturopathic,

traditional oriental and Native American Indian medicine.

WHO notes that 119 plant-derived pharmaceutical

medicines, about 74% are used in modern medicine in

ways that correlated directly with their traditional uses as

plant medicines by native cultures. Major pharmaceutical

companies are currently conducting extensive research on

plant materials gathered from the rain forests and other

places for their potential medicinal value (Sreenu Thalla,

2011). Over thousands of years; traditional Chinese

medicine has developed a theoretical and practical

approach to the treatment and prevention of diseases. The

first documented source of Chinese medical theory, the

Huangdi Nei Jing (“Inner Classic of the Yellow

Emperor”) was written between 300 and 100 BC. It

describes the diagnosis and treatment of a huge range of

disorders and gives advice about healthy lifestyles,

exercise, and diet, which conforms remarkably well to

current recommendations for the prevention of chronic

diseases.

The liver is a key organ regulating homeostasis

within the body. It has wide range of functions, including

detoxification, protein synthesis and production of

biochemicals necessary for digestion. This organ plays a

major role in metabolism and has a number of functions in

the body including glycogen storage, decomposition of red

blood cells, plasma protein synthesis, hormone production

and detoxification. It lies below the diaphragm in the

thoracic region of the abdomen. It produces bile, an

alkaline compound which plays in the digestion via

emulsification of lipids. It is also performs and regulates a

wide variety of high-volume biochemical reactions

requiring highly specialized tissues including the synthesis

and breakdown of small and complex molecules many of

which are necessary for normal vital functions. Substances

derived from the plants remain the basis for a large

proportion of the commercial medications used today for

the treatment of heart disease, high blood pressure, pain,

asthma and other problems. In spite of phenomenal

growth of allopathic system of medicine the synthetic drug

to prevent or cure the hepatic damage due to various

hepatotoxins is not available. Treatment of hepatotoxicity

with plants or plant preparations and medicaments has

been mentioned in the ancient indigenous systems of

medicine of many countries. Even today, rural folks and

aboriginal tribes all over the world, including India, are

using many plants in the treatment of liver damage.

Up-regulation of hepatic metabolism of hormones

decreases their levels, and Rifampicin can also in similar

fashion reduce the efficacy of hormonal contraception to

the extent the unintended pregnancies have been reported

among users of oral contraceptives taking Rifampicin in

even short courses (for example, as prophylaxis against

exposure to bacterial meningitis). Ocimum gratissimum is

containing alkaloids, flavonoids, volatile oils, steroids.

Traditionally the plant Ocimum gratissimum is claimed to

treat cytoprotective (Sreenu Thalla, 2012). So we can use

Ocimum gratissimum as hepatoprotective drug which is

caused by Rifampicin- Isoniazid induced liver toxicity

(Abbas L, 2005). Keeping in view all the literature survey

the present study was planned to evaluate the activity




hepatoprotective. An attempt is also made to evaluate its

effect on liver metabolic functions.


2.1. Animals: Male Wistar rats weighing (150-200g) were

obtained and they were maintained in animal house as per

IAEC guidelines. Animals were access to standard pellet

diet and water given ad libitum. The study was approved

by Institutional animal ethical committee, IAEC/131/2012.

2.2. Plant material: The leaves of Ocimum gratissimum

used in the present study was collected from the natural

habitat in and around Chennai, Tamilnadu and the plant

material was authentified by Dr.P.Jayaraman Ph.D., Plant

Anatomy Research Centre(PARC),Tambaram. Voucher

number is PARC/2012/803.

2.3. Plant extraction: The fresh leaves of Ocimum

gratissimum were collected. It was defatted using

petroleum ether. The marc obtained was dried and

subjected to extraction by adding dried leaf powder of

distilled water (1:10), heated to 50-600C under constant

stirring conditions for 1hour and filtered. The methanol

extract was prepared by using Soxhlet’s appataratus

(Sreenu Thalla, 2011).

2.4. Phytochemical screening: The alcoholic extracts

obtained were subjected to preliminary phytochemical

screening (Kokate CK,) to identify the chemical

constituents. The methods of analysis employed were

those described by Harbon et al., 1973.

2.5. Induction of hepatotoxicity: Hepatotoxicity was

induced by administering the Rifampicin-Isoniazid

(50mg/kg each, i.p) for 14 days in Albino Wistar rats

(Sreenu Thalla, 2011)

2.6. Experimental design: In experiment, totally 24 rats

used. The rats were divided into 4groups of six animals

each

Group I: Control (saline) 5ml/kg, p.o

Group II: Inducing agent (Rifampicin-Isoniazid),

each 50mg/kg, i.p

Group- III Inducing agent 50mg/kg, i.pand

hydroalcoholic leaf extract,100mg/kg,p.o

Group IV: Inducing agent 50mg/kg, i.p and

hydroalcoholic leaf extract, 200mg/kg,p.o

Animals were fasted overnight, the hydroalcoholic

extract of Ocimum gratissimum (100mg/kg, 200mg/kg)

was given orally for 14 days to the third and fourth group

of animals with liver damage induced by Rifampicin-

Isoniazid (50mg/kg) was administered intraperitoneally for

all 14days. At 15th

day 1ml Blood was collected from all

animals by Retro-orbital bleeding for the evaluation of

serum parameters like Aspartate transaminase (AST),

Alanine transaminase (ALT), Alkaline phosphatase

(ALP), Total serum proteins, Bilrubin.Then animals were

sacrificed and liver tissues was used for histopathological

study (Sreenu Thalla, 2012).

2.7. Preparation of rat liver homogenate: Tissue

homogenate was prepared in a ratio of 1 g of wet tissue to

10 times (w/v) 0.05M-ice cold phosphate buffer (pH 7.4)

and homogenized by using a Teflon homogenizer. 0.2 ml

of sample homogenate was used for estimation of Thio-

Barbituric Acid Reactive Substance (TBARS). The

remaining part of the homogenate was centrifuged at

15,000 g at 4°C for 60 minutes and the supernatant was

used for superoxide dismutase, catalase and HMG-CoA

estimation

2.8. Histopathological study of liver: Liver was collected

after the rats were sacrificed in 10% formalin solution and

utilized for the histopathological studies. Liver was

separated from all the groups and blotted free of blood and

tissue fluids. They were fixed in bovine’s fluid (picric

acid:Formalin:Acetic acid in the ratio of 75:52:5). After

24 hours the tissues were washed thoroughly in 70%

alcohol and then dehydrated in ascending grades of

alcohol (70,100%). Dehydration in absolute alcohol was

followed by treatment of tissue with toluene:xyline

(50:50) successively by 10%, 50%, 70%, 90% paraffin

wax in toluene and finally to 100 % paraffin wax, at 60-

62º C followed by embedding of tissue in wax.5-15 micro-

meter thick sections were serially cut in leitz microtome in

horizontal plane and mounted on glass slides with the help

of egg albumin in glycerin solution (50% v/v). The

sections were de-paraffinated in xylene and downgraded

through 100, 90, 50 and 30% alcohol and then finally in

water. They were then stained with105 hematoxylin for 3-

5 minutes and staining was intensified by running water.

The hematoxylin stained section was stained with 10%

eosin for two minutes and were then quickly passed

through ascending grades of alcohol and finally treated

with xylene followed by mounting in DPX. The sections

were observed and desired area was photographed in an

Olympus microscope. The sections were observed under

40X magnifications.

2.9. Statistical analysis: All the data were expressed as

mean ± SEM. Statistical significance was tested using one

way ANOVA followed by the Dunnet’s t test using

computer based fitting program (Prism, Graph pad.).

Statistical significance was determined at P < 0.05.


Literature survey indicates that there is no

scientific evidence to support hepatoprotective activity,

therefore the present study is undertaken to investigate the

actions of hydroalcoholic extract of Ocimum gratissimum



leaves in Rifampicin-Isoniazid induced rats ascertain used

to scientific basis.

3.1. Phytochemical screening: Preliminary

phytochemical screening of the plant extract of Ocimum

gratissimum reveals the presence of alkaloids,

carbohydrates, phytosterols, glycosides, saponins, tannins

and phenollic compounds.

3.2. Histopathology of liver: The use of rats as

experimental animals for hepatoprotective activity is

mainly because of the structural homology of rat CYP 450

enzymes with that of humans (Burke, 1994) and moreover

female rats are less susceptible to chemical induced liver

damage, especially hydroxyl-proline accumulation. So, we

had used male rats in our study. Rifampicin acts directly

on messenger RNA synthesis. Isoniazid inhibits the

mycolic acid synthesis. Necrosis or membrane damage

releases the enzymes into circulation and hence it can be

measured in the serum. The reversal of increased serum

enzymes in Rifampicin-Isoniazid induced liver damage by

the extract may be due to the prevention of the leakage of

intracellular enzymes by its membrane stabilizing activity

(Serum biochemical parameters).

Amino transferases contribute a group of enzymes

that catalyse the inter-conversion of amino acids and α-

keto acids by the transfer of amino groups. These are liver

specific enzymes and are considered to be very sensitive

and reliable indices for necessary hepatotoxic as well as

hepatoprotective or curative effect of various compounds.

Both AST and ALT levels increase due to toxic

compounds that affect the integrity of liver cells.

Decreased levels of transaminases indicate stabilisation of

plasma membrane and protection of hepatocytes against

damage caused by hepatotoxin. Both the test groups could

significantly lower the elevated amino transferase levels

when compared to Rifampicin-Isoniazid group. This is in

agreement with the commonly accepted view that serum

levels of transaminases return to normal with the healing

of hepatic parenchyma and the regeneration of

hepatocytes. Moreover, the Test extract (200mg/kg,p.o)

showed a remarkable decrease in the enzyme levels than

the Test extract (100 mg/kg,p.o) indicating the greater

hepatoprotective activity (Sreenu Thalla, 2011).

Alkaline phosphatase is a membrane bound

glycoprotein enzyme with a high concentration in

sinusoids and endothelium. This enzyme reaches the liver

mainly from the bone. It is excreted into the bile; therefore

its elevation in serum occurs in hepatobiliary diseases.

Serum alkaline phosphatase is related to the functioning of

hepatocytes and increase in its activity is due to the

increased synthesis in presence of biliary pressure. The

results of the present study indicate that both Test groups

probably stabilize the hepatic plasma membrane from

Rifampicin-Isoniazid induced damage. Reduction of

alkaline phosphatase levels with concurrent depletion of

raised bilirubin levels suggests the stability of biliary

function during injury with Rifampicin-Isoniazid.There

was a remarkable reduction in the bilirubin levels of both

Test groups implying its potential as hepatoprotective

agent (Sreenu Thalla, 2012).

The liver was also known to play a significant role

in the serum protein synthesis, being the source of plasma

albumin, fibrinogen and also the other important

components like α and β-globulin. The liver is also

concerned with the synthesis of γ- globulin. The serum

albumin level is low in hepatic diseases. The metabolic

biotransformation of amino acids in liver by synthesis,

transamination, etc., may be impaired due to the escape of

both non-proteins and protein nitrogenous substances from

injured cells as mediated by raise in the serum enzyme

levels of ALP, AST and ALT. The reduction in the total

protein (TP) is attributed to the initial damage produced

and localised in the endoplasmic reticulum which results

in the loss of CYP 450 leading to its functional failure

with a decrease in protein synthesis and accumulation of

triglycerides leading to fatty liver. The Test groups

considerably enhanced the synthesis of TP which may be

by accelerating the regeneration process and protecting the

liver cells. The increased levels of total protein in serum

are indicative of the hepatoprotective activity.

Inhibition of bile acid synthesis from cholesterol

which is synthesized in liver or derived from plasma lipids

leading to an increase in cholesterol levels also results

during Rifampicin-Isoniazid intoxication. Significant

suppression of cholesterol levels by both the Test groups

suggests that bile acid synthesis inhibition was reversed.

Decrease in enzyme activity of superoxide dismutase

(SOD) is a sensitive index of hepatocellular damage and is

the most sensitive enzymatic index in liver injury. Curtis

and Mortiz (Curtiz, 1972) reported SOD as one of the

most important enzymes in the enzymatic antioxidant

defense system. It scavenges the superoxide anion to form

hydrogen peroxide and thus diminishes the toxic effect

caused by this radical. The Test groups showed a

markable increase in the SOD levels when compared to

the Rifampicin-Isoniazid treated group. (Tissue and

funcitional parameters present in Table.2)

Catalase (CAT) is an enzymatic antioxidant

widely distributed in all animal tissues and its highest

activity is found in the red blood cells and liver. CAT

decomposes hydrogen peroxide and protects the tissues

from highly reactive hydroxyl radicals. Therefore,

reduction in the activity of CAT may result in a number of

deleterious effects due to the assimilation of superoxide

radical and hydrogen peroxide. The Test groups showed a



drastic increase in the catalase levels when compared to

the Rifampicin-Isoniazid treated group. This clearly

implies the antioxidant ability of Ocimum gratissimum.

Glutathione (GSH) is one of the most abundant tripeptide,

non-enzymatic biological antioxidant present in the liver.

It removes free radical species such as hydrogen peroxide,

superoxide radicals and maintains membrane protein

thiols. Also it is a substrate for glutathione peroxidase

(GPx). Decreased levels of GSH are associated with an

enhanced lipid peroxidation in Rifampicin-Isoniazid

treated rats. Test group was found to produce a rise in the

collapsed GSH levels when compared to Rifampicin-

Isoniazid group.This demonstrates an increase in the liver

tissue GSH levels.

The activated radicals bind covalently to the

macro molecules and induce peroxidative degradation of

membrane lipids of endoplasmic reticulum rich in

polyunsaturated fatty acids. This leads to the formation of

lipid peroxides, which in turn give products like

malondialdehyde (MDA) that cause damage to the

membrane. MDA levels have seen a dramatic reduction in

Test groups. This may be attributed due to the anti lipid

peroxidative potential of Test groups which could

considerably decrease MDA levels. This might be due to

the presence of alkaloids in our plant which are

responsible for antioxidant activity. The extent of hepatic

damage is assessed by histological evaluation along with

the levels of various biochemical parameters in

circulation. The animals in the Rifampicin-Isoniazid group

showed severe hepatotoxicity evidenced by profound

steatosis, centrilobular necrosis, ballooning degeneration,

nodal formation and fibrosis as compared to the normal

hepatic architecture of the control group animals. Test

groups showed the healing of damaged parenchyma .The

efficacy of any hepatoprotective drug is dependent on its

capacity of either reducing the harmful effect or restoring

the normal hepatic physiology that has been disturbed by a

hepatotoxin. Both the Test groups decreased Rifampicin-

Isoniazid induced elevated enzyme levels, indicating the

protection of structural integrity of hepatocytic cell

membrane or the regeneration of damaged liver cells.Both

the test groups showed hepatoprotective activity. The Test

group containing the plant extract showed an

improvement in the liver activity. It clearly indicates that

the plant “Ocimum gratissimum” has the hepatoprotective

potential which is independent. Thus, the drastic

improvement in liver functions may be due

phytoconstituents present in Ocimum gratissimum. The

activity of extract is due to the chemical constituents

present in it like the flavonoids, triterpenoids, saponins

and alkaloids are known to possess hepatoprotective

activity. Along with these, the antioxidants and

prooxidants in our plant i.e. Ocimum gratissimum might

be responsible for its antioxidant and thus

hepatoprotective activity (Sreenu Thalla, 2011).

In summary, this study suggests that the oral

administration of Ocimum gratissimum alone significantly

ameliorates Rifampicin-Isoniazid induced hepatotoxicity

in rats. The extract may be protecting the liver by free

radical scavenging activity and thus preventing

peroxidation of lipids of the endoplasmic reticulum. And

this may be due to the presence of flavonoids and

alkaloidal pigments in our extract. However, the

possibility that Ocimum gratissimum might suppress the

cytochrome P-450 mediated metabolic activation of

Rifampicin-Isoniazid cannot be ruled out.

Figure.1.Histopathology of liver

A B C D

A= Control B=Rifampicin+Isoniazid (50mg/kg each)

C= Rifampicin+Isoniazid (50mg/kg each) +leaf extract

(100mg/kg, p.o)

D= Rifampicin+Isoniazid (50mg/kg each) +leaf extract

(200mg/kg, p.o)



Table 1.Effect of Ocimumgratissimum on serum biochemical parameters

All values are shown as mean ± SEM and n=6.

# indicate p< 0.05,##indicate p<0.01, ### indicate p<0.001 when compared to control group.

* indicate p<0.05, ** indicate p<0.01, *** indicate p<0.001 when compared to Rifampicin-Isoniazidgroup.

AST: AsparatateAminotransaminase, ALT: Alanine Aminotransaminase, ALP: Alkaline phosphatase, TB: Total bilirubin.

Table 2.Effect of Ocimumgratissimum on tissue and functional parameters

Group

SOD(U/mg

protein)

CAT(µM

H2O2consumed/mg

protein)

Reduced GSH(µg of

GSH/mg protein)

MDA (nM of

MDA/mg protein)

Control (saline) 8±0.80 10.68±0.54 9.854±1.002 0.448±0.07

Rifampicin-Isoniazid treated 4.394±0.51##

6.136±0.45##

5.35±0.64##

1.288±0.14***

Rifampicin + Isoniazid + Test

extract (100 mg/kg PO) treated

9.808±0.83***

10.99±0.50

10.52±0.64 0.4384±0.05

Rifampicin + Isoniazid + Test

extract (200 mg/kg PO) treated

7.658±0.73 10.73±0.87* 9.516±0.41

** 0.718±0.059

**

All values are shown as mean ± SEM and n=6.

# indicate p< 0.05, ##indicate p<0.01, ### indicate p<0.001 when compared to control group.

* indicate p<0.05, ** indicate p<0.01, *** indicate p<0.001 when compared to Rimpicin-Isoniazid group.

SOD: Superoxide dismutase, CAT: Catalase, GSH: Glutathione, MDA: Malondialdehyde

5. CONCLUSION

In our study we have made an attempt to study the

hepatoprotective activity of a locally available plant which

is in use by the local tribal people but lacks its mention in

scientific literature. Our work aims to study the

therapeutic effect of the hydroalc0holic extract of the plant

Ocimum gratissimum by examining the prevention of

Rifampicin-Isoniazid induced hepatotoxicity in rats.From

all these findings we can conclude that the plant Ocimum

gratissimum has significant hepatoprotective activity as

evidenced by the biochemical, functional and histological

parameters.The present findings provide scientific

evidence to the ethno medicinal use of this plant genetic

resource by the tribal people in treating hepatotoxicity.The

potential usefulness of the extract in clinical conditions

associated with liver damage is still to be demonstrated.

Further studies are needed to be carried out with regard to

the isolation of active principles responsible for

hepatoprotective activity and also for the intoxication with

other models such as iron, alcohol etc to prove its efficacy.

REFERENCES

Abbas.L, abul k, Robbins and cotran pathologic basis of

disease, St. Louis, mo: elsevier saunders, 2005, 878.

Anasuya.N, K.Raju, S.Manian, Hepatoprotective and

toxicological assessment of an ethnomedicinal plant

Euphorbia fusiformisBuch-Ham.ex.D.Don, Journal of

Ethnopharmacology, 127, 2010, 463-467.

Ayurvedicpharmacopiea of India by Govt. Of India, The

ministry of health and welfare society of ayush, 5,146.

Curtis and Mortiz, SOD one of the most important

enzymes in the enzymatic antioxidant defence system,

Ind.J.Pharmacol, 2010, 246-248.

Evan I. Saad, Sahar M.EI-Gowilly, MarbrokO.Sherhaa,

Azza E.Bistawroos, Role of oxidative stress and nitric

oxide in the protective effects of α-lipolic acid and

aminoguanidine against Isoniazid-rifampicin induced

hepatotoxicity in rats” Food and chemical Toxiocol, 48,

2010, 1869-1875.

Harbone JB, Phytochemical methods a guide to modern

techniques of plant analysis, Chapman and Hall, London,

1, 1973, 279.

Henry, R. J., Cannon, D. C. and Winkleman, J. W.,

Clinical Chemistry, Principles and Technics, 2nd Ed.,

Harper and Row, New York, 1974, 884-889.

Indian Medicinal plants by Kritikar Coll. No.AVS 1528,

Volume-I, Page No:346

Jaeschke H, Gores GJ, Cederbaum AI, Hinson JA,

Pessayre D, Lemasters JJ, Mechanisms of hepatotoxicity,

Toxicol. Sci, 65 (2), 2002, 166–76.

Group AST (IU/L) ALT (IU/L) ALP (KA units) TB (mg/dl)

Control (saline) 14.48±0.53 15.71±0.63 17.03±1.03 0.4083±0.01641

Rifampicin-Isoniazid treated 41.62±0.90##

32.52±0.65###

32.12±0.62###

0.9433±0.03904###

Rifampicin + Isoniazid +Test extract

(100 mg/kg P.O)

32.28±0.62***

23.1±0.77***

29.12±0.76*

0.785±0.02291***

Rifampicin + Isoniazid +Test extract

(200 mg/kg P.O)

19.28±0.76***

13.7±1.5***

24.68±1.02***

0.567±0.01352***



Kokate CK. Practical Pharmacognosy, 3rd

Ed, Vallabh

Prakashan, New Delhi, 1994, 07.

Marklund S, The involvement of the Superxoide anion

radical in the auto-oxidation of pyrogallol and a

convenient assay for SOD, Eur.J.Biochem, 1974, 121-

126.

SreenuThalla, JyothibasuTammu, Subba Reddy Thalla,

Nootropic activity of Ocimum gratissimum in

streptozotocin induced Amnesia, AJRC, 5(12), 2012,

1437-1439.

SreenuThalla, K.Venkata Ramana, JyothibasuTammu,

Subba Reddy Thalla, Cytoprotective effect of Ocimum

gratissimum in the Attenuation of Myocardial Infarction

Induced by Musa acuminate, AJPTR, 2(6), 2012, 724-730.

SreenuThalla. BhavaniPentela, Hepatoprotective effect of

hydroalcoholic extract of Calycopteris floribunda leaves

on Rifampicin-Isoniazid induced rats, IJCPS, 2 (3), 2011,

15-21.

Sujatha and Pavani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF AMITRIPTYLINE

HYDROCHLORIDE AND CHLORDIAZEPOXIDE IN TABLET BY RP-HPLC Neeli Sujatha* K Haritha Pavani

Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Jupudi, Vijayawada, Andhra

Pradesh, India

*Corresponding author: Email: [email protected], Phone: 8142540237

ABSTRACT

A simple, economic, selective, precise, and accurate Reverse Phase High Performance Liquid Chromatography

method for analysis of Amitriptyline Hcl & Chlordiazepoxide in tablet dosage form was developed and validated

according to ICH guidelines. The quantification of the drug was carried out by using YMC Colimited C8 (250 X

4.6 mm,5μ) column its equivalent in isocratic mode and maintain column at 400C, using mobile phase comprising

of Ortho phosphoric Acid : Methanol in the ratio of 50:50 v/v (Adjust pH -2 with Orthophosphoric Acid ), with a

flow rate of 1.0mL/min and the detection wavelength was carried at 253 nm. The retention time for

Amitriptyline Hcl & Chlordiazepoxide was found to be 2.502&5.176. The percent assay was found to be

101%&99%. Proposed method was validated for precision, accuracy, linearity & range, specificity and robustness

according to ICH guidelines. The method was successfully applied to Amitriptyline Hydrochloride and

Chlordiazepoxide combination Tablet dosage form.

KEY WORDS: Amitriptyline Hydrochlorde, Chlordiazepoxide, RP-HPLC, YMC-Colimited Column, Validation.

INTRODUCTION

Amitriptyline Hydrochloride is a 3-(10,11-Dihydro-5H-

dibenzo[a,d] cyclo hepten-5- ylidene)-N,N- dimethyl-1-

propanamine hydrochloride.TricyclicAntidepressent drug. They contain a tricyclic ring system with an alkyl amine

substituent on the central ring. In non-depressed

individuals, amitriptyline does not affect mood or arousal,

but may cause sedation.It is Decrease reuptake of nor

epinephrine and serotonin. Amitriptyline appears to exert

effect on both norepinephrine and serotonin (5-HT),

although the selective acting desipramine is a more potent

inhibitor of norepinephrine transport. The drug structure

shows in figure no-1.

Chlordiazepoxide is a (7-chloro 2(methylamino)-

5-phenyl-3-H-1,4 benzodiazepine 4-oxide).Tricyclic

Antidepressent drug.It is bides to stereospecific

benzodiazepine binding sites on GABA receptor

complexes at several sites within the central nervous

system including the limbic system and reticular

formation.This result in an increased binding of the

inhibitory neurotransmitter GABA receptor BZDs

therefore enhance GABA-mediated chloride influx

through GABA receptor channel causing membrane

hyperpolarization.The drug structure shows in figure no-2.

Literature review reveals that several methods are

reported for these drugs alone or in combination with

other drugs. For combination of these drugs Spectroscopic

method, HPTLC method is reported, there is no single

work done for this combination by using RP-HPLC.

Hence an attempt has been made for the development of

RP-HPLC method for the combination of drugs.

The present study illustrate development and



Amitriptyline Hcl and Chlordiazepoxide in tablets dosage

forms as per ICH guidelines.


List of equipment: Quantitative HPLC was performed on

a high performance liquid chromato graph -Waters

e2695Alliance HPLC system connected with PDA

Detector 2998 and Empower2 Software. The drug analysis

data were acquired and processed using Empower2

software running under Windows XP on a Pentium PC

and YMC Colimited C8 (250 X 4.6 mm,5μ)Column. In

addition an analytical balance (DENVER 0.1mg



List of chemicals: Pharmaceutical grade Amitriptyline

Hcl & Chlordiazepoxide were kindly supplied as a gift

sample by Dr.Reddy’s Laboratory, Hyderabad, and






Amitriptyline Hcl & Chlordiazepoxide Tablets available

in the market as 'Amixide' (Sun pharmaceutical Ind ltd

,Gujarat, India.) in composition of Amitriptyline Hcl

(50mg), Chlordiazepoxide(20mg).

Preparation of mobile phase: The mobile phase was

prepared by mixing Ortho phosphoric acid Buffer and

Methanol in the ratio 50:50 v/v. Then it was sonicated for

15min and filtered through 0.45µ membrane filter.



Preparation of standard solution: Accurately 50mg of

Amitriptyline Hcl and 20mg of Chlordiazepoxide was

weighed and transferred into 50mL volumetric flask and

diluted with 30mL diluent and sonicated for 15minutes.

Then the volume was makeup to 50mL with diluent and

filtered through 0.45µ nylon filter. Further 10mL of above

solution was diluted to 50 mL and mixed to get a

concentration of 100 µg/mL. From this stock solution

further dilutions were made by taking the two drugs for

the validation of the method developed.

Preparation of sample solutions: 20 tablets were

powdered and weigh and transfer tablet powder equivalent

to 50 mg(291.6mg) of Amitriptyline Hcl &20mg of

chlordiazepoxide into 100 mL volumetric flask, diluted to

60 mL diluent and sonicated for 15 mins and makeup to

final volume with diluent and filtered through 0.45µ

membrane filter. Further dilute 5 mL of this solution to 25

mL diluent and mixed to get a concentration of 100

µg/mL. From this stock solution further dilutions were

made for the validation of the method developed.

System suitability: The purpose of system suitability is to

ensure that the complete testing (including

instrument,method,analyst ) is suitable for the intended

application. All system suitability parameters shows in the

table no:2

Calibration curves for Amitriptyline Hcl &

Chlordiazepoxide: Replicate analysis of solution

containing 25-75µg/mL of Amitriptyline Hcl &10-

30µg/mL of Chlordiazepoxide sample solutions

respectively were injected into HPLC according to the

procedure in a sequence and chromatograms were



of standards on Y-axis. Calibration graphs shows in the

figure no:7, 8.

Optimized method: The quantification of the drug was

carried out by using YMC Colimited C8 (250 X 4.6 mm,5

μ) column its equivalent in isocratic mode and maintain

column at 400C, using mobile phase comprising of Ortho

phosphoric Acid : Methanol in the ratio of 50:50v/v

(Adjust pH 2 with Orthophosphoric Acid ), flow rate of

1.0mL/min and the detection wavelength was carried at

253 nm. Mobile phase was used as diluent during the

standard and test samples preparation. The optimized

chromatographic conditions are mentioned in Table-1 and

chromatogram for standard was shown in the figure no: 3.

Validation parameters:

Specificity: Specificity is the ability of analytical method

to measure accurately and specifically the analyte in the

presence of components that may be expected to be





interference with the drug peak.

Linearity: Linearity is the ability of the method to



Linearity in the concentration range of 25-75µg/mL for

Amitriptyline Hcl, 10-30µg/mL for Chlordiazepoxide.

From the linearity studies calibration curve was plotted

and concentrations were subjected to least square

regression analysis to calculate regression equation. The

regression coefficient was found to be 0.999 and shows

good linearity for both the drugs.

Precision: Precision is the degree of closeness of

agreement among individual test results when the method

is applied to multiple sampling of a homogeneous sample.

Study was carried out by injecting six replicates of the

same sample preparations at a concentration of 100ppm.

Accuracy: Accuracy is the closeness of results obtained

by a method to the true value. It is the measure of






working standard solution of the drug.

Lod&Loq: Limit of detection and limit of quantification

were calculated using following formula LOD=3.3(SD)/S

and LOQ=10(SD)/S, where SD= standard deviation of


calibration curve.


of Amitriptyline Hcl & Chlordiazepoxide under different


flow rate (±0.2 mL/min), λmax (±5), column temperature


buffer solution.

RESULTS & DISCUSSION

Specificity: As no other extra peaks were found at

retention time of 2.50 min & 5.17 min the proposed

method was a specific for the detection of Amitriptyline

Hcl & Chlordiazepoxide. The results are tabulated in the

table no-3 and the chromatogram was shown in the figure

no- 3,4,5,6.

Linearity: From the Linearity data it was observed that

the method was showing linearity in the concentration

range of 25-75µg/mL for Amitriptyline Hcl 10-30µg/mL

for Chlordiazepoxide. Correlation coefficient was found to

be 0.999 for both the compounds. The results are tabulated



in the table no-5 & Linearity graphs shows in the figure

no-7,8.

Accuracy: The percentage recovery of Amitriptyline Hcl

& Chlordiazepoxide was found 101% and 99%

respectively. The percentage RSD of the samples was

found less than 2. The results are tabulated in the table no-

4.

Precision: The percentage relative standard deviation

value for precision of six replicate samples of

Amitriptyline Hcl & Chlordiazepoxide was found to be

0.43&0.22, which was well within the acceptance criteria

limit.

Lod&Loq: The limit of detection was obtained as

0.154mg/mL for Amitriptyline Hcl and 0.130mg/mL for

Chlordiazepoxide. The limit of quantitation was obtained

as 0.466mg/mL for Amitriptyline Hcl and 0.395mg/mL

for Chlordiazepoxide.

Robustness: All the system suitability parameters are

within limits for variation in flow rate (±0.2 mL). Hence

the allowable flow rate should be within 0.8 mL to 1.2

mL. All the system suitability parameters are within limits

for variation (±50C) in temperature. Hence the allowable

variation in Temperature should be within 350C to

450C.The results shows Table no.7.

All validation parameters shows in the table no.6

All the results obtained were satisfactory and good

agreement as per the ICH guidelines.

Fig:1 Structure of Amitriptyline Hcl Fig:2 Structure of Chlordiazepoxide

Fig:3 Chromatogram for Standard Fig:4 Chromatogram for Sample

Fig:5 Chromatogram for Blank Fig:6 Chromatogram for Placebo



Fig:7 Linearity plot for Amitriptyline Hcl

Fig:8 Linearity plot for Chlordiazepoxide

Table.1. Optimised Conditions for Amitriptyline Hcl & Chlordiazepoxide

Parameter Chromatographic Condition

Column YMC-Co-limited column, C8 (150×4.6)mm, 5µ

Mobile phase OPA Buffer : Methanol(50:50) v/v

Flow rate 1.0 mL/ min

Wavelength 253 nm


Column temperature 400C

Run time 10 min

Table.2. System Suitability Parameters

Parameter Amitriptyline Hcl Chlordiazepoxide Acceptance criteria

Theoretical plates 8604 7548 >2000

Tailing factor 1.263 1.810 <2

Asymmetric factor 0.4 0.38 0.9-1.2

Retention time 2.502 5.176 ±10% of Actual Rt

%RSD 0.43 0.22 <2

Table.3. Specificity data for Amitriptyline Hcl & Chlordiazepoxide

Sample name Amitriptyline Hcl Area Rt Chlordiazepoxide Area Rt

Standard 1077129 2.508 2293861 5.239

Sample 1064380 2.486 2274042 5.094

Blank -- -- -- --

Placebo -- -- -- --

Table.4. Accuracy data for Amitriptyline Hcl & Chlordiazepoxide Amitriptyline HCI

Spiked Level Sample

Weight(mg) Sample Area µg/mL added µg/mL found % Recovery % Mean

50% 145.80 535849 49.500 49.83 101

101 100% 291.60 1068848 99.000 99.40 100

150% 437.40 1600269 148.500 148.82 100

Chlordiazepoxide

50% 145.80 1137087 20.000 19.84 99

99 100% 291.60 2279745 40.000 39.77 99

150% 437.40 3401849 60.000 59.34 99

533515

800575

1060145

1331620

1600675

y = 10661.46x+840

r² = 0.99

0

200000

400000

600000

800000

1000000

1200000

1400000

1600000

1800000

0 50 100 150 200

1139722

1701723

2279771

2829389

3403237

y = 22618.78x+8890

r² = 0.99

0

500000

1000000

1500000

2000000

2500000

3000000

3500000

4000000

0 50 100 150 200



Table.5. Linearity data for Amitriptyline Hcl & Chlordiazepoxide sample Linearity level

(µg/mL)


Amitriptyline

Hcl

25 533515

10661.4

840

0.999 37.5 800575

50 1060145

62.5 1331620

75 1600675

Chlordiazepoxide 10 1139722

22618.78

8890

0.999 15 1701723

20 2279771

25 2829389

30 3403237

Table.6. Summary of validation parameters Parameter Amitriptyline Hcl Chlordiazepoxide

Specificity(Rt) 2.50min 5.17min

Range,Linearity(r2) 25-75µg/mL,0.999 10-30µg/mL,0.999

Precision(% RSD) 0.43 0.22

Accuracy 101% 99%

LOD & LOQ 0.154,0.466 0.130,0.395

Table.7. Robustness data for Amitriptyline Hcl & Chlordiazepoxide

sample Parameters Optimized Used Rt Peak area Plate count

Amitriptyline

Hcl

Flow rate

(±0.2)

1mL/min

0.8 2.487 1063950 7324

1 2.500 1065899 8291

1.2 2.492 1072653 7432

Temperature

(±5°C)

40°C

35 2.482 1084297 7423

40 2.501 1062198 8684

45 2.481 1076311 7245

Chlordiazepoxide Flow rate

(±0.2)

1mL/min 0.8 5.146 2240382 7942

1 5.173 2256757 7613

1.2 5.156 2306841 7413

Temperature

(±5°C)

40°C 35 5.040 2330109 7701

40 5.158 2262283 7674

45 5.044 2127480 7563

CONCLUSION





economical. Hence the method was a good approach for

obtaining reliable results and found to be suitable for the

routine analysis of Amitriptyline Hcl & Chlordiazepoxide

in Tablets dosage forms.

ACKNOWLEDGEMENT




REFERENCES

Barbai C, Hotopf M, The British Journal of Psychiatry,

The Journal of Mental Science, 178(2), 129-144.

Bhatt, Mitesh, Shah, Sanjay, Shiv Prakash, Method

development and validation of amitriptyline and its

metabolites in human plasma by ultra performance liquid

chromatography; Tandam mass spectrometry and its

application to a bioequivalence study, Bio med

chromotogr, 24(11), 2010, 1247-54.

Dhara patel, Vivek patel, Simultaneous estimation of

amitriptyline hcl and perphenazine by absorption ratio (Q-

Analysis) UV spectrophotometric method in combined

tablet dosage form, International journal of

pharmaceutical sciences and research, 1(12), 2010, 133-

137.

Sejal patel, N.T Patel, Spectrophotometric and

chromatographic simultaneous estimation of amitriptyline

and chlordiazepoxide in tablet dosage form, Indian Journal

of Pharmaceutical Sciences, 7 (4), 2009, 472-476.

Shoba Rani et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF HEPATOPROTECTIVE ACTIVITY OF SAPINDUS EMARGINATUS VAHL.PERICARP

EXTRACT AGAINST ANTI TUBERCULAR DRUGS INDUCED LIVER DAMAGE IN RATS

Shoba Rani J *, Janarthan M, Firasat Ali,

Department of Pharmacology, Nimra College of Pharmacy, Vijayawada, India

*Corresponding author: Email: [email protected], Phone:7382222566

ABSTRACT

The objectiveof the present study is to evaluate the hepato protective activity of Sapindus emarginatus Vahl.

pericarp against anti tubercular drugs induced liver damage in rats. Hepatotoxicity was induced by Rifampicin

and Isoniazid administration (100±50 mg/kg p.o) at every 72 hrs for 21days. Sapindus emarginatus extract at

different doses (200 and 400 mg/kg) 1hr prior to Rifampicin and Isoniazid administration. The degree of

protection was determined by measuring levels of biochemical markers like SGOT,SGPT,ALP and Bilirubin and

anti oxidant enzymes CAT, SOD, non enzymatic anti oxidant GSH and level of lipid peroxidation .The

histopathology studies also carried out. Treatment of rats with different doses of plant extract (200 and 400

mg/kg) significantly (P<0.001) altered serum marker enzymes and antioxidant levels to near normal against

rifampicin and isoniazid treated rats. The activity of the extract at dose of 200 mg/kg was comparable to the

standard drug, silymarin (50 mg/kg, p.o.). The present study suggests that the methanolic extract of Sapindus

emarginatus posses significant hepatoprotective and anti oxidant activities

Keywords: Sapindus emarginatus; Rifampicin; Isoniazid; Biochemical parameters; Antioxidants; Lipid

peroxidation

1. INTRODUCTION

Herbal drugs have gained importance and

popularity in recent years because of their safety, efficacy

and cost effectiveness. They have recently attracted much

attention as alternative medicines useful for treating or

preventing life style related disorders and relatively very

little knowledge is available about their mode of action.

There has been a growing interest in the analysis of plant

products which has stimulated intense research on their

potential health benefits (Pushpangadan, 2007). Liver, the

key organ of metabolism and excretion has an immense

task of detoxification of xenobiotics, environmental

pollutants and chemotherapeutic agents. Hence, this organ

is subjected to variety of diseases and disorders. Several

hundred plants have been examined for use in a wide

variety of liver disorders. Antioxidants play an important

role in inhibiting and scavenging free radicals and thus

providing protection against infections and degenerative

diseases (Subramaniam, 2000).

Sapindus emarginatus Vahl family Sapindaceae is

a medium-sized deciduous tree found in south

India.Traditionally, Sapindus emarginatus is used as anti-

inflammatory and antiprurutic. It is used to purify the

blood. The seed is in intoxicant and the fruit rind has

oxytropic action. Its powder is used as nasal insufflations.

S.emarginatus also showed strong anti bacterial activity

against the tested bacterial strains (Nair, 2005).

Antifertility and antiandrogenic activities of Sapindus

emarginatus extract have been reported (Venkatesh,

2002). High content of saponins such as Two Pisicidal

triterpenoid saponins (Wilawan, 1990) acetylated

triterpene saponins, hederagenin, sweet acyclic

sesquiterpene glycoside, Mukurozioside IIb15 have been

isolated from the Pericarps of S. emarginatus. Flavonoids

have been isolated from the pericarp of Sapindus

emarginatus (Tripetch, 2001). The presence of such

flavonoids, triterpenoid or saponins, encouraged us to

evaluate the hepatoprotective activity of S. emarginatus

against antitubercular drugs induced hepatotoxicity in rats.


Collection and authentication of plant material:

Sapindus emarginatus pericarps were collected during the

may-2013 from Vuyyuru, Krishna (Dist),Andhra Pradesh,

India and authenticated by Dr K Madhavachetty,

Assistant professor, Department of Botany, Sri

Venkateswara, university, Tirupati.

Preparation of extract: The shad dried pericarps were

collected and powdered. Dried powder material (500g) of

the pericarp of Sapindus emarginatus was extracted with

2000ml of methanol in a Soxhelt apparatus. The resulted

extract yield was 7.45% and the appearance of the extract

was dried gum resin in nature

Animals: The Female wister albino rats (200-210g) were

obtained from the central animal house of Sigma institute

of clinical research & administration PVT LTD,

Hyderabad. The animals were housed at room temperature

(22-28 ºC) for 12 hrs dark light cycles. The study was

conducted after obtaining Institutional animal ethical

committee clearance.

Acute toxicity studies: Toxicity studies were performed





Experimental design: Animals were divided in to Five groups

(n=6)

Group I Control animals received the vehicle viz.

normal saline (2 ml/kg)

Group II Animals received RCIN and INH (100 ±50

mg/kg p.o.) at every 72hours

Group III Animals received silymarin 50 mg/kg p.o. for

21 days and simultaneously administered

RCIN and INH (100 ±50 mg/kg p.o.) every

72 hours

GroupIV Animals received MSE 200 mg/kg p.o for 21

days and after 1hour Simultaneously

administered RCIN and INH (100 ±50 mg/kg

p.o.) every 72 hours.

Group V Animals received MPA 400 mg/kg p.o. for

21 days and after 1hour Simultaneously

administered RCIN and INH (100 ±50 mg/kg

p.o.) every 72 hours

At the end of all experimental methods, all the animals

were sacrificed by cervical decapitation. Blood samples

were collected, allowed to clot. Serum was separated by

centrifuging at 2500 rpm for 15 min and analyzed for

various biochemical parameters.

Assessment of liver function: Biochemical parameters

i.e., aspartate amino transferase (AST) alanine amino

transferase (ALT), alkaline phosphatase (ALP), total

bilirubin and total protein were analyzed according to the

reported methods. The liver was removed, weighed and

morphological changes were observed. A 10% of liver

homogenate was used for antioxidant studies such as

reduced glutathione (GSH), (lipid peroxidation (LPO),

superoxide dismutase (SOD), catalase. The liver was

removed, weighed and morphological changes were

observed. A portion of liver was fixed in 10% formalin for

histopathological studies.

Histopathological studies: Liver slices fixed for 12 hrs in

Bouin’s solution were processed for paraffin embedding

following standard micro techniques.5μm sections of liver

grained with alum haematoxylin and eosin were observed

microscopically for histopathological changes.

Statistical analysis: The values were expressed as mean ±

SEM. Statistical analysis was performed by one way

analysis of variance (ANOVA) followed by Dunnett,s

multiple comparison test and data on liver weight

variations were analyzed using Student’s ‘t’ test. P values

< 0.05 were considered as significant.

3. RESULTS

The effect of MSE on serum marker enzymes are

presented in table 1.The levels of serum AST, ALT, ALP,

total bilirubin, were markedly elevated and that of protein

decreased in RCIN and INH treated animals, indicating

liver damage. Administration of MSE at the doses of 200

and 400 mg/kg remarkably prevented RCIN and INH -

induced hepatotoxicity in a dose dependent manner. LPO

levels in the INH and RCIN treated rats showed a

significant (P<0.001) increase. Treatment with MSE (200

mg/kg and 400 mg/kg) significantly (P<0.001) prevented

the increase in LPO level which was brought to near

normal. The effect of MSE was comparable with that of

standard drug silymarin.

RCIN and INH treatment caused a significant

(P<0.001) decrease in the level of SOD, catalase, and

GSH, in liver tissue when compared with control group

(table 2). The treatment of MSE at the doses of 200 and

400 mg/kg resulted in a significant increase of enzymic

and non enzymic antioxidants when compared to RCIN

and INH treated rats. The liver of silymarin treated

animals also showed a significant increase in antioxidant

enzymes levels compared to INH and RCIN treated rats.

Morphological observations showed an increased size and

enlargement of the liver in RCIN and INH treated groups.

These changes were reversed by treatment with silymarin

and also MSE at the doses tested. Histopathological

studies, showed RCIN and INH to produced extensive

vascular degenerative changes and centrilobular necrosis

in hepatocytes. Treatment with different doses of MSE

produced mild degenerative changes and absence of

centrilobular necrosis when compared with control. All

these results indicate a hepatoprotective potential of the

extract.

4. DISCUSSION

Drug-induced hepatotoxicity is a potentially

serious adverse effect of the currently used anti-tubercular

chemotherapeutic regimens containing RCIN and INH.

The conversion of monoacetyl hydrazine, a metabolite of

INH, to a toxic metabolite via cytochrome P450 leads to

hepatotoxicity. RCIN induces cytochrome P450 enzyme

resulting an increased production of toxic metabolites

from acetyl hydrazine (AcHz). RCIN can also increase the

metabolism of INH to isonicotinic acid and hydrazine,

both of which are hepatotoxic.

The plasma half life of AcHz (metabolite of INH)

is shortened by RCIN and AcHz is quickly converted to its

active metabolites by increasing the oxidative elimination

rate of AcHz, which is related to the higher incidence of

liver necrosis caused by RCIN and INH combination. In

addition to these mechanisms; oxidative stress induced

hepatic injury is one of the important mechanisms in

hepatotoxicity produced by anti-tubercular drugs (Mitra,

1998). When liver cell plasma membrane is damaged, a

variety of serum marker enzymes, like AST, ALT, ALP,

total bilirubin located in the cytosol are released in to the

blood stream. Their estimation in the serum is a useful

quantitative marker of the extent and type of

hepatocellular damage. The enhanced activities of these



serum marker enzymes observed in RCIN and INH treated

rats in our study correspond to the extensive liver damage

induced by RCIN and INH. Results indicate that MSE

administration could blunt RCIN and INH -induced

increase in activities of different marker enzymes of

hepatocellular injury, viz. AST, ALT, ALP, total bilirubin,

and total protein, (Table 1) suggesting that MSE possibly

has a protective influence against RCIN and INH induced

hepatocellular injury and degenerative changes.

The combination of RCIN and INH was reported

to result in higher rate of inhibition of biliary secretion and

an increase in liver cell lipid peroxidation, and

cytochrome P-450 was thought to be involved in the

synergistic effect of RCIN and INH (Ramaiah,

2001).Treatment of the rats with MSE significantly

reduced the elevated levels of LPO. Alterations of various

cellular defense mechanisms consisting of enzymatic and

non-enzymatic antioxidant components [superoxide

dismutase (SOD), catalase, reduced glutathione,

Glutathione reductase, have been reported in RCIN and

INH -induced hepatoxicity (Table 2). The RCIN and INH

administered animals exhibited significantly (p<0.001)

low levels of hepatic enzymatic and non-enzymatic

antioxidant components, and significantly increased with

co-administration of MSE (200 and 400 mg/kg) at the all

the doses and in silymarin treatment group after 21 days.

Table.1.Effect of MSE on Biochemical Parameters in RCIN and INH -induced hepatotoxicity rats

Notes: All the values are mean ± SEM, n=6, ns=Not significant, One way Analysis of Variance (ANOVA) followed by

Dunnett,s multiple comparision test, *P<0.05, **P<0.01, ***P<0.001 Vs control group and aP<0.001,

bP<0.01,

cP<0.05

Vs Sham operated normal

Table.2.Effect of MSE on enzymic and non-enzymic antioxidants level in RCIN and INH -induced hepatotoxicity

rats Treated groups LPO SOD CATALASE GSH

Normal 9.97±0.27 44.87±0.66 72.33±0.81 3.17±0.05

Control (R±I 100:50mg/kg) 24.39±0.59a 26.45±0.84

a 30.63±0.84

a 1.13±0.06

a

Standarrd (Silymarin) 50mg/kg 15.64±0.37***

41.25±0.37***

69.72±0.74***

2.42±0.07***

MSE 200mg/kg)T1 15.91±0.65***

37.87±0.7***

46.59±0.91***

1.93±0.01***

MSE(400mg/kg)T2 17.53±0.58***

32.64±0.94***

60.57±0.82***

1.80±0.02***

Notes: All the values are mean ± SEM, n=6, ns=Not significant, One way Analysis of Variance (ANOVA) followed by

Dunnett,s multiple comparision test, *P<0.05, **P<0.01, ***P<0.001 Vs control group and aP<0.001,

bP<0.01,

cP<0.05

Vs Sham operated normal

5. CONCLUSION

From the results obtained, we can conclude that

methanolic pericarp extract of Sapindus emarginatus

possess hepatoprotective activity.

6. ACKNOWLEDGEMENT

I would like to take the privilege to thank the

selfless people such as my parents , teachers friends, well-

wishers and relatives from the core of my heart who with

their constant support , affection ,inspiration and

encouragement made me feel comfortable to successfully

complete this venture.

REFERENCES

Mitra SK, Venkataranganna MV, Sundaram R,

Gopumadhavan S. Protective effect of HD-03, a herbal

formulation,against various hepatotoxic agents in rats, J

Ethnopharmacol, 63, 1998, 18-186.

Nair R,Kalariya T, Sumitra Chandra, Antibacterial activity

of some selected Indian Medicinal Flora .Turk J Biol, 29,

2005, 29, 410

Treated groups SGPT SGOT ALP Total protein Total bilirubin Direct Bilirubin

Normal

(0.9%Saline)

31.86±2.14 51.94±1.50 76.87±1.64 10.53±0.67 0.17±0.010 0.18±0.02

Control

(R±I 100:50mg/kg)

102.33±2.13a 165.62±1.66

a 212.30±1.87

a 3.29±0.32

a 1.94±0.20

a 0.54±0.03

a

Standarrd

(Silymarin) 50mg/kg

43.63±1.93***

89.88±1.03***

123.30±1.87***

7.56±0.31***

0.33±0.01***

0.33±0.01***

MSE

(200mg/kg)T1

37.71±2.02***

68.01±1.48***

142.71±1.67***

6.92±0.030***

0.33±0.03***

0.30±0.01***

MSE

(400mg/kg)T2

47.05±2.02***

87.69±1.38***

158.98±2.12***

8.56±0.42***

0.38±0.01***

0.40±0.001**



Pushpangadan P, Kumar B, Vijayakumar M and

Govindarajan R Ethnopharmacological approaches to

wound healing exploring medicinal approaches to wound

healing exploring medicinal plants, J Ethnopharmacol,

2007, 114, 2007, 103-113.

Ramaiah SK, Apte U, Mehendale HIM. Cytochrome

P4502E1 induction increases thioacetamide liver injury in

diet-restricted rats. Drug Metab Dispos, 29, 2001, 1088-

95.

Subramaniam A, Evans DA, Rajasekharan S and

Pushpangadam P,Effect of Trichopus zeylanicus Gaertn

(active fraction) on phagocytosis by peritoneal

macrophages and humoral immune in response in mice,

Indian J Pharmacol, 32, 2000, 221-225.

Tripetch Kanchanapoom, Ryoji Kasai and

KazuoYamasaki, Acetylated Triterpene Saponins from the

Thai Medicinal Plant, Sapindus emarginatus, Chem Pharm

Bull, 49(9), 2001, 1195.

Venkatesh V, Sharmal JD and Raka Kamal, A

Comparative study of alcoholic extract of Saem,

Terminalia belerica, Cuminnum cyminum and Allium

cepa on reproductive organs of Male albino rats, Asian

J.Exp Sci, 16(1), 2002, 510.

Wilawan Maha Busarakam, Towers GHN, Pittaya

Tuntiwachwesttikul and pichaet Wiryachitra, Pisicidal

triterpenoid saponins of the pericarps of Sapindus

emarginatus, J.Sci.SOC, Thailand, 16, 1990, 187.

Srilakshmi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF ANTI-DIABETIC AND HEPATO PROTECTIVE ACTIVITY OF

95% METHANOLIC EXTRACT OF TERMINALIA TOMENTOSA BARK BY USING

ALBINO RATS Srilakshmi P

*, Janarthan M, Zuber Ali M



ABSTRACT

The anti-diabetic and hepatoprotective activity of the Methanolic extract of the bark of Terminalia tomentosa

(family: combrataceae) was investigated on alloxan induced diabetic albino rats. A comparison was made

between both plant extract and a known antidiabetic drug glibenclamide (5mg/kg-1

). The dried bark of Terminalia

tomentosa was subjected to extraction by continuous hot extraction method using methanol as a solvent.

Phytochemical estimation was done for the presence of phytoconstituents. Dose selection was made on the basis

of acute oral toxicity study (250mg/kg-1

, 500mg/kg-1

bodyweight) as per OECD guidelines. Oral administration of

extract of Terminalia tomentosa for 21days resulted in significant reduction in blood glucose level. Alloxan

induced diabetic rat model and oral glucose tolerance test (OGTT) model was used for evaluation of antidiabetic

activity. The biochemical parameters were analysed. All rats in the diabetic groups had FBG levels well within

the diabetic range (>150 mg dL-1

) at the initial stage of the experiment but after three weeks of treatment with

extracts or glibenclamide the FBG significantly dropped in dose-dependent manner, and also correct the lipid

profile and liver enzymes. The results suggest that the Methanol extracts of the bark of Terminalia tomentosa

restored the metabolic changes in alloxan-induced diabetic rats.

Key words: Terminalia tomentosa, glibenclamide, alloxan, anti-diabetic activity

INTRODUCTION

Diabetes mellitus is a metabolic disorder initially

characterized by a loss of glucose homeostasis with

disturbances of carbohydrate, fat and protein metabolism

resulting from defects in insulin secretion, insulin action,

or both. (Alberto Barceló1 and Swapnil Rajpathak,

2001) In 2005, an estimated 1.1 million people died from

diabetes with a projected rise in deaths of 50% over the

next 10 years. It is estimated that at least 1 in 20 deaths,

globally and across all ages, are attributable to diabetes.

(WHO, 2005) Diabetes induced by alloxan, it produce

oxidative free radicals. This free radicals damage the β-

Cells of pancreas. In present study Terminalia tomentosa

bark was selected for anti diabetic activity because it is

having anti oxidant property. Due to this anti oxidant

property the oxidative species were reduced so that β-

Cells were recovered.


Chemicals: Alloxan monohydrate, glibenclamide,

glucose, all other chemicals and reagents used were

analytical grade.

Plant material: The stem bark of Terminalia tomentosa

(Roxb.) Wight & Arn. Belonging to Combrataceae were

collected from Tirumala Hills, Chithoor district (A.P). The

plant material was identified and authenticated by Dr.

Prathibha (Professor and H.O.D. of Department of Botany

Osmania University, Hyderabad, India.

Preparation of plant extraction: The collected bark was

shade dried and powdered in mixer grinder to get coarse

powder. The powdered plant material (100gms) was

extracted with methanol (95%v/v) by using soxhlet

apparatus. The extract was air dried to evaporate solvent.

Phytochemical screening: The preliminary

phytochemical screening of methanolic extract of

Terminalia tomentosa was carried by using standard

procedures.

Acute Toxicity Study: toxicity studies were performed


Experimental model: Alloxan monohydrate was weighed

individually for each animal according to their body

weight and solubilised with saline just prior to injection.

Diabetes was induced by injecting it at a dose of 150

mg/kg body weight intrapertonially. The animals were

kept under observation and after 48 hrs blood glucose

level was measured by One-touch glucometer. The

diabetic rats (glucose level 200-300 mg/dl) were separated

and divided into five different groups for experimental

studies, with each group containing six animals. Present

study has confirmed that the treatment of methanolic

extract of Terminalia tomentosa for a period of 3weeks

caused a significant decreased in BGL (Blood glucose

level) of diabetic rats. 250&500 mg/kg of plant extract

were screened for anti diabetic activity against alloxan

induced diabetic rats. It produced significant anti diabetic

activity in a dose dependent manner. The animals treated

with alloxan had high BGL. The anti diabetic activity

http://www.scialert.net/asci/result.php?searchin=Keywords&cat=&ascicat=ALL&Submit=Search&keyword=diabetic+rats



exhibited by extract was compared with that of standard

drug (glibenclamide).

Experimental design:

The rats were divided into five groups each consist of six

rats. Significant hyperglycaemia was achieved within 48

hrs after alloxan (150 mg/kg body weight i.p) injection.

Group I- Served as normal control and did not receive any

treatment

Group II- Served as diabetic control and received Inducer

(alloxan-150mg/kg) and vehicle

Group III- Alloxan + Glibenclamide (5 mg/kg p.o.) and

served as standard

Group IV- Alloxan + 95% MTT extract (250 mg/kg, p.o.)

Group V- Alloxan + 95% MTT extract (500 mg/kg, p.o.)

Statistical Analysis: The result of the study were

subjected to one way analysis of variance (ANOVA)

fallowed by Dunnet’s test for multiple comparisions.

Values with p<0.05 were consider significant.

RESULTS

Phytochemical Screening: Phytochemical screening of

methanolic extract of Terminalia tomentosa showed the

presence of various chemical constituents mainly

alkaloids, Proteins, glycosides, phytosterols and saponins.

Extract may be responsible for antidiabetic and

hepatoprotective properties. The results obtained were

comparable and satisfied the standard literature.

Acute oral toxicity studies: In the present study the MTT

was subjected for toxicity studies. For the LD50 dose

determination MTT was administered the dose level of

1000 mg/kg and 2000 mg/kg body weight and both doses

did not produce any mortality. Hence one-fourth of the

dose tested i.e. 250mg/kg and 500mg/kg body weight

was selected for the study in order to ascertain a

scientific base for the useful of this plant in the treatment

of diabetes. It was decided to evaluate experimental

design of antidiabetic activity by Alloxan induced model.

Anti-diabetic activity:

Alloxan induced diabetic model: The anti-diabetic effect

of MTT in alloxan induced diabetic animals is presented.

The results showed that after single dose treatment of the

extract in individual group of alloxan induced diabetic

rats, there was a significant reduction in serum glucose

levels throughout the entire period of study (21 days) as

compared to diabetic control group. Terminalia tomentosa

bark extract were screened for antidiabetic activity in rats

Where Alloxan (150 mg/kg, i.p.) used as the diabetogenic

agent.

In an alloxan induced diabetic rats (Gr. II)

significantly increased serum glucose level at ‘0’day

(P<0.001), 1st

day (P<0.001), 7th day (P<0.001), 14

th day

(P<0.001) and 21st day (P<0.001) were shown in the Table

No.1.

Glibenclamide at an oral dose 5 mg/kg reduced

serum glucose level at ‘0’day (P<0.001), 1st

day

(P<0.001), 7th day (P<0.001), 14

th day (P<0.001) and 21

st

day (P<0.001) significantly when compared with control

respectively.

Administration of MTT 250 and 500 mg/kg orally

reduced significantly serum glucose level at ‘0’

day

(P>0.001), (P>0.001), at 1st day (P<0.001), (P<0.001), at

7th day (P<0.001), (P<0.001), 14

th day (P<0.001),

(P<0.001) and 21st day (P<0.001), (P<0.001) when

compared to (Gr. II) control respectively.

Oral glucose tolerance test (OGTT) model: The anti-

diabetic effect of MTT in glucose induced diabetic

animals is presented. The results showed that after single

dose treatment of the extract in individual group of

glucose induced diabetic rats, there was a significant

reduction in glucose levels throughout the entire period of

study (1440 min) as compared to diabetic control group.

In an glucose induced diabetic rats significantly

increased serum glucose level at ‘0’min (P<0.01), 30 min

(P<0.001), 60 min (P<0.001), 90 min (P<0.001), 120 min

(P<0.01) and 1440 min (P<0.001) were shown in the

Table No.2.

Glibenclamide at an oral dose 5 mg/kg reduced

serum glucose level at ‘0’min (P<0.01), 30 min

(P<0.001), 60 min (P<0.001), 90 min (P<0.001), 120 min

(P<0.001) and 1440 min (P<0.001) significantly when

compared with control respectively.

Administration of MTT 250 and 500 mg/kg orally

reduced significantly serum glucose level at ‘0’min

(P<0.001) (P<0.001), 30 min (P<0.001) (P<0.001), 60

min (P<0.001) (P<0.001), 90 min (P<0.001) (P<0.001),

120 min (P<0.001) (P<0.001) and 1440 min (P<0.001)

(P<0.001) when compared with control respectively.



Table.1. Effect of 95% MTT extract on fasting blood glucose level in Alloxan induced diabetic rats Normal Control

(Allaxon-

150mg/kg)

Standard

(Glibenclamide-

5mg/kg)

MTT

(250mg/kg)

MTT

(500mg/kg)

0 Day 83.5±0.84 371.83±0.72 a 254.17±0.64

*** 283.17±0.77

*** 260.83±0.64

***

1st Day 79.83±0.44 355±0.82

a 240.17±0.64

*** 249.67±0.77

*** 235.83±0.86

***

7th

Day 74.83±1.01 298.33±1.05 a 179±0.67

*** 185.17±0.76

*** 154.5±0.87

***

14th

Day 71±0.47 232.16±0.89 a 175.5±0.61

*** 179.83±0.83

*** 149.5±0.87

***

21st Day

79.5±0.39 234.5±2.10 a 120.33±0.77

*** 131.5±0.51

*** 121±0.47

***

All the values are mean± SEM, n=6, One way ANOVA followed by multiple compression Dennett’s test ***

P<0.001

as compare to control. a P<0.001 when compared with normal

Table.2. Effect of 95% MTT extract on OGTT in oral glucose induced diabetic rats Normal Control (glucose-

1gm/kg)

Standard

(Glibenclamide

5mg/kg)

MTT

(250mg/kg)

MTT

(500mg/kg)

0 min 68±0.666 72±0.5270b 73.33±0.6085

** 73.16±0.8633

*** 78.66±0.6526

***

30 min 72±0.666 122±0.7817a 94.33±0.4513

*** 96.16±0.5485

*** 80±0.7453

***

60 min 75.66±0.5610 140±0.5270a 80.5±0.6972

*** 91.33±0.6526

*** 79.33±0.4513

***

90 min 77.66±0.5610 92.66±0.7698a 71.66±0.6085

*** 83.16±0.5485

*** 71.83±0.4356

***

120 min 77±0.4082 80.16±0.6419b 61.66±0.6085

*** 71.5±0.6972

*** 66.16±0.6419

***

1440 min 75.33±0.3849 70.5±0.6972 a 70.5±0.6971

*** 71.33±0.4513

*** 71.16±0.4356

***

Table.3. Effect of 95% MTT extract on lipid profile in Alloxan induced diabetic rats

Parameters

TREATMENT

Normal Control

(ALLOXAN

-150mg/kg)

STANDARD

(GLIBENCLA

MIDE-5mg/kg)

MTT

(250mg/kg)

MTT

(500mg/kg)

Cholesterol 152.25±0.50 353.86±1.49a 163.58±0.60

*** 188.32±0.75

*** 157.74±0.78

**

Tri glycerides 144.92±0.95 292.29±1.05a 151.07±0.79

*** 152.04±0.78

*** 163.73±0.81

***

HDL

cholestol

48.87±0.58 19.42±0.65 a 65.45±0.59

*** 62.05±0.71

*** 62.89±0.73

***

LDL cholestrol 73.89±0.46 275.98±1.91a 67.89±0.64

*** 95.87±1.20

*** 62.09±1.34

***

VLDL cholestrol 28.82±0.22 58.48±0.21 a 30.21±0.16

*** 30.41±0.16

*** 32.75±0.16

***

All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression

Dennett’s test ***

P<0.001, **

P<0.01 as compared to control. a P <0.001 when compared with normal.

Table.4. Effect of 95% MTT extract on liver enzyme levels in Alloxan induced diabetic rats

Parameters

Treatment

Normal Control

(Alloxan-

150mg/kg)

Standard

(Glibenclamide-

5mg/kg)

MTT

(250mg/kg)

MTT

(500mg/kg)

SGPT 15.13±0.23 58.55±0.72a 11.68±0.55

*** 21.77±0.38

*** 17.00±0.37

***

SGOT 20.65±0.50 63.23±0.76a 22.45±0.63

*** 22.51±0.55

*** 26.05±0.79

***

ALP 66.06±0.84 114.06±0.83a 107.33±0.77

*** 123.94±0.92

*** 106±0.42

***

Total

bilurubin

0.82±0.02 1.43±0.056a 1.28±0.08

*** 0.85±0.01

*** 0.43±0.01

***

Direct

Bilurubin

0.25±0.01 0.33±0.01a 0.26±0.01

*** 0.37±0.01

*** 0.27±0.01

***

Total protein 8.50±0.26 6.77±0.15a 7.88±0.30

*** 4.83±0.19

*** 6.28±0.032

***

All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression Dennett’s test ***

P<0.001

as compared to control. a P <0.001 when compared with normal.



Table.5. Effect of 95% MTT extract on body weight of Alloxan induced diabetic rats Normal Control

(Allaxon-

150mg/kg)

Standard

(Glibenclamide-

5mg/kg)

MTT (250mg/kg) MTT (500mg/kg)

0 Day 231.66±5.97 210±7.0710a 231.66±5.485

*** 236.66±4.513

*** 235±5.1370

***

1st Day 231.66±5.49 206.66±5.610

a 230.33±6.0858

*** 233.33±4.5133

*** 231.66±4.953

***

7th

Day 233.33±6.94 205±5.6519 a 231.66±6.419

*** 235±3.908

*** 231.66±4.356

***

14th

Day 236.66±4.51 208.33±3.664 a 228.33±6.419

*** 228.33±4.356

*** 228.333±3.664

***

21st Day

240±6.666 200±8.0794 a 230±6.666

*** 234.166±6.057

*** 240±3.333

***

All the values are mean± SEM, n=6, one way ANOVA followed by multiple compression

Dennett’s test ***

P<0.001,**P<0.01 as compared to control, a P <0.001 when compared with normal.

DISCUSSION

The results obtained from the present

investigation demonstrated that the bark extract of

Terminalia tomentosa constantly maintained significant

reduction of the glucose level in alloxan and oral glucose

mediated diabetic rats throughout the experimental period

suggesting the antidiabetic property of the title plant.

Diabetes mellitus causes failure to use of glucose for

energy that leads to increased utilization and decreased

storage of protein responsible for reduction of body

weight essentially by depletion of the body proteins. (John

E. Hall, 2001) In the present study, it was observed that

the extract reversed the weight loss of the diabetic rats.

Alloxan has been shown to induce free radical production

and cause tissue injury. (Halliwell and Gutteridge, 1985)

The pancreas is especially susceptible to the action of

alloxan induced free radical damage. The dose of

150mg/kg of alloxan can induces an autoimmune process

that results in the destruction of the β-cells of islets of

Langerhans; it also results in the toxicity of beta cells with

emergence of clinical diabetes within 2-4 days. (Weiss

RB)

CONCLUSION

The results of the present study indicated

that Terminalia tomentosa bark extract possesses

significant antidiabetic activity and hepatoprotective

activity against alloxan induced diabetic rats. Thus

justifies the traditional use of this plant in the

treatment of diabetes mellitus. Bark extract of the

title plant possesses almost equipotent antidiabetic

activity when compared with reference standard

Glibenclamide.

REFERENCES

Alberto Barceló1 and Swapnil Rajpathak, Incidence

and prevalence of diabetes mellitus in the Americas,

Pan Am J Public Health, 10(5), 2001, 300-308.

Halliwell B, Gutteridge JMC, Free radicals in biology

and medicine Clearendon Press Oxford, 1985, 215-

17.

John E. Hall, Guyton and Hall a text book of medical

physiology, Philadelphia Pennsylvania: The Curtis

center Saunders, 2000, 884-889.

Weiss RB, Streptozocin: A review of its

pharmacology, efficacy and toxicity, Cancer

Treatment Report, 66 (3), 1982, 427-38.

Wolrd Health Organization, W. H. Preventing

chronic diseases: a vital investment, 2005.

Vijay kumar et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


IN-VIVO ANTI-INFLAMMATORY ACTIVITY OF METHANOLIC EXTRACT OF

CISSUS REPANDA Vijay Kumar S

1*, Satyanarayana T

2, Anjana Mathew

2, S.Chandrasekhar

3, Rajendra G

1

1. Sri Krishna chaithanya college of pharmacy, Madanapalle, A.P

2. University College of pharmaceutical sciences, Andhra University, Visakhapatnam, A.P

3.Govt.Ayurvedic Dispensory,Nagenahalli,Karnataka

*Corresponding author: E mail: [email protected]

ABSTRACT The present investigation deals with the in-vivo acute toxicity studies and in-vivo anti-inflammatory

activity by Carrageenan induced rat paw edema model of methanolic extract in the stems of Cissus Repanda.

TheLiterature review reveals the presence of steroids, flavonoids, triterpenoids, and glycosides in Cissus

Repanda. Some plants belonging to Cissus genus have been reported to possess anti-inflammatory activity hence

methanolic extract of stems of C. Repanda were screened for anti-inflammatory activity. Carrageenan induced

significant inflammation when compared with the animals treated with the extracts. Standard drug, indomethacin

at 10 mg/kg inhibited the inflammation significantly at all-time intervals. C.Repanda exhibited significant anti-

inflammatory activity in dose dependant manner. C.Repanda inhibited the carrageenan induced inflammation

significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and 5 hours.

KEY WORDS:Cissus Repanda, Carrageenan induced Paw edema, Anti-Inflammatory, Acute toxicity.

1. INTRODUCTION

Plants have been used for medicinal purposes long

before recorded history in many countries such as India,

China and Africa. Since then, thousands of indigenous

plants have been used for the treatment of chronic

ailments. Many other herbs and minerals were later

described by ancient Indian herbalists such as Charaka and

Sushruta during the 1st millennium BC. The

SushrutaSamhita attributed to Sushruta in the 6th century

BC describes 700 medicinal plants (Agarwal, 2007). In

20th century, as part of industrial revolution, the practice

of allopathic medicines gained popularity. Eventually, the

spirit of herbal medicine declined from conventional

medicinal use as safety and effectiveness of herbal

medicines were not scientifically corroborated and remain

largely unknown. Due to the fact that the safety of

medicine has always been around for us, it becomes a

common theme to rely on safe treatments. Usage of herbal

traditional medicine is rising steadily, because of lesser

side effects, affordability and in certain diseases where no

suitable allopathic medicines are available. Based on the

therapeutics significant of herbs and by proper monitoring

of quality, dosage of the drug by the ayurvedic physician

is essential. Recent advances in the methodologies used to

extract, purify and evaluate plant extracts for biological

activity have enable the miniaturization and automation of

extremely specific biochemical tests. As a result, in

number of patients a resurgence of interest on plants and

plant derived products as a source of medicine is

increasing. There is an urgent need to re-emphasize and

enhance research in natural products in many therapeutic

areas (Bhujbal, 2008). Inflammation term is derived from

Latin word inflammare, which means - to set on fire.

Inflammation refers to a vital response of a tissue against

injury elicited by physical trauma, noxious chemical or

microbiological agents. It is considered to be body’s

defensive reaction either to inactivate or destroy the

injurious foreign agent or organism. It is triggered by the

release of chemical mediators which includes amines such

as histamine, serotonin and lipids such as prostaglandins

and small peptides such as kinins from the injured tissues

and migrating cells. Mainly, inflammatory responses

occur in three distinct phases, each apparently mediated

by different mechanisms: Accordingly, pharmacological

methods for anti-inflammatory evaluation have been

developed by artificially inducing inflammation by using

phlogistic agent (irritants) such as: Brewer’s yeast,

formaldehyde, dextran, egg albumin, kaolin, aerosol,

sulfated polysaccharides like carrageenan. The effects can

be measured by several methods such as UV-erythema in

guinea pigs, vascular permeability, Croton-oil ear edema

in rats and mice, Paw edema in rats and Granuloma pouch

technique (Brooks, 1991).

2. METHODOLOGY

2.1 Toxicity Studies on stems of methanolic extract of

C. Repanda in rats

2.1.1 Acute toxicity study in rats with test drugs: The

animals were used with the approval of Institutional

Animal Ethics Committee (Reg .No.627/02/A/CPCSEA).

Two groups, each of three female rats, were treated with

methanolic extract of stems of C. Repanda by oral

administration at a dosage of 2000 mg/kg body weight.

The test drugs were formulated in vehicle (distilled water)

at a concentration of 2000 mg/kg and administered at the

dose of 1ml/kg.

2.1.2 Treatment: The animals received a single dose of

the test item by oral administration at 2000 mg/kg body

weight for groups I and II, after being fasted for




approximately 18.0 hours but with free access to water.

Food was provided again at approximately 3.0 hours after

dosing for both the groups. The administration volume

was 10 ml/kg body weight. The animals were dosed using

18 G oral Stainless steel feeding tubes. The animals were

observed daily during the acclimatization period and

mortality/viability and clinical signs were recorded. All

animals were observed for clinical signs during first

30 minutes and at approximately 1, 2, 3 and 4 hours after

administration on test day 0 and once daily during test

days 1-14. Mortality/viability was recorded twice daily

during days 1-14 (at least once on day of sacrifice). Body

weights were recorded on test day 0 (prior to

administration), test days 7 and 14. All animals were

necrosed and examined macroscopically (Dorni, 2006).

2.1.3 Necroscopy: All animals were sacrificed at the end

of the observation period by carbon dioxide in euthanasia

chamber and discarded after the gross/macroscopic

pathological changes were visually observed and

recorded. No organs or tissues were retained.

2.2 Screening for anti-inflammatory activities of

methanolic extract of stems of C. Repanda in rats

2.2.1 Carrageenan induced rat paw edema model: The

model is based on the principle of release of various

inflammatory mediators by carrageenan. Edema formation

due to carrageenan in the rat paw is biphasic event. The

initial phase is attributed to the release of histamine and

serotonin. The second phase of edema is due to the release

of prostaglandins, protease and lysosome.Subcutaneous

injection of carrageenan into the rat paw produces

inflammation resulting from plasma extravasation,

increased tissue water and plasma protein exudation along

with neutrophil extravasation. All these events occur as a

result of metabolism of arachidonic acid. The

pharmacological screening of the C. Repanda was carried

out using standard protocols1. The crude extract was

suspended in 1% carboxy methyl cellulose (CMC) for

administration to albino rats. Albino rats of 150-200 g

were used for present investigation and were used with the

approval of the Institutional Animal Ethics Committee

(Regd. No. 627/02/A/CPSCSEA). They were kept in

polypropylene cages in an air-conditioned area at 25 +

2oCin 10-14 hours light dark cycle. They were provided

with Amruth brand balanced feed and tap water ad libitum

(Eshrat MH, 2003).

2.2.2 Experimental procedure: Seventy two rats were

divided into five groups (n=6) starved overnight with

water adlibitum prior to the day of experiment. The group

I kept as carrageenan control, groups II to IV received test

drugs at different doses and group V kept as standard drug

control, respectively.Left paw was marked with ink at the

level of lateral malleolus; basal paw volume was measured

plethysmographically by volume displacement method

using Plethysmometer (UGO Basile 7140) by immersing

the paw till the level of lateral malleolus. In the

experiment, animals from the control group were given

vehicle control, Carboxy Methy Cellulose (CMC) and

animals from standard drug were treated with

Indomethacin 10 mg/kg b.w orally as given in table 2.

Other groups were treated with different doses of test

drugs orally as given in table 2. After 30 min. of drug

treatment the rats are charged by a subcutaneous injection

of 0.1ml of 1% solution of carrageenan into the sub-

plantar side of the left hind paw (Gupta R, Bajpai KG,

2008). The paw volume is measured again at 1, 2, 3, 4 and

5 hours after charging. The increase in paw volume is

calculated as percentage compared with the basal volume.

The difference of average values between treated animals

and control group is calculated for each time interval and

evaluated statistically. The percent increase in paw

volume was calculated using formula as follows.

% increase in paw volume = 100)(

XV

VV

c

ct

Where Vt = paw volume at a time t, Vc = paw volume at a

time 0

3. RESULTS

All animals survived in group I and group II until

the end of the experimental period. All the animals dosed

at 2000 mg/kg body weight did not show evident toxicity

throughout the experimental period. The animals showed

increase in their body weight by day 14 as compared to

day 0. No abnormalities were detected for all the animals

at necropsy. Based on the results, the median lethal doses

(LD50)of, C. Repanda was greater than 2000 mg/kg b.w

and were classified as category 4 (it indicates that no death

was observed at 2000mg/kg b.w.) as per OECDguidelines

(Hoareau and DaSilva,1999).



Table.1.Body weight analysis of test drug treated rats Test drug Group Dose(mg/kg

bodyweight) Animal

Numbers

Sex Test day 0

(treatment)(g)

Testday7

(g)

Testday14

(g)

C.

Repanda I 2000

002013 Female 201.00 231.30 252.10

002014 Female 210.14 231.72 252.60

002015 Female 203.86 229.92 242.84

II 2000

002016 Female 205.66 231.54 252.25

002017 Female 201.44 232.06 253.03

002018 Female 212.61 232.22 263.18

mg/kg = miligram/kilogram, g = gram

Table.2 Macroscopic findings of animals from test drug treated groups

Table.3.Showing percentage of inflammation indicating Anti-inflammatory activity of test drugs on

Carrageenan induced rat paw oedema Groups Drug Doses Percentage of inflammation at time (hours)

1 2 3 4 5

I Carrageenan

Control

38.83±1.03 81.83±1.16 113.3±2.39 131.0±4.98 146.72±5.46

II C.Repanda

250mg/kg

38.57 ±0.80 80.58 ±1.10 110.9 ±1.94 130.02 ±5.35 138.75 ± 6.42

III C.Repanda

500mg/kg

36.78 ±1.76 80.16 ±0.62 * 99.07 ±4.00 *** 120.55 ±4.29 ** 114.32 ± 4.30 ***

IV C.Repanda

1000mg/kg

36.28 ±1.82 * 79.60 ±1.04 ** 97.5±2.32*** 113.8±5.26*** 98.00±3.67 ***

V Indomethacin

10 mg/kg

12.55±0.86*** 19.1±0.48 *** 27.17±1.07*** 32.65±1.52*** 30.15±2.50 ***

* P<0.05, ** P<0.01, *** P<0.001 significant from control

Figure.1.Percentage of inflammation indicating Anti-inflammatory activity of C. Repanda in Carrageenan induced rat

paw oedema

Test

drug

Group Dose

(mg/kgbw)

Animal

Numbers

Sex Mode of death Macroscopic findings

C.

Repand

a

I 2000

002013 Female Terminal Sacrifice No abnormalities

Detected


Detected


Detected

II 2000


Detected


Detected


Detected



4. CONCLUSION

In the control group, carrageenan induced

significant inflammation when compared with the animals

treated with the extracts. Standard drug, indomethacin at

10 mg/kg inhibited the inflammation significantly at all

time intervals. C. Repanda exhibited significant anti-

inflammatory activity in dose dependent manner. C.

Repanda inhibited the carrageenan induced inflammation

significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and

5 hours.

REFERENCES

Agarwal SS, Herbal Drug Technology, Universities Press,

India, 2007, 582.

Bhujbal SS, Chitlange SS, Suralkar AA, et al., Anti-

inflammatory activity of an isolated flavonoid fraction

from Celosia argentea Linn, Journal of Medicinal Plants

Research, 2(3), 2008, 52-54.

Brooks RR, Carpenter JF, Jones SM, Ziegler TC, Pong

SF, Canine carrageenin-induced acute paw inflammation

model and its response to nonsteroidal anti-inflammatory

drugs, Journal of Pharmacological Methods, 25, 1991,

275–283.

Dorni C, Vidyalakshmi KS, Vasanthi HR, Anti-

inflammatory activity of Plumbago capensis,

Pharmacognosy Magazine, 2(8), 2006, 239-243.

Eshrat MH, Effect of Coccinia indica (L) and Aroma

augusta (L) on glycemia, lipid profile and on indications

of end-organ damage in streptozotocin induced diabetic

rats, Indian Journal of Clinical Biochemistry, 18(2), 2003,

54-63.

Ghosh MN, Fundamental Experimental Pharmacology,

Calcutta, 1981, 145.

Gupta R, Bajpai KG, Johri S, Saxena AM, An overview of

Indian novel traditional medicinal plants with antidiabetic

potentials, The African Journal of Traditional, 5(1), 2008,

1-17.

Hoareau L, DaSilva EJ, Medicinal plants, a re-emerging

health aid, Electronic Journal of Biotechnology, 2(2),

1999, 56-70.

Kanwar P, Sharma N, Rekha A, Medicinal plants use in

traditional healthcare systems prevalent in western

Himalayas, Indian Journal of Traditional Knowledge,

5(3), 2006, 300-309.

Maduka IC, Neboh EE, Kwubiri UN, The prevalence of

diabetic nephropathy in diabetic patients, European

Journal of Scientific Research, 26(2), 2009, 255-259.

Mbanya JC, Ramiya K, Diabetes mellitus,

http://www.ncbi.nlm.nih.gov/bookshelf, Accessed, 2010.

Mohan V, Sandeep S, Deepa R, Epidemiology of type 2

diabetes, Indian Scenario, Indian Journal of Medical

Research, 125, 2007, 217-230.

Mujumdar AM, Naik DG, Dandge CN, et al., Anti-

inflammatory activity of Curcuma amada Roxb in Albino

rats, Indian Journal of Pharmacology, 32, 2000, 375-377.

Mukherjee PK, Quality control of herbal drugs,

Pharmaceutical Publishers, India, 2005, 554.

OECD/OCDE guideline for testing of chemicals, Revised

draft guidelines 423, Acute oral toxicity- acute toxic class

method, Revised document, 17th December 2001, 12.

Prempeh ABA, Attipoe JM, Analgesic activity of crude

aqueous extract of the root bark of Zanthoxylum

xanthoxyloides, Ghana Medical Journal, 42(2), 2008, 79-

84.

Turner AR, Screening Methods in Pharmacology,

Academic press, London, 1965, 152.

Winter CA, Risley EA, Nuss GW, Carrageenan -induced

oedema in hind paw of the rat as an assay for anti-

inflammatory drugs, Proc.Soc.Exp.Biol.Med., 111, 1962,

544-547.

Winter CA, Risley EA, Nuss GW, Antiinflammatory and

antipyretic activities of indomethacin, (1-

(pchlorobenzoyl)-5-methoxy-2-methyl-indole-3-acetic

acid, Journal of pharmacolological experimental

therapeutics, 141, 1963, 369-376.



IN-VIVO ANTI-INFLAMMATORY ACTIVITY OF METHANOLIC EXTRACT OF

CISSUS VITIGINEA Vijay Kumar S

1*, Satyanarayana T

2, Anjana Mathew

2, S.Chandrasekhar

3, Reddysekhar1

1.Sri Krishna Chaithanya college of pharmacy, Madanapalle, A.P

2. University College of pharmaceutical sciences, Andhra University, Visakhapatnam, A.P

3.Govt. Ayurvedic Dispensory,Nagenahalli,Karnataka

*Corresponding author: E mail: [email protected]

ABSTRACT

The present investigation deals with the in-vivo acute toxicity studies and in-vivo anti-inflammatory activity

by Carrageenan induced rat paw edema model of methanolic extract in the stems of Cissus Vitiginea. The

Literature review reveals the presence of steroids, flavonoids, triterpenoids, and glycosides in Cissus Vitiginea.

Some plants belonging to Cissus genus have been reported to possess anti-inflammatory activity hence

methanolic extract of stems of C. Vitiginea were screened for anti-inflammatory activity. Carrageenan induced

significant inflammation when compared with the animals treated with the extracts. Standard drug, indomethacin

at 10 mg/kg inhibited the inflammation significantly at all-time intervals. C.Vitiginea exhibited significant anti-

inflammatory activity in dose dependant manner. C.Vitiginea inhibited the carrageenan induced inflammation

significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and 5 hours.

KEY WORDS: Cissus Vitiginea, Carrageenan induced Paw edema, Anti-Inflammatory, Acute

1. INTRODUCTION

Plants have been used for medicinal purposes long

before recorded history in many countries such as India,

China and Africa. Since then, thousands of indigenous

plants have been used for the treatment of chronic

ailments. Many other herbs and minerals were later

described by ancient Indian herbalists such as Charaka and

Sushruta during the 1st millennium BC. The Sushruta

Samhita attributed to Sushruta in the 6th century BC

describes 700 medicinal plants (Agarwal, 2007). In 20th

century, as part of industrial revolution, the practice of

allopathic medicines gained popularity. Eventually, the

spirit of herbal medicine declined from conventional

medicinal use as safety and effectiveness of herbal

medicines were not scientifically corroborated and remain

largely unknown. Due to the fact that the safety of

medicine has always been around for us, it becomes a

common theme to rely on safe treatments. Usage of herbal

traditional medicine is rising steadily, because of lesser

side effects, affordability and in certain diseases where no

suitable allopathic medicines are available. Based on the

therapeutics significant of herbs and by proper monitoring

of quality, dosage of the drug by the ayurvedic physician

is essential. Recent advances in the methodologies used to

extract, purify and evaluate plant extracts for biological

activity have enable the miniaturization and automation of

extremely specific biochemical tests. As a result, in

number of patients a resurgence of interest on plants and

plant derived products as a source of medicine is

increasing. There is an urgent need to re-emphasize and

enhance research in natural products in many therapeutic

areas (Bhujbal, 2008). Inflammation term is derived from

Latin word inflammare, which means - to set on fire.

Inflammation refers to a vital response of a tissue against

injury elicited by physical trauma, noxious chemical or

microbiological agents. It is considered to be body’s

defensive reaction either to inactivate or destroy the

injurious foreign agent or organism. It is triggered by the

release of chemical mediators which includes amines such

as histamine, serotonin and lipids such as prostaglandins

and small peptides such as kinins from the injured tissues

and migrating cells. Mainly, inflammatory responses

occur in three distinct phases, each apparently mediated

by different mechanisms: Accordingly, pharmacological

methods for anti-inflammatory evaluation have been

developed by artificially inducing inflammation by using

phlogistic agent (irritants) such as: Brewer’s yeast,

formaldehyde, dextran, egg albumin, kaolin, aerosol,

sulfated polysaccharides like carrageenan. The effects can

be measured by several methods such as UV-erythema in

guinea pigs, Vascular permeability, Croton-oil ear edema

in rats and mice, Paw edema in rats and Granuloma pouch

technique (Brooks, 1991).

2. METHODOLOGY

2.1. Toxicity Studies on stems of methanolic extract of

C. Vitiginea in rats:

2.1.1 Acute toxicity study in rats with test drugs: The

animals were used with the approval of Institutional

Animal Ethics Committee (Reg .No. 627/02/A/CPCSEA).

Two groups, each of three female rats, were treated with

methanolic extract of stems of C. Vitiginea by oral

administration at a dosage of 2000 mg/kg body weight.

The test drugs were formulated in vehicle (distilled water)

at a concentration of 2000 mg/kg and administered at the

dose of 1ml/kg.

2.1.2 Treatment: The animals received a single dose of

the test item by oral administration at 2000 mg/kg body

weight for groups I and II, after being fasted for




approximately 18.0 hours but with free access to water.

Food was provided again at approximately 3.0 hours after

dosing for both the groups. The administration volume

was 10 ml/kg body weight. The animals were dosed using

18 G oral Stainless steel feeding tubes. The animals were

observed daily during the acclimatization period and

mortality/viability and clinical signs were recorded. All

animals were observed for clinical signs during first

30 minutes and at approximately 1, 2, 3 and 4 hours after

administration on test day 0 and once daily during test

days 1-14. Mortality/viability was recorded twice daily

during days 1-14 (at least once on day of sacrifice). Body

weights were recorded on test day 0 (prior to

administration), test days 7 and 14. All animals were

necrosed and examined macroscopically(Dorni,2006).

2.1.3 Necroscopy: All animals were sacrificed at the end

of the observation period by carbon dioxide in euthanasia

chamber and discarded after the gross/macroscopic

pathological changes were visually observed and

recorded. No organs or tissues were retained.

2.2 Screening for anti-inflammatory activities of

methanolic extract of stems of C. Vitiginea in rats:

2.2.1 Carrageenan induced rat paw edema model: The

model is based on the principle of release of various

inflammatory mediators by carrageenan. Edema formation

due to carrageenan in the rat paw is biphasic event. The

initial phase is attributed to the release of histamine and

serotonin. The second phase of edema is due to the release

of prostaglandins, protease and lysosome. Subcutaneous

injection of carrageenan into the rat paw produces

inflammation resulting from plasma extravasation,

increased tissue water and plasma protein exudation along

with neutrophil extravasation. All these events occur as a

result of metabolism of arachidonic acid.

The

pharmacological screening of the C. Vitiginea was carried

out using standard protocols1. The crude extract was

suspended in 1% carboxy methyl cellulose (CMC) for

administration to albino rats. Albino rats of 150-200 g

were used for present investigation and were used with the

approval of the Institutional Animal Ethics Committee

(Regd. No. 627/02/A/CPSCSEA). They were kept in

polypropylene cages in an air-conditioned area at 25 + 2oC

in 10-14 hours light dark cycle. They were provided with

Amruth brand balanced feed and tap water ad libitum

(Eshrat MH, 2003).

2.2.2 Experimental procedure: Seventy two rats were

divided into five groups (n=6) starved overnight with

water adlibitum prior to the day of experiment. The group

I kept as carrageenan control, groups II to IV received test

drugs at different doses and group V kept as standard drug

control, respectively. Left paw was marked with ink at the

level of lateral malleolus; basal paw volume was measured

plethysmographically by volume displacement method

using Plethysmometer (UGO Basile 7140) by immersing

the paw till the level of lateral malleolus. In the

experiment, animals from the control group were given

vehicle control, Carboxy Methy Cellulose (CMC) and

animals from standard drug were treated with

Indomethacin 10 mg/kg b.w orally as given in table 2.

Other groups were treated with different doses of test

drugs orally as given in table 2. After 30 min. of drug

treatment the rats are charged by a subcutaneous injection

of 0.1ml of 1% solution of carrageenan into the sub-

plantar side of the left hind paw (Gupta R, Bajpai KG,

2008). The paw volume is measured again at 1, 2, 3, 4 and

5 hours after charging. The increase in paw volume is

calculated as percentage compared with the basal volume.

The difference of average values between treated animals

and control group is calculated for each time interval and

evaluated statistically. The percent increase in paw

volume was calculated using formula as follows.

% increase in paw volume = 100)(

XV

VV

c

ct

Where Vt = paw volume at a time t, Vc = paw volume at a

time 0

3. RESULTS

All animals survived in group I and group II until

the end of the experimental period. All the animals dosed

at 2000 mg/kg body weight did not show evident toxicity

throughout the experimental period. The animals showed

increase in their body weight by day 14 as compared to

day 0. No abnormalities were detected for all the animals

at necropsy. Based on the results, the median lethal doses

(LD50) of, C. Vitiginea was greater than 2000 mg/kg b.w

and were classified as category 4 (it indicates that no death

was observed at 2000mg/kg b.w.) as per OECD

guidelines (Hoareau and DaSilva,1999).



Table.1 Body weight analysis of test drug treated rats Test drug Group Dose(mg/kg

bodyweight) Animal

Numbers

Sex Test day 0

(treatment)(g)

Testday7

(g)

Testday14

(g)

C.

Vitiginea I

2000

002001 Female 220.23 241.22 252.38

002002 Female 221.24 241.89 252.13

002003 Female 202.28 240.92 251.68

II

2000

002004 Female 222.41 243.11 263.61

002005 Female 223.12 243.68 253.84

002006 Female 222.51 243.00 253.38

mg/kg = miligram/kilogram, g = gram

Table.2 Macroscopic findings of animals from test drug treated groups Test drug Group Dose

(mg/kgbw)

Animal

Numbers

Sex Mode of death Macroscopic findings

C.

Vitiginea I 2000 002001 Female Terminal Sacrifice No abnormalities Detected

002002 Female Terminal Sacrifice No abnormalities Detected


II 2000 002004 Female Terminal Sacrifice No abnormalities Detected



bw = body weight,T.S.= Terminal Sacrifice, N.A.D.= No abnormalities Detected

Table 3: Showing percentage of inflammation indicating Anti-inflammatory activity of test drugs on

carrageenan induced rat paw oedema Groups Drug Doses Percentage of inflammation at time (hours)

1 2 3 4 5

I Carrageenan Control 38.83±1.03 81.83±1.16 113.3±2.39 131.0±4.98 146.72±5.46

II C.Vitiginea, 250mg/kg 37.18 ±1.15 80.10 ±1.03 109.83 ±3.23 130.60 ±3.74 143.68 ± 4.62

III C.Vitiginea,500mg/kg 36.00 ±3.36 78.63 ±3.15 108.58 ±1.71 127.00 ±2.18 139.87 ± 5.20

IV C.Vitiginea,1000mg/kg 37.88 ±2.74 77.42 ±3.39 * 101.87 ±3.14 *** 128.75 ±2.63 126.74 ± 5.84 *** V Indomethacin,10 mg/kg 12.55±0.86*** 19.1±0.48 *** 27.17±1.07*** 32.65±1.52*** 30.15±2.50 ***

Figure.1. Percentage of inflammation indicating Anti-inflammatory activity of C. Vitiginea in carrageenan induced

rat paw oedema

4. CONCLUSION

In the control group, carrageenan induced

significant inflammation when compared with the animals

treated with the extracts. Standard drug, indomethacin at

10 mg/kg inhibited the inflammation significantly at all

time intervals. C. Vitiginea exhibited significant anti-

inflammatory activity in dose dependent manner. C.

Vitiginea inhibited the carrageenan induced inflammation

significantly at doses of 500 and 1000 mg/kg at 2, 3, 4 and

5 hours.



REFERENCES

Agarwal SS, Herbal Drug Technology, Universities Press,

India, 2007, 582.

Bhujbal SS, Chitlange SS, Suralkar AA, et al., Anti-

inflammatory activity of an isolated flavonoid fraction

from Celosia argentea Linn, Journal of Medicinal Plants

Research, 2(3), 2008, 52-54.

Brooks RR, Carpenter JF, Jones SM, Ziegler TC, Pong

SF, Canine carrageenin-induced acute paw inflammation

model and its response to nonsteroidal anti-inflammatory

drugs, Journal of Pharmacological Methods, 25, 1991,

275–283.

Dorni C, Vidyalakshmi KS, Vasanthi HR, et al., Anti-

inflammatory activity of Plumbago capensis,

Pharmacognosy Magazine, 2(8), 2006, 239-243.

Eshrat MH, Effect of Coccinia indica (L) and Aroma

augusta (L) on glycemia, lipid profile and on indications

of end-organ damage in streptozotocin induced diabetic

rats, Indian Journal of Clinical Biochemistry, 18(2), 2003,

54-63.

Ghosh MN, Fundamental Experimental Pharmacology,

Calcutta, 1981, 145.

Gupta R, Bajpai KG, Johri S, Saxena AM, An overview of

Indian novel traditional medicinal plants with antidiabetic

potentials, The African Journal of Traditional, 5(1), 2008,

1-17.

Hoareau L, DaSilva EJ, Medicinal plants, a re-emerging

health aid, Electronic Journal of Biotechnology, 2(2),

1999, 56-70.

Kanwar P, Sharma N, Rekha A, Medicinal plants use in

traditional healthcare systems prevalent in western

Himalayas, Indian Journal of Traditional Knowledge,

5(3), 2006, 300-309.

Maduka IC, Neboh EE, Kwubiri UN, The prevalence of

diabetic nephropathy in diabetic patients, European

Journal of Scientific Research, 26(2), 2009, 255-259.

Mbanya JC, Ramiya K, Diabetes mellitus,

http://www.ncbi.nlm.nih.gov/bookshelf, Accessed, 2010.

Mohan V, Sandeep S, Deepa R, et al., Epidemiology of

type 2 diabetes, Indian Scenario, Indian Journal of

Medical Research, 125, 2007, 217-230.

Mujumdar AM, Naik DG, Dandge CN, et al., Anti-

inflammatory activity of Curcuma amada Roxb in Albino

rats, Indian Journal of Pharmacology, 32, 2000, 375-377.

Mukherjee PK, Quality control of herbal drugs,

Pharmaceutical Publishers, India, 2005, 554.

OECD/OCDE guideline for testing of chemicals, Revised

draft guidelines 423, Acute oral toxicity- acute toxic class

method, Revised document, 17th December 2001, 12.

Prempeh ABA, Attipoe JM, Analgesic activity of crude

aqueous extract of the root bark of Zanthoxylum

xanthoxyloides, Ghana Medical Journal, 42(2), 2008, 79-

84.

Turner AR, Screening Methods in Pharmacology,

Academic press, London, 1965, 152.

Winter CA, Risley EA, Nuss GW, Carrageenan -induced

oedema in hind paw of the rat as an assay for anti-

inflammatory drugs, Proc.Soc.Exp.Biol.Med., 111, 1962,

544-547.

Winter CA, Risley EA, Nuss GW, Antiinflammatory and

antipyretic activities of indomethacin, (1-

(pchlorobenzoyl)-5-methoxy-2-methyl-indole-3-acetic

acid, Journal Of Pharmacolological Experimental

Therapeutics, 141, 1963, 369-376.

Indumathi et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND EVALUATION OF BILAYER TABLET OF CONVENTIONAL

RELEASE PARACETAMOL AND MODIFIED RELEASE DICLOFENAC SODIUM Indhumathi D*, Mastan Vali Sheik, Priyadharshini N, Damodharan N

SRM College of Pharmacy, SRM University, Kattankulathur, Kanchipuram, Tamil Nadu, India


ABSTRACT

The present study deals with formulation and evaluation of bilayer tablet of paracetamol and diclofenac

sodium to provide control over release of drug and to maintain the drug concentration. The major ingredients are

paracetamol granules and diclofenac sodium granules and were prepared separately by wet granulation method.

Paracetamol, PEG6000 and intragranular fraction granules were cooled and blended with microcrystalline

cellulose, croscarmellose, Cab-O-Sil and magnesium stearate and mixture of diclofenac sodium and HPMC K4M

were granulated using water and isopropyl alcohol. The wet mass is passed through a 20# sieve and dried. The

granules of optimized batch of paracetamol and diclofenac sodium were compressed to obtain bi-layer tablet. The

tablets were evaluated for percentage friability, crushing strength and in-vitro drug release. Totally 9 formulations

for paracetamol and 6 formulations of diclofenac were prepared and studied for their various precompression and

postcompression parameters. The formulation F9 for paracetamol showed in-vitro drug release of 93.09% and

exhibited satisfactory results in all parameters and subjected to stability studies. And the formulation F6 showed

in-vitro drug release of 71.68% and exhibited satisfactory results and was subjected to stability studies. Thus

formulation F9 for paracetamol and F6 for Diclofenac was found to be successful as immediate release and

extended release bi-layer tablet and can be manufactured with reproducible characteristics from batch to batch.

Key words: Bilayer tablet, Paracetamol, Diclofenac sodium

INTRODUCTION

The conventional dosage forms provide no control

over release of drug. To maintain the drug concentration

within the therapeutically effective range, it is necessary

to take it several times a day which results in significant

fluctuation in drug levels. The sustain release of drug, in a

general way is to modify the normal behaviour of drug

molecule in a physiological environment. The present

study deals with formulation and evaluation of bilayer

tablet of Paracetamol and Diclofenac sodium to provide

control over release of drug and to maintain the drug

concentration.


Preparation of Microcrystalline cellulose granules:

Microcrystalline cellulose was granulated using 5% w/v

aqueous PVP K30 solution. The wet mass was passed

through a 20# sieve to obtain granules and dried at 60oC in

a tray drier. The 20/40 mesh cut granules were used for

preparing paracetamol tablets.

Preparation of Paracetamol tablets: Paracetamol,

PEG6000 and intragranular fraction granules were cooled

and blended with microcrystalline cellulose,

croscarmellose, Cab-O-Sil and magnesium stearate. The

tablets were prepared on a single station tablet press and

evaluated for percentage friability, crushing strength and

disintegration time.

Preparation of Diclofenac sodium tablets: Mixture of

diclofenac sodium and HPMC K4M were granulated

using water (1part) and isopropyl alcohol (9parts). The

wet mass passed through a 20# sieve and dried at 55oC for

15 min in tray drier. Cab-O-Sil and magnesium stearate,

each at 0.5% w/w were mixed with the granules. The

tablet were prepared on single station tablet press and


in vitro drug release.

Preparation of Bi-Layer tablet: The granules of

optimized batch of Paracetamol were added in the die

cavity of single punch tablet machine. The granules of

optimized batch of Diclofenac sodium were added over

the granules of paracetamol. The granules were

compressed to obtain bi-layer tablet. The tablets were


in vitro drug release.


Nine formulations were prepared for Paracetamol

and similarly 6 formulations were made for diclofenac

sodium and their precompression and postcompression

parameters were studied. The formulation F9 for

paracetamol showed in-vitro drug release of 93.09% and

exhibited satisfactory results in all parameters and

subjected to stability studies. And the formulation F6

showed in-vitro drug release of 71.68% and exhibited

satisfactory results and was subjected to stability studies.



0

20

40

60

80

100

0 10 20 30 40 50

Percentage drug release of paracetamol bilayer tablets with respect to time in min

Table.1.Formulation table for Paracetamol Ingrediants (mg)

Quantities(mg/tab)

F1 F2 F3 F4 F5 F6 F7 F8 F9

Paracetamol 500 500 500 500 500 500 500 500 500

PEG 6000 30.00 20.00 - - - - - - -

Water q.s q.s q.s q.s q.s q.s q.s q.s q.s

MCC PH 101 60.00 60.00 80.00 40.00 40.00 55.00 50.00 56.56 58.40

Magnesium stearate 1.00 1.00 1.00 1.00 1.50 1.50 1.00 1.50 1.00

Gelatin - 10.00 - - - - - - -

Talc 2.00 2.00 2.00 2.00 2.00 2.00 - - -

Aerosol 1.00 1.00 1.00 1.00 1.00 1.00 - - -

Lactose 20.00 - 30.00 30.00 20.00 18.00 20.00 16.00 16.00

Hydroxylpropyl cellulose

LF

- - - 2.00 1.50 1.50 1.80 1.60 1.20

Calcium carbonate - - - 40.00 36.00 40.00 38.00 24.00

MCC PH 102 - - - 10.00 10.00 10.00 10.00 10.00 10.00

Croscarmellose sodium - - - 25.00 - 12.00 16.00 7.00 4.50

Croscarmellose sodim - 16.00 - - - - - 6.5 9.10

Total weight (mg/tab) 614.0 604.0 614.0 611.0 617.0 637.0 641.0 640.0 635.0

Table.2.Formulation table for Diclofenac Sodium Ingrediants(mg/tab) F1 F2 F3 F4 F5 F6

Diclofenac sodium 100.00 100.00 100.00 100.00 100.00 100.00

HPMC K 100 90.00 110.00 120.00 130.00 140.00 150.00

PVP K 90 87.00 30.00 18.60 25.00 23.80 22.50

IPA q.s q.s q.s q.s q.s q.s

Stearic acid 36.68 40.95 46.40 35.20 21.40 11.50

Total weight (mg/tab) 313.0 313.68 315.0 325.0 320.0 320.0

Table.3.Evaluation parameters for Paracetamol and Diclofenac sodium Bilayer tablet Parameters T1 T2 T3 T4 T5 Average

Hardness (kg/ ) 9.38 9.20 9.28 9.10 9.39 9.26

Thickness(mm) 7.32 7.44 7.35 7.40 7.39 7.38

Friability(%) 0.09 0.11 0.14 0.10 0.15 0.12

Disintegration time(sec) Paracetamol 373 382 375 379 371 376

Drug content (%) of Paracetamol 105.71 111.70 - - - 108.70

Drug content(%) of Diclofenac sodium 101.38 102.16 - - - 101.77

In-vitro Dissolution (%) Paracetamol 93.09 - - - 93.09

In-vitro dissolution (%) Diclofenac sodium 71.68 - - - 71.68

Fig 1: Percentage drug release of Diclofenac sodium

bilayer tablets with respect to time in min

Fig 2: Percentage drug release of Paracetamol bilayer

tablets with respect to time in min

0

20

40

60

80

0 200 400 600 800

Percentage drug release of diclofenac sodium bilayer tablets with respect to time in min



CONCLUSION

From this study, it may be concluded that the

formulation F9 for Paracetamol and F6 for Diclofenac

sodium was found to be successful as immediate release

and extended release bi-layer tablet and can be

manufactured with reproducible characteristics from batch

to batch.

REFERENCES Collins SL., Moore RA., McQuay HJ., Wiffen PJ.,

Edwards JE, Single dose oral ibuprofen and diclofenac for

postoperative pain, Cochrane Systematic Rev, 3, 1998, 3,

1-10.

Davie IT, Gordon NH, Comparative assessment of

fenoprofen and paracetamol given in combination for pain

after surgery, Br J anaesth, 50, 1978, 931-5.

Davie IT., Gordon NH, Comparitive assessment of

fenoprofen and paracetamol, Br J Anaesth, 50, 1978, 931-

5.

Montgomery JE, Sutherland CJ, Kestin IG, Sneyd JH,

morphine consumption in patients receiving rectal

paracetamol and diclofenac alone and in combination. BJ

Anaesth, 77, 1996, 445-7.

Parkhouse J., Hallinon P. A comparison of aspirin and

paracetamol, Br J Anaesth, 39, 1967, 146-54.

Shah HJ., Rathod IS.,Shah SA.,Savale SS., Shishoo CJ,

Sensitive HPTLC method for monitoring dissolution

profiles of diclofenac sodium from different tablets

containing combined diclofenac and acetaminophen, J

Planar chromatogr, 16, 2003, 36-44.

Ward B, Alexander-Williams JM, Paracetamol revisted: a

review of the pharmacokinetics and pharmacodynamics,

Acute Pain, 12, 1999, 139-149.

Wiebalck CA, Van Aken H, Paracetamol and

propacetamol for post-operative pain: contrasts to

traditional Nsaids, Bailliere’s Clin Anaesthesiol, 1995, 9,

469-482.

Ranjith et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


DEVELOPMENT AND VALIDATION OF ASSAY METHOD FOR MELOXICAM

TABLETS BY RP-HPLC K. Ranjith1, M.V.Basaveswara Rao2, T.E.G.K.Murthy3

1 &3.Department of Pharmaceutical Analysis, Bapatla College of Pharmacy, Bapatla, Guntur, Andhra Pradesh, India.

2. Department of Chemistry and Pharmacy, Krishna University, Machilipatnam, Krishna, Andhrapradesh, India.


ABSTRACT

A simple, precise, accurate and economical RP-HPLC method has been developed and validated

for the assay of Meloxicam tablets. The method was developed using pH 7.0 Phosphate buffer: Acetonitrile (40:60

v/v) in isocratic mode and Waters Xterra C 18 (150 X 4.6mm), 5µ column. Flow rate and detection wavelengths

were fixed at 0.8 ml/min and 344 nm. Retention time for Meloxicam was found to be 2.448 minutes. Method

was validated as per ICH guidelines to test its suitability for intended purpose. Linearity range for Meloxicam

was set at 10-75 µg/ml with correlation coefficient 0.999. Accuracy values for method were found to be 99.53-

99.66%. Method found to be robust against changes in flow rate, organic composition, pH of mobile phase and

detection wavelength. The proposed method is suitable for quality control analysis of Meloxicam tablets.

Key words: Meloxicam, RP-HPLC, Method development and Validation.

INTRODUCTION

Meloxicam is a potent non-steroidal anti-

inflammatory drug of the enolic acid class of oxicam

derivatives. Chemically it is 4-hydroxy-2-methyl-N-(5-

methyl-2-thiazolyl)-2H-1, 2-benzo-thiazine-3-

carboxamide-1, 1-dioxide (C14H13N3O4S2).It is more

effective at low doses with a good gastrointestinal

tolerability. Literature survey reveals the availability of

various analytical methods for quantitation of meloxicam

present in different matrices i.e. biological and tablet, by

employing different techniques like UV-Visible

Spectrophotometry, Fluorimetry, RP-HPLC, LC-MS, LC-

MS/MS and Capillary Zone Electrophoresis. Many of

reported methods employed internal standard for the

estimation of meloxicam present in matrix, which turned

the analytical procedure tedious. Some RP-HPLC methods

are not economical in terms of mobile phase composition,

column dimensions and run times. Hence there is need for

the development of newer analytical method to overcome

above discussed hurdles for the estimation of meloxicam

present in tablets. Aim of the present study is to develop a

simple, precise and accurate method for the estimation of

meloxicam in formulations by RP-HPLC.


Chemicals and Solvents: Meloxicam working reference

standard (Potency-99.95 %w/w on as is basis) was

obtained from Dr.Reddy’s Laboratories Ltd., Hyderabad.

HPLC grade- Acetonitrile and Water were procured from

E.Merck (India) Ltd., Mumbai, India. Orth AR grade –

Potassium dihydrogen orthophosphate and Triethylamine

were obtained from E.Merck (India)Ltd., Mumbai, India.

Muvera 7.5 manufactured by Sun Pharma Limited,Sikkim

were procured from local pharmacy.

Preparation of Phosphate Buffer:

21.10 gm of Potassium dihydrogen orthophosphate was

weighed and dissolved in 3000 mL of water (HPLC

grade). pH was adjusted to 7.01 with triethylamine and

sonicated for 10 min. Filtered through 0.45 µ Millipore

Nylon filter.

Preparation of Mobile Phase: A mixture of pH 7.01

phosphate buffer 2400 mL (40%) and acetonitrile 3600

mL (60%) were mixed well, degassed in a sonicator for

about 10 minutes and filtered through 0.45 µ Millipore

Nylon filter.

Diluent: Mobile phase was used as diluent

Chromatographic Conditions: Assay of Meloxicam

tablets was carried out on a Waters HPLC system

equipped with Aliance 2695 binary pump, a 100 µL

injection loop, auto sampler and a 2487 dual wavelength

UV detector and running on Waters Empower software.

The chromatographic conditions are as follows, Column:

Waters Xterra C18 (150 x 4.6mm), 5µ; Flow rate: 0.8

ml/min; Detection wavelength: 344 nm; Injection volume:

20 µl; Runtime: 6 minutes; Column temperature: Ambient

and Sample cooler temperature: 20°C

Preparation of Standard Stock Solution for Assay:

Accurately 50.07 mg of Meloxicam working reference

standard was weighed and transferred into a 50 mL clean

dry volumetric flask. 10 mL of diluent was added and

sonicated for 10 min for complete dissolution of the drug.

Finally the volume was made up to the mark with the

diluent.

Preparation of Standard Solution for Assay: 3 mL of

standard stock solution was pipetted into a 100 mL

volumetric flask and diluted up to the mark with diluent.

Filtered through 0.45µ Millipore Nylon filter.

Preparation of Sample Stock Solution for Assay: 20

tablets were weighed and the average weight was

determined. Tablets were crushed into fine powder.




Accurately weighed and transferred 1001.1 gm of powder

equivalent to 50 mg of meloxicam into 50 mL volumetric

flask, 20 mL of diluent was added and sonicated for 20

minutes with intermittent shaking. Volume was made up

to the mark with the diluent. Mixed well and centrifuged

at 5000 RPM for 8 minutes.

Preparation of Sample Solution for Assay: 3 mL of

supernatant sample stock solution was pipetted into a 100

mL volumetric flask and diluted up to the mark with

diluent. Filtered through 0.45µ Millipore Nylon filter.

System Suitability Criteria:

1. %RSD for the peak areas of responses of three replicate

injections of the standard solution is not more than 2.0%.

2. The number of theoretical plates (N) for meloxicam

should be NLT 2000.

3. The tailing factor (T) for meloxicam should be NMT

2.0

Method Validation: The proposed method for assay was

subjected to validation as per ICH guidelines to test its

suitability for intended purpose.

Specificity was demonstrated by comparing blank,

standard and sample chromatograms. Linearity was

demonstrated from 33-250% of sample concentration.

System precision was demonstrated by injecting six

replicate injections of standard solution. Method precision

for assay was demonstrated by injecting a set of of six

separate assay samples in to chromatographic system.

Ruggedness for assay was demonstrated by injecting a set

of six separate assay samples in to chromatographic

system on different day. Accuracy was performed by

standard addition method,spiking 50% to 150%of

standard into 100% sample .Robustness was evaluated by

changing ± 10% flow rate, ± 0.2 units of buffer, ± 5 nm

variation in detection wavelength and ± 2% absolute in

organic content of mobile phase.


In proposed method retention time of Meloxicam

was found to be 2.448 minutes. USP Plate Count for

Meloxicam 2552 indicated suitability of column. Linearity

was demonstrated for Meloxicam from 33 to 250% of test

concentration with correlation coefficient 0.999.All types of

precisions showed %RSD 0.2-0.35 indicated method was

precise. Accuracy values 99.53-99.66 for Meloxicam

indicated high recovery of analyte from its matrix. LOD and

LOQ values obtained were 0.06µg/ml and 0.135µg/ml for

Meloxicam. Calculated LOQ values allowed confidant

determination of analyte by proposed method. System

suitability was passed against changes in flow rate, pH of

buffer, detection wavelength and organic content, indicated

high robustness of proposed methods.

Figure.1.Molecular structure of Meloxicam Figure.2.retention time of Meloxicam

Table.1.System suitability evaluation for assay

Retention Time Name of the Peak Area USP Plate count USP Tailing

2.067 Meloxicam 182287 2552 1.6

Table.2.Linearity of Meloxicam for assay

Level Concentration Retention time (min) Peak Area

I 10 µg/mL 2.453 634405

II 20 µg/mL 2.452 1294705

III 30 µg/mL 2.448 1856592

IV 40 µg/mL 2.443 2479121

V 50 µg/mL 2.448 2962653

VI 60 µg/mL 2.452 3365663

VII 75 µg/mL 2.457 4825300

Slope 59179

Intercept 21703

Correlation Coefficient 0.999



CONCLUSION

A simple, precise, accurate and economical RP-HPLC

method was developed and validated for the assay of

meloxicam in tablet formulations. The proposed method

showed high recoveries with good linearity and precision.

It can be concluded that the proposed method is a good

approach for obtaining reliable results and found to be

suitable for the routine analysis of meloxicam

formulations in quality control.

REFERENCES

Ekram M.Hassan, Journal of Pharmaceutical and

Biomedical Analysis, 27, 2002, 771-777.

Emirhan Nemutlu, Sedef Kir, Journal of pharmaceutical

and Biomedical Analysis, 31, 2003, 393-400.

Farzana S Bandarkar, Pradeep R Vavia, Tropical Journal

Pharmaceutical Research, 3, 2009, 254-264

Gunter Trummlitz, Peter Luger, Klaus Daneck, Wolfhard

Engel , Klaus Wagner, European Journal of

Pharmaceutical Sciences, 4, 1996, 175-187.

J. Joseph-Charles and M. Bertucat, Analytical letters, 32

(10), 1999, 2051-2059.

Mrunalini C. Damle, Purushotam K. Sinha, Rajesh M.

Jeswani, Kirti S. Topagi, International Journal of

PharmTech Research, 1(4), 2009, 1051-1060.

Najma Sultana, M.Saeed. Arayne, F.A. Siddiqui, Pakistan

Journal of Pharmaceutical Science, 18(4), 2005, 58-62.

S.M. El-Moghazy Aly, N.H. Zawilla, M. Abdul-Azim

Mohammad, N.M. El Kousy, Journal of Pharmaceutical

and Biomedical Analysis, 32, 2003, 1135-1144.

Teodoro.S. Kauffman S.E. Vignaduzzo, P.M. Castellano,

Journal of Pharmaceutical and Biomedical Analysis, 46,

2008, 219-225.

United States Pharmacopeia 34, National Formulary 29,

2010, 3407-3408.



RP-HPLC DEVELOPMENT AND VALIDATION OF ASSAY AND UNIFORMITY OF

DOSAGE UNITS BY CONTENT UNIFORMITY FOR IN HOUSE LAMIVUDINE AND

ABACAVIR COMBINED TABLET K. Ranjith1, M.V.Basaveswara Rao2, T.E.G.K.Murthy3

1 &3.Department of Pharmaceutical Analysis, Bapatla College of Pharmacy, Bapatla, Guntur, Andhra Pradesh, India.

2. Department of Chemistry and Pharmacy, Krishna University, Machilipatnam, Krishna, Andhrapradesh, India.


ABSTRACT

A precise, accurate, h ighly sens i t ive , rugged and robust HPLC method has been developed and

validated for the assay and content uniformity of Lamivudine and Abacavir in combined tablets. The method was

developed using pH 3.0 Phosphate buffer: Methanol (80:20 v/v) in isocratic mode and Waters Symmetry C 18 (100 X

4.6mm), 3.5µ column. Flow rate and detection wavelengths were fixed at 0.5 ml/min and 276 nm. Retention times for

Lamivudine and Abacavir were found to be 2.122 and 3.194 minutes respectively. Both methods were validated as per

ICH guidelines to test their suitability for intended purpose. Linearity ranges for Lamivudine and Abacavir were set at

50-150 µg/ml with correlation coefficient 1.000 and 100-300 µg/ml with correlation coefficient 1.000. Accuracy values

for both methods were found to be found to be 100.09-100.14% for Lamivudine and 99.99-100.11 for Abacavir.

Methods found to be robust against changes in flow rate, organic composition, pH of mobile phase and detection

wavelength. The proposed method is suitable for quality control analysis of in house Lamivudine and Abacavir

combined tablets.

Key words: Lamivudine, Abacavir sulphate, RP-HPLC, Method development and Validation.

INTRODUCTION

Lamivudine is a 4-amino-1-((2R,5S)-2-(hydroxyl

methyl)-1,3-oxathiolan-5-yl)pyrimidin-2(1H)-one.

Lamivudine is a synthetic nucleoside analogue with potent

activity against HIV virus (Type-I) and hepatitis-B.

Abacavir sulphate is [(1S,4R)-4-[2-amino-6-

(cyclopropylamino)-9H-purin-9-yl]cyclopent-2-en-1-

yl]methanol sulphate. Abacavir is a carbocyclic synthetic

nucleoside analogue with activity against HIV virus (type-

I). These both drugs act by inhibiting reverse transcriptase

enzyme. In the recent past Lamivudine and Abacavir

combined formulations are designed as they exhibit

synergistic effect in activity against HIV-virus.

UV, RP-HPLC and HPTLC methods were

reported for individual assay of Lamivudine and Abacavir

in bulk and formulations. Analytical methods such as UV

and HPTLC were available for the estimation of

Lamivudine and Abacavir combination. Few RP-HPLC

methods were only reported for assay of combined tablets

of Lamivudine and Abacavir and only one method was

reported for content uniformity. Methods already available

were not efficient to perform assay and content uniformity

of in house tablets due to changes in grade of bulk drug

and excipients. In the present study authors report a

precise, accurate, highly sensitive, rugged and robust RP-

HPLC method for assay and content uniformity of in

house Lamivudine and Abacavir combined tablets.


Chemicals and Solvents: Lamivudine working reference

standard (Potency-99.91%w/w on as is basis) and

Abacavir sulphate working reference standard (Potency-

99.89 on as is basis) were obtained from Aurobindo

Pharma Limited., Hyderabad. HPLC grade Methanol and

Water were procured from E.Merck (India) Ltd., Mumbai,

India. Potassium dihydrogen phosphate AR grade,

Orthophosphoric acid AR grade and Triethylamine AR

grade were obtained from E.Merck (India)Ltd., Mumbai,

India.

Preparation of Phosphate Buffer: 2.72 g of Potassium

dihydrogen phosphate dihydrate was transferred in to

1000 ml of water. Mixed well and sonicated to dissolve.

pH was adjusted to 3.0 with Orthophosphoric acid and

filtered through 0.45µ Millipore Nylon filter.

Preparation of Mobile Phase: Phosphate buffer pH 3.0

and Methanol -80:20 v/v were mixed to prepare mobile

phase.

Diluent: Mobile phase was used as diluent

Chromatographic Conditions: Assay and Content

uniformity of tablets were carried out on a Waters

HPLC system equipped with a reverse phase Waters

Symmetry C18 (100 x 4.6 mm I.D., 3.5 µm particle

size), Aliance 2695 binary pump, a 100 µL injection

loop, auto sampler and a 2487 dual wavelength UV

detector and running on Waters Empower software. The

chromatographic conditions are as follows, Column:

Waters Symmetry C18 (100 x 4.6mm), 3.5µ; Flow rate:

0.5 ml/min; Detection wavelength: 276 nm; Injection

volume: 5 µl; Runtime: 9 minutes; Column temperature:

Ambient; Sample cooler temperature: 20°C

Preparation of Standard Stock Solution for Assay and




Content Uniformity: 25.08 mg of Lamivudine standard

and 58.71 mg of Abacavir sufphate standard were

weighed accurately and transferred in to dried 25 ml

volumetric flask.10 ml of diluent was added and sonicated

to dissolve components. Cooled and made up to the

volume with diluent.

Preparation of Standard Solution for Assay and

Content Uniformity: 5 ml of standard stock solution was

diluted to 50 ml with diluent to get 0.1 mg/ml of

Lamivudine and 0.2 mg/ml of Abacavir.

Preparation of Sample Stock Solution for Assay:

Twenty tablets were weighed accurately to determine

average weight of tablet.446.66 mg of powder equivalent

to 100 mg of Lamivudine was transferred in to dried 100

ml volumetric flask.25 ml of diluent was added and

sonicated for 25 minutes with intermittent shaking. Cooled

and made up to the volume with diluent. Solution was

centrifuged at 8000 RPM for 8 min.

Preparation of Sample Solution for Assay: 5 ml of

supernatant solution was transferred in to 50 ml

volumetric flask, made up to the volume with diluent and

filtered through 0.45µ Millipore Nylon filter.

Preparation of Sample Stock Solution for Content

Uniformity: Ten tablets were taken and weighed

individually. Each tablet was transferred in to separate 500

ml flask. 50 ml of diluent was added to each flask to

disperse the tablet.200 ml of diluent was added to each

flask and sonicated for 30 minutes with intermittent

shaking. The solution was centrifuged at 8000 RPM for 8

min.

Preparation of Sample Solution for Content

Uniformity: 4 ml of supernatant solution was transferred

in to 25 ml volumetric flask, diluted to volume with

diluent and filtered through 0.45µ Millipore Nylon filter.

System Suitability Criteria:

1. Tailing factor for any peak from standard injection

should be not more than 2.0.

2. USP plate count (N) should be not less than 2000 for

Lamivudine and 4000 for Abacavir.

3. USP resolution should not be less than 2.0

4. %RSD of areas of the five standard injections should be

not more than 2.0.

Method Validation: The proposed methods for assay and

content uniformity were subjected to validation as per ICH

guidelines to test its suitability for intended purpose.

Specificity was demonstrated by comparing blank,

standard and sample chromatograms. Linearity was

demonstrated from 50-150% of sample concentration.

System precision was demonstrated by injecting six

replicate injections of standard solution. Method precision

for assay and content uniformity were demonstrated by

injecting a set of of six separate assay samples and a set of

six separate content uniformity samples in to

chromatographic system. Ruggedness for assay and

content uniformity were demonstrated by injecting a set of

six separate assay samples and a set of six separate content

uniformity samples in to chromatographic system on

different day. Accuracy was performed by spiking active

pharmaceutical ingredient in to placebo from 50% to

150%.Robustness was evaluated by changing ± 10% flow

rate, ± 0.2 units of buffer, ± 5 nm variation in detection

wavelength and ± 2% absolute in organic content of

mobile phase.

N

N

S

O

NH2

O

Lamivudine

N

N N

N

HN

H2N

CH2OH

H2SO4

2

.

OH

Abacavir sulphate

Figure.1.Molecular structure of Lamivudine and Abacavir sulphate



Figure.2.Retention time of Lamivudine and Abacavir sulphate

Table.1. System suitability evaluation for assay and content uniformity Retention Time Name of the Peak Area USP Resolution USP Plate count USP Tailing

2.067 Lamivudine 2238019 3952 1.12

3.293 Abacavir 4834253 4.12 6124 1.32

Table.2.Standard areas for standard of assay and content uniformity Injection Retention Time Peak Area

Lamivudine Abacavir Lamivudine Abacavir

1 2.126 3.105 2238019 4835162

2 2.134 3.183 2237664 4826278

3 2.112 3.145 2235649 4834896

4 2.246 3.128 2245672 4836045

5 2.121 3.152 2242416 4835074

Mean 2239884 4833491

SD 4069.82 4056.55

%RSD 0.2 0.1

Table.3.Linearity of Lamivudine and Abacavir for assay and content uniformity Linearity of Lamivudine Linearity of Abacavir

Concentration Area S.No Concentration Area

50 1115389 1 100 2426458

75 1689123 2 150 3621546

100 2238694 3 200 4836218

125 2808246 4 250 6054321

150 3346745 5 300 7245698

Correlation coefficient 1.000 Correlation coefficient 1.000

Slope 22389 Slope 24180

Intercept 2466.21 Intercept 2980.79

R2 1.000 R

2 1.000

Linearity of Abacaviry = 24180x +2980.79

R² = 1

0

1000000

2000000

3000000

4000000

5000000

6000000

7000000

8000000

0 100 200 300 400

Concentration (µg/ml)

Pe

ak A

rea

Figure.2.Linearity of Lamivudine and Abacavir sulphate



Table.4. Precision of Lamivudine and Abacavir sulphate Name of Precision %RSD

Lamivudine Abacavir

System precision for assay and content uniformity 0.1 0.1

Method precision Assay 0.1 0.2

Content uniformity 0.1 0.1

Intermediate precision Assay 0.2 0.2

Content uniformity 0.2 0.2

CONCLUSION

The developed method is precise, accurate, highly

sensitive, rugged and robust for assay and content

uniformity of Lamivudine and Abacavir combined tablets

and can be reliably adopted for quality control analysis of

Lamivudine and Abacavir in combined tablets.

REFERENCES

B. Jayakar, M. Kumar, C. Saravanan and M. V.

Kumudhavalli, Journal of Chemical and Pharmaceutical

Research, 2(1), 2010, 478-480

Ch. Balasekarreddy, Bahlul Z.Awen, Ch.Babu rao,

N.Sreekanth and P.Ramalingam, International Journal of

Advances In Pharmaceutical Sciences,1(1), 2010, 23-25.

D. Anantha Kumar, M.V. Naveen Babu, J.V.L.N.

Seshagiri Rao and V. Jayathirtha Rao, Rasayan J.Chem,

3(1), 2010, 94-96.

D. Anantha Kumar, J.V.L.N. Seshagiri Rao and

G.SrinivasaRao, E.Journal of Chemistry, 7(1), 2010,

180-182.

T. Sudha, V.R. Ravikumar and P.V. Hemalatha,

International Journal of Pharmaceutical Sciences and

Research, 1(11), 2010, 107-109.

Asma Parveen et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


DEVELOPMENT AND VALIDATION OF A SIMPLE AND RAPID RP- HPLC

METHOD FOR THE DETERMINATION OF METRONIDAZOLE AND

NORFLOXACIN IN COMBINED DOSAGE FORM SK Asma

Parveen

*, Chandana Nalla

Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Vijayawada, A.P, India


ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise reverse phase

high performance liquid chromatographic method for the simultaneous estimation of Metronidazole and

Norfloxacin in pure and pharmaceutical dosage forms. Metronidazole and Norfloxacin were well separated using

a Thermohypersil BDS C18, (5 μ, 150 x 4.6mm) and a mobile phase consisting of Phosphate buffer pH- 4.6: ACN

(45:55) at the flow rate 1 ml/min and the detection was carried out at 254nm with UV detector. The Retention

time for Metronidazole and Norfloxacin were found to be 2.440 & 4.510 respectively. The developed method was

validated for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was

successfully applied to Metronidazole and Norfloxacin combination pharmaceutical dosage form.

KEY WORDS: RP-HPLC, Metronidazole, Norfloxacin, Accuracy, Precision.

INTRODUCTION

Metronidazole [2-(2-methyl-5-nitro-1H-imidazol-

1-yl) ethanol] is a Nitro-imidazole antibiotic medication

used particularly for anaerobic bacteria and protozoa.

Metronidazole is an antibiotic, amoebicide, and

antiprotozo*al. Metronidazole, taken up by diffusion, is

selectively absorbed by anaerobic bacteria and

sensitive protozoa. Once taken up by anaerobes, it is non-

enzymatically reduced by reacting with

reduced ferrodoxin, which is generated by pyruvate oxido

reductase. In addition or alternatively, the metronidazole

metabolites are taken up into bacterial DNA, and form

unstable molecules. This function only occurs when

metronidazole is partially.

Norfloxacin [1-ethyl-6-fluoro-4-oxo-7-piperazin-

1-yl-1H-quinoline-3-carboxylic acid] is a

synthetic chemotherapeutic antibacterial agent.

Occasionally used to treat common as well as

complicated urinary tract infections. It is sold under

various brand names with the most common

being Noroxin. In form of ophthalmic solutions it is

known as Chibroxin. Norfloxacin is a first generation

synthetic fluoroquinolone (quinolone). Norfloxacin is

a broad spectrum antibiotic that is active against

both Gram positive and Gram negative bacteria. It

functions by inhibiting DNA gyrase, enzymes necessary to

separate bacterial DNA, thereby inhibiting cell division.


have been reported for the analysis of Metronidazole and

Norfloxacin combinational dosage forms which include

UV spectroscopy, Reverse Phase High performance

Liquid Chromatography, Densitometric method, HPTLC

methods. The present study illustrate development and



Metronidazole and Norfloxacin in bulk and

Pharmaceutical dosage forms as per ICH guidelines.

The goal of this study is to develop rapid,

economical HPLC method for the analysis of

Metronidazole and Norfloxacin in combined dosage form

using most commonly employed column (C18) and simple

mobile phase preparation. In the present proposed work a

successful attempt had been made to develop a method for

the simultaneous estimation of Metronidazole and

Norfloxacin pharmaceutical dosage form and validate it.

From the economical point of view and for the purpose of

routine analysis, it was decided to develop a more

economical RP-HPLC method with simple mobile phase

preparation for the estimation of Metronidazole and

Norfloxacin combinational dosage form. The method

would help in estimate of drugs in single run which

reduces the time of analysis and does not require separate

method for each drug. Thus, the paper reports an




Quantitative HPLC was performed on a high performance

liquid chromatograph -Waters e2695Alliance HPLC

system connected with UV Detector 2998 and Empower2

Software. The drug analysis data were acquired and

processed using Empower2 software running under

Windows XP on a Pentium PC and Thermohypersil BDS

C18 column of dimension 100 × 4.6, 5µm particle size. In


sensitivity), digital pH meter (Elico pH meter LI120), a

sonicator (Unichrome associates UCA 701) were used in

this study.

Standards and chemicals used: The reference samples of

Metronidazole and Norfloxacin standards were kindly

http://en.wikipedia.org/wiki/Nitroimidazole

http://en.wikipedia.org/wiki/Antibiotic

http://en.wikipedia.org/wiki/Anaerobe

http://en.wikipedia.org/wiki/Bacterium

http://en.wikipedia.org/wiki/Protozoa

http://en.wikipedia.org/wiki/Chemotherapeutic

http://en.wikipedia.org/wiki/Antibacterial

http://en.wikipedia.org/wiki/Urinary_tract_infections

http://en.wikipedia.org/wiki/Eye_drop

http://en.wikipedia.org/wiki/Fluoroquinolone



supplied as gift samples by Hetero Drugs Ltd., Hyderabad,

Andhra Pradesh, India. All the chemicals were analytical

grade. Potassium dihydrogen orthophosphate and

phosphoric acid from Rankem Ltd., Mumbai, India, while

acetonitrile (HPLC grade) and triethylamine (HPLC

grade) from Merck Pharmaceuticals Private Ltd., Mumbai,

India. Ortho phosphoric acid used was of HPLC grade and

purchased from Merck Specialties Private

Ltd.,Mumbai,India. Metronidazole and Norfloxacin

Tablets available in the market as Bacigyl N(Aristo

Pharmaceuticals Ltd.) in composition of

Metronidazole(200mg), Norfloxacin(200mg).



Then adjust its pH to 4.5 +/- 0.5 phosphate buffer and

Acetonitrile in the ratio of 45:55 was prepared and filtered

through 0.45µ membrane filter and degassed by

sonication.

Preparation of calibration standards: Metronidazole

150mg and 150mg Norfloxacin was taken into a 10, 50 ml

of volumetric flask and add 10ml of Diluent and sonicated

for 10 minutes and made up with Diluent. It was further

diluted to get stock solution of Metronidazole and

Norfloxacin. This is taken as a 100% concentration.

Working standard solutions of Metronidazole and

Norfloxacin was prepared with mobile phase. To a series

of 10 ml volumetric flasks, standard solutions of

Metronidazole and Norfloxacin in the concentration range

of 100µg/ml were transferred respectively.





concentration level for Metronidazole and Norfloxacin to


system was stabilized for 40 min. One blank followed by

six replicate analysis of solution containing 100% target

concentration of Metronidazole and Norfloxacin were





in Table 1.

Calibration curves for Metronidazole and Norfloxacin: Replicate analysis of solution containing 60-140µg/mL of

Metronidazole and Norfloxacin sample solutions

respectively were injected into HPLC according to the

procedure in a sequence and chromatograms were





Analysis of marketed formulation: The content of ten


were determined. Powder of tablets equivalent to one

tablet weight (595.2mg) were weighed and taken in a 50








procedure. From the peak areas of Metronidazole and

Norfloxacin the amount of the drugs in the sample were





Validation study of Metronidazole and Norfloxacin:

An integral part of analytical method development is











Metronidazole and Norfloxacin in the determination under








Precision: precision study of sample (Metronidazole and

Norfloxacin) was carried out by estimating corresponding

responses 6 times on the same day for the 100% target

concentration. The percent relative standard deviation

(%RSD) is calculated which is within the acceptable

criteria of not more than 2.0.



60-140µg/ml (100-140%) Metronidazole and Norfloxacin

respectively. Method of least square analysis is carried out

for getting the slope, intercept and correlation coefficient,

regression data values and the results were presented in

Table 2. The representative chromatograms indicating the

sample were shown in fig.2&3. A calibration curve was

plotted between concentration and area response and

http://www.healthkartplus.com/drugs/manufacturer/56048/j-b-chemicals-pharmaceuticals-ltd

http://www.healthkartplus.com/drugs/manufacturer/56048/j-b-chemicals-pharmaceuticals-ltd



statistical analysis of the calibration curves were shown in

fig.6 &7.



Atorvastatin and Fenofibrate by the method of addition.

Known amount of Metronidazole and Norfloxacin at

100%, 120%, 140% is added to a pre quantified sample

solution. The recovery studies were carried out in the

tablet in triplicate each in the presence of placebo. The

mean percentage recovery of Metronidazole and

Norfloxacin at each level is not less than 98% and not

more than 102%.


of Metronidazole and Norfloxacin under different




buffer solution.



necessarily quantified. Under the stated experimental

conditions, the limit of quantification is the lowest





LOQ=10(SD)/S, where SD= standard deviation of


calibration curve.



the determination of Metronidazole and Norfloxacin.










in mobile phase. Different experiments were performed to

optimize the mobile phase but adequate separation of the

drugs could not be achieved. By altering the pH of buffer

results a good separation. Different proportions of solvents

were tested. Eventually the best separation was obtained

by the isocratic elution system using a mixture of

Phosphate buffer pH- 4.6: ACN (45:55) at a flow rate of 1

ml/min. A typical chromatogram for simultaneous

estimation of the two drugs obtained by using a above

mentioned mobile phase. Under these conditions

Metronidazole and Norfloxacin were eluted at minutes

2.440 & 4.510 respectively with a run time of 5 minutes.

The representative chromatogram of this simultaneous

estimation shown in fig. 3 & 4 and results were

summarized in Table 1.

The Phosphate buffer pH- 4.6: ACN (45:55) was chosen

as the mobile phase. The run time of the HPLC procedure

was 5 minutes at flow rate of 1ml/min was optimized

which gave sharp peak, minimum tailing factor. The

system suitability parameters were shown in Table 1 were

in within limit, hence it was concluded that the system

was suitable to perform the assay.

The method shows linearity between the

concentration range of 60-140µg/ml for Metronidazole

and Norfolxacin. The experimental results were shown in

table 6 and fig.6&7. The % recovery of Metronidazole and

Norfloxacin was found to be in the range of 98.96 to

101.84 % and 98.29 to 100.54% respectively. As there

was no interference due to excipients and mobile phase,

the method was found to be specific. As both compounds

pass the peak purity, the method was found to be specific.

The method was robust and rugged as observed from

insignificant variation in the results of analysis by changes

in Flow rate, column oven temperature, mobile phase

composition and wave length separately and analysis

being performed by different analysts. The results were

shown in Table 5. The LOD and LOQ values were

calculated based on the standard deviation of the response

and the slope of the calibration curve at levels


was obtained as 2.50974µg/mL for Metronidazole and

3.59µg/mL for Norfloxacin. The limit of quantitation was

obtained as 7.60529µg/mL for Metronidazole and

10.88µg/mL for Norfloxacin which shows that the method

is very sensitive. The results were shown in Table-7.

Fig. 1: Structure of Metronidazole Fig. 2: Structure of Norfloxacin



Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions


Column Thermohypersil BDS C18, (5 μ, 150 x 4.6mm)

Detector UV Detector 2998

Diluents Methanol

Mobile phase Phosphate buffer pH- 4.6: ACN (45:55) Flow rate 1ml/min


Temperature 25°c


Retention time

Metronidazole 2.440

Norfloxacin 4.510

Theoretical plate count

Metronidazole 2570

Norfloxacin 3126

Tailing factor

Metronidazole 1.460

Norfloxacin 1.045

Resolution factor 8.593

Table.2.Specificity study


Blank No peaks

Metronidazole 2.446

Norfloxacin 4.519

Table.3.Recovery data of the proposed Metronidazole and Norfloxacin

Sample Spiked Amount

(µg/ml)

Recovered Amount

(µg/ml)

%Recovered %Average

recovery

Metronidazole

80 101.84 101.84

99.96% 110 119.24 99.51

120 138.54 98.96

Norfloxacin

80 100.32 100.32

99.71% 100 120.64 100.54

120 137.60 98.29

Table.4.Results of Precision study

Sample Injection number precission

RT Peak area

Metronidazole

1 2.483 4538.983

2 2.437 4451.407

3 2.463 4448.696

4 2.467 4474.308

5 2.453 4539.624

6 2.483 4517.392

Mean 2.4643 4495.068

%RSD(NMT 2.0) 0.94

Norfloxacin

1 4.523 2975.916

2 4.483 2993.931

3 4.513 2948.557

4 4.517 2992.825

5 4.497 2984.785

6 4.523 3006.637

Mean 4.509 2983.775

%RSD(NMT 2.0) 0.67



Table 5-a: Robustness data for Metronidazole

Parameter Rt Peak Area Theoretical

Plates

Asymmetry

Decreased Flow Rate 3.413 6231.711 2745 1.444

(0.8ml/min)

Actual Flow rate(1ml/min) 2.666 4587.238 2543 1.460

Increased Flow Rate (1.2ml) 1.920 3502.766 2344 1.476

Decreased Wave length(252nm) 2.450 4095.817 2589 1.462

Actual wave length(254nm) 2.438 4454.386 2585 1.463

Increased Wave length (256nm) 2.447 4812.955 2582 1.462

Table 5-b: Robustness data for Norfloxacin

Parameter Rt Peak Area

Theoretical Plates Asymmetry

Decreased Flow Rate (0.8ml/min) 6.263 4128.098 4775 1.138

Actual Flow Rate(1ml/min) 4.92 3202.361 4484 1.157

Increased Flow Rate (1.2ml/min) 3.577 2276.625 4194 1.176

Decreased wave length(252nm) 4.513 2794.526 4598 1.195

Actual wave length(254nm) 4.508 2903.456 4585 1.181

Increased wave length (256nm) 4.503 3066.386 4577 1.167

Table 6: Linearity data of the Metronidazole and Norfloxacin

Table 7: Limit of Detection and Limit of Quantification

Metronidazole Norfloxacin

Mcg Area Mcg Area

LOD 2.50974 104.53 3.59 104.46

LOQ 7.60529 316.77 10.88 316.56

Fig. 3: Typical Chromatogram of standard Metronidazole and

Norfloxacin

Fig. 4: Typical chromatogram of Metronidazole and

Norfloxacin tablets in marketed formulation

Sample Parameters Optimized Used RT Peak area Plate count

Metronidazole

Flow rate

(±0.2)

1ml/min 60 2.457 2603 2739.882

80 2.460 2610 3570.039

100 2.452 2603 4517.959

Temperature

(±5°C)

35°C 120 2.463 2617 5338.82

140 2.477 2646 6014.213

Norfloxacin

Flow rate

(±0.2)

1ml/min 60 4.520 4611 1805.882

80 4.517 4605 2400.415

100 4.520 4611 3007.73

Temperature

(±5°C)

35°C 120 4.520 4421 3616.148

140 4.523 4618 4105.921



CONCLUSION



determination of Metronidazole and Norfloxacin in tablet

dosage forms in bulk and pharmaceutical dosage forms

was established. The method was completely validated

shows satisfactory results for all the method validation

parameters tested and method was free from interferences

of the other active ingredients and additives used in the

formulation. Infact results of the study indicate that the

developed method was found to be simple, reliable,

accurate, linear, sensitive, economical and reproducible

and have short run time which makes the method rapid.

Hence it can be concluded that the proposed method was a

good approach for obtaining reliable results and found to

be suitable for the routine analysis of Metronidazole and

Norfloxacin in Bulk drug and Pharmaceutical

formulations.

ACKNOWLEDGEMENT

The authors would like to thank beloved parents and all

my well wishers, one and all who have helped me directly

and indirectly in completing this project work.

REFERENCES

Amit J. Kasabe, Vikram V. Shitole, Vikram V.

Waghmare, Vijay Mohite Department of Pharmaceutical

Chemistry, Simultaneous Estimation of Metronidazole and

Ofloxacin in Combined dosage form by Reverse Phase

High performance Liquid Chromatography Method,

International Journal of ChemTech Research, 1(4), 2009,

1244-1250.

Ghante, Minal R, Pannu, Harpreet K, Loni, Amruta,

Shivsharan, Tejashree, Development and Validation of a

RP- HPLC Method for Simultaneous Estimation of

Metronidazole and Norfloxacin in Bulk and Tablet

Dosage form, International Journal of Pharmacy &

Pharmaceutical Sciences, 4, 2012, 241.

Rajyalakshmi Chavakula, Rambabu Chintala,

Benjamin Tadanki, Application of Validated Stability

Indicating HPLC method in Stability Testing of Nor-

Metrogyl tablets, Journal of Pharmacy Research, 6(5),

2013, 499-503.

T. Saffaj M. Charrouf, A. Abourriche, Y. Abboud, A.

Bennamara, M. Berrada Spectrophotometric

Determination of Metronidazole and Secnidazole in

Pharmaceutical Preparations. Il Farmaco, 59(10), 2004,

843–846.

http://www.jpronline.net/article/S0974-6943(13)00191-6/abstract



http://www.sciencedirect.com/science/article/pii/S0014827X0400151X







http://www.sciencedirect.com/science/journal/0014827X

Farhana Pattan et.al. Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


ANALYTICAL METHOD DEVELOPMENT AND VALIDATION FOR THE

ESTIMATION OF OLMESARTAN MEDOXOMIL BY RP-UPLC IN BULK AND

PHARMACEUTICAL DOSAGE FORMS Farhana pattan, K.Haritha Pavani, A.Kiran Kumar, N.Sunny Babu, K.V.Kalyan Kumar, Chandana N

Department of pharmaceutical analysis, Nimra College of Pharmacy

Corresponding Author: [email protected], Phone no: 8885818293

ABSTRACT

A simple rapid, accurate, precise and reproducible validated reverse phase UPLC method was developed for

the determination of Olmesartan medoxomil in bulk and pharmaceutical dosage forms. The quantification was

carried out using Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm) column run in Gradient way using

mobile phase-A [pH 3.4 Buffer: Acetonitrile (70:30% v/v)] and mobile phase-B [pH 3.4 Buffer:Acetonitrile (30

:70 % v/v)] and a detection wavelength of 250nm, and injection volume of 4µL, with a flow rate of 0.5mL/min.

The retention times of Olmesartan medoxomil was found to be 3.418. The method was validated in terms of

linearity, precision, accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges

of the proposed method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 10% to 150% and

with correlation coefficient of r2=0.9999.The assay of the proposed method was found to be 98.79%. The

recovery studies were also carried out and mean % Recovery was found to be 100.5%. The % RSD from

reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for

routine quality control analysis of Olmesartan medoxomil in bulk and in Pharmaceutical dosage form.

Key Words: Olmesartan medoxomil, RP-UPLC, Waters acquity UPLC BEH C18, Tablets, Validation.

1. INTRODUCTION

Olmesartan medoxomil is (5-methyl-2-

oxo-2H-1,3-dioxol-4-yl)methyl 4-(2-hydroxypropan-2-yl)-

2-propyl-1-({4-[2-(2H-1,2,3,4-tetrazol-5-

yl)phenyl]phenyl}methyl)-1H-imidazole-5-

carboxylate.The molecular weight is 558.59,molecular

formula is C29H30N6O6. Olmesartan is a prodrug that

works by blocking the binding of angiotensin II to the

AT1 receptors in vascular muscle; it is therefore

independent of angiotensin II synthesis pathways,

unlike ACE inhibitors. By blocking the binding rather

than the synthesis of angiotensin II, olmesartan inhibits

the negative regulatory feedback on renin secretion. As a

result of this blockage, olmesartan reduces

vasoconstriction and the secretion of aldosterone. This

lowers blood pressure by producing vasodilation, and

decreasing peripheral resistance and is used as

antihypertensive.

Literature review reveals very few methods are

reported for the assay of Olmesartan medoxomil in Tablet

dosage forms using RP-HPLC method and no method has

been developed by RP-UPLC. The proposed RP-UPLC

method utilizes economical solvent system and having

advantages like Less time consuming,better retention time,

less flow rate, very sharp and symmetrical peak shapes.

The aim of the study was to develop a simple, precise,

economic and accurate RP-UPLC method for the

estimation of Olmesartan medoxomil in Tablet dosage

forms.

Figure.1. Olmesartan medoxomil


UV-3000 LABINDIA double beam with UV-

probe software,UV-VISIBLE spectrophotometer with 1cm

matched quartz cells. UPLC system (Waters Acquity

equipped with Empower software), Waters Acquity UPLC

BEH column

2.1. Chemicals and reagents: Gifted sample of

Olmesartan medoxomil pure sample and dosage form

“OLME TECH” marketed by REDDY’S was purchased

from local pharmacy. Other chemicals all are of HPLC

grade and GR grade.

2.2. Preparation of mobile phase:Preparation of pH 3.4

Buffer: Dissolve 2.04gm of monobasic potassium

phosphate in 1000mL of water, mix well adjust to pH 3.4

with diluent OPA (1mL in 10mL of water) and filtered

through 0.22µm filter.Mobile phase-A: pH 3.4 Buffer :

ACN (70 :30 % v/v)

Mobile phase-B: pH 3.4 Buffer : ACN (30 :70 % v/v)

2.3. Standard solution preparation:weighed and

transferred about 56mg of olmesartan medoxomil working

standard in to a 100ml volumetric flak,added 60ml of

acetonitrile and sonicated to dissolve.Diluted up to the


http://en.wikipedia.org/wiki/Prodrug

http://en.wikipedia.org/wiki/Angiotensin

http://en.wikipedia.org/wiki/ACE_inhibitor

http://en.wikipedia.org/wiki/Renin

http://en.wikipedia.org/wiki/Vasoconstriction

http://en.wikipedia.org/wiki/Aldosterone

http://en.wikipedia.org/wiki/Vasodilation



volume with acetonitrile.Diluted 4ml of the above solution

to 50ml with diluents and filtered through 0.22um filter.

2.4. Preparation of sample solution: Five tablets were

weighed and finely powdered and a powder quantity

equivalent to 56mg of Olmesartan medoxomil were

accurately weighed and transferred to a 100ml volumetric

flask and 60ml of acetonitrile was added to the same. The

flask was sonicated and volume was made up to the mark

with acetonitrile. Diluted 4ml of the above solution to

50ml with diluents and filtered through 0.22um

filter,mixed well and injected. The amount present in each

tablet was calculated by comparing the area of standard

Olmesartan medoxomil and tablet sample.

2.5. Method optimization: The chromatographic

separation was performed using Waters Acquity UPLC

BEH C18 (100 mm X 2.1 mm, 1.7µm) column. For

selection of mobile phase, various mobile phase

compositions were observed for efficient elution and good

resolution. The mobile phase consisting of Mobile phase-

A [pH 3.4 Buffer: ACN (70:30% v/v)] and Mobile phase-

B [pH 3.4 Buffer: ACN (20 :80 % v/v)] was found to be

the optimum composition for efficient elution of analyte.

The mobile phase was injected to the column at a flow

rate of 0.5 ml/min for 6min. The column temperature was

maintained at 25oC. The analyte was monitored at 250 nm

using UV-detector. The retention time of the drugs was

found to be 3.418min. Water:CAN(50:50) was used as

diluent during the standard and test samples preparation.

The optimized chromatographic conditions are mentioned

in Table-1 and chromatogram for standard was shown in

the figure no:

3. RESULTS

3.1. Method Validation

3.1.1. System suitability: System suitability tests are an

integral part of method validation and are used to ensure

adequate performance of the chromatographic system.

Retention time (RT), number of theoretical plates (N) or

column efficiency and tailing factor (T) were evaluated for

six injections of standard solution at a solution of

44.8µg/ml of Olmesartan medoxomil. The results are


shown in the figure no- 4.

3.1.2. Specificity: Specificity is the ability of analytical

method to measure accurately and specifically the analyte

in the presence of components that may be expected to be



to standard drug solution (44.8ppm). The diluent and


interference with the drug peak.There was no blank and

placebo interference was found.

3.1.3. Linearity: Linearity is the ability of the method to



The linearity of Olmesartan medoxomil was in the

concentration range of 10-150%.From the linearity studies

calibration curve was plotted and concentrations were

subjected to least square regression analysis to calculate

regression equation. The regression coefficient was found

to be 0.9999 shows good linearity. The results are


shown in the figure no- 7, 8, 9.

3.1.4. Accuracy: Accuracy is the closeness of results

obtained by a method to the true value. It is the measure of




drug (50%,75%,100% ,150%) at four different

concentration levels in its solution has been added to the

pre analyzed working standard solution of the drug. The

results are tabulated in the table no-5, 6, 7.

3.1.5. Precision: The precision of the analytical method

was studied by analysis of multiple sampling of

homogeneous sample. The Precision expressed as

standard deviation or relative standard deviation.

3.1.6. System precision: System precision was performed

by injecting a standard solution of Olmesartan medoxomil

for six times. The results are tabulated in the table no-8.

3.1.7. Method precision: Method precision was

performed by analyzing a sample solution of Olmesartan

medoxomil by injecting six replicates of the same sample

preparations at a concentration of 44.8ppm/mL. The

results are tabulated in the table no-9.

3.1.8.Intermediate precision(Ruggedness): Intermediate

precision was performed by analyzing a standard and

sample solutions of Olmesartan medoxomil by injecting

six replicates of the same standard and sample

preparations at a concentration of 44.8 ppm/mL. The

results are tabulated in the table no-9.

3.1.8. Robustness: Robustness shows the reliability of an

analysis with respect to deliberate variations in method

parameters. If measurements are susceptible to variations

in analytical conditions, the analytical conditions should

be suitably controlled or a precautionary statement should

be included in the procedure. The results are tabulated in

the table no-4.

3.1.9. LOD and LOQ:Calibration curve was repeated for

five times and the standard deviation (SD) of the

intercepts was calculated.The results shows,the limit of

detection with a signal to noise ratio of 3:1 was found to



be 0.010 µg/ml. the limit of quantification with a signal to noise ratio of 10:1 was found to be 0.032 µg/ml.

Table.1.Optimized chromatogram conditions for Lamivudine, Zidovudine and Efavirenz

Table.2. System suitability Data for Olmesartan medoxomil

System suitability parameters Results

% RSD 0.08

Tailing factor 1

Theoretical plates 40289

Table.4. Linearity Data for Olmesartan medoxomil

Level Con.

(mg/ml)

Peak area

10% 5.63 65673

50% 22.53 259905

75% 33.8 395268

100% 45.06 525796

150% 67.60 787084

Slope 11674.33

Intercept 826.20

Correlation coefficient

(R2)

0.9999

Table.4. Accuracy Data for Olmesartan medoxomil Level % Recovery % RSD

50% 100 65673

75% 100.6 259905

100% 100.8 525796

150% 100.6 787084

Table.5. System precision of Olmesartan medoxomil

Column Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 µm)

Mobile phase Mobile phase-A: pH 3.4 Buffer: ACN (70 :30 % v/v) ,Mobile

phase-B: pH 3.4 Buffer: ACN (70 :30 % v/v)


Wavelength 250 nm


Column temperature Ambient

Run time 6 min

No of injections Area RT

1 524321 3.418

2 523789 3.417

3 523912 3.418

4 524832 3.418

5 524721 3.416

6 524198 3.416

Average 524297 -

SD 420.1 -

% RSD 0.08 -



Table.6. Method precision and intermediate precision Data for Olmesartan medoxomil Sample no. %ASSAY

Method precision Intermediate precision

1 98.79 98.76

2 98.74 98.66

3 98.94 98.86

4 98.76 98.76

5 98.94 98.86

6 98.9 98.66

Mean 98.81 98.76

%RSD 1.06 0.090

Table.7. Variation in flow rate, column temperature for Olmesartan medoxomil Parameter Flow (mL/min) Temperature(

oC)

Low

(0.3ml/min)

Actual

(0.5ml/min)

High

(0.7ml/min)

Low

(20 oC)

Actual

(25 oC)

High

(30 oC)

%RSD 0.16 0.08 0.11 0.15 0.089 0.1

Retention time 4.451 3.336 2.528 3.856 3.418 3.014

Plate count 51056 40289 38529 42106 40289 40562

Tailing factor 1 1 1 1 1 1

Figure.2. Standard chromatogram of Olmesartan Figure.3. Sample chromatogram

Figure.4.Linearity Figure.2. Chromatogram for specificity

4. DISSCUSSION

4.1. System suitability: From the system suitability

studies it was observed that retention time of Olmesartan

medoxomil was found to be 3.418 min. % RSD of peak

area was found to be 0.08. Theoretical plates were found

to be more than 40289. USP tailing factor was found to be

1. All the parameters were within the limit.

4.2. Specificity: The Chromatograms of Standard and

Sample are identical with nearly same Retention time.

There is no interference with blank and placebo to the

drugs. Hence the proposed method was found to be

specific.

4.3. Linearity: From the Linearity data it was observed

that the method was showing linearity in the concentration

range of 10-150μg/ml. Correlation coefficient was found

to be 0.9999.

4.4. Accuracy: The recoveries of pure drug from the

analyzed solution of formulation were in the range of

98%-102%, which shows that the method was accurate.



4.5. Precision

4.5.1. System precision: The percentage relative standard

deviation (RSD) for the peak area 0.08.

4.5.2. Method precision: The percentage relative

standard deviation for the assay values found to be 1.06

4.6. Ruggedness: Comparison of both the results obtained

for two different Analysts shows that the method was

rugged for Analyst-Analyst variability. The %RSD for

intermediate precision was 0.09.

4.7. Robustness


were within limits for variation in flow rate (± 0.2

ml). Hence the allowable flow rate should be

within 0.3 ml to 1.7 ml.


were within limits for variation (+ 50C) in column

oven temperature. Hence the allowable variation

in column oven temperature is + 50C.

The results obtained were satisfactory and are in

good agreement as per the ICH guidelines.

4.8. Acknowledgement: The authors thankful to Mr.

A.Kiran kumar,Mr. N.Sunny babu, and Mr.K.V.kalyan

kumar for providing necessary facilities to carry out the

research work.

5. CONCLUSION






used for routine sample analysis.

REFERENCES

Jain Pritam,Chaube Udit,Chaudhari Rakesh,UV-

Spectrophotometric method for determination of

olmesartan medoxomil in bulk and in

formulation.Internationale Pharmaceutica

Sciencia,1(7),2011, 2231-5896.

Selvadurai Muralidharan, Kumar, developed Sensitive

estimation of olmesartan medoxomil tablets by RP- HPLC

method. International Journal of Pharmacy & Life

Sciences, 1(7), 2012, 0976-7126.

Chaitanya Prasad MK, Vidyasagar G, Sambasiva Rao

KRS, developed RP-HPLC method for the estimation of

olmesatan medoxomil in tablet dosage form, Der pharma

chemica, 3(6), 2011:208-212

Lakshmi surekha M, Kumara swamy G, RP-HPLC

method for the estimation of olmesartan medoxomil in

bulk and tablet dosage form. Contemporary Investigations

and Observations in Pharmacy, 2(1), 2013, 3-6, 2278-

7429.

Suman Avula K.Naveen Babu, M.V.Ramana, RP-HPLC

method for the estimation of olmesatan medoxomil in bulk

and tablet dosage form. An international journal of

advances in pharmaceutical sciences, 2(2-3), 2011, 0976-

3090.

Sharma ritesh, Pancholi syam.S, RP-HPLC-DAD method

for determination of olmesartan medoxomil in bulk and

tablets exposed to forced conditions, INIST-CNRS, 60,

2010, 1330-0075.

http://www.researchgate.net/researcher/84302066_Selvadurai_Muralidharan/

Vaibhav and Shasi Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION DEVELOPMENT AND EVALUATION OF GLICLAZIDE GEL

USING WATER SOLUBLE SODIUM CARBOXY METHYL CELLULOSE POLYMER Vaibhav Kumar Mishra, Shashi Shekhar Tripathi

Sir Madan Lal Institute of Pharmacy, Alalpur Hauz Etawah, U.P, India

*Corresponding author:[email protected]

ABSTRACT

High molecular weights water soluble homopolymer of Sodium Carboxy Methyl Cellulose (Sodium CMC) are

reported to possess very high viscosity in low concentration, transparency, film forming properties and are useful in

formation of gel. The Gliclazide gels were prepared by using different concentration of Sodium Carboxy Methyl Cellulose

for topical drug delivery with an objective to increase transparency and spreadability. These preparations were with

marketed Gliclazide gel. Spreadability and consistency of sodium CMC gel containing Gliclazide were 6.5g.cm/sec. The

percent drug release was 97.11 and 98.66 from F9. Stability studies under accelerated condition showed satisfactory

results. It can be concluded that sodium CMC gel containing Gliclazide showed good consistency, homogeneity,

spreadability and stability and has wider prospect for topical preparations.

Key words: Topical drug delivery, Water soluble polymer, Gliclazide, Sodium Carboxy Methyl Cellulose

1. INTRODUCTION

Topical gel preparations are intended for skin

application or to certain mucosal surfaces for local action

or percutaneous penetration of medicament or for their

emollient or protective action. Gels are typically formed

from a liquid phase that has been thickened with other

components. The continuous liquid phase allows free

diffusion of molecules through the polymers scaffold and

hence release should be equivalent to that from a simple

solution. Gliclazide is an oral hypoglicemic drug and Oral

hypoglycemic drugs are used only in the treatment of type

2 diabetes which is a disorder involving resistance to

secreted insulin. Type 1 diabetes involves a lack of insulin

and requires insulin for treatment. There are now four

classes of hypoglycemic drugs: Sulfonylureas, Metformin,

Thiazolidinediones, Alpha-glucosidase inhibitors

Bioadhesion is the phenomenon between two materials,

which are held together for extended periods of time by

interfacial forces. It is referred as bioadhesion when

interaction occurs between polymer and epithelial surface;

mucoadhesion when occurs with the mucus layer covering

a tissue. Generally bioadhesion is deeper than the

mucoadhesion (Sudhakar, 2006).

Topical gel preparations are intended for skin

application or to certain mucosal surfaces for local action

or percutaneous penetration of medicament or for their

emollient or protective action. Gels are typically formed

from a liquid phase that has been thickened with other

components. The continuous liquid phase allows free

diffusion of molecules through the polymers scaffold and

hence release should be equivalent to that from a simple

solution. Sodium CMC is used as water soluble or

hydrophilic polymers topically in gel drug delivery system

(H.S.Golinkin, 1979). A range of grades based on

molecular fractions of these polymer are available, they

are typically used at a concentration between 5 to 10% in

topical gel formulation. Due to their non greasy properties,

they can provide easily washable film on the skin. Sodium

CMC polymer of high molecular weight do not penetrate

the skin and are non toxic (D.J.King, 1989). Human

cutaneous tolerance tests performed to evaluate the

irritation of 1-5% w/w Sodium CMC indicated that the

polymer was well tolerated. Sodium CMC polymers have

the potential to be naturally broken down and

biodegradable and do not persist or accumulate in the

environment (C.D.Rowland, 1999; Yang JF, 2004).

2. MATERIAL AND METHODS

Gliclazide was received as gift sample from

Torrent Pharmaceuticals, Ahmedabad, Gujrat, India.

Sodium CMC homopolymer, Iso Propyl Myristate and

Ethyl Paraben were bought from Loba Chemi Pvt

Ltd,Mumbai (India). Cineole is received from local

market (Etawah). All the ingredients used in this project

were of analytical grade.

Procedure of gel preparation: About 3.75 g of sodium

CMC was weighed and dissolved in upto 50 ml of water

than gel formulation and specified quantity of glycerin or

drug Gliclazide (2.5gm) was added and weighed quantity

of iso propyl myristate (2.5ml) was added in reference and

add to the Ethyl paraben (0.5gm) and add the Glycerin

(5gm) to mix than the formulation. Cineole was added to

enhance permeability. Precipitation or turbidity occurs in

some of the batches (F3, F4, F5, F6, and F7 and F8) of

Gliclazide gel containing sodium CMC which could be

due to the incompatibility in the system due to presence of

glycerin

Evaluation of Gliclazide gel containing sodium CMC:

The above formulate Gliclazide gel containing sodium

CMC were subjected to evaluation for the following

parameters:

pH: The pH of the various gel formulations was

determined by using digital pH meter



Spreadability: It was determined by wooden block and

glass slide apparatus. Weights about 20g were added to

the pan and the time were noted for upper slide (movable)

to separate completely from the fixed slides.

Consistency: The measurement of consistency of the

prepared gels was done by dropping a cone attached to a

holding rod from a fix distance of 10cm in such way that it

should fall on the centre of the glass cup filled with the

gel. The penetration by the cone was measured from the

surface of the gel to the tip of the cone inside the gel. The

distance traveled by cone was noted down after 10sec.

Homogeneity: All developed gels were tested for

homogeneity by visual inspection after the gels have been

set in the container. They were tested for their appearance

and presence of any aggregates.

Skin irritation test: Test for irritation was performed on

human volunteers. For each gel, five volunteers were

selected and 1.0g of formulated gel was applied on an area

of 2 square inch to the back of hand. The volunteers were

observed for lesions or irritation.

Drug content: A specific quantity (100mg) of developed

gel and marketed gel were taken and dissolved in 100ml

of phosphate buffer of pH 6.8. The volumetric flask

containing gel solution was shaken for 2hr on mechanical

shaker in order to get complete solubility of drug. This

solution was filtered and estimated spectrophotometrically

at 276.0nm using phosphate buffer (pH 6.8) as blank

(U.V.Sera, 2006).

Accelerated stability studies: All the selected

formulations were subjected to a stability testing for three

months as per ICH norms at a temperature of 40º ± 2º. All

selected formulations were analyzed for the change in

appearance, pH or drug content by procedure stated

earlier.

Permeability studies: Phosphate buffer of pH 6.8 was

used for in vitro release as a receptor medium. The

pretreated skin of albino mice was used in fraz diffusion

cell. The gel sample was applied on then skin and then

fixed in between donor and receptor compartment of

diffusion cell. The receptor compartment contained

phosphate buffer (100ml) of pH 6.8. The temperature of

diffusion medium was thermostatically controlled at 37º ±

1º by surrounding water in jacket and the medium was

stirred by magnetic stirrer at 500rpm. The sample at

predetermined intervals were withdrawn and replaced by

equal volume of fresh fluid. The samples withdrawn were

spectrophotometrically estimated at 276nm against their

respective blank.

3. Results and discussion The pH values of all developed (F3, F4, F5, F6,

F7, and F8) and reference Iso Propyl Myristate gel

Reference was 5.5. The values of spreadability indicate

that the gel is easily spreadable by small amount of shear.

Spreadability of Reference gel was 5.5g.cm/sec while F9

was 6.5g.cm/sec, indicating spreadability of sodium CMC

containing Gliclazide gel. The consistency reflects the

capacity of the gel, to get ejected in uniform and desired

quantity when the tube is squeezed. Consistency in terms

of distance travel by cone was 5mm. Consistency is

inversely proportional to the distance traveled by falling

cone. Hence, the consistencies of Gliclazide gel

containing with add permeation enhencer Cineole

compare to Iso propyl myristate.

All developed gel showed good homogeneity with

absence of lumps. The developed preparations were much

clear and transparent gel. The skin irritation studies of

developed gel were carried out on human volunteers and

that confirmed the absence of any irritation on the applied

surface. During the stability studies the appearance was

clear and no significant variation in pH was observed.

Considering the accelerated stability studies and

physiochemical parameters, batch was selected for in vitro

permeability release studies.

In vitro Permeability study showed that

permeation studies of Gliclazide gel containing enhencer

Cineole compare to Iso propyl myristate. It was observed

that Gliclazide gel containing produced better

spreadability and consistency. The developed gel showed

good homogeneity, no skin irritation, good stability and in

vitro permeability. The sodium CMC forms water soluble

gel and has wider prospects to be used as a topical drug

delivery system.



Table.1. Composition and concentration of Gliclazide gel. Batch

No

Polymer (g)

Sod CMC

Drug (g)

Gliclazide

Isopropyl

Myristate(ml)

Ethyl

Paraben(g)

Glyceri

n (g)

Cineole

(ml)

Distilled

water (ml)

Remarks

F1 2.5 - - 0.5 5.0 - Upto50 Too Fluid

F2 5 - - 0.5 5.0 - Upto50 Too

Viscous

F3 3.75 2.5 2.5 0.5 5.0 - Upto50 Desired

Viscosity

F4 3.75 2.5 - 0.5 5.0 1.5 Upto50 Desired

Viscosity

F5 3.75 2.5 - 0.5 5.0 2.0 Upto50 Desired

Viscosity

F6 3.75 2.5 - 0.5 5.0 2.5 Upto50 Desired

Viscosity

F7 3.75 2.5 - 0.5 5.0 3.0 Upto50 Desired

Viscosity

F8 3.75 2.5 - 0.5 5.0 3.5 Upto50 Desired

Viscosity

Table.2. Release rate of Gliclazide from different gellants Batch No pH Spreadability

(g.cm/sec)

Drug Content

F3 5.4 7.1 99.96

F4 5.6 6.8 99.86

F5 5.5 7.0 99.79

F6 5.8 6.7 99.56

F7 5.5 6.9 99.45

F8 5.9 7.3 99.38

Table.3. Stability study of Gliclazide Batches Week Appearance pH Drug Content (%)

F3 (Reference) 0 Clear 5.4 99.20

1 Clear 5.5 98.95

2 Clear 5.7 98.54

3 Clear 5.8 98.09

F4 (test) 0 Clear 5.4 99.75

1 Clear 5.6 99.32

2 Clear 5.7 99.08

3 Clear 5.9 98.68

F5 (test) 0 Clear 5.5 99.79

1 Clear 5.6 99.43

2 Clear 5.7 98.75

3 Clear 5.8 98.32

F6(test) 0 Clear 5.5 99.90

1 Clear 5.7 99.56

2 Clear 5.8 98.86

3 Clear 5.8 98.32

F7(test) 0 Clear 5.4 99.45

1 Clear 5.6 99.11

2 Clear 5.7 98.78

3 Clear 5.8 98.31

F8(test) 0 Clear 5.5 99.38

1 Clear 5.7 98.67

2 Clear 5.8 98.43

3 Clear 5.9 98.09



Table.4. Drug permeability release profile of Gliclazide gel formulation Time interval Media ph %drug release

30 5.5 72.35%

60 5.6 75.68%

90 5.8 79.68%

120 5.9 86.79%

4. CONCLUSION

The polymer being macromolecules of very high

molecular weight remain unabsorbed on the skin and from

our studies it can be concluded that sodium CMCcan be

used for various topical dosage form for external

application. It has been observed that optimized batch

produces the gel with good consistency, homogeneity,

spreadabiltity and stability. Since, the polymer is water

soluble; consequently, it forms water washable gel and has

wider prospects to be used as a topical drug delivery

dosage form.

ACKNOWLADGEMENT

Authors are thankful to H-Jules Corporation

(Nagpur, India) for supply of gift sample of Gliclazide.

The Management of Sharad Pawar College of Pharmacy

for providing necessary facilities to carry out this research

work.

REFERENCES

C.D.Rowland, J.R. Burton, A review on toxicity of

various hydrophilic polymers, Environ Toxi Chem., 19,

1999, 2136-2139.

D.J.King, R.R.Noss, Toxicity of polyacrylamide and

acrylamide polymers, Environ Toxi Chem, 16, 1989, 1-4.

G.D.Gupta, R.S. Gound, Release rate of nimesulide from

different gellants, Indian J Pharm Sci, 61, 1999, 229-234.

H.S.Golinkin, Process for fracturing well formations using

aqueous gels, US Patent No. US4137182, 1979.

Sudhakar Y, Kuotsu K, Bandyopadhyay AK, Buccal

bioadhesive drug delivery promising option for orally

less efficient drugs, J. Control Rel., 114, 2006, 15 – 40.

U.V.Sera, M.V.Ramana, In vitro skin absorption and drug

release – a comparison of four commercial hydrophilic gel

preparations for topical use, The Indian Pharmacist, 73,

2006, 356-360.

Yang JF,Wei GL,Lu R. Determination of Gliclazide in

human plasma by high performance liquid

chromatography, Asian J Drug Metab Pharmaxokinet,

4(3), 2004, 231-234.

Haseen et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF

GEMIFLOXACIN AND AMBROXOL IN SOLID DOSAGE FORM BY REVERSE

PHASE HIGH PERFORMANCE LIQUID CHROMATOGRAPHY Md Haseena Begum, Nanda Kishore Agarwal and Duraivel.S

Department of Pharmaceutical Analysis and Quality Assurance,

Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India


ABSTRACT

The present investigation describes about a simple rapid, accurate, precise and reproducible validated

reverse phase HPLC method was developed for the determination of Ambroxol and Gemifloxacin in tablet dosage

forms. The quantification was carried out using Hypersil BDS HypersilC18(4.6*250mm,3.5 µm,make;ACE)

column run in isocratic way using mobile phase comprising of Sodium Phosphate buffer: acetonitrile, in the ratio

of 40:60 with a detection wavelength of 246nm, and injection volume of 20µL, with a flow rate of 1.2ml/min. The

retention times of the drugs was found to be 3.4min and 2.3min. The linearity ranges of the proposed method lies

between 60-140mcg and 7.5-17.5mcg for Gemifloxacin and Ambroxol with correlation coefficient of r2=0.999

and r2=0.998. The assay of the proposed method was found to be 101.22% and 101.92%. The recovery studies

were also carried out and % RSD from reproducibility was found to be <2%. LOD and LOQ were found to be

2.93 and 9.91 for Gemifloxacin and 3.0 and 9.97 for Ambroxol respectively. The proposed method was

statistically evaluated and can be applied for routine quality control analysis of Gemifloxacin and Ambroxol in

bulk and in Pharmaceutical dosage form.

Key Words: Gemifloxacin, Ambroxol, RP-HPLC, Hypersil BDS, validation.

1. INTRODUCTION

Gemifloxacin is an oral broad-spectrum quinolone

antibacterial agent used in the treatment of acute bacterial

exacerbation of chronic bronchitis and mild-to-moderate

pneumonia. Gemifloxacin acts by inhibiting DNA

synthesis through the inhibition of both DNA gyrase and

topoisomerase IV, which are essential for bacterial

growth. Gemifloxacin is indicated for the treatment of

infections caused by susceptible strains of the designated

microorganisms in the conditions listed below. Acute

bacterial exacerbation of chronic bronchitis caused by S.

pneumoniae, Haemophilus influenzae, Haemophilus

parainfluenzae, or Moraxella catarrhalis. Community-

acquired pneumonia (of mild to moderate severity) caused

by S. pneumoniae (including multi-drug resistant strains,

Haemophilus influenzae, Moraxella catarrhalis,

Mycoplasma pneumoniae, Chlamydia pneumoniae, or

Klebsiella pneumoniae. (Snyder,1997)

Ambroxol is kind of strong expectorant, clinically

proven active mucolytic agent. The medicine helps to

remove sticky phlegm from the respiratory tract easily and

quickly by enhancing the bronchial secretions that loosen

congested phlegm. It also releases and strengthens tiny

striking hairs inside the windpipe and bronchial tubes,

which is referred to as the cilia , which can then expel the

abnormal phlegm with their conveyor-belt like action.

Ambroxol increases the body's production of surfactant

which helps to overcome infection in the bronchi.

Ambroxol has local anesthetic properties, which make it

an efficacious treatment for sore throat and to reduce

symptoms of chronic, neuropathic, and inflammatory pain.

Ambroxol inhibits the release of histamine, leukotrienes

and cytokines from human leukocytes and mast cells.It

has also well documented antioxidant properties.

(Sethi P.D,2010).


have been reported for the analysis of Gemifloxacin and

Ambroxal Hcl combinational dosage forms which include

UV spectroscopy,Spectrophotometric,spectroflurimetric,

Reverse Phase High performance Liquid Chromatography,

HPTLC methods. The present study illustrate

development and validation of simple, economical,

selective, accurate, precise RP-HPLC method for the

determination of Gemifloxacin and Ambroxol bulk and

Pharmaceutical dosage forms as per ICH guidelines.


economical HPLC method for the analysis of

Gemifloxacin and Ambroxol combined dosage form using

most commonly employed column (C18) and simple

mobile phase preparation.



In the present proposed work a successful attempt had

been made to develop a method for the simultaneous

estimation of Gemifloxacin and Ambroxol dosage form

and validate it. From the economical point of view and for

the purpose of routine analysis, it was decided to develop

a more economical RP-HPLC method with simple mobile

phase preparation for the estimation of Gemifloxacin and

Ambroxol dosage form. The method would help in

estimation of drugs in single run which reduces the time of

analysis and does not require separate method for each

drug. Thus, the paper reports an economical, simple and

accurate RP-HPLC method for the above said

pharmaceutical dosage forms.


Quantitative HPLC was performed on a high performance

liquid chromatograph (Waters make), (software Empower,

2695 seperation module) HPLC system connected with

Lambindia UV detector. The drug analysis data were

acquired and processed using Empower software running

under Windows XP on a Pentium PC and Thermohypersil

BDS C18column (of dimension 100 × 4.6, 5µm particle

size). In addition an analytical balance (Afcoset ER-200A

0.1mg sensitivity), digital pH meter (Adwa-AD 1020), a

sonicator (Ultra sonic Cleaner) were used in this study

(Chagan, 2003).


Gemifloxacin and Ambroxol were kindly supplied as a

gift sample by Reddy´s Laboratory, Hyderabad, and




Fischer Scientific Chemicals.Water HPLC grade was


Gemifloxacin and Ambroxol Tablets available in the

market in composition of Gemifloxacin (320mg),

Ambroxol (75mg).

Preparation of mobile phase: Mix a mixture of above

buffer 400 mL (40%) and 600 mL of acetonitrile HPLC

(60%) and degas in ultrasonic water bath for 5 minutes.

Filter through 0.45 µ filter under vacuum filtration.

Preparation of Sodium Phosphate buffer: Weighed

2.5milligrams of Sodium di hydrogen ortho phosphate into

a 1000ml beaker, dissolved and diluted to 1000ml with

HPLC water. pH of the mobile phase was adjusted to 5.8

with orthophosporic acid.

Diluent Preparation: Use the Mobile phase as diluent.

Standard Solution Preparation: Accurately weigh and

transfer 10 mg of Gemifloxacin & Ambroxol working

standard into a 100ml clean dry volumetric flask add

Diluent and sonicate to dissolve it completely and make

volume up to the mark with the same solvent. (Stock

solution)

Sample Solution Preparation: Accurately weigh and

transfer equivalent to 10 mg of Gemifloxacin & Ambroxol

sample into a 100ml clean dry volumetric flask add about

70mL of Diluent and sonicate to dissolve it completely

and make volume up to the mark with the same solvent.

(Stock solution).

System suitability: System suitabilityare an integral part



repetitively injecting the drug solutions at 100%,

concentrations level for Gemifloxocin and Ambroxol to


system was stabilized for 40 min.One blank followed by

six replicate analysis of solution containing, 100% target

concentrations of Gemifloxocin and Ambroxol were




and retention time were taken.




60-140mcg and 7.5-17.5 mcg (50-150%) Gemifloxacin

and Ambroxol respectively. Method of least square

analysis is carried out for getting the slope, intercept and

correlation coefficient, regression data values and the

results were presented in Table:8. Calibration curves for

Gemifloxacin and Ambroxol: Accurately weigh and

transfer 10 mg of Gemifloxacin & Ambroxol working

standard into a 100mL clean dry volumetric flask add

about 70mL of Diluent and sonicate to dissolve it

completely and make volume up to the mark with the

same solvent.

Preparation of Level – I (50ppm of Gemifloxacin &

11.7 ppm Ambroxol): 5.0ml &1.17ml of Gemifloxacin &

Ambroxol stock solution has taken in 10ml of volumetric

flask dilute up to the mark with diluent.



Preparation of Level – II (60ppm of Gemifloxacin &




Preparation of Level – III (70ppmof Gemifloxacin &




Preparation of Level – IV (80ppmof Gemifloxacin &




Preparation of Level – V (90ppmof Gemifloxacin &

21.1 ppm Ambroxol): 9.0ml & 2.11ml of Gemifloxacin

& Ambroxol stock solution has taken in 10ml of

volumetric flask dilute up to the mark with diluent.

Procedure:: Inject each level into the chromatographic

system and measure the peak area. Plot a graph of peak

area versus concentration (on X-axis concentration and on

Y-axis Peak area) . Represented in Table:9&10.

Validation study of Gemifloxacin and Ambroxol: An







parameters like system suitability,

accuracy,linearity,precision (repeatability), limit of

detection (LOD), limit of Quantification (LOQ) and

robustness. (Dennis J, 2003)

Precision: Precision study of samples (Gemifloxacin and

Ambroxol) was carriedout by estimating corresponding




criteria of not more than 2.0



Gemifloxacin and Ambroxol by the method of addition.

Known amount of Gemifloxacin and Ambroxol at 50%,


The recovery studies were carried out in the tablet. The

mean percentage recovery of Gemifloxacin and Ambroxol

at each level is not less than 98.0% and not more than

102%.


of Gemifloxacin and Ambroxol under different


flow rate (1.1 ml/min to 1.3ml/min), λmax (±5), column

temperature (±5), mobile phase composition (±5%), and

pH of the buffer solution.

LOD and LOQ:Limit of detection is the lowest


necessarily quantified under the stated experimental





using following formula LOD = (SD)/S and LOQ =

(SD)/S, where SD= standard deviation of response (peak

area) and S= average of the slope of the calibration curve.



the determination of Gemifloxacin and Ambroxol.







detection wave length was selected as 246nm with UV









Acetonitrile and Orthophosphoric acid in the ratio of

(60:40) adjusted to pH- 5.8 at a flow rate of 1.2 ml/min. A

typical chromatogram for simultaneous estimation of the

two drugs obtained by using a above mentioned mobile

phase. Under these conditions Gemifloxacin and

Ambroxol were eluted at be 3.4min and 2.3min

respectively with a run time of 8 minutes.



The Acetonitrile and Orthophosphoric acid in the

ratio of (60:40) adjusted to pH- 5.8 was chosen as the

mobile phase. The run time of the HPLC procedure was 8

minutes at flow rate of 1.2ml/min was optimized which

gave sharp peak, minimum tailing factor.The system

suitability parameters were shown in Table:7 were in

within limit, hence it was concluded that the system was

suitable to perform the assay. The method shows linearity

between the concentration range of 60-140mcg for

Gemifloxacin and 7.5-17.5 for Ambroxol. The

experimental results were shown in table 9,10.The %

recovery of Gemifloxacin and Ambroxol was found to be

in the range of 98.0 to 102.0 and 100.5-100.59

respectively. As there was no interference due to

excipients and mobile phase, the method was found to be

specific. As both compounds pass the peak purity, The






shown in Table.1.The LOD and LOQ values were



approximately LOD and LOQ were found to be 2.93 and

9.91 for Gemifloxacin and 3.0 and 9.97 for Ambroxol

respectively which shows that the method is very

sensitive.

Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method

Parameter Chromatographic conditions

Instrument Waters, HPLC soft ware Empower,2695 seperation module 2487

Column Thermohypersil BDS C18column of dimension 100 × 4.6, 5µm particle

size.

Detector 2487 UV Detector.(DAD)

Diluents Methanol,Acetonitrile,Orthophosphoric acid.

Mobile phase Acetonitrile,orthophosphoric acid (60:40 )pH- 5.8

Flow rate 1.2ml/min


Temperature 25°c


Retention time Gemifloxacin:3.4; Ambroxol:2.3

Theoretical plate count Gemifloxacin:2265; Ambroxol: 4067

Tailing factor Gemifloxacin: 1.71; Ambroxol: 1.41

Table.2.Specificity study Table.3.Results of precision study Name of the solution Retention time in min

Blank No peaks

Gemifloxacin 3.4

Ambroxol 2.3

Injection Area

(Gemifloxacin)

Area

(Ambroxol)

Injection-1 2226346 618580

Injection-2 2225186 610329

Injection-3 2217922 614718

Injection-4 2176317 616030

Injection-5 2187753 616391

Average 2206705 615210

Standard Deviation 23107 3061.4

%RSD 1.05 0.50

Table.4.Recovery data of the proposed Gemifloxacin %Concentration

(at specification Level)

Area Amount

Added (mg)

Amount

Found (mg)

% Recovery Mean

Recovery

50% 1023451 5.0 4.97 99.56% 100.05%

100% 2055454 10.0 9.99 99.9%

150% 3105394 15.0 15.10 100.7%



Table.5. Recovery data of the proposed Ambroxol %Concentration

(at specification Level)

Area Amount

Added (mg)

Amount

Found (mg)

% Recovery Mean

Recovery

50% 263040 5.0 5.02 100.47% 100.59%

100% 520157 10.0 9.93 99.34%

150% 800883 15.0 15.30 101.97%

Fig.1. Structure of Gemifloxacin Fig.2. Structure of Ambroxol

Fig.3. Standard chromatogram for Gemifloxacin and Ambroxol

Fig.4. Sample chromatogram for Gemifloxacin and Ambroxol

4. CONCLUSION



determination of Gemifloxacin and Ambroxol tablet












be suitable for the routine analysis of Gemifloxacin and

Ambroxol Bulk drug and Pharmaceutical formulations.

ACKNOWLEDGEMENT

The authors would like to thank beloved parents and all

my well-wishers, one and all who have helped me directly

and indirectly in completing this project work.

REFERENCES

Snyder, L.R., Kirkland, J.J. and Glajch, J.L, “Practical

HPLC Method Development”, 2nd edition. John Wiley

and Sons, Inc, 1997, 653-660.

Sethi P.D. HighPerformance Liquid Chromatograph

Quantitative Analysis of Pharmaceutical Formulations, 1st

http://en.wikipedia.org/wiki/File:Gemifloxacin.svg



edition. CBS Publishers and Distributors, New Delhi,

2001, 60.

ICH Guidelines Q2B, Validation of Analytical Procedure,

Definitions, Geneva, Switzerland, March 1996

Chagan L, Gemifloxacin for the Treatment of Acute

Bacterial Exacerbation of Chronic Bronchitis and

Community-Acquired Pneumonia, Drug Forecast, 28(12),

2003, 769-79.

Dennis J. Cada, Terri Levien, Danial E. Baker,

Gemifloxacin Mesylate, Hospital Pharmacy, Wolters

Kluwer Health, Inc, 38, 2003, 85161.

Aqheel et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF THE ANTI HYPERGLYCEMIC ACTIVITY OF METHANOLIC

EXTRACT OF ROOT OF HELIOTROPIUM INDICUM IN STREPTOZOTOCIN AND

ALLOXAN INDUCED DIEBETIC RATS. Aqheel MA

* Janardhan M, Durrai vel S,

Department of pharmacology, Nimra College of pharmacy, Vijayawada, Andhra Pradesh, India

Corresponding author: [email protected]

ABSTRACT

The root of Heliotropium indicum is reported to have good medicinal values in traditional system of

medicines. Commonly called as Indian Turnsole, is a herb with slightly woody at base. The present study

highlights the anti hyperglycemic activity of Methanolic extract of root of Heliotropium Indicum in

Streptozotocin (60mg/kg i.p) for 15days and Alloxan (120mg/kg i.p) for 21 days induced Diabetic rats. The anti

hyperglycemic activity of oral administration of Methanolic extract of root of Heliotropium Indicum at 100mg/kg,

250mg/kg, and 500mg/kg was investigated in diabetic rats. Glibenclamide10mg/kg, p.o was used as standard

drug. The extract decreased the blood glucose level, feed and water intake as well as triacylglycerols at the three

doses investigated while the best result was obtained at 500 mg/Kg for both STZ and Alloxan induced diabetic

rats. In addition, the weight loss of diabetic-treated rats was markedly normalized at all doses. The glucose

tolerance level of diabetic animals was effectively reduced to near normal level after 90 min of extract

administration especially at the dose of 250 and 500 mg/Kg. Further, the Histopathological examination of

pancreas supported the anti-Hyperglycemic activity of test extract. All the data was analyzed by using one way

analysis of variance (ANOVA) followed by multiple comparison Dunnett’s test and the acceptance criteria was

P<0.05.

KEY WORDS: Heliotropium indicum, Streptozotocin (STZ), Alloxan, Glibenclamide.

INTRODUCTION

Diabetes is defined as a state in which the

homeostasis of carbohydrate and lipid metabolism is

improperly regulated by the pancreatic hormone, insulin,

ultimately resulting in increased blood glucose level. It is

the world’s largest endocrine disorder and is one of the

major killers in recent times. According to World Health

Organization (WHO), the world wide global population is

in the midst of a diabetes epidemic with people in

Southeast Asia and Western Pacific being mostly at risk.

The number of cases for diabetes which is currently at 171

million is predicted to reach 366 million by the end of

2030. Therefore, it is necessary to search for new drugs

and interventions that can be used to manage this

metabolic disorder. The most prevalent form of diabetes is

non-insulin dependent diabetes mellitus (type 2).

Ayurvedic, the Indian system of traditional medicine,

provides a number of medicinal plants to treat type2

diabetes. Traditional knowledge and historic literatures on

medicine play an important role in the discovery of novel

leads from medicinal plants.

Heliotropium indicum Linn. Commonly known as

‘Indian heliotrope’ is very common in India and some

parts of Africa and Bangladesh, but also found in other

countries. H. indicum has been used in different traditional

and folklore systems of medicine for curing various

diseases. An ethnopharma-cological survey revealed that,

the traditional healers in Kancheepuram district of Tamil

Nadu, India use H. indicum to cure skin diseases, poison

bites, stomachache and nervous disorders.

In some

African countries, another ethnopharma-cological survey

reports that H. indicum is believed to be useful in treating

malaria, abdominal pain and dermatitis. The highest

number of usages (22%) was reported for the treatment of

malaria. H. indicum is very rich in pyrrolizidine alkaloids.

Numerous pyrrolizidine alkaloids have been identified in

this plant by several authors. The alkaloids reported in the

entire plant include heliotrine , lasiocarpine, indicine, 12-

acetyl indicine , indicinine.


Collection of Plant Material: The fresh root of

Heliotropium Indicum was collected from the surrounding

fields of Harapanahalli in the month of June 2013.

Identification and authentification was done by Dr K.

Madhava Chetty, Assistant Professor, Department of

Botany, at Sri Venkateswara University, Tripati, A.P,

India

Preparation of the plant Extract: The fresh roots were

collected, cleaned and shade dried at room temperature.

The dried roots were coarse powdered by using grinder.

The coarse powder was packed in Soxhlet column and

then extracted with 95% Methanol (75-80⁰C). Thereafter,

the extract was concentrated using rotary flash evaporator

(50⁰C).

Animals: Sprague Dawley rats weighing 200-250 g were

used for the present study. The animals were maintained

under standard environmental conditions and were fed

with standard pellet diet and water ad libitum.



The study was approved by Institutional Animal

Ethics Committee (Reg.no.769/2010/CPCSEA), Proposal

no.191/ACE/CPCSEA. CPCSEA guidelines were adhered

during the maintenance and experiment.

Acute Toxicity Study: 95% MEHI was studied for acute

toxicity at dose of 200 mg/kg i.p. in female albino mice.

The extract was found devoid of mortality of the animals.

Hence 2500 mg/kg was considered as LD50 cut off value.

Hence, the doses selected for extract as per the OECD

guidelines No. 420 (Annexure - 2d) fixed dose method are

mentioned below.

100 mg/kg (1/25th of 2500 mg/kg)

250 mg/kg (1/10th of 2500 mg/kg)

500 mg/kg (1/5th of 2500 mg/kg)

Induction of Non Insulin Dependent Diabetes Mellitus

(NIDDM):

Streptozotocin induced hyperglycemia: Fasting blood

glucose was determined after depriving food for 16 hr

with free access of drinking water. Hyperglycemia was

induced by a single i.p. injection of 60 mg/kg of

Streptozotocin (SISCO Chem Pvt. Ltd., Mumbai, India) in

0.1M citrate buffer pH of 4.5. After 3 days of

Streptozotocin injection, the hyperglycemic rats (glucose

level > 200 mg/dl) were separated and divided into

various groups comprising of 6 rats. Normal control,

diabetic control and standard groups kept same for

antidiabetic activity of root extract. The treatment (p.o.)

was started from the same day except normal control and

diabetic control groups for a period of 15 days. During

this period, animals in all groups had free access to

standard diet and water. Body weight and blood glucose

levels were measured on ‘0’ day, 7th, 10th and 15th day of

the post treatment in overnight fasted animals. On 15th

day, blood samples were collected from rats by retro

orbital plexus for biochemical estimations. The whole

pancreas from all the animals was removed immediately

and was kept in 10% formalin solution for

Histopathological examination.

Alloxan induced hyperglycemia: Fasting blood glucose

was determined after depriving food for 16 hr with free

access of drinking water. Hyperglycemia was induced by a

single i.p. injection of 120 mg/kg of alloxan monohydrate

(s.d. fine-chem. Ltd., Mumbai, India) in sterile saline.

After 5 days of alloxan injection, the hyperglycemic rats

(glucose level > 200 mg/dl) were separated and divided

into various groups comprising of 6 rats. Normal control,

diabetic control and standard groups kept same for

antidiabetic activity of root extract. The treatment (p.o.)

was started from the same day except normal control and

diabetic control groups for a period of 21 days. During

this period, animals in all groups had free access to

standard diet and water. Body weight and blood glucose

levels were measured on ‘0’ day, 7th, 14th and 21th day of

the post treatment in overnight fasted animals. On 21th

day, blood samples were collected from rats by retro

orbital plexus for biochemical estimations. The whole

pancreas from all the animals was removed immediately

and was kept in 10% formalin solution for

Histopathological examination.

Anti Hyperglycemic Study:

Group I - Served as normal control and did not receive

any treatment.

Group II - Served as diabetic control and received Inducer

and vehicle.

Group III - Inducer + Glibenclamide (10 mg/kg p.o.) and

served as standard.

Group IV - Inducer + 95% MEHI extract (100 mg/kg,

p.o.)

Group V - Inducer + 95% MEHI extract (250 mg/kg, p.o.)

Group VI - Inducer + 95% MEHI seed extract (500

mg/kg, p.o.)

The parameters studied are as follows:

Biochemical parameters include;

a) Fasting blood glucose.

b) Serum urea.

c) Serum creatinine.

d) Serum total cholesterol.

e) Serum protein.

Morphological parameter includes; Body weight.

Statistical Analysis: Values were represented as mean ±

S.D. for 6 animals in each group. Data were analyzed

using one-way analysis of variance (ANOVA) followed

by multiple comparison Dunnett’s test. The values were

considered significant when p< 0.05.


Table.1.Effect of 95% MEHI Extract on Body weight in Streptozotocin Induced Diabetic Rats Groups Dose (mg/ kg) Body Weight (Mean ± S.E.M)

0thday 7thday 10thday 15thday

G I Norma control 229.33±2.53 232 ±4.31 251.00 ±6.84 258.50 ±9.79

G II Diabetic control (Vehicle) 190.67 ±3.72 175 ±3.41 163.50 ±0.99 129 ±1.59

G III 10 mg/ kg 193.17 ±2.20 176.1 ±5.6 182.00±2.28*** 165.20 ±2.08***

G IV 100 mg/ kg 186.50 ±3.53 184 ±3.61 183.17±2.52***

187.17 ±3.23***

G V 250 mg/ kg 190.83 ±1.30 185 ±2.90* 178.50±4.22** 178.67 ±3.46***

G VI 500 mg/ kg 185.83 ±3.00 191.5±4.17* 192.67±4.04*** 196.17±1.35*** Values are expressed as mean ± SEM; n=6. *P < 0.05, **P<0.01 and ***P<0.001 Vs Diabetic control



Table.2. Effect of 95% MEHI Extract on Serum Glucose levels in Streptozotocin Induced Diabetic Rats

Groups Dose (mg/ kg) Fasting Serum Glucose (mg/dl) Mean ± S.E.M)

0th

day 7th

day 10th

day 15th

day

G I Norma control 95.90 ± 3.4 94.87 ± 2.1 94.1 ± 1.70 95.67 ± 4.0

G II Diabetic

control(Vehicle)

250.80 ±9.76

256.51±8.8 233.80± 9.76 259.62 ±10.1

G III 10 mg/ kg 250.52±10.87 220.63±9.71* 165.76±12.11 121.25±12.3***

G IV 100 mg/ kg 253.39 ±7.78 250.3 ± 6.9 230.54 ± 9.9 189.91±10.87***

G V 250 mg/ kg 253.15±10.12 240.41 ±11.1 175.63±10.09** 143.69 ±11.4***

G VI 500 mg/ kg 254.98 ± 19 229.13 ±10.1 167.21 ±10.1***

122.01 ±1.35***

Table.3. Effect of 95% MEHI Extract on Biochemical Parameters in Streptozotocin Induced Diabetic Rats

Groups Dose(mg/kg) Serum

Urea (mg/dl)

Serum

Creatinine (mg/dl)

Serum

Cholesterol (mg/dl)

Serum

Protein (g/dl)

G I Norma control 55.61 ±1.80 0.7 ± 0.01 65.13 ± 2.5 8.1 ± 0.9

G II Diabetic control(Vehicle) 123.67±0.05 1.56 ± 0.05 130.13±2.3 5.1 ± 0.24

G III 10 mg/ kg 58.88±3.19** 0.54±0.02*** 61.9± 4.1*** 8.5 0.34***

G IV 100 mg/ kg 87.96 ±4.75 0.96±0.01*** 108.4± 4.4** 5.9 ± 0.19*

G V 250 mg/ kg 74.27 ±4.60* 0.71±0.04*** 81.8± 3.6*** 7.01±0.48**

G VI 500 mg/ kg 65.62±3.61** 0.59±0.03*** 73.4±1.2*** 7.6 ±0.47** Values are expressed as mean ± SEM; n=6.*P < 0.05, **P<0.01 and ***P<0.001 Vs Diabetic control.

Table.4. Effect of 95% MEHI Extract on Body weight in Alloxan Induced Diabetic Rats TREATMENT Body weight (gram)

Day 1 Day 7 DAY14

G I 223±2.10

229.5±2.94 231.7±2.19

G II 222±3.15 213±2.17c 216.7±2.74b

G III 220±2.46 222.5±4.56* 229.2±3.18***

G IV 219.5±3.16 222.5±3.15* 228.3±2.70*

G V 224.16±2.47 248.3±2.26* 251.7±2.10**

G VI 223.15±2.56 248.6±2.25 253.45±2.13

Table.5. Effect of 95% MEHI Extract on Serum Glucose levels in Alloxan Induced Diabetic Rats Groups Fasting Serum Glucose (mg/dl) Mean ± S.E.M)

0th

DAY 1stday 7

thday 14

thday

G I 82.00±3.540 85.839±3.030 88.44±5.162 87.76±2.056

G II 253.00±7.739 264.25±3.199 271.17±4.786a 240.25±3.071

a

G III 229.83±5.597 229.34±3.613 115.14±3.189** 94.49±2.421***

G IV 220.00±3.765 225.12±2.055 155.20±4.112* 112.45±1.987*

G V 231.68±6.332 228.15±2.045 122.90±1.53* 109.55±1.998**

G VI 245.65±7.23 210.58±2.46 110.36±1.59*** 97.25±1.67***

Table.6.Effects of 95% MEHI Extract on Biochemical Parameters in Alloxan Induced Diabetic Rats Groups Dose (mg/kg) Serum urea (mg/dl) Serum creatinine (mg/dl) Serum cholesterol (mg/dl) Serum protein (g/dl)

G I Norma control 45.23 ±1.85 0.5 ± 0.01 70.12 ± 2.5 9.3 ± 0.9

G II Diabetic

control(Vehicle)

110.5±2.54 1.23 ± 0.05 150.25±2.3 4.63 ± 0.24

G III 10 mg/ kg 52.36±3.19** 0.65±0.02*** 50.28±4.1*** 8.5 ±0.34***

G IV 100 mg/ kg 92.55 ±4.75 0.84±0.01*** 120.56±4.4** 6.23 ± 0.19*

G V 250 mg/ kg 83.20 ±4.60* 0.78±0.04*** 100.45±3.6*** 8.25±0.48**

G VI 500 mg/ kg 68.25±3.61** 0.59±0.03*** 75.63±1.2*** 7.56 ±0.47**

All the values are expressed as mean±SEM, N=6, One way analysis of variance (ANOVA) followed by multiple comparison Dunnett’s test, *p<0.05, **p<0.01

and ***p<0.001 as compared to control group. And bp<0.01, cp<0.05as compared to Normal group



Effects of 95% MEHI Extract on Histopathological

changes of pancreas in Streptozotocin Induced

Diabetic Rats: Group –I: Normal control - Photomicrograph shows

normal acini and normal cellular population in the islets of

langerhans of pancreas (Fig-1).

Group – II: Diabetic control - It suggests extensive

damage to the islets of langerhans and reduced dimensions

of islets (Fig-2).

Group –III: Standard - It suggests restoration of normal

cellular size of islets with hyperplasia (Fig-3).

Group –IV: 95% Methanolic root extract (100 mg/kg) -

Less restoration of cells of islet of langerhans can be

observed (Fig-4).

Group –V: 95% Methanolic root extract (250 mg/kg) - It

suggests possible restoration of repair of the cells of islet

of langerhans (Fig-5).

Group –VI: 95% Methanolic root extract (500 mg/kg) –

Maximum restoration of the cells of islet of langerhans

can be observed (Fig-6).

The results obtained from the present investigation

demonstrated that the root extract of Heliotropium indicum

constantly maintained significant reduction of the glucose

level in streptozotocin and alloxan mediated diabetic rats

throughout the experimental period suggesting the

antihyperglycemic property of the title plant. In the present

study, it was observed the extract reversed the weight loss

of the diabetic rats. Alloxan has been shown to induce free

radical production and cause tissue injury. The pancreas is

especially susceptible to the action of alloxan induced free

radical damage.

The Dose of 60mg/kg Streptozotocin can induces

an autoimmune process that results in the destruction of the

ß-cells islets of Langerhans; it also results in the toxicity of

beta cells with emergence of clinical diabetes within 2-4

days. The results of the present study also indicated the

extract can reduce the levels of serum urea, creatinine, and

cholesterol. Increase the serum protein and the major

function of the extract is to protect vital tissues (Kidney

and liver) including the pancreas, thereby reducing the

causation of diabetes in the experimental animals.

Figure.1 Figure.2 Figure.3 Figure.4

CONCLUSION

The results of the present study indicated that

Heliotropium Indicum root extract possesses significant

anti hyperglycemic activity against streptozotocin and

alloxan induced diabetic rats. Thus justifies the traditional

use of this plant in the treatment of diabetes mellitus. Root

extract of the title plant possesses almost equipotent

antidiabetic activity when compared with reference

standard Glibenclamide.

REFERENCES

Asprey GF and Thornton P, Medicinal plants of Jamaica,

Part-III, West Indian Med J, 4(4), 1955, 69-82.

Bhat M, Zingarde SS, Bhargava SY, Kumar AR, Joshi

BN, Antidiabetic Indian plants: a good source of potent

amylase inhibitors. Evidence Based on Complementary

and Alternative Medicine, 2008,

doi:10.1093/ecam/nen040

Buenz EJ, Johnson HE, Beekman EM, Motley TJ, Bauer

BA, Bioprospecting Rumphius’s Ambonese herbal, I.

Journal of Ethnopharmacology, 1(96), 2005, 57–70.

Chellaiah M, Muniappan A, Nagappan R and Savarimuthu

I, Medicinal plants used by traditional healers in

Kancheepuram district of Tamil Nadu. Indian J Ethnobiol

Ethnomed, 2, 2006, 43.

World Health Organization (WHO), 2006.Diabetes

Programme. Available at http://www.who.Int/diabetes/en/

(accessed 15.10.07).

Alekhya Pallapolu and Aneesha Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


NOVEL RP-HPLC METHOD DEVELOPMENT AND VALIDATION OF METFORMIN AND

PIOGLITAZONE DRUGS IN PURE AND PHARMACEUTICAL DOSAGE FORMS Alekhya Pallapolu, Aneesha A

Department of Pharmaceutical Analysis and Quality Assurance, Nimra College of Pharmacy, Vijayawada, India


ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise reverse phase

high performance liquid chromatographic method for the simultaneous estimation of metformin and pioglitazone

in pure and pharmaceutical dosage forms. Metformin and pioglitazone were well separated using a HYPERSIL

BDS C18column of dimension 250 × 4.6, 5µm and Mobile phase consisting of Phosphate buffer( Pottasium

dihydrogen phosphate) : Methanol (Adjusted with Ortho phosphoric acid to pH-4.5) in the ratio of 70:30v/v at the

flow rate 1 ml/min and the detection was carried out at 240nm with PDA detector. The Retention time for

Metformin and Pioglitazone were found to be 1.945, 3.595min respectively. The developed method was validated

for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully

applied to Metformin, and Pioglitazone combination pharmaceutical dosage form.

KEY WORDS: RP-HPLC, Metformin, Pioglitazone, Accuracy, Precision.

1. INTRODUCTION

Metformin (1, 1- Dimethyl biguanide monohydro

chloride) is a member of the drug class known as Anti

Diabetic agent. It is used for type-2 diabetes. Metformin

improves hyperglycemia primarily through its suppression

of hepatic glucose production (hepatic glucogenesis). It

activates AMP-activated protein kinase (AMPK), a liver

enzyme that plays an important role in insulin signaling,

whole body energy balance, and metabolism of glucose

and fats, incisory effect on the production of glucose by

liver cells. The mechanism by which bigaunides increase

the activity of AMPK remains uncertain. Metformin

increases the amount of cytosolic AMP. Metformin

increases insulin sensitivity, fatty acid oxidation and

decreases absorption of glucose from the gastrointestinal

tract. AMPK probably plays a role, as Metformin

administration increases AMPK activity skeletal muscle.

AMPK is known to cause GLUT4 deployment to the

plasma membrane, resulting insulin –independent glucose

uptake.

Pioglitazone acts as an agonist at peroxisome

proliferator activated receptors (PPAR) in target tissues

for insulin action such as adipose tissue, skeletal muscle,

and liver. Activation of PPAR- gamma receptors increases

the transcription of insulin-response genes involved in the

control of glucose production, transport, and utilization. In

this way, pioglitazone both enhances tissue sensitivity to

insulin and reduces hepatic gluconeogenesis. Thus, insulin

resistance associated with type-2 diabetes mellitus is

improved without an increase insulin secretion by

pancreatic cells.


have been reported for the analysis of Metformin and

Pioglitazone combinational dosage forms which include

UV spectroscopy, Chromatography. In view of the need

for a suitable Spectrophotometric and RP-HPLC methods

for routine analysis of Metformin and Pioglitazone in

formulations, attempts were made to develop simple,

precise and accurate analytical method for estimation of

Metformin and Pioglitazone and extend it for their

determination in formulation as per ICH guidelines.


economical HPLC method for the analysis of Metformin

and Pioglitazone in combined dosage form using most

commonly employed column (C18) and simple mobile

phase preparation. In the present proposed work a

successful attempt had been made to develop a method for

the simultaneous estimation of Metformin and

Pioglitazone pharmaceutical dosage form and validate it.

From the economical point of view and for the purpose of

routine analysis, it was decided to develop a more

economical RP-HPLC method with simple mobile phase

preparation for the estimation of Metformin and

Pioglitazone combinational dosage form. The method

would help in estimate of drugs in single run which

reduces the time of analysis and does not require separate

method for each drug. Thus, the paper reports an




Quantitative HPLC was performed on a high

performance liquid chromatograph -Waters e2695Alliance

HPLC system connected with PDA Detector 2998 and

Empower2 Software. The drug analysis data were

acquired and processed using Empower2 software running

under Windows XP on a Pentium PC and HYPERSIL

C18column of dimension 100 × 4.6, 5µm particle size. In







Metformin and Pioglitazone were kindly supplied as a gift

sample by NATCO, Hyderabad, and Andhra Pradesh,

India. Methanol was of HPLC grade and Purchased from

E. Merck, Darmstadt, Germany. Ortho Phosphoric Acid

was analytical reagent grade supplied by Fischer Scientific

Chemicals. Water HPLC grade was obtained from a Milli-

QRO water purification system.Metformin and

Pioglitazone Tablets available in the market as zipio m, in

composition of Metformin (500mg), Pioglitazone (7.5mg).

Preparation of mobile phase: Transfer 13.02gm of

KH2PO4into 1000ml of beaker dissolve and diluted

volume with methanol. Then adjust its pH to 4.5.

Composition of mobile phase was 70:30 v/v Buffer and

Methanol respectively. Finally the mobile phase was

filtered through 0.45µ membrane filter and degassed by

sonication.

Preparation of calibration standards: 500mg

Metformin and 7.5mg pioglitazone was taken into a 50, 5

ml of volumetric flask and add 25ml of diluent and

sonicated for 10 minutes and made up with Diluent. It was

further diluted to get stock solution of Metformin and

Pioglitazone. This was taken as a 100% concentration.

Working standard solutions of Metformin and

Pioglitazone was prepared with mobile phase. A series of

25 ml volumetric flasks containing standard solutions of

Metformin and Pioglitazone were prepared.





concentration level for Metformin and Pioglitazone to


system was stabilized for 40 minion blank followed by six

replicate analysis of solution containing 100% target

concentration of Metformin and Pioglitazone were





in Table 1.


Calibration curves for Metformin and Pioglitazone:

Replicate analysis of solution containing 1-3µg/mL,

0.015-0.45µg/mL of Metformin and Pioglitazone sample

solutions respectively were injected into HPLC according

to the procedure in a sequence and chromatograms were

recorded.Calibration curves were constructed by plotting




Analysis of marketed formulation: The content often


were determined. Powder of tablets equivalent to

twotablets weight (1302.6mg) were weighed and taken in

a 50ml volumetric flask, dissolved in diluents, shaken and







procedure. From the peak areas of Metformin and

Pioglitazone the amount of the drugs in the sample were





Validation study of Metformin and Pioglitazone: An












Metformin and Pioglitazone in the determination under








Precision: precision study of sample (Metformin and

Pioglitazone) was carried out by estimating corresponding




criteria of not more than 2.0.


methods were obtained over the concentration range of1-

3µg/mL, 0.015-0.045µg/mL (50-150%) Metformin and

Pioglitazone respectively. Method of least square analysis

is carried out for getting the slope, intercept and

correlation coefficient, regression data values and the

results were presented in Table 2. The representative

chromatograms indicating the sample were shown in

figures 2&3. A calibration curve was plotted between



concentration and area response and statistical analysis of

the calibration curves were shown in figures 6&7.



Metformin andPioglitazone by the method of addition.

Known amount of Metformin andPioglitazone at 50%,


The recovery studies were carried out in the tablet in

triplicate each in the presence of placebo. The mean

percentage recovery of Metformin and Pioglitazone at

each level is not less than 99% and not more than 100%.


of Metformin and Pioglitazone under different




buffer solution.


concentration in as ample that can be detected but not

necessarily quantified under the stated experimental


concentration of analytic in a sample that can be




LOQ=10(SD)/S, where SD = standard deviation of


calibration curve.



the determination of Metformin and Pioglitazone.
















phosphate buffer ( potassium di hydrogen phosphate) :

Methanol (70:30, v/v)(Adjusted pH 4.5 with Ortho

Phosphoric Acd ) at a flow rate of 1 ml/min. a typical

chromatogram for simultaneous estimation of the two

drugs obtained by using a above mentioned mobile phase.

Under these conditions Metformin and Pioglitazone were

eluted at 1.94 minutes and 3.59 minutes respectively with

a run time of 6 minutes. The representative chromatogram

of this simultaneous estimation shown in fig. 3 & 4 and

results were summarized in Table 1.

The Methanol and water (pH 4.5 with Potasssium

Di hydrogen Phosphate) (70:30, v/v) was chosen as the

mobile phase. The run time of the HPLC procedure was 6

minutes at flow rate of 1ml/min was optimized which

gave sharp peak, minimum tailing factor. The system

suitability parameters were shown in Table 1were in

within limit, hence it was concluded that the system was

suitable to perform the assay. The method shows linearity

between the concentration ranges of 1-3µg/mL, 0.015-

0.045µg/mL. The experimental results were shown in

table 6 and fig.6&7.The % recovery of Metformin and

Pioglitazone was found to be in the range of 99.41 to

99.67 % & 99 to 100% respectively. As there was no

interference due to excipients and mobile phase, the

method was found to be specific. As both compounds pass

the peak purity, the method was found to be specific. The






shown in Table5.The LOD and LOQ values were




was obtained as 0.125µg/mL for Metformin and

0.026µg/mL for Pioglitazone which shows that the

method is very sensitive. The results were shown in

Table.7.

Figure.1.Structure of Metformin Figure.1.Structure of Pioglitazone



Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions


Column HYPERSIL C18, (5μ, 250 x 4.6mm)

Detector PDA Detector 2998

Diluents Methanol

Mobile phase Phosphate buffer(Potassium dihydrogen phosphate):methonal (adjusted pH

4.5 with ortho phosphate) (70:30 v/v)

Flow rate 1ml/min


Temperature 35°c


Retention time Metformin:1.948; Pioglitazone:3.594

Theoretical plate count Metformin:2132; Pioglitazone:2349

Tailing factor Metformin:1.84; Pioglitazone:1.76

Resolution factor 7

Table.2.Specificity study


Blank No peaks

Metformin 1.948min

Pioglitazone 3.594min

Table.3.Results of precision study

Sample Injection number Precision

RT Peak area

Metformin

1 1.947 10627252

2 1.948 10643033

3 1.951 10699827

4 1.954 10695555

5 1.949 10626006

6 1.954 10646083

Mean 10656293

%RSD(NMT 2.0) 0.3

Pioglitazone

1 3.594 5647514

2 3.593 5642430

3 3.595 5649391

4 3.595 5653442

5 3.593 5643778

6 3.593 5647612

Mean 5647361

%RSD(NMT 2.0) 0.1

Table.4.Recovery data of the proposed Metformin and Pioglitazone

Sample Spiked Amount

(µg/ml)

Recovered Amount

(µg/ml)

%Recovered %Average

recovery

Metformin 992.78 993.19 100

99.66% 1985.5 1975.6 99

2969.2 2958.22 100

Pioglitazone 14.89 14.90 100

100.% 29.78 29.77 100

44.53 44.6 100



Table.5.Robustness results of Metformin and Pioglitazone

Table.6.Linearity data of the Metformin and Piogitazone

Sample Linearity level

(µg/ml)


Metformin 0.1 2581359

192888

99780.88

0.999 0.15 4170046

0.2 4989227

0.25 5779047

0.3 7896996

Pioglitazone 0.01 1465678

19288

61387

0.999 0.015 2455416

0.02 2921616

0.025 3411233

0.03 4689975

Table.7.Limit of Detection and Limit of Quantification

Parameter Metformin Pioglitazone

Limit of detection(LOD) 0.125µg/mL 0.026µg/mL

Limit of Quantification(LOQ) 0.416µg/mL 0.0877µg/mL

Figure.3.Typical Chromatogram of blank

Figure.4.Typical Chromatogram of standard Figure.5.Typical chromatogram of Metformin marketed

formulation

Sample Parameters Optimized Usedp RT Peak area Plate count

Metformin

Flow rate

(±0.2)

1ml/min

0.8 2.399 6671088 2576

1 1.617 4016272 2543

Temperature

(±5°C)

30°C

20 1.931 4408830 2535

30 1.924 4984239 2586

Pioglitazone

Flow rate

(±0.2)

1ml/min

0.8 5.149 3896192 2808

1 3.469 2335282 2800

Temperature

(±5°C)

30°C

20 4.158 2858998 2902

30 4.082 2215484 3112



Figure.6.Linearity of metformin Figure.7.Linearity of pioglitazone

4. CONCLUSION



determination of Metformin andPioglitazone in tablet












be suitable for the routine analysis of Metformin and

Pioglitazone Bulk drug and Pharmaceutical formulations.

ACKNOWLEDGEMENT


and all my well-wishers, one and all who have helped me


REFERENCES

T A Phaznadevi, Pharmaceutical Drug Analysis, 2nd

edition 2005, New age international publishers, 452-456.

The British Pharmacopoeia, Volume 2, 2007, 1575.

The Indian Pharmacopoeia, 2nd edition, Volume 2,

Controller publications, New Delhi, 1996, 554.

United States Pharmacopeia and National Formulary

(USANF), Asian Edition, Volume 2, 2007, 1269.

Sahoo PK, Sharma R, Chaturvedi SC, Simultaneous

Estimation of Metformin hydrochloride and Pioglitazone

hydrochloride by RP-HPLC method from combined tablet

dosage form, Ind J Pharm Sci, 2008, 70, 383-386.

Shaiaja et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


CARBON NANO TUBE: A REVIEW K.Shailaja

*, Tahseen Sameena, S.P.Sethy, Prathima Patil, Md. Owais Ashraf,

Department of Pharmaceutics, Sushrut Institute of Pharmacy, Taddanpally, Pulkal, Medak, India


ABSTRACT

Carbon nanotubes are fullerene-related structures which consist of graphene cylinders closed at either end

with caps containing pentagonal rings. This is a nanoscopic structure made of carbon atoms in the shape of a

hollow cylinder. The cylinders are typically closed at their ends by semi-fullerene-like structures. There are three

types of carbon nanotubes: armchair, zig-zag and Chiral (helical) nanotubes. These differ in their symmetry.

Namely, the carbon nanotubes can be thought of as graphene planes 'rolled up' in a cylinder (the closing ends of

carbon nanotubes cannot be obtained in this way). Depending on how the graphene plane is 'cut' before rolled up,

the three types of carbon nanotubes are obtained. Within a particular type, carbon nanotubes with many different

radii can be found. These tubes can be extremely long .Some consider them as special cases of fullerenes. When

produced in materials, carbon nanotubes pack either in bundles (one next to another within a triangular lattice) -

single-walled carbon nanotubes, or one of smaller radius inside others of larger radii - multi-walled carbon

nanotubes. Carbon nanotubes have already found several technological applications, including their application in

high-field emission displays.

Key words: Nanotechnology, Nanotubes, Nanoparticles.

INTRODUCTION

Nanotechnology is the creation of

useful/functional materials, devices and systems (of any

useful size) through control/manipulation of matter on the

nanometer length scale and exploitation of novel

phenomena and properties which arise because of the

nanometer length scale.Research and technology

development aimed to understand and control matter at

dimensions of approximately 1 - 100 nanometer – the

nanoscale .Ability to understand, create, and use

structures, devices and systems that have fundamentally

new properties and functions because of their nanoscale

structure. Ability to image, measure, model, and

manipulate matter on the nanoscale to exploit those

properties and functions. Ability to integrate those

properties and functions into systems spanning from nano-

to macro-scopic scales.A Carbon Nanotube is a tube-

shaped material, made of carbon, having a diameter

measuring on the nanometer scale. A nanometer is one-

billionth of a meter, or about one ten-thousandth of the

thickness of a human hair. The graphite layer appears

somewhat like a rolled-up chicken wire with a continuous

unbroken hexagonal mesh and carbon molecules at the

apexes of the hexagons. Carbon Nanotubes have many

structures, differing in length, thickness, and in the type of

helicity and number of layers. Although they are formed

from essentially the same graphite sheet, their electrical

characteristics differ depending on these variations, acting

either as metals or as semiconductors. As a group, Carbon

Nanotubes typically have diameters ranging from <1 nm

up to 50 nm. Their lengths are typically several microns,

but recent advancements have made the nanotubes much

longer, and measured in centimeters.

Discovery: They were discovered in 1991 by the Japanese

electron microscopist Sumio Iijima who was studying the

material deposited on the cathode during the arc-

evaporation synthesis of fullerenes. He found that the

central core of the cathodic deposit contained a variety of

closed graphitic structures including nanoparticles and

nanotubes, of a type which had never previously been

observed

Category of carbon nanotubes: Carbon Nanotubes can

be categorized by their structures:

1. Single-wall Nanotubes (SWNT)

2. Multi-wall Nanotubes (MWNT)

3. Double-wall Nanotubes (DWNT)

Single-wall Nanotubes: Single-Walled Nano Tubes:

Most single-walled nanotubes (SWNT) have a diameter of

close to 1 nanometer, with a tube length that can be many

millions of times longer. The structure of a SWNT can be

conceptualized by wrapping a one-atom-thick layer of

graphite called graphene into a seamless cylinder.

Double-wall Nanotubes: Double-wall nanotubes are an

important sub-segment of MWNT. These materials

combine similar morphology and other properties of

SWNT, while significantly improving their resistance to

chemicals. This property is especially important when

functionality is required to add new properties to the

nanotube. Since DWNT are a synthetic blend of both

SWNT and MWNT, they exhibit the electrical and

thermal stability of the latter and the flexibility of the

former.

Multi walled annotates: Multi-walled nanotubes

(MWNT) consist of multiple rolled layers (concentric

tubes) of graphene. There are two models that can be used


http://www.rdg.ac.uk/~scsharip/Tubecap.htm

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-Nanotubes/Single-wall-Nanotubes-SWNT

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-Nanotubes/Multi-wall-Nanotubes-MWNT

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-Nanotubes/Double-wall-Nanotubes-DWNT

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-Nanotubes/Double-wall-Nanotubes-DWNT

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-nanotubes-technology/Multi-wall-Nanotubes-MWNT

http://www.nanocyl.com/en/CNT-Expertise-Centre/Carbon-nanotubes-technology/Single-wall-Nanotubes-SWNT



to describe the structures of multi-walled nanotubes. In

the Russian Doll model, sheets of graphite are arranged in

concentric cylinders, e.g., a (0,8) single-walled nanotube

(SWNT) within a larger (0,17) single-walled nanotube.

Properties of a carbon nanotube: The intrinsic

mechanical and transport properties of Carbon Nanotubes

make them the ultimate carbon fibers. The following

tables (Table 1 and Table 2) compare these properties to

other engineering materials. Overall, Carbon Nanotubes

show a unique combination of stiffness, strength, and

tenacity compared to other fiber materials which usually

lack one or more of these properties. Thermal and

electrical conductivity are also very high, and comparable

to other conductive materials.

132,000,000:1 Length-To-Diameter Ratio

Diameter of 3 to 9 nm

Lengths in the millimeter range

Efficient electrical conductors

Can act as both thermal conductors and thermal

insulators

Applications of carbon nanotubes: Carbon Nanotube

Technology can be used for a wide range of new and

existing applications:

1. Micro-electronics / semiconductors

2. Conducting Composites

3. Controlled Drug Delivery/release

4. Artificial muscles

5. Supercapacitors

6. Batteries

7. Field emission flat panel displays

8. Field Effect transistors and Single electron

transistors

9. Nano lithography

10. Nano electronics

11. Doping

12. Nano balance

13. Nano tweezers

14. Data storage

15. Magnetic nanotube

16. Nanogear

17. Nanotube actuator

18. Molecular Quantum wires

19. Hydrogen Storage

20. Noble radioactive gas storage

21. Solar storage

22. Waste recycling

23. Electromagnetic shielding

24. Dialysis Filters

25. Thermal protection

26. Nanotube reinforced composites

27. Reinforcement of armour and other materials

28. Reinforcement of polymer

29. Avionics

30. Collision-protection materials

31. Fly wheels

Table.1.Mechanical Properties of Engineering Fibers

Fiber Material Specific Density E (TPa) Strenght (GPa) Strain at Break (%)

Carbon Nanotube 1.3 - 2 1 10 - 60 10

HS Steel 7.8 0.2 4.1 < 10

Carbon Fiber - PAN 1.7 - 2 0.2 - 0.6 1.7 - 5 0.3 - 2.4

Carbon Fiber - Pitch 2 - 2.2 0.4 - 0.96 2.2 - 3.3 0.27 - 0.6

E/S - glass 2.5 0.07 / 0.08 2.4 / 4.5 4.8

Kevlar* 49 1.4 0.13 3.6 - 4.1 2.8

Table.2. Transport Properties of Conductive Materials

Material Thermal Conductivity (W/m.k) Electrical Conductivity

Carbon Nanotubes > 3000 106 - 107

Copper 400 6 x 107

Carbon Fiber - Pitch 1000 2 - 8.5 x 106

Carbon Fiber - PAN 8 - 105 6.5 - 14 x 106

Carbon nanotubes in healthcare: Researchers have

demonstrated artificial muscles composed of yarn woven

with carbon nanotubes and filled with wax. Tests have

shown that the artificial muscles can lift weights that are

200 times heavier than natural muscles of the same size.

Nanotubes bound to an antibody that is produced by

chickens have been shown to be useful in lab tests to

destroy breast cancer tumors. The antibody-carrying

http://en.wikipedia.org/wiki/Matryoshka_doll

http://www.understandingnano.com/nanotube-yarn-artificial-muscles.html



nanotubes are attracted to proteins produced by one type

of breast cancer cell. Once attached to these cells, the

nanotubes absorb light from an infrared laser, tumor.

Carbon nanotubes and the environment: Carbon

nanotubes are being developed to clean up oil spills.

Researchers have found that adding boron atoms during

the growth of carbon nanotubes causes the nanotubes to

grow into a sponge like material that can absorb many

times it's weight in oil. These nanotube sponges are made

to be magnetic, which should make retrieval of them

easier once they are filled with oil. Carbon nanotubes can

be used as the pores in membranes to run reverse osmosis

desalination plants. Water molecules pass through the

smoother walls of carbon nanotubes more easily than

through other types of Nano pores, which requires less

power.

Carbon nanotubes and electronics: Building transistors

from carbon nanotubes enables minimum transistor

dimensions of a few nanometers and the development of

techniques to manufacture integrated circuits built with

nanotube transistors. Carbon nanotubes used to direct

electrons to illuminate pixels, resulting in a lightweight,

millimeter thick "nanoemissive" display panel. Printable

electronic devices use nanotube "ink" in inkjet printers,

transparent, flexible electronic devices using arrays of

nanotubes.

Toxicity: The toxicity of carbon nanotubes has been an

important question in nanotechnology. Such research has

just begun. The data are still fragmentary and subject to

criticism. Preliminary results highlight the difficulties in

evaluating the toxicity of this heterogeneous material.

Parameters such as structure, size distribution, surface

area, surface chemistry, surface charge,

and agglomeration state as well as purity of the samples,

have considerable impact on the reactivity of carbon

nanotubes. However, available data clearly show that,

under some conditions, nanotubes can cross membrane

barriers, which suggests that, if raw materials reach the

organs, they can induce harmful effects such as

inflammatory and fibrotic reactions.

CONCLUSION

Carbon annotates are allotropes of carbon with

a cylindrical nanostructure. Nanotubes have been

constructed with length-to-diameter ratio of up to

132,000,000:1, significantly larger than for any other

material. These cylindrical carbon molecules have unusual

properties, which are valuable

for nanotechnology, electronics, optics and other fields

of materials science and technology. In particular, owing

to their extraordinary thermal conductivity and mechanical

and electrical properties, carbon nanotubes find

applications as additives to various structural materials.

REFERENCES

Gullapalli, S.; Wong, M.S. Nanotechnology: A Guide to

Nano-Objects, Chemical Engineering Progress 107 (5),

2011, 28–32.

Hsu, Hsin-Cheng; Chen-Hao Wang, S.K. Nataraj, Hsin-

Chih Huang, He-Yun Du, Sun-Tang Chang, Li-Chyong

Chen, Kuei-Hsien Chen, Stand-up structure of graphene-

like carbon nanowalls on CNT directly grown on

polyacrylonitrile-based carbon fiber paper as

supercapacitor, Diamond and Related Materials, 25, 2012,

176–9

Liu, Q, Ren, Wencai; Chen, Zhi-Gang; Yin, Lichang; Li,

Feng; Cong, Hongtao; Cheng, Hui-Ming, Semiconducting

properties of cup-stacked carbon nanotubes,

Carbon, 47 (3), 2009, 731–736.

Nitrogen-Doped Multiwall Carbon Nanotubes for Lithium

Storage with Extremely High Capacity Weon Ho Shin,

Hyung Mo Jeong, Byung Gon Kim, Jeung Ku Kang, and

Jang Wook Choi Nano Letters, 12 (5), 2012, 2283-2288.

Wang, M.; Li, C.M, An oscillator in a carbon peapod

controllable by an external electric field: A molecular

dynamics study, Nanotechnology, 21 (3), 2010, 03570.

Yu, Kehan; Ganhua Lu, Zheng Bo, Shun Mao, and

Junhong Chen, Carbon Nanotube with Chemically

Bonded Graphene Leaves for Electronic and

Optoelectronic Applications, J. Phys. Chem. Lett, 2 (13),

2011, 1556–1562.

Zavalniuk V, Marchenko S, Theoretical analysis of

telescopic oscillations in multi-walled carbon nanotubes,

Low Temperature Physics, 37 (4), 2011, 337.

http://www.understandingnano.com/nanotube-sponge-oil-cleanup.html

http://www.understandingnano.com/nanotube-sponge-oil-cleanup.html

http://www.understandingnano.com/carbon-nanotube-membrane.html

http://www.understandingnano.com/carbon-nanotube-membrane.html

http://www.understandingnano.com/nanoelectronics-y-shaped-nanotube-transistor.html

http://www.understandingnano.com/nanoelectronics-y-shaped-nanotube-transistor.html

http://www.understandingnano.com/nanotube-transistor-integrated-circuits.html

http://www.understandingnano.com/nanotube-transistor-integrated-circuits.html

http://www.understandingnano.com/nanotube-nanoemissive-display.html

http://www.understandingnano.com/nanotube-ink-printing.html

http://www.understandingnano.com/nanotube-ink-printing.html

http://www.understandingnano.com/nanotube-transistors-transparent-flexible-electronics.html

http://en.wikipedia.org/wiki/Frequency_distribution

http://en.wikipedia.org/wiki/Surface_area

http://en.wikipedia.org/wiki/Surface_area

http://en.wikipedia.org/wiki/Surface_charge

http://en.wikipedia.org/wiki/Agglomeration

http://en.wikipedia.org/wiki/Reactivity_(chemistry)

http://en.wikipedia.org/wiki/Allotropes_of_carbon

http://en.wikipedia.org/wiki/Cylindrical

http://en.wikipedia.org/wiki/Nanostructure

http://en.wikipedia.org/wiki/Carbon

http://en.wikipedia.org/wiki/Molecule

http://en.wikipedia.org/wiki/Nanotechnology

http://en.wikipedia.org/wiki/Electronics

http://en.wikipedia.org/wiki/Optics

http://en.wikipedia.org/wiki/Materials_science

http://en.wikipedia.org/wiki/Thermal_conductivity

http://en.wikipedia.org/wiki/Electricity

http://www.aiche.org/uploadedFiles/Publications/CEPMagazine/051128_public.pdf

http://www.aiche.org/uploadedFiles/Publications/CEPMagazine/051128_public.pdf

Veeranjaneyulu et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


STABILITY INDICATING RP-HPLC METHOD FOR THE SIMULTANEOUS

DETERMINATION OF CANDESARTAN CILEXETIL AND

HYDROCHLOROTHIAZIDE IN BULK AND DOSAGE FORMS Veeranjaneyulu D, Aneesha A, Nandakishore Agarwal

Department of pharmaceutical analysis, Nimra College of Pharmacy, Vijayawada, India

Corresponding author: [email protected], phone no: 9951523344

ABSTRACT

A simple, specific and accurate reverse phase high performance liquid chromatographic method was

developed for the simultaneous determination of Candesartan cilexetil and Hydrochlorothiazide in pharmaceutical

dosage form. The column used was Hypersil BDS C18 (150*4.6mm, 5µ) in isocratic mode, with mobile phase

containing phosphate buffer- acetonitrile (55:45) adjusted to pH 4.6 using ortho phosphoric acid was used and

injection volume of 20µL, with a flow rate of 1.0ml/min. and effluents were monitored at 244 nm. The retention

times of Candesartan cilexetil and hydrochlorothiazide were 2.6 min and 3.6.min, respectively. The linearity for

Candesartan cilexetil and Hydrochlorothiazide were in the range of 38.4-86.6 mcg/mL and 30-70 mg/mL

respectively with correlation coefficient of r2=0.999 for both. The assay of the proposed method was found to be

99.38% and 99.26%. The recoveries of Candesartan cilexetil and Hydrochlorothiazide were found to be 101.3%

and 99.86%, respectively. The % RSD from reproducibility was found to be <2%. The proposed method was

statistically evaluated and can be applied for routine quality control analysis of Candesartan cilexetil and

Hydrochlorothiazide in bulk and in Pharmaceutical dosage form.

Key Words: Candesartan cilexetil, hydrochlorothiazide, RP-HPLC, Hypersil BDS, Validation, Forced

degradation studies.

INTRODUCTION

Candesartan cilexetil (CAN) belongs to

angiotensin II receptor blocker effective in lowering blood

pressure in hypertensive patients. Chemically it is known

as 2, 3-dihydroxy-2-butenyl 4-[1-hydroxy-1-methylethy] -

2-propyl-1- [p (o-1H-tetrazol-5-ylphenyl) benzylimida -

zole-5-carboxylate, cyclic-2, 3-carbonate.

Hydrochlorothiazide (HCTZ) is a diuretic of the class of

benzothiadiazine widely used in antihypertensive

pharmaceutical formulations, alone or combination with

other drugs, which decreases active sodium reabsorption

and reduced peripheral vascular resistance. It is

chemically 6-chloro-3, 4-dihydro-2H-1, 2, 4-

benzothiadiazine-7-sulfonamide 1, 1-dioxide, and was

successfully used as one content in association with other

drugs in the treatment of hypertension. Literature survey

revealed that a various analytical methods have been

reported for the determination of Candesartan cilexetil and

Hydrochlorothiazide in pure drug, pharmaceutical dosage

forms and in biological samples using liquid

chromatography either in single or in combined forms.

Confirmation of the applicability of the developed method

was validated according to the International Conference

on Harmonization (ICH) for the simultaneous

determination of CAN and HCTZ in bulk and in tablet

dosage form. (K. Balamuralikrishna, 2010)


UV-3000 LABINDIA double beam with UV win

5software UV-VISIBLE spectrophotometer with 1cm

matched quartz cells. Schimadzu HPLC equipped with

SPD 20A UV-VIS detector and the column used was

HYPERSIL BDS C18 (150*4.6mm, 5µ). The data

acquisition was performed by using LC solutions

software. In addition an analytical balance (DENVER

0.1mg sensitivity), digital pH meter (Eutech pH 510), a

sonicator (Unichrome associates UCA 701) were used in

this study.

Chemicals and reagents: Candesartan cilexetil and

Hydrochlorothiazide pure sample was taken as a gift

sample from local labs and dosage form “atacand”

manufactured by astrazeneca was purchased from local

pharmacy. Other chemicals all are of HPLC grade.

Figure.1.Structure of Candesartan Figure.2.Structure of Hydrochlorothiazide




Preparation of mobile phase: Potassium dihydrogen

phosphate was weighed (4.6 g) and dissolved in 1000 ml

of water. Finally the pH was adjusted to 4.6 with ortho

phosphoric acid (0.1 M). The solution was sonicated for

10 minutes and filtered using Whatman filter paper (No.1)

and used.

Preparation of stock solutions:

Candesartan standard stock solution: An accurately

weighed quantity of candesartan 64 mg was transferred

to the 100ml volumetric flask add 30ml of diluents (buffer

: ACN 55:45), sonicate to dissolve, dilute upto the mark

with diluent and mix well. (Concentration of candesartan

is about 640g/ml).

Hydrochlorothiazide standard stock solution: An

accurately weighed quantity of hydrochlorothiazide 50 mg

was transfer to the 100ml volumetric flask add 30ml of

diluent, sonicate to dissolve, dilute up to the mark with

diluent and mix well. (Concentration of Hydrochlothiazide

is about 500g/ml).

Preparation of standard: Take 10 ml solution from

standard stock solution of Candesartan and 10ml solution

from standard stock solution of hydrochlorothiazide and in

100 ml volumetric flask and make up the volume up to the

mark with diluents.

Preparation of the sample solution: The powder

equivalent to 300.54 mg of Candesartan and

Hydrochlorothiazide were weighed and taken into a

100mL volumetric flask. To this 25mL of diluents was

added and sonicated for 15min to dissolve the drugs then

made up the volume to required volume with the diluents.

From this solution 10ml was taken into a 100mL flask and

made upto final volume with diluents to get concentration

of Candesartan is about 64 g/ml, concentration of

Hydrochlorothiazide is about 50g/ml and filtered through

0.45µ filter under vacuum filtration. From this stock

solution further dilutions were made for the validation of

the method developed. (Narendra Devanaboyina, 2012).


Method Validation:

Specificity: Specificity is the ability of analytical method

to measure accurately and specifically the analyte in the

presence of components that may be expected to be





interference with the drug peak.

Linearity: Linearity is the ability of the method to



The linearity of CANDESARTAN was in the

concentration range of 38.4-86.6 %, for

HYDROCHLOTHIAZIDE 30-70%. From the linearity

studies calibration curve was plotted and concentrations

were subjected to least square regression analysis to

calculate regression equation. The regression coefficient

was found to be 0.999 and shows good linearity for both

the drugs.

Precision: Precision is the degree of closeness of

agreement among individual test results when the method

is applied to multiple sampling of a homogeneous sample.

Study was carried out by injecting six replicates of the

same sample preparations at a concentration of CAN 64

ppm/ml & HCTZ 50 ppm/ml.

Accuracy: Accuracy is the closeness of results obtained

by a method to the true value. It is the measure of






working standard solution of the drug.

LOD& LOQ: LOD is the lowest concentration of analyte

in a sample that can be detected but not quantified under

experimental conditions. The LOD values were

determined by the formulae LOD=3.3σ/s (where σ is the

standard deviation of the responses and s is the mean of

the slopes of the calibration curves). LOQ is the lowest


determined with acceptable precision and accuracy under

experimental conditions. It is a parameter of the

quantitative determination of compounds in the mixtures.

The LOQ values were determined by the formulae

LOD=10σ/s.

Forced degradation of candesartan and

hydrochlorothiazide:

Acid degradation: Accurately weighed 300.10 mg of

tablet powder was transferred into 100 ml volumetric

flask, 2.5 ml 5N Hydrochloric acid was added and heated

for 1 hour on a water bath at 80°C. The solution was

cooled and neutralized with 2.5ml 5 N sodium hydroxide,

10 ml diluent, sonicated for 10 minutes. The volume was

made up to mark with diluent, mixed well, filtered through

0.45µ nylon filter. The 5 ml of this solution was diluted to

50 ml diluent and analysed to record chromatogram.

Base Degradation: Accurately weighed 300.10 mg of

tablet powder was transferred into 100 ml volumetric

flask, 2.5ml 5N sodium hydroxide was added and heated

for 1 hour on awater bath at 80°C. The solution was

cooled and neutralized with 2.5ml 5 N hydrochloric acid,

10 ml diluent was adeed and sonicated for 10 minutes,

The volume was made upto mark with diluent mixed well,



filtered through 0.45µ nylon filter. The 5 ml of this

solution was diluted to 50 ml diluent and analysed to

recorded chromatogram.

Oxidative degradation: Accurately weighed 300.10 mg

of tablet powder was transferred into 100 ml volumetric

flask, add 1ml of 5%H2O2 and 10 ml diluent was adeed

and sonicated for 10 minutes, The volume was made upto

mark with diluent mixed well, filtered through 0.45µ

nylon filter. The 5 ml of this solution was diluted to 50 ml

diluent and analysed to recorded chromatogram.

Thermal degradation: Accurately weighed 300.10 mg of

tablet powder was taken and kept in a controlled

temperature oven at 800c for 12hrs.After that transferred

into 100 ml volumetric flask, 10 ml diluent was adeed and

sonicated for 10 minutes, The volume was made upto

mark with diluent mixed well, filtered through 0.45µ

nylon filter. The 5 ml of thissolution was diluted to 50 ml

diluent and analysed to recorded chromatogram.

Photolytic degradation: Accurately weighed 300.10 mg

of tablet powder was exposed to UV light for 12hrs. After

that transferred into 100 ml volumetric flask, 10 ml diluent

was adeed and sonicated for 10 minutes, The volume was

made upto mark with diluent mixed well, filtered through

0.45µ nylon filter. The 5 ml of thissolution was diluted to

50 ml diluent and analysed to recorded chromatogram.

Discussion: Several trials has made until getting good

peak resolution, acceptable plate count and tailing factor.

Method was optimized and the retention times of

candesartan cilexetil and hydrochlorothiazide was

reported as 2.6 &3.6

Specificity: The chromatograms of standard and sample

are identical with nearly same retention time. There is no

interference with blank and placebo to the drugs. Hence

the proposed method was found to be specific.

Linearity: From the Linearity data it was observed that

the method was showing linearity in the concentration

range of 38.4-86.6μg/ml for candesartan and 30-70 μg/ml

for Hydrochlorothiazide. Correlation coefficient was

found to be 0.999 for both the compounds.

Accuracy: The recoveries of pure drug from the analyzed

solution of formulation were 101.37 % for Candesartan

and 99.89 % for Hydrochlorothiazide, which shows that

the method was accurate.

Precision: The %RSD for the sample chromatograms of

method precision was found to be 0.34&0.42 (Rt & Area)

for Candesartan and 0.62 &0.44 (Rt & Area) for

Hydrochlorothiazide. Hence it passes method precision.

Robustness: All the system suitability parameters are

within limits for variation in flow rate (±0.2 ml). Hence

the allowable flow rate should be within 0.8 ml to 1.2 ml.

All the system suitability parameters are within limits for

variation (±2nm) in wavelength. Hence the allowable

variation in wavelength is ± 2nm

LOD & LOQ: LOD & LOQ of candesartan was found to

be 2.05, 6.20 and for Hydrochlorothiazide was found to be

2.59, 7.85 respectively. All the system suitability

parameters are within in the limits when the drugs are

subjected to stress conditions like acid, base peroxide,

thermal and photolysis. The results obtained were

satisfactory and good agreement as per the ICH

guidelines.

Table.1. Details of marketed Formulation

Brand name Content Manufacturing Company

Atacand HCT CAN&HCTZ (32mg & 25mg Respectively) Astrazeneca

Table.2. Optimized chromatogram conditions for candesartan and hydrochlorothiazide

Column Hypersil BDS C18 (150*4.6mm,5µ)

Mobile phase Phosphate Buffer pH 4.8:ACN(55:45)


Wavelength 244 nm


Column temperature Ambient

Run time 5 min



Table.3. Specificity Data for Candesartan and Hydrochlorothiazide:

Table.4. Linearity data for Candesartan and Hydrochlorothiazide

Candesartan Hydrochlorothiazide

Mcg/ml Area Rt Mcg/ml Area Rt

38.4 1088.683 2.6 30 529.605 3.6

51.2 1497.424 2.6 40 728.278 3.6

64 1876.036 2.6 50 914.671 3.6

76.8 2286.045 2.6 60 1150.078 3.6

86.6 2595.886 2.6 70 1325.845 3.6

Slope 31.2 Slope 20.14

Correlation coefficient 0.999 Correlation Coefficient 0.9998

Table.5.Summary of validation parameters

Parameter Candesartan Hydrochlorothiazide

Linearity 38.4-86.6µg/ml 30-70µg/ml

Precision (% RSD) 0.34 (Rt) 0.2(Area) 0.62 (Rt) 0.44 (Area)

Accuracy 101.37% 99.86%

LOD & LOQ 2.05, 6.20 2.59,7.85

Assay 100.41% 99.85 %

Table.6.Summary of Forced degradation data for candesartan and hydrochlorothiazide

Stress Condition Time(hrs) Retention Time Time(hrs) Retention Time

As such 12hrs 2.673 12hrs 3.637

Acid Hydrolysis (0.1 N, at RT) 12hrs 2.673 12hrs 3.637

Base Hydrolysis (0.1N at RT) 12hrs 2.707 12hrs 3.610

Oxidation (5% H2O2 at RT) 12hrs 2.680 12hrs 3.583

Photolysis(UV Light and sunlight) 12hrs 2.677 12hrs 3.630

Thermal (at 800c) 12hrs 2.663 12hrs 3.610

Figure.3.Chromatogram of standard drug

Standard

Injection

Retention time Area Theoretical

Plates

Retention

time

Area Theoretical

Plates

2.6 1811.967 3940 3.6 928.994 3048

2.6 1907.112 3708 3.6 915.563 3256

2.6 1948.456 3506 3.6 919.607 3088

Sample Injection

2.6 1902.678 3708 3.6 907.612 3256

2.6 1811.967 3940 3.6 928.994 3048

2.6 1955.852 3532 3.6 932.645 3105

Blank injection - - - - - -



Figure.4.Chromatogram for specificity sample

CONCLUSION






used for routine and stability sample analysis.

ACKNOWLEDGEMENT The authors thankful to Dr.Nanda Kishore

Agarwal Professor, Department of Pharmaceutical

Analysis and Quality Assurance for his valuable guidance

and all the staff and non-teaching staff of Nimra College

of Pharmacy for providing necessary facilities to carry out

the research work. The authors would like to thank

beloved parents and all my well wishers, one and all who

have helped me directly and indirectly in completing this

project work.

REFERENCES

K. Balamuralikrishna and B. Syamasundar, Development

and validation of high performance liquid

chromatographic method for the simultaneous estimation

of Candesartan cilexetil and Hydrochlorothiazide in

combined tablet dosage form.

Scholars Research Library, Der Pharma Chemica, 2010,

2(6), 231-237.

Narendra Devanaboyina, Satyanarayana T, Ganga Rao B,

Simultaneous determination of Candesartan and

Hydrochlorothiazide in combined Pharmaceutical Dosage

form by New RP-HPLC Method, Research Journal of

Pharmaceutical, Biological and Chemical Sciences, 3(1),

2012, 270.

Khopkar SM, Basic concepts of analytical chemistry,

2nd

ed. New Delhi: New age International Ltd. Publishers,

1998, 178-179.

Settle F, Handbook of Instrumental techniques for

analytical chemistry, 17th ed. NJ: Prentice Hall PTR; 1997,

56-57.

Thomas A Little, Assay development and method

validation essentials, Bio pharm, 1, 2012, 1-5.

Skoog DA, Holler FJ, Crouch SR, Principle of

Instrumental Analysis. 6th ed. India: Thomson

Publications, 2007, 145-147,180.

Chakravarthi and Duraivel Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A REVIEW ON ENHANCEMENT OF SOLUBILITY AND DISOLUTION RATE OF

BCS CLASS-II DRUG BY SOLID DISPERSION AND NONAQEOUS

GRANULATION TECHNIQUE Chakravarthi V

*, Duraivel S



ABSTRACT Solid dispersion, defined as the dispersion of one or more active ingredient in a carrier or matrix at solid

state, is an efficient strategy for improving dissolution of poorly water-soluble drugs for enhancement of their

bioavailability. Non aqueous granulations technique means size enlarged granules containing MCC with CCS

showed higher solubility and dissolution rate compared to other conventional formulations such as tablets or

capsules, solid dispersion which can be prepared by various methods has many advantages. Fairly soluble drugs

in gastrointestinal (GI) media exhibit complete oral absorption, and thus good bioavailability. About 40% of drugs

are not soluble in water in practice and therefore are slowly absorbed, which results in insufficient and uneven

bioavailability and GI toxicity. For BCS class II drug, solubility is a crucial rate limiting factor to achieve its

desired level in systemic circulation for pharmacological response. Thus, problematic solubility of BCS class II

drug is a main challenge for dosage. This review give detail information to improve the BCS class II drug

solubility by solid dispersion method and non aqueous granulation methods are ease and efficiency is most

promising and routinely employed technique to resolve the solubility problems of BCS class II drug.

Key Words: Simvastatin, Solid dispersion, Non aqueous granulations, bioavailability, dissolution,

gastrointestinal (GI) media.

I. INTRODUCTION

Fairly soluble drugs in gastrointestinal media

exhibit complete oral absorption, and thus good

bioavailability. About 40% of drugs are not soluble in

water in practice and therefore are slowly absorbed, which

results in insufficient and uneven bioavailability and GI

toxicity. Thus, most exigent phase of drug development

practice particularly for oral dosage forms is the

enhancement of drug solubility thereby its oral

bioavailability. Bioavailability refers to the limit of

therapeutically active drug that approaches the systemic

circulation and thus, is available at the site of action.

There are two reasons proposed for poor aqueous

solubility of drugs (i) high lipophilicity and (ii) strong

intermolecular forces which cause the insolubilization of

drugs. Various approaches have been proposed to enhance

solubilisation of poorly water soluble drugs for the

improvement of their bioavailability commonly used for

drug solubilisation includes micronization, chemical

modification, pH adjustment, solid dispersion,

complexation, co-solvency, micellar solubilisation and

hydrotropy.

Simvastatin, an inactive lactone, is cholesterol

lowering agent and a lipid lowering agent developed

synthetically from a fermentation product of Aspergillus

terreus. After oral ingestion, simvastatin is hydrolyzed to

the analogous β-hydroxyacid form. This is a major

metabolite and an inhibitor of 3-hydroxy-3-methylglutaryl

coenzyme A (HMG CoA) reductase, the enzyme that

catalyzes the conversion of HMG-CoA to mevalonate, the

rate-limiting step in the biosynthesis of cholesterol. This

review is prepared to narrate different traditional and

novel methodologies for the increase in solubility of

hydrophobic drugs for converting to oral dosage forms.

Advantages of solid dispersions over other strategies to

improve bioavailability of poorly water soluble drugs

(Dhananjay S Saindane, 2011):

Improving drug bioavailability by changing their

water solubility has been possible by chemical

approaches, in this active target can be achieved by

incorporating polar in the main drug structure,

resulting in the formation of a pro-drug.

Formulation approaches include solubilisation and

particle size reduction techniques, and solid

dispersions.

Milling or micronization for particle size reduction

is commonly performed as approaches to improve

solubility, on the basis of the increase in surface

area.

Among others solid dispersions appear to be a better

approach to improve drug solubility than these

techniques.

Solid dispersions are more efficient than these

particle size reduction techniques, since the latter

have a particle size reduction limit around 2–5 mm

which frequently is not enough to improve

considerably the drug solubility or drug release in

the small intestine and, consequently, to improve the

bioavailability.

Solid dispersions are more acceptable to patients

than solubilisation products, since they give rise to



solid oral dosage forms instead of liquid as

solubilisation products.

Solid dispersions disadvantages:

Despite extensive expertise with solid dispersions,

they are not broadly used in commercial products,

mainly because there is the possibility that during

processing (mechanical stress) or storage

(temperature and humidity stress) the amorphous

state may undergo crystallization.

The effect of moisture on the storage stability of

amorphous pharmaceuticals is also a significant

concern, because it may increase drug mobility and

promote drug crystallization.

Most of the polymers used in solid dispersions can

absorb moisture, which may result in phase

separation, crystal growth or conversion from the

amorphous to the crystalline state or from a meta

stable crystalline form to a more stable structure

during storage.

This may result in decreased solubility and

dissolution rate. Therefore, exploitation of the full

potential of amorphous solids requires their

stabilization in solid state, as well as during in-vivo

performance

Limitations:

Laborious and expensive methods of preparation.

Reproducibility of physicochemical characteristics

Difficulty in incorporating into formulation of

dosage forms, Scale-up of manufacturing process,

and Stability of the drug and vehicle.

Liquisolid technology: (Manpreet Kaur, 2013)

Spireas described the method for promoting

dissolution i.e. the formation of liquisolid compacts. A

liquid may be transformed into a free flowing, readily

compressible and apparently dry powder with the

liquisolid technology by simple physical blending with

selected excipients named the carrier and coating material.

The liquid portion which can be a liquid drug, drug

suspension or a drug solution in suitable non-volatile

liquid vehicles is incorporated into the porous carrier

material. Water miscible organic solvent systems with

high boiling point such as liquid poly ethylene glycols,

propylene glycol or glycerine are best suitable as liquid

vehicles. Once the carrier is saturated with liquid, a liquid

layer is formed on the particle surface which is instantly

adsorbed by the fine coating particles. Thus, an apparently

dry, free flowing, and compressible powder is obtained.

Schematic representation of liquisolid

system

Advantages:

Practically water-insoluble liquid and solid drugs

can be formulated into liquisolid systems using

new formulation mathematical model.

Better availability of an orally administered water-

insoluble drug is achieved when the drug is in

solution form.

It can be used for the formulation of liquid oily

drugs.

It can be used in controlled drug delivery.

Disadvantages:

The liquisolid systems have low loading

capacities and they require high solubility in non

volatile liquid vehicles.

High levels of carrier and coating materials are

required to maintain acceptable flowability and

compatibility for liquisolid powder formulation

and that in turn will increases the weight of each

tablet above 1gm which is very difficult to

swallow.

Applications:

Mechanisms of enhanced drug release from liquisolid system

increased drug surface area

increased aqueous solubility

increased wettability



Liquisolid compact technology is a powerful tool

to improve bioavailability of water insoluble

drugs. Several water insoluble drugs on dissolving

in different non-volatile solvents have been

formulated into liquisolid compacts.

Rapid release rates are obtained in liquisolid

formulations.

These can be efficiently used for water insoluble

solid drugs or liquid lipophilic drugs.

Solubility and dissolution improvement.

Non aqueous granulation technique: All the ingredients

were separately weighed and sifted using mesh no.40.and

mixed in a poly bag for 10 min. the binder solution was

prepared by using volatile solvents. Then the above dry

mixture was granulated with binder solution and dried in

the tray drier at the temperature 40-500C untile the

moisture reduce down to NMT-2%. The dried granules

were passed through mesh no.30and then diluents are

added to granules and blended for 10 min. the lubricants

also added to granules then evaluated for the flow

properties and the evaluated blend was compressed into

tablets to get tablets.

Methods of preparation of solid dispersions: Various

methods used for preparation of solid dispersion system.

1. Melting method

2. Solvent method

3. Melting solvent method (melt evaporation)

4. Melt extrusion methods

5. Lyophilization techniques

6. Melt agglomeration Process

7. The use of surfactant

8. Electrospining

9. Super Critical Fluid (Scf) technology

10. Dropping method

The advantageous properties of solid dispersions:

1. Particles with higher porosity: Particles in solid

dispersions have been found to have a higher degree of

porosity. The increase in porosity also depends on the

carrier properties, for instance, solid dispersions

containing linear polymers produce larger and more

porous particles than those containing reticular polymers

and, therefore, result in a higher dissolution rate. The

increased porosity of solid dispersion particles also

hastens the drug release profile.

2. Particles with improved wettability: Carriers with

surface activity, such as cholic acid and bile salts when

used, can significantly increase the wettability property of

drug. Even carriers without any surface activity, such as

urea, improved drug wettability. Carriers can influence the

drug dissolution profile by direct dissolution or co-solvent

effects.

3. Particles with reduced particle size: Molecular

dispersions, as solid dispersions, represent the last state on

particle size reduction, and after carrier dissolution the

drug is molecularly dispersed in the dissolution medium.

Solid dispersions apply this principle to drug release by

creating a mixture of a poorly water soluble drug and

highly soluble carriers. A high surface area is formed,

resulting in an increased dissolution rate and,

consequently, improved bioavailability.

4. Drugs in Amorphous State: Poorly water soluble

crystalline drugs, when in the amorphous state tend to

have higher solubility. The enhancement of drug release

can usually be achieved using the drug in its amorphous

state, because no energy is required to break up the crystal

lattice during the dissolution process.

Types of solid dispersion: Based on their molecular

arrangement, 6 different types of solid dispersions can be

distinguished

1. Eutectics

2. Amorphous precipitations in crystalline matrix

3. Solid solutions

i. Continuous solid solutions

ii. Discontinuous solid solutions

iii. Substitutional solid solutions

iv. Interstitial solid solutions

4. Glass suspension (contain 2 phases)

5. Glass suspension (contain1 phase)

6. Glass solution

Applications of solid dispersions:

To increase the solubility of poorly soluble drugs

thereby increase the dissolution rate, absorption

and bioavailability.

To stabilize unstable drugs against hydrolysis,

oxidation, recrimination, isomerisation, photo

oxidation and other decomposition procedures.

To reduce side effect of certain drugs.

Masking of unpleasant taste and smell of drugs.

Improvement of drug release from ointments

creams and gels.

To avoid undesirable incompatibilities.

To obtain a homogeneous distribution of a small

amount of drug in solid state.

To dispense liquid (up to 10%) or gaseous

compounds in a solid dosage.

To formulate a fast release primary dose in a

sustained released dosage form.



To formulate sustained release regimen of soluble

drugs by using poorly soluble or insoluble

carriers.

Characterization of solid dispersion: Several different

molecular structures of the drug in the matrix can be

encountered in solid dispersions. Several techniques have

been available to investigate the molecular arrangement in

solid dispersions. However, most effort has been put into

differentiate between amorphous and crystalline material.

Many techniques are available which detect the amount of

crystalline material in the dispersion.

Drug -carrier miscibility:

Hot stage microscopy: HSM is used to characterize the

interactions of many drugs with polymer.

Differential scanning calorimetry: Differential Scanning

Calorimetry (DSC) technique is used to detect the amount

of crystalline material.

Powder X-ray diffraction: Powder X-ray diffraction can

be used to qualitatively detect material with long range

order. Sharper diffraction peaks indicate more crystalline

material.

NMR 1H Spin lattice relaxation time: 1H NMR spin-

lattice relaxation provides a picture of the differences in

structure and dynamics in these materials. NMR

relaxometry has been shown to provide novel information

about the particle size of the drug and its recrystallisation

behaviour within swelling solid dispersions.

Drug carrier interactions:

FT-IR spectroscopy: Infrared spectroscopy (IR) can be

used to detect the variation in the energy distribution of

interactions between drug and matrix. Sharp vibrational

bands indicate crystallinity. Fourier Transform Infrared

Spectroscopy (FTIR) was used to accurately detect

crystallinities ranging from 1 to 99% in pure material.

Using IR or FTIR, the extent of interactions between drug

and matrix can be measured.

Raman spectroscopy: Confocal Raman Spectroscopy

was used to measure the homogeneity of the solid

mixture.

Physical Structure: Several different molecular

structures of the drug in the matrix can be encountered in

solid dispersions. Many attempts have been made to

investigate the molecular arrangement in solid dispersions.

However, most effort has been put into differentiate

between amorphous and crystalline material.

Scanning electron microscopy: Macroscopic techniques

that measure mechanical properties that are different for

amorphous and crystalline material can be indicative for

the degree of crystallinity.

Dynamic vapor sorption: Water vapour sorption can be

used to discriminate between amorphous and crystalline

material when the hygroscopicity is different.

DSC (MTDSC): Temperature Modulated Differential

Scanning Calorimetry (TMDSC) can be used to assess the

degree of mixing of an incorporated drug.

Stability: Humidity studies, Isothermal Calorimetry, DSC

(Tg, Temperature re crystallization), Dynamic vapor

sorption,

Dissolution: Dissolution Calorimetry measures the energy

of dissolution, which is dependent on the crystallinity of

the sample. Intrinsic dissolution, Dynamic solubility,

Dissolution in bio-relevant media

CONCLUSION

Solubility is a most important parameter for the

oral bio availability of poorly soluble drugs. Dissolution

of drug is the rate determining step for oral absorption of

the poorly water soluble drugs, which can subsequently

affect the in vivo absorption of drug. Currently only 8% of

new drug candidates have both high solubility and

permeability. Because of solubility problem of many

drugs the bio availability of them gets affected and hence

solubility enhancement becomes necessary. Solid

dispersion technology is one of the possible modes that

increase the solubility of poorly soluble drugs.

REFERENCES

Ansel C. Howard, Allen V. Loyd, Popovich A.

Nicholas, Pharmacetical dosage forms and drug

delivery systems, 7 th edition, 2000; 248-252.

D Praveen Kumar, Arora Vandana, Solid Dispersions:

A review, JPSI, 1(4), 2012, 27-34.

Dhirendra K, Solid dispersions: a review, Pak. J.

Pharm. Sci., 22(2), 2009, 234-246.

Lachman L., Liberman H.A, theory and practice of

industrial pharmacy, 3 rd edition, 1998; 462-464.

Luhadiya A, Agrawal S, Jain P, Dubey P K, A review

on solid dispersion, IJARPB, 2 (2), 2012, 281-291

Manpreet Kaur, International journal of advances in

pharmaceutical sciences.2013,4(1).

Pawar Anil R & Choudhari Pravin D, Novel

techniques for solubility, dissolution rate and

bioavailability enhancement of class II and IV drugs,

2(4), 2012, 9-14.

Saindane D.S, Kulkarni A. S, Khade T.S, Patil M.D,

Enhancing drug solubility and bioavailability using

solid dispersion: a review, International Journal of

Biopharmaceutics, 2(1), 2011, 22-30.

Karthik et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF ANTI-INFLAMMATORY ACTIVITY OF CANTHIUM

PARVIFLORUM BY IN-VITRO METHOD Kandikattu Karthik

1*, Bharath Rathna Kumar P

1, Venu Priya R

2, Sunil Kumar K

3 , Ranjith Singh.B.Rathore

4

*1Department of Pharmaceutical Analysis, JNTUA - Oil Technological Research Institute, Ananthapuramu, A.P, India.

2Department of Pharmaceutics, JNTUA - Oil Technological Research Institute, Ananthapuramu, A.P, India.

3Department of Pharmacology, Vijaya College of Pharmacy, Hyderabad, A.P, India.

4Department of Pharmacognosy, Vagdevi College of Pharmacy, Nellore, A.P., India.


ABSTRACT

The present study investigates the anti-inflammatory activity of ethanolic extract of Canthium Parviflorum,

is a valuable medicinal shrubby and woody plant which has been valued for centuries in ayurvedic medicine.

Phyto-chemical analysis of Canthium parviflorum plant extracts revealed the presence of various bio-chemical

compounds such as flavonoids, glycosides, alkaloids, saponins and terpinoids. Since terpenoids and flavonoids

have remarkable anti-inflammatory activity, our present work aims at evaluating the in-vitro anti-inflammatory

activity of Canthium parviflorum by protein denaturation method. Denaturation of proteins is a well documented

cause of inflammation and rheumatoid arthritis. Several anti-inflammatory drugs have shown dose dependent

ability to inhibit thermally induced protein denaturation. Ability of CPE extract to bring down thermal

denaturation of protein is possibly a contributing factor for its anti-inflammatory activity. The data of our studies

suggests that CPE extract showed significant anti-inflammatory activity. Therefore our studies support the

isolation and use of active constituents of Canthium parviflorum in treating inflammation.

Key Words: Canthium parviflorum, flavanoids, glycosides, phytochemical analysis, inflammation.

INTRODUCTION

Medicinal plants are believed to be an important

source of new chemical substances with potential

therapeutic effects. The research into plants with alleged

folkloric use as anti-inflammatory agents should therefore

be viewed as a fruitful and logical research strategy in the

search for new anti-inflammatory drugs. Inflammation

may be potentially harmful, causing life threatening

hypersensitivity reactions and progressive organ damage

(Robbins, 2008). NSAIDs are reported to possess

prevention of the denaturation of proteins, which act as

antigens and leads to auto-immune diseases (Insel, 1996).

Canthium as herbal medicine is used for the treatment of

diabetes (Ayyanar, 2008), treatment of snake bites

(Mahishi Parinitha, 2005), scabies and the ring worm

infection (Anitha, 2008) antioxidant and diuretic activity

(Mohideen, 2003). Canthium Parviflorum, is a valuable

medicinal shrubby and woody plant which has been

valued for centuries in ayurvedic medicine. Phyto-

chemical analysis of Canthium parviflorum plant extracts

revealed the presence of various bio-chemical compounds

such as flavanoids, glycosides, alkaloids, saponins and

terpinoids. Different parts of Canthium parviflorum, have

been used traditionally for the treatment of variety of

diseases including anaemia, toothache, cough and as a

hypoglycemic agent. Roots and leaves were used to

reduce swellings in inflammation. However, there is no

systematic scientific report published indicating utility of

this plant material in the treatment of inflammation. Thus

the presence of therapeutically active flavonoids as major

constituents was the basis of selection and evaluation

ethanol extract of Canthium parviflorum leaves for their

anti-inflammatory activity.


Plant material: Fresh leaves of the plant Canthium

parviflorum were collected from Andhrapradesh, India.

The plant material was taxonomically identified by

C.V.S.Bhaskar, Prof. in Botany, Venkatagiri Raja’s

college, SPSR Nellore, Andhra Pradesh, India. A voucher

specimen has been preserved in our laboratory for future

reference. The leaves were dried under shade and then

powdered with a mechanical grinder and stored in airtight

container. The dried powder material of the leaves was

defatted with petroleum ether and subsequently extracted

with ethanol in a Soxhlet apparatus. The solvent was

completely removed under reduced pressure and Ethanol

extract of Canthium parviflorum leaves was obtained

(yield 18.5%). Solution of Canthium parviflorum was

prepared freshly in distilled water and used for the studies.

Chemicals and drugs: Tris amino methane and bovine

Serum Albumin were obtained from Himedia Lab.,

Mumbai India, Ibuprfen from Sigma-Aldrich and all other

chemicals used were of analytical grade. Solvents were

purchased from Sd-Fine Chem Ltd. All other chemicals

used were of analytical grade and purchased locally.

Extract Preparation: Plant parts were air dried at room

temperature for 4 weeks to get consistent weight. The

dried parts were later ground to powder. 100g of dried

samples were extracted with hexane and ethanol using




Soxhlet apparatus. The extracts were concentrated under

reduced pressure by using rota vapour.

Phytochemical analysis: Phytochemical analysis was

carried out for the presence of various phytochemical

constituents i.e. saponins, steroids, phenol, alkaloids and

tannins, flavonoids, glycosides, etc. Phytochemical

screening was performed by employing standard screening

tests and the results are represented in table1.

Table.1.Phyto chemical Screening of Canthium parviflorum extracts

Test Hexane Extract Ethanolic Extract

Alkaloids + +

Saponins + +

Tanins + +

Phlobatanins + +

Steroids - -

Flavonoids + +

Anthraquinones - -

Glycosides + +

Reducing sugars - +

Terpenoids + +

+ve sign indicates the presence and –ve sign indicates the absence

In-vitro anti-inflammatory activity:

Antidenaturation activity: A solution of 0.2% w/v of

BSA was prepared in a Tris Buffer Saline and pH was

adjusted to 6.8 using glacial acetic acid stock solutions of

10,000µg/ml of all the extracts were prepared by using

ethanol as a solvent. From these stock solutions 4 different

concentrations of 1,100, 200 and 500µg/ml were prepared

by using ethanol as a solvent. 50µl (0.05ml) of each

extract was transferred to Eppendorf tubes using 1ml

micropipette. 5ml of 0.2% w/v BSA was added to the

entire above Eppendorf tubes. The control consists of 5ml

of 0.2% w/v BSA solution with 50µl ethanol. The

standard consists of 100µg/ml of Ibuprofen in ethanol

with 5ml 0.2% w/v BSA solution. The test tubes were

heated at 72ºC for 5 minutes and then cooled for 10

minutes. The absorbance of these solutions was

determined by using a UV-VIS Double beam

spectrophotometer (ELICO SL 244) at a wavelength of

660nm. Each experiment was carried out in triplicate and

the mean absorbance was recorded. The percentage of

inhibition of precipitation was determined on a percentage

basis relative to control using the formula.

Percentage of inhibition of denaturation =

controlofabsorbance

extractofabsorbancecontrolofabsorbance ×100


Anti-inflammatory properties - Inhibition of albumin

denaturation: Denaturation of proteins is a well

documented cause of inflammation. As part of the

investigation on the mechanism of the antiinflammation

activity, ability of different solvent plant extract protein

denaturation was studied. It was effective in inhibiting

heat induced albumin denaturation (Table 2). Maximum

percentage of inhibition 67.5 was observed from Ethanol

extract followed by hexane (56.4). All the solvent extracts

inhibited the albumin denaturation, the ethanol extract

stood first compared to hexane extracts. Ibuprofen, a

standard anti-inflammatory drug showed the maximum

inhibition 71.89% at the concentration of 100 μg/ml.

Inflammation is the response of living tissues to injury. It

involves a complex array of enzyme activation, mediator

release, extravasations of fluid, cell migration, tissue

breakdown and repair (Vane, 1995). Denaturation of

proteins is a well documented cause of inflammation and

rheumatoid arthritis (Mizushima, 1966). Several anti-

inflammatory drugs have shown dose dependent ability to

inhibit thermally induced protein denaturation (Grant,

1970). Ability of Canthium parviflorum extract to bring

down thermal denaturation of protein is possibly a

contributing factor for its anti-inflammatory activity. The

anti-inflammatory activity of Canthium parviflorum

extract found may be due to the presence of

therapeutically active flavonoids. The therapeutic

applications of flavonoids on inflammation have

previously been reported (Middleton, 2000;

Havsteen,2002). The data of our studies suggests that

Canthium parviflorum showed significant anti-

inflammatory activity by in vitro methods tested. Further

studies involving the isolation and purification of the

chemical constituents of the plant and the investigations in

the biochemical pathways may result in the development

of a potent anti-inflammatory agent with a low toxicity

and better therapeutic index.



Table.2.Anti denaturation of BSA in presence of Canthium parviflorum extracts

Type of sample Concentration(μg/ml) %Inhibition

Ethanolic 1 67.5±0.07

Ethanolic 100 46.6±0.03

Ethanolic 200 23.7±0.06

Ethanolic 500 12.2±0.09

Hexane 1 56.4±0.03

Hexane 100 39.4±0.07

Hexane 200 27.8±0.02

Hexane 500 10±0.06

Ibuprofen 100 71.89±0.07

CONCLUSION Canthium parviflorum is a valuable medicinal

shrubby and woody plant which has been valued for

centuries in ayurvedic medicine. Phyto-chemical analysis

of Canthium parviflorum plant extracts revealed the

presence of various bio-chemical compounds such as

flavonoids, glycosides, alkaloids, saponins and terpenoids.

Since glycosides and flavonoids have remarkable anti-

inflammatory activity, our present work aims at evaluating

the in-vitro anti-inflammatory activity of Canthium

parviflorum by protein denaturation method. Denaturation

of proteins is a well documented cause of inflammation

and rheumatoid arthritis. The data of our studies suggests

that Canthium parviflorum extract showed significant anti-

inflammatory activity. Therefore our studies support the

isolation and use of active constituents of Canthium

parviflorum in treating inflammation.

ACKNOWLEDGEMENT

The authors are thankful to Prof.Dr.N.Devanna,

Director, Oil Technological Research Institute, JNTUA,

Ananthapuramu for the encouragement and facilities

provided to carry out this research work.

REFERENCES

Anitha B, Mohan.V.R, Athiperumalsami T and Sudha S,

Ethnomedicinal plants used by the kanikkars of

Tirunelveli District, Tamil Nadu, India to treat skin

diseases, Ethnobotanical Leaflets, 12, 2008, 171-180

Ayyanar M, Sankarasivaraman K., and Ignacimuthu. S,

Traditional Herbal Medicines used or the treatment of

Diabetes among two major tribal groups in south Tamil

Nadu, India, Ethnobotanical Leaflets, 12, 2008, 276-280

Grant NH, Alburn HE, Kryzanauskas C, Stabilization of

serum albumin by anti-inflammatory drugs. Biochem.

Pharmacol, 19, 1970, 715 -722.

Havsteen BH, The biochemistry and medical significance

of the flavonoids, Pharmacol. Ther, 96 (2-3), 2002, 67-

202.

Insel PA, Analgesic-antipyretic and anti-inflammatory

agents and drugs employed in the treatment of gout. In:

Hardman JG Limbird LE, Molinoff PB, Ruddon RW and

Goodman Gilman A, The pharmacological Basics of

Therapeutics. McGraw Hill, New York, ninth edition,

1996, 617-657.

Mahishi Parinitha, Srinivasa B.Ha and Shivanna M.B,

Medicinal plant wealth of local communities in some

villages in Shimoga District of Karnataka, India Journal

Ethno pharmacology, 98 (3), 2005, 307-312.

Middleton E, Kandaswami C, Theoharides TC. The

effects of plant flavonoids on mammalian cells:

implications for inflammation, heart disease and cancer,

Pharmacol. Rev, 52, 2000, 673–751.

Mizushima Y, Screening test for anti-rheumatic drugs,

Lancet, 2, 1966, 443.

Mohideen S, Ilavarasan R, Hemalatha S, Anitha N, and

Sasikala E, Wound healing and diuretic activities of

Canthium parviflorum Lam, Natural Product Sciences, 9

(2), 2003, 102-104.

Robbins, Cotron, Vinay K, Abdul KA, Nelson F,

Pathologic Basis of Disease, Elsevier publication, seventh

edition, 2008, 47-53.

Vane JR, Bolting RM, New insights into the mode of

action of anti-inflammatory drugs, Inflam. Res, 44, 1995,

1–10.

Bhargavi et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


EVALUATION OF NEPHRO PROTECTIVEACTIVITY OF METHANOLIC

EXTRACT OF SEEDS OF VITIS VINIFERA AGAINST RIFAMPICIN AND

CARBONTETRA CHLORIDE INDUCED NEPHRO TOXICITY IN WISTAR RATS Kalluru Bhargavi,

*N Deepa Ramani, Janarthan M, Durraivel S



ABSTRACT

The Objective of the study was to investigate the nephroprotective activity of methanolic extract of seeds

of Vitisvinifera (family:vitaceae) against rifampicin induced and carbontetrachloride induced kidney damage in

rats.Male albino wistar rats (150-250gm) were selected and divided in to six groups of six animals each. Group 1

served as normal control, group 2 served as positive control, group 3 served as standard, group 4 was treated with

MEVV (low dose) and group 5 was treated with MEVV (high dose). The same grouping was followed for both

models (rifampicin and carbon tetra chloride). Inducing agents are given 3 days once for two weeks to induce

nephrotoxicity. The results are evidenced on the basis of physical, biochemical and histological parameters. One-

way analysis of variance followed by tukey’s multiple comparison tests were used for statistical

analysis.Rifampicin and carbontetrachloride produced significant changes in physical (decreased liver and body

weight), biochemical (increased levels of total protein, uric acid, urea, and creatinine), and histological parameters

in rats. Pretreatment with MEVV and standard drug cystone significantly prevented the physical, biochemical and

histological changes produced by rifampicin and carbon tetrachloride toxicity. Results of the present study

suggest that MEVV has a significant nephroprotective activity probably by acting against free radicals.

Key words: Vitis vinifera, Nephrotoxicity, Rifampicin, Carbontetrachloride, Biochemical parameters

INTRODUCTION

Nephrotoxicity is one of the most common kidney

problems and occurs when body is exposed to a drug or

toxin. When kidney damage occurs, body unable to rid of

excess urine and wastes from the body and blood

electrolytes (such as potassium and magnesium) will all

become elevated (Ramya, 2011). A number of therapeutic

agents can adversely affect the kidney resulting in acute

renal failure, chronic interstitial nephritis and nephritic

syndrome. Because of the increasing number of potent

therapeutic drugs like aminoglycoside antibiotics,

chemotherapeutic agents and NSAIDS have been added to

the therapeutic arsenal in recent years. Exposure to

chemical reagents like ethylene glycol, carbon

tetrachloride, sodium oxalate and heavy metals like lead,

mercury, arsenic and cadmium also induces

nephrotoxicity which leads to acute kidney injury (AKI).

(Porter, 1981; Hoitsma, 1991, Paller, 1990)


Materials: All chemicals were of analytical grade and

obtained locally. Creatinine,totalprotein,urea and uric acid

kit were procured from Robonik diagnostics, Hyderabad,

India.

Plant material: The fresh seeds Vitis vinifera was

collected from Kadapa District; A.P. Identification of the

plant was done by Dr. SreedharMurty, Assistant Professor,

Department of Botany, Government College of Arts,

Kadapa, A.P, India.

Animals: Healthy adult male wistar rats weighing

between 150-250gm were used for the present study. The

animals were housed in groups of six and maintained

under standard conditions (27±2ºC, relative humidity 44 -

56% and light and dark cycles of 10 and 14 hours

respectively) and fed with standard rat diet and purified

drinking water ad libitum for 1 week before and during the

experiments.

Preparation of the extract: The dried flowers of

V.viniferawas collected, cleaned, dried and powdered in a

grinder - mixer to obtain a coarse powder and then passed

through 40 mesh sieve. About 1000 gm of powdered drug

was extracted with aqueous methanol by soxhlet

apparatus. The extraction was carried out until the drug

becomes exhausted. The solvent was recovered from their

extract by distillation under reduced pressure. The dried

extract thus obtained was kept in a desicator and was used

for further experiments.

Induction of nephrotoxicity in rats: Rifampicin

(1000mg/kg) was dissolved in distilled water and

administered orally to rats for 14 consecutive days at an

interval of 72 hrs to induce experimental Nephro toxicity

in rats .CCl4 (1ml/kg) was dissolved in olive oil and

injected intraperitoneally to rats for 14 consecutive days at

an interval of 24 hrs to induce experimental Nephro

toxicity in rats.

Experimental design:

Rifampicin induced nephrotoxicity: The experimental

animals were randomly divided in to 5 groups (n= 6) and

treated for duration of 14 days as per the treatment



schedule given in table.1. Nephrotoxicity was induced by

administration of Rifampicin (1000 mg/kg oral) three days

once for two weeks. Methanolic extract of V. vinifera was

freshly suspended in distilled water and administered to

animals by oral feeding needle.

Carbon tetra chloride induced nephrotoxicity: The

experimental animals were randomly divided in to 5

groups (n= 6) and treated for duration of 15 days as per

the treatment schedule given in table.2. Nephrotoxicity

was induced by injected intraperitoneally of CCl4 (1ml/kg

i.p) with olive oil every day for two weeks. Methanolic

extract of V. vinifera was freshly suspended in distilled

water and administered to animals by oral feeding needle.

PARAMETERS MEASURED

Physical Parameters: The body weight was recorded on

the first day and then last day of the study period in each

group.

Blood Estimations: Levels of creatinine,total

protein,urea,uric acid in blood weredetermined by using

commercial glucometer kit on final day of the experiment

by collecting blood.

Urine Estimations:Levels of creatinine,total

protein,urea,uric acid in urine were determined by using

commercial glucometer kit on final day of the experiment

by collecting urine.

Histopathological studies: For histopathological studies,

tissue obtained from the excised kidney was immediately

fixed in 10% buffered neutral formalin solution. The fixed

tissues were embedded in paraffin and serial sections were

cut. Each section was stained with hematoxylin and eosin

(H & E stain). The sections were examined under light

microscope and photomicrographs were taken.

Statistical analysis: All the data was expressed as mean ±

S.E.M. Statistical significance between more than two

groups was tested using one way ANOVA followed by the

Tukey’s multiple comparison test using computer based

fitting program (Prism graph pad 5.0). Statistical

significance was set accordingly.

Table.1.Treatment schedule for evaluation of nephroprotective activity of V vinifera against Rifapmicin induced

nephrotoxicity in Wistar Rats S.NO Groups Treatment (14 days)

I Normal Vehicle (1% CMC)

II Control Rifampicin (1000mg/kg,p.o.)

III Standard Rifampicin (1000mg/kg,p.o.) + Cystone (500 mg/kg, p.o.)

IV Low dose Rifampicin (1000 mg/kg, p.o.) + VVFE (100 mg/kg, p.o.)

V High dose Rifampicin (1000 mg/kg, p.o.) + VVFE (200 mg/kg, p.o.)

Table.2.Treatment schedule for evaluation of nephroprotective activity of V vinifera against Carbon tetrachoride

induced nephrotoxicity in Wistar Rats S.NO Groups Treatment (15 days)

I Normal Olive oil (5ml/kg.p.o.)

II Control CCl4 (1ml/kg,i.p.)

III Standard CCl4 (1ml/kg,i.p.) + Cystone (500 mg/kg, p.o.)

IV Low dose CCl4 (1ml/kg,i.p.) + VVFE (100 mg/kg, p.o.)

V High dose CCl4 (1ml/kg,i.p.) + VVFE (200 mg/kg, p.o.)

Note: I.P = Intra peritoneal, P.O = Per oral


Effect of plant extract on body and kidney weight:

Carbon tetra chloride treated rats showed significant

(p<0.05) decrease in body and kidney weight compared to

control rats. Pretreatment with test-1, test-2 and standard

significantly (p<0.05) increased body and kidney weights

as compared to carbon tetra chloride treated rats (table 3).

Rifampicin treated rats showed significant (p<0.05)

decrease in body and kidney weight compared to control

rats. Pretreatment with test-1, test-2 and standard

significantly (p<0.05) increased body and kidney weights

as compared to Rifampicin treated rats. (Table.4).

Effect of Plant extract on blood and urine estimations:

Carbon tetra chloride (CCl4) treated rats showed

significant (p<0.05) increase in levels of total Protein,

urea, uric acid and Creatinine in blood and urine as

compared to control rats. Pretreatment with test-1, test-2

and Standard significantly (p<0.05) decreased the elevated

levels of these parameters as compared to CCl4 treated rats

(table.5). Rifampicin treated rats showed significant

(p<0.05) increase in levels of Total Protein, urea, uric acid

and Creatinine in blood and urine as compared to control

rats. Pretreatment with test-1, test-2 and Standard

significantly (p<0.05) decreased the elevated levels of

these parameters as compared to Rifampicin treated rats.

(Table.6).



Table.3.Effect of extract on body and kidney weight (CCl4 induced)

All the values were expressed as Mean ± SEM using one way ANOVA followed by Tukey’s multiple comparison test, where

n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance

Table.4.Effect of extract on body and kidney weight (Rifampicin induced)

Groups Initial body weight

(gm)

Final body weight

(gm)

Change in body

weight (gm)

Kidney weight

(gm)

Normal 180 200 20±0.62 0.815±0.021

Positive Control 210 180 -30±1.02 0.59±0.024

Standard 250 230 -20±1.21 0.86±0.027

Test-1 190 185 -5±0.39 0.62±0.021

Test-2 200 180 -20±0.66 0.75±0.028


n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance

Table.5.Effect of plant extract on blood and urine estimations in Carbon tetra chloride induced nephrotoxic rats

Group

Blood Parameters Urine Parameters

Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine

Control 7.355+0.119 22.89+0.8 2.561+0.133 0.603+0.037 41.8+1 25.253+1.302 3.468+0.052 51.95+0.16

Positive control 19.5+0.086* 52.626+0.958* 7.49+0.109 1.85+0.036* 88.93+1.024* 56.75+2* 10.63+0.089* 2.628+0.045*

Standard 7.74+0.084# 41.5+0.081# 3.12+0.173# 0.3+8.975# 43.51+0.097# 35.611+0.112# 8.34+0.043# 0.675+0.029#

Test 1 9.59+0.082# 34.67+0.89# 50.35+0.038# 0.218+0.011# 62.26+0.099# 40.363+2.127# 4.708+0.035# 0.458+0.108#

Test 2 9.05+0.103# 26.21+1.199# 4.26+0.01# 0.413+0.01# 51.95+0.16# 28.9+2.438# 0.458+0.108# 0.348+0.032#


n=6; *when compared with Control; #-when compared with Positive control; *P<0.05 ; ns-no significance

Table.6.Effect of Plant extract on blood and urine estimations in Rifampicin induced nephrotoxic rats

Group

Blood Parameters Urine Parameters

Total Protein Urea Uric acid Creatinine Total Protein Urea Uric acid Creatinine

Control 7.458+0.076 23.96+1.028 2.302+0.06 0.068+0.038 39.46+1.29 26.132+1.507 3.368+0.541 0.822+0.023

Positive control 18.594+0.180* 51.562+1.18* 7.66+0.076* 1.84+0.043* 90.76+1.196* 62.43+1.467* 10.502+0.12* 2.59+0.056*

Standard 7.22+0.079# 40.23+0.049# 3.007+0.168# 0.284+0.0082# 44.346+0.01# 36.6+0.032# 8.274+0.393# 0.644+0.028#

Test 1 9.93+0.177# 33.4+0.079# 5.32+0.023# 0.504+0.273# 61.63+0.007# 35.54+1.546 4.72+0.027# 0.0386+0.123#

Test 2 8.85+0.032# 25.48+1.468# 4.242+0.003# 0.408+0.127# 51.402+0.008# 26.2+0.222# 4.68+0.02# 0.324+0.029#


n=6; *when compared with Control; #-when compared with Positive control; *P<0.05 ; ns-no significance

Histopathological studies: Histological changes such as

cortical glomerular, peritubular blood vessels congestion,

and interstitial inflammation etc. were observed in the

CCl4 and Rifampicin administered group. Pretreatment

with standard (cystone), low and high dose of Vitis

vinifera extract (VVFE) significantly prevented

histopathological changes towards normal.

Normal Group Positive Control (CCl4)

Groups Initial body

weight (gm)

Final body weight

(gm)

Change in body

weight (gm)

Kidney weight

(gm)

Normal 200 230 +30±1.065 0.95±0.033

Positive Control 210 180 -30±0.866* 0.61±0.029*

Standard 190 180 -10±0.578# 0.72±0.016

#

Test-1 240 210 -30±0.87# 0.82±0.012

#

Test-2 200 190 -10±0.613# 0.79±0.025

#



Standard Group Low dose Extract

High dose extract Control

Positive Control (Rifampicin) Standard

Low dose extract High dose extract

Note: ET: Extended Tubules; BC = Bowmen’s capsule ; DBC = Distanded bowmen’s capsule; V = Vacules; C = Casts

Percentage change in body weight and increased

the levels of serum and urine markers such as Creatinine,

urea, uric acid, and total protein when compared with

control rats. Pretreatment with VVFE in CCl4

administered rats significantly reduced the elevated levels

of serum and urine markers when compared to positive

control group. It indicates protective effect of VVFE

against rifampicin induced nephrotoxicity in rats.

Histological changes such as cortical glomerular,

peritubular blood vessels congestion, and interstitial

inflammation were observed in the CCl4 and rifampicin

administered group. The VVFE pretreated rats

significantly prevented these histological changes, further

indicating their nephroprotective activity. All the

histological changes observed were in correlation with the

physical and biological parameters of the kidney. From

the present study results, it indicates that VVFE has

protective effect against rifampicin and carbon

tetrachloride induced nephrotoxicity in rats individually.



CONCLUSION

In conclusion, Results of the present study suggest

that VVFE provides adequate protection against

rifampicin induced and carbon tetra chloride induced

nephrotoxicity on albino wistar rats as evidenced by

physical, biochemical and histological parameters. The

protective effect of VVFE may be due to its antioxidant

potential. However, further studies are needed to confirm

its clear mechanism of action in nephroprotection and to

characterize the chemical constituents responsible for it.

REFERENCES

Hoitsma AJ., Wetzels JF and Koene RA, Drug induced

nephrotoxicity. Aetiology, clinical features and

management. Drug Saf, 6 (2), 1991, 131-147.

Paller MS, Drug induced nephropathies, Med Clin North

Am, 74 (4), 1990, 909-917.

Porter G. A., Bennett W.M, Nephrotoxic acute renal

failure due to common drugs, American journal of

Physiology, F1-F8, 241(7), 1981, 252-256.

RamyaPydi, IRajalakshmi, S Indumathy, S Kavimani,

Nephroprotective Medicinal Plants - A Review,

International Journal of Universal Pharmacy and Life

Sciences, (2), 2011, 266-281.

Abirami et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


ANALYTICAL METHOD DEVELOPMENT AND VALIDATION OF ESTIMATION

METHOD FOR SOTALOL HYDROCHLORIDE TABLETS BY USING RP-HPLC

G Abirami*, K Anand Kumar, T.Veterichelvan, Arunateja Muvva

Department of Pharmaceutical Analysis, Adhiparasakthi College of Pharmacy, Melmaruvathur, Tamil Nadu, India

*Corresponding author: Email:[email protected], Phone +91- 9444884490

ABSTRACT

The present investigation describes about a simple, economic, selective, accurate, precise Reverse phase

High performance liquid chromatographic method for the estimation of Sotalol Hydrochloride in pharmaceutical

dosage forms. Sotalol Hydrochloride was well eluted using a C18 column of dimension 100 × 4.6, 5µm and

Mobile phase consisting of Acetonitrile: 20 mM Ammonium acetate buffer (pH-6): Methanol in the ratio of

10:75:15 v/v/v at the flow rate 1 ml/min and the detection was carried out at 229 nm with UV detector. The

Retention time for Sotalol Hydrochloride was found to be 3.314. The developed method was validated for

recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully

applied to Sotalol Hydrochloride pharmaceutical dosage form.

KEY WORDS: RP-HPLC, Sotalol Hydrochloride, Accuracy, Precision.

1. INTRODUCTION

Sotalol Hydrochloride ((RS)-N-{4-[1hydroxy2

(propan2ylamino) ethyl] phenyl} methane sulfonamide) is

an antiarrhythmic drug with Class II (beta-adrenoreceptor

blocking) and Class III (cardiac action potential duration

prolongation) properties. Sotalol hydrochloride has both

beta-adreno receptor blocking (Vaughan Williams Class

II) and cardiac action potential duration prolongation

(Vaughan Williams Class III) antiarrhythmic properties.

Sotalol hydrochloride is a racemic mixture of d- and l-

sotalol. Both isomers have similar Class III antiarrhythmic

effects. The chemical structure of Sotalol Hydrochloride

was shown in Fig.1.


have been reported for the analysis of Sotalol

Hydrochloride dosage form which includes UV

spectroscopy, Reverse Phase High performance Liquid

Chromatography methods (Gluth, 1988; Läer, 1996;

Rbeidaa, 2003; Poirier, 1986; Robert, 1991;

Banerjee, 1991). The present study illustrate

development and validation of simple, economical,

selective, accurate, precise RP-HPLC method for the

determination of Sotalol Hydrochloride in Pharmaceutical

dosage form as per ICH guidelines.


economical HPLC method for the analysis of Sotalol

Hydrochloride dosage form using most commonly

employed column (C18) and simple mobile phase

preparation. In the present proposed work a successful

attempt had been made to develop a method for the

estimation of Sotalol Hydrochloride pharmaceutical

dosage form and validate it. From the economical point of

view and for the purpose of routine analysis, it was

decided to develop a more economical RP-HPLC method

with simple mobile phase preparation for the estimation of

Sotalol Hydrochloride dosage form. Thus, the paper

reports an economical, simple and accurate RP-HPLC

method for the above said pharmaceutical dosage form.


Quantitative HPLC was performed on a Shimadzu

HPLC system connected with UV Detector. The drug

analysis data were acquired and processed using Lab

Solutions software running under Windows XP and C18

column of dimension 100 × 4.6, 5µm particle size. In

addition to an analytical balance (Shimadzu AUX- 220),

digital pH meter, a sonicator (Soltec - Sonica Ultrasonic

Cleaner - Model 2200 MH) was used in this study.


Sotalol Hydrochloride was kindly supplied as a gift

sample by KOCH Laboratories, Vijayawada, India.

Methanol, Acetonitrile and water of HPLC grade were

purchased from Qualigens India Pvt. Limited, Mumbai.

Ammonium acetate was analytical reagent grade supplied

by Fischer Scientific Chemicals. Sotalol Hydrochloride

Tablets available in the market as SOTALAR 40 which

contains 40 mg of Sotalol Hydrochloride.

Preparation of mobile phase: 1.5416 gm of Ammonium

acetate was accurately weighed and dissolved in sufficient

quantity of water and made up to 1000 mL with the same

to get 20 mM Ammonium acetate buffer (pH-6) and

filtered through 0.45µ membrane filter. Mobile phase is

prepared by mixing Methanol: Acetonitrile: 20 mM

Ammonium acetate buffer (pH-6) (15: 10:75) v/v/v and

degassed by sonication.

Standard stock solution preparation: Weighed

accurately about 10 mg of Sotalol hydrochloride working

standard and transferred into a 25 mL volumetric flask.

Added about 15 mL water to dissolve it completely and

made up to the volume with the same. Further 2.5 mL of

this solution was diluted to 25 mL with mobile phase.



Preparation of Calibration graph: In this progression,

the aliquots of stock solution of Sotalol hydrochloride (1

to 6 mL) individually were transferred into a series of six

10 mL volumetric flasks and made up to the mark with

mobile phase. The solutions contain the concentrations of

4-24 µg/mL. All the solutions were injected and the

chromatograms were recorded at 229 nm. The above

concentration range was found to be linear and obeys

Beer’s law. The procedure was repeated for three times.

The peak areas were plotted against concentration and the

calibration curve was constructed.

Quantification of formulation: Estimation of Sotalol

hydrochloride in tablet formulation by RP – HPLC was

carried out using optimized chromatographic conditions.

Ten tablets of formulation (SOTALAR 40) were weighed

accurately. The average weight of tablets was found and

powdered. The tablet powder equivalent to 60 mg of

Sotalol hydrochloride was weighed and transferred into

100 mL volumetric flask and added about 80 mL of water

to dissolve the substance and made up to the volume with

the same (600 g/mL). The solution was sonicated for 15

minutes, centrifuged at 200 rpm for 15 minutes and

filtered through Whatmann filter paper No. 41. From the

clear solution, further dilutions were made by diluting 2.5

mL into 25 mL with mobile phase. Further 2 mL of this

solution is diluted to 10 mL with mobile phase to obtain

the expected concentration of 12 g/mL solution. A

steady base line was recorded with optimized

chromatographic conditions. After the stabilization of base

line for 30 minutes, the test solutions were injected and

recorded the chromatograms. The concentration of each

test solution was determined by using slope and intercept

values from the calibration graph.

Recovery studies

Preparation of raw material stock solution: 240 mg of

Sotalol hydrochloride was accurately Weighed and

transferred in to a 10 mL volumetric flask, dissolved in

water and made up to the mark with water to get a

concentration of 24 mg/mL of Sotalol hydrochloride

Recovery procedure: To determine the accuracy of the

method, recovery study was performed by standard

addition method. The recovery experiment was done by

adding known concentrations of Sotalol hydrochloride

working standard to the pre analyzed formulations. To the

50% of pre-analysed formulation solution, known

quantities of standard drug that is 80, 100, and 120 % of

quantification concentration (2 mL, 2.5 mL and 3 mL of

Sotalol hydrochloride raw material stock solution) were

added into a series of 100 mL volumetric flasks, diluted

with water and sonicated for 15 minutes. After sonication

the solution was made up to 100 mL with water. The

solutions were filtered through Whatmann filter paper No.

41. From each solution, 1 mL of clear filtrate was

transferred into a series of 50 mL volumetric flasks and

made up to the volume with mobile phase. The solutions

were injected and the chromatograms were recorded. The

quantity of drug recovered was calculated by using slope

and intercept values from the calibration graph. The

procedure was repeated for three times for each

concentration.

System suitability studies: The system suitability studies

conceded as per ICH guidelines and USP. The parameters

like capacity factor, tailing factor, asymmetry factor, and

number of theoretical plates were calculated.

Validation of Developed Method:

Linearity: A calibration curve was plotted with

concentration versus the peak area. The linearity range

was checked for in the concentration range of 4 - 24

µg/mL of Sotalol hydrochloride. The drug was found to be

linear in the specified concentration range.

Precision: The repeatability of the method was checked

by repeated analysis of the formulation for six times with

the same concentration. The amount of drug present in the

formulation was calculated. The percentage RSD value

was calculated.

Accuracy: Accuracy of the method was confirmed by

recovery studies. To the pre-analyzed formulation a

known quantity of the standard drug solution was added

and the amount of drug recovered was calculated. The

percentage RSD value was calculated.

LOD and LOQ: The linearity study was carried out for

three times. The LOD and LOQ were calculated based up

on the calibration curve method. The LOD and LOQ were

calculated using the average of slope and intercept.

Figure.1.Chemical Structure of Sotalol Hydrochloride





the determination of Sotalol Hydrochloride. Preliminary

experiments were carried out to achieve the best

chromatographic conditions for the determination of the

drug substance. C18 column with a 4.6 mm inner diameter

and 5µm particle size was chosen. The detection wave

length was selected as 229 nm with UV detector.

Chromatographic conditions were optimized by changing

the mobile phase composition and buffers used in mobile

phase. Different experiments were performed to optimize

the mobile phase but adequate elution of the drug could

not be achieved. By altering the pH of buffer results a

good elution. Different proportions of solvents were

tested. Eventually the best elution was obtained by the

isocratic elution system using a mixture of Methanol:

Acetonitrile: 20 mM Ammonium acetate buffer (pH-6) in

the proportion of 15: 10:75 v/v/v at a flow rate of 1

ml/min. Under these conditions Sotalol Hydrochloride

was eluted at 3.314 minutes with a run time of 7 minutes.

The representative chromatogram of this estimation was

shown in Fig. 2.

The Methanol: Acetonitrile: 20 mM Ammonium

acetate buffer (pH-6) in the proportion of 15: 10:75 v/v/v

was chosen as the mobile phase. The run time of the

HPLC procedure was 7 minutes at flow rate of 1ml/min

was optimized which gave sharp peak, minimum tailing

factor. The system suitability parameters were shown in

Table 1 were in within limit, hence it was concluded that

the system was suitable to perform the assay. The method

shows linearity between the concentration ranges of 4-24

µg/ml. The experimental results were shown in Table 2

and Fig.4. The precision of the method was confirmed by

repeatability of the formulation. The percentage purity of

Sotalol hydrochloride present in formulation was found to

be 99.3314 % ± 1.0697. The % RSD value was found to

be 1.0769. It indicates that the method has good precision.

The values are shown in Table 3 and Fig.3. The %

recovery of Sotalol Hydrochloride was found to be in the

range of 100.131 – 101.696 and the recovery data was

shown in Table 4. As there was no interference due to

excipients and mobile phase, the method was found to be

specific.

Table.1.System suitability parameters for proposed method

Parameter Sotalol Hydrochloride Standard limit

Retention time 3.314 -

Tailing Factor 1.39 <2

Asymmetrical Factor 1.51 <2

Theoretical Plates 2533 >2000

Table.2: Optical characteristics of Sotalol Hydrochloride

Parameters Sotalol Hydrochloride

Beers law limit (μg/mL) 4 – 24

Correlation Coefficient (r) 0.99902

Regression Equation (y=mx+c) y=3652.6339x + 900.3928

Slope (m) 3652.6339

Intercept (c) 900.3928

LOD (μg/mL) 0.164485

LOQ (μg/mL) 0.498439

Standard Error 1524.76594

Table.3: Results of Precision study

Labelled amount

(mg/tab)

Amount

found(mg)

%

Obtained

Average*

S.D %RSD SE

40 39.8511 99.6277 99.3314 1.0697 1.0769 0.0297

40 40.5202 101.3005

40 39.6941 99.2352

40 39.3301 98.3252

40 39.4315 98.5787

40 39.5685 98.9212



Table.4.Recovery data of Sotalol Hydrochloride Drug % Level Amount

present

(µg/mL)

Amount

added

(µg/mL)

Amount

estimated

(µg/mL)*

Amount

recovered

(µg/mL)*

%

Recovery

Average(%)

±S.D

%

R.S.D

S.E

Sotolol 80 11.9197 9.6 21.5870 9.6673 100.1010 100.396

±

1.1693

1.1647 0.1299

11.9197 9.6 21.4337 9.514 99.1041

11.9197 9.6 21.6574 9.7327 101.3822

100 11.9197 12 23.9450 12.0253 100.2108 100.131

±

0.8116

0.8106

0.0901

11.9197 12 23.8336 11.9139 99.2885

11.9197 12 24.0277 12.108 100.9

120 11.9197 14.4 26.6987 14.779 102.6319 101.696

±

0.8172

0.8036

0.0908

11.9197 14.4 26.4818 14.5621 101.1256

11.9197 14.4 26.5111 14.5914 101.3291

Fig.2: Optimized chromatogram of Sotalol Hydrochloride

Fig.3: Chromatogram of Sotalol Hydrochloride in marketed formulation

Fig.4.Linearity of Sotalol Hydrochloride

0

16844

30851

44874

57897

72237

90421

0

20000

40000

60000

80000

100000

0 5 10 15 20 25 30

PE

AK

AR

EA

CONCENTRATION [µg/mL]

SOTALOL HYDROCHLORIDE LINEARITY



4. CONCLUSION


developed for the Quantitative and Qualitative

determination of Sotalol Hydrochloride in tablet dosage

form. The method was completely validated shows

satisfactory results for all the method validation









be suitable for the routine analysis of Sotalol

Hydrochloride Pharmaceutical formulations.

ACKNOWLEDGEMENT

The authors wish to thank Sakthi Arul Thiru

Amma and Thirumathi Amma ACMEC Trust,

Melmaruvathur for providing facilities to do the work in

successful manner. The authors would like to thank

KOCH Laboratories, Vijayawada for providing samples

for completing this project work successfully.

REFERENCES

Anonymous, http://en.wikipedia.org/wiki/Sotalol

Anonymous, http://www.drugs.com/pro/sotalol.html

Anonymous, The Merck Index, An Encyclopedia of

Chemicals, Drugs and Biologicals, 14th Edition, Merck

Research Laboratories, a division of Merck and Co. Inc.,

NJ, USA, 2006, 8725.

Boutagy J, Shenfield GM, Simplified procedure for the

determination of sotalol in plasma by high-performance

liquid chromatography, J Chromatogr, 565(1-2), 1991,

523-8.

Clarkes Analysis of Drugs and Poisons (in

Pharmaceutical, body fluids and postmortem material),

Third Edition, 2004, 1565.

Code Q2A, Text on Validation of Analytical Procedures,

ICH Harmonized Tripartite Guidelines, Geneva,

Switzerland, and 27th October, 1-5, 1994.

Code Q2B, Validation of Analytical Procedures and

Methodology, ICH Harmonized Tripartite Guidelines,

Geneva, Switzerland, 1-8, 1996.

Dogrukol D, Dal AG, Tunçel M, Determination of Sotalol

in Tablets and Serum by CZE, Chromatographia, 66(1),

2007, 159-163.

Gluth WP, Sörgel F, Gluth B, Braun J, Geldmacher-von

Mallinckrodt M. Determination of Sotalol in human body

fluids for pharmacokinetic and toxicokinetic studies using

high-performance liquid chromatography,

Arzneimittelforschung, 38(3), 1988, 408-11.

Läer S, Neumann J, Scholz H, Uebeler P, Zimmermann

N.Determination of Sotalol in human cardiac tissue by

high-performance liquid chromatography, J Chromatogr B

Biomed Appl, 681(2), 1996, 291-8.

Lloyd R Snyder, Practical HPLC Method Development,

2nd

edition, John Wiley and sons, New York, 180-182,

1997.

Poirier JM, Jaillon P, Cheymol G.Quantitative liquid

chromatographic determination of Sotalol in human

plasma, Ther Drug Monit, 8(4), 1986, 474-7.

Rbeidaa O, Christiaensa B, Chiapa P, Huberta Ph, Lubdab

D, Boosc K S, Crommena J, Fully automated LC method

for the determination of sotalol in human plasma using

restricted access material with cation exchange properties

for sample clean-up, Journal of Pharmaceutical and

Biomedical Analysis, 32(4–5), 2003, 829–838.

Robert A. Carr, Robert T. Foster, Nadeem H. Bhanji.

Stereospecific High-Performance Liquid Chromatographic

Assay of Sotalol in Plasma, Pharmaceutical Research,

8(9), 1991, 1195-1198

Shimadzu Instruction Manual AX-200 Digital balance,

Shimadzu Corporation, Kyoto, Japan, 42, 2001.

Shimadzu LC-10 ATVP High Performance Liquid

Chromatography Instruction Manual, Shimadzu

Corporation, Kyoto, Japan, 11-2, 2001.

Shimadzu SPD-10 ATVP High Performance Liquid

Chromatography Instruction Manual, Shimadzu

Corporation, Kyoto, Japan, 11-2, 2001.

SK Banerjee, R Mashru. A rapid colorimetric

determination of Sotalol-hydrochloride in bulk and dosage

form, Indian journal of pharmaceutical sciences, 53(6),

1991, 243-244.

Zarghi A, Foroutan SM, Shafaati A, Khoddam

A.Development an ion-pair liquid chromatographic

method for determination of Sotalol in plasma using a

monolithic column, J Pharm Biomed Anal, 41(4), 2006,

1433-7.

Durga Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


A STUDY ON ROLE OF DEMOGRAPHIC FACTORS IN SMALL INVESTORS’

SAVINGS IN STOCK MARKET Durga Rao P V

*1, Chalam G V

1 and Murty T N

2

1. Dept. of Commerce & Business Admn., Acharya Nagarjuna University, Guntur, India

2. Nimra College of Business Management, Vijayawada, India

*Corresponding Author: E Mail:[email protected]

ABSTRACT

Stock market helps to channelize household savings to the corporate sector which in turn utilize for the

development of industrial and service sector. An equity share is a part of the ownership capital of a company and

the holder of such a share is a member of the company eligible to share many benefits of the company. One

invests in shares keeps it for some time depending upon the stock price. When the rate of share price increases,

the investor sells the securities to another party. Investment in shares will fetch better returns compared to any

other forms of investment. Whenever the inflation rate is high, the stock market has given higher rates of return

to the investors.

Key Words: Investment, Share, Securities, Demography

1. INTRODUCTION

Stock market helps to channelize household

savings (Retail) to the corporate sector which in turn

utilize for the development of industrial and service

sector. An equity share is a part of the ownership capital

of a company and the holder of such a share is a member

of the company eligible to share many benefits for the

company. Share trading helps the corporate to raise

additional funds for expansion by creating demand for the

securities. The liquidity that an exchange provides gives

the investors the ability to quick and easy selling of

securities. This is an attractive feature of stock market

investment. Stock trading is done only though brokers.

Demographic factors influencing in small Investors’

investment in stock market are Residence, Age, Sex,

Marital status, Education, Occupation, Family Size,

Earning members in the Family, Family Income, Type of

Investor, and Category of Investor.

The objectives of the present study are to study

the demographic factors of the respondents, to identify the

investment pattern of small investors based on

demographic factors and to make valuable suggestions to

the small investors in stock market.

MATERIALS AND METHODS The study is on primary and secondary data. The

primary data relating to the retail equity investors were

collected by interviewing the equity investors

(respondents are 500) with the help of the interview

schedule. The secondary data relating to the study like the

capital market developments and the trends in retail

investor participation in India were obtained from various

published and unpublished records, annual reports,

manuals, bulletins, booklets, journals, magazines, etc.,


Investment objectives of the retail equity investors

based on the following Demographic variables: Place of

Residence, Age, Gender, Marital Status, Educational

Level, Occupation, Family Size, No. of Earning Members

in the Family, Monthly Family Income, Type of Investor,

Category of Investor, Type of Market Operated and

Market Experience.

Residence: Investors’ place of residence has been broadly

classified into eight categories such as Guntur town,

Tenali, Narasaraopet, Piduguralla, Ponnur, Sattenapalli,

Repalle and Guntur and Tenali Rural. Out of 500 sample

investors 60% (300) are from Guntur town, 8% (40) are

from Narasaraopet, 9% (45) are from Piduguralla, 12%

(60) are from Tenali, 2% (10) are from Ponnur, 5% (25)

are from Sattenapalli, 2% (10) are from Repalle and 2%

(10) are from Tenali and Guntur rural.

Age: Investors have been divided into three categories

based on their age as ‘Young’ (20 – 40 years), ‘Middle

aged’ (40 – 60 years) and ‘Old’ (60 years and above). Out

of 500 sample investors, 70% (350) are Young investors,

25% (125) are Middle aged investors and 5% (25) are Old

investors.

Sex: Investors have been divided into two groups based on

their gender as ‘Male’ and ‘Female’. Out of 500 sample

investors, 85% (425) are Male investors and 15% (75) are

Female investors.

Marital Status: Investors have been placed into two

groups based on their marital status as ‘Married’ and

‘Unmarried’. Out of 500 sample investors 70% (350) are

Married investors and 30% (150) are Unmarried investors.

Education: Investors have been classified into four

categories based on their educational level as ‘School

Education’, ‘College Education’, ‘Professionals’ and

‘Others’. Out of 500 sample investors, 10% (50) are

investors with School education, 60% (300) are investors



with College education, 27% (135) are investors with

Professional education and 3% (15) investors belong to

the others category.

Occupation: Investors have been divided into four groups

based on their occupation as ‘Salaried’, ‘Professionals’,

‘Business’ and ‘Others’. Out of 500 sample investors,

50% (250) belong to the Salaried category, 12% (60)

belong to the Professional category, 35% (175) of the

investors are Businessmen and 3% (15) belong to the

Others category.

Family Size: Investors have been classified into three

categories based on their family size as ‘Small’ (less than

4 members), ‘Medium’ (4 – 6 members) and ‘Huge’ (6 &

above members). Out of 500 sample investors, 52% (260)

belong to Small family, 44% (220) belong to Medium

family and 4% (20) belong to Huge family.

Earning Members in the family: Investors have been

classified into three categories based on the number. of

earning members in their family as ‘1’, ‘2’, and ‘3’ &

above’. Out of 500 sample investors, 34% (170) investors

have 1 earning member in their family, 55% (275)

investors have 2 earning members in their family and 11%

(55) investors have 3 & above earning members in their

family.

Family Income: Investors have been classified into three

categories based on their monthly family income as ‘Low’

(below Rs20,000), ‘Medium’ (Rs.20,000 – Rs.40,000) and

‘High’ (Rs.40,000 and above). Out of 500 sample

investors, 45% (225) have Low monthly family income,

41% (205) Medium family income and 14% (70) have

High family income.

Type of Investor: Investors have been classified into two

types based on their nature as ‘Hereditary Investor’ and

‘New Generation Investor’. Out of 500 sample investors,

20% (100) are Hereditary investors and 80% (400) are

New generation investors.

Category of Investor: Investors have been classified into

three categories based on their period of holding stock as

‘Long-term investor’, ‘Day trader’ and ‘Both’. Out of 500

sample investors 45% (225) are Long-term investors,11%

(55) are Day traders and 44% (220) are both long-term

investors as well as day traders.

Type of Market Operated: Investors have been divided

into three groups based on the type of market operated by

them as operators in ‘Primary market’, ‘Secondary

market’ and ‘Both’. Out of 500 sample investors, 12%

(60) deal in Primary market alone, 50% (250) deal in

Secondary market alone and 38% (190) deal in both

primary and secondary markets.

Market Experience: Investors have been classified into

three categories based on their market experience as

‘Low’ (less than 1 year) ‘Moderate’ (1 – 3 years) and

‘High’ (3 years and above). Out of 500 sample investors,

20% (100) have Low market experience, 30% (150) have

Moderate market experience and 50% (250) have High

market experience.

Findings: Guntur town people are participating 60%

(300) and more in the share investment. Young people are

investing more than 70% (350) in shares as they may take

risk. Men are participating about 85% (425). Men are

more than women as retail investors. Married and college

education level people participating more in this

investment. Salaried, small size family people are

participating more. New Generation investors and low

level income people are participating more. Long term

investors are more and investing more in secondary

market. High experience i.e. 3 years and above investment

experience people are more than others.

Suggestions: It is suggested that it is better to bring

the government or regulatory bodies like SEBI to create

a lot of awareness and encourage in retail investors in

equities to become greater part of development of

economic system for making investment on long term

basis.

Social Relevance: Society consists of several groups of

people with different demographic factors, understanding

their investment influencing factors based on socio

economic factors may help serve the better to the society

through proper investment procedure.

Scope for further Research: The Present study is

confined to Guntur District only; there is scope for further

research in other districts in Andhra Pradesh and different

areas in financial management.

CONCLUSION

The bitter experiences are facing participants from

the Indian Capital market due to the dramatic change in

the attitude of the investor. The investor can make the

share trading as a beneficial investment area. It is purely

based upon the investor’s awareness towards share

trading. When the investor gets more and more accurate

information on the right time, then he/she can enjoy the

taste of success from the share trading. The authorities

should implement more training and awareness

programmes for the investors.

REFERENCES

Gupta L.C, Geographic Distribution of Equity and Bond

Ownership, Fortune India, 5(9), 1987, 9-11.

Jawaharlal, Understanding Indian Investors, Global

Business Press, 1992, New Delhi



Radha V, A study on investment behaviour of investors in

corporate securities, Doctoral Dissertation at Allgappa

University, 1995.

Gupta. L.C, What Ails the Indian Capital Markets?

Economic and Political Weekly, 32(29), 1998, 1961 –

1966.

Panda K, Tapan NP and Tripathi, Recent Trends in

Marketing of Public Issues: An Empirical Study of

Investors Perception, Journal of Applied Finance, 7(1),

2007, 1-6

Santi Swarup K, Role of Mutual Funds in Developing

Investor confidence in Indian Capital Markets, Sajosps,

2(2), 2008, 58-60.

Narayan and Chandrashekar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


MORBIDITY PATTERN AMONG THE ELDERLY POPULATION IN A SOUTH

INDIAN TERTIARY CARE INSTITUTION: ANALYSIS OF A RETROSPECTIVE

STUDY Narayan V

1, Chandrashekar R*

2

1. Department of Community Medicine, Father Muller Medical College, Kankanady, Mangalore,India

2. Department of Pharmacology, Yenepoya Medical College, Yenepoya University, Deralakatte, Mangalore, India.

*Corresponding author: Email: [email protected], Ph. No. +919483787982

ABSTRACT A retrospective study of the morbidity profiles among the elderly and an assessment of the related factors are

required to plan an appropriate geriatric health care service. The present study also sought to determine the

relationships between morbidity and socio-demographic and health characteristics in Yenepoya Hospital,

Derlakatte, Mangalore, India. A hospital based retrospective study was undertaken between January to April

2009. The total number of admissions between January to April 2009 was 1307. Mean age of geriatric patients

during study period was 67 years and maximum age of patient admitted was 90 years. Out of them 332 were of

age 60 years and above. More number of males (65.9%) was admitted when compared to the females (34.1%).

Religion wise distribution showed that majority of the elderly admitted to the hospital belonged to the Muslim

religion (66.5%). Religion sex distribution of the geriatric patients showed that (Table 3 & Figure 3) there were

(11.0%) females and (9.2%) males belongs to Christian religion. Among Hindus about (28.8%) were females and

(21.1%) were males. Among Muslims about (60.2%) were females and 159 (69.7%) were males. Average number

of illnesses per person was 1.32. Majority of the elderly patients suffered from chronic obstructive pulmonary

disease (COPD) (20.72%), Ischaemic heart disease IHD (19.6%), cataract & diminished vision (13.9%), arthritis

(6.2%), diabetes mellitus (4.32%), cancer (3.2%), hemiplegia (3%) & a host of miscellaneous diseases (29.15%).

Highest number of cases (20.72%) were of COPD. More number of males (23.2%) suffered from COPD when

compared to the females (11.9%).

KEYWORDS: Geriatrics, Morbidity Profile

INTRODUCTION

The two extremes of life child and elderly always

need a special care. Elderly life is full of problems

concerned to physical, social and economic. Usually

ageing of the population is essentially a simple

phenomenon and its consequences are multiple and not

always well recognized. According to famous quote by Sir

James Sterling Ross- “You do not heal old age, you

protect it, you promote it, you extend it” (Pathak, 1975).

The elderly are afflicted by the process of ageing which

causes a general decline in health.

Certain diseases are more frequently seen among

elderly population than that of the young generations like

degeneration diseases of heart and blood vessels, cancer,

accidents, diabetes, diseases of locomotor system,

respiratory illness, genito-urinary tract diseases. Even

though in India the percentage of aged persons to the total

population is low; nevertheless, the absolute size of the

aged population is considerate. Elderly population with

disability resulting from chronic diseases appears to be at

a high risk of acute illness and injuries although Primary

Health Centers (PHCs) along with their sub- centres are

distributed all over the country. They are not able to avail

complete facilities at the PHC or its sub-centres owing to

lack of transport, geographical distance, or physical

disabilities or for want of funds and physical help for

travel. Always there is a ample of scope for research into

the degeneration and other diseases of elderly and their

treatment in hospital and general practice and family into

preventive geriatrics and the epidemiology affecting the

elderly (Jadhav, 2012).

MATERIAL AND METHODS

A hospital based retrospective study was

undertaken between January to April 2009. The total

number of admissions between Januarys to April 2009

was 1307. Mean age of geriatric patients during study

period was 67 years and maximum age of patient admitted

was 90 years. Out of them 332(25.40%) were of age 60

years and above.

RESULTS AND DISCUSSION Religion wise distribution: Data was analyzed to know

religion wise distribution concerned to morbidity profile.

Religion wise distribution (Table 1 & Figure) showed that

majority of the elderly admitted to the hospital belonged

to the Muslim religion 346 (66.5%).

Sex wise distribution: Data was analyzed to know sex

wise distribution concerned to morbidity profile. Sex wise

distribution (Table 2) showed that number of males 228

(65.9%) was more admitted to hospital when compared to

the females 118 (34.1%).

Religion wise sex distribution: Religion sex distribution

of the geriatric patients showed that (Table 3 & Figure 3)

[email protected]



there were 13(11.0%) females and 21(9.2%0 males

belongs to Christian religion. 34 (28.8%) females and 48

(21.1%) males belongs to Hindu religion. 71 (60.2%)

females and 159 (69.7%) males belongs to Muslim

religion.

Distribution of aged persons according to different

morbidity & icd-10 classification (WHO, 1992):

Majority of the elderly patients (Table 4 & Figure 4)

suffered from COPD 91 (20.72%), IHD 86 (19.6%),

cataract & diminished vision 6 (13.9%), arthritis 27

(6.2%), diabetes mellitus 19 (4.32%), cancer 14 (3.2%),

hemiplegia 13 (3%) & a host of miscellaneous diseases

128 (29.15%). Highest number of cases 91 (20.72%) was

chronic obstructive pulmonary disease (COPD). More

number of males 53 (23.2%) suffered from COPD when

compared to the females 14 (11.9%).

According to WHO, the geriatric population of 65

years and above should be considered (WHO, 1995). But

we have considered the age group of 60 and above years

according to Indian scenario. A study carried out in

Southern part of India reported results that show a

prevalence of 82.9% in the age group of 60 years and

above5. In India, over the past few decades the proportion

of 60 years and above has grown up to 7.8 % according to

recent census from Govt of India. The contribution of

elderly population to demographic figures is increasing

day by day. Increasing problems of healthcare,

psychosocial, personal and socio-economic factors

associated with the elderly further overwhelm this. The

present study also sought to determine the relationships

between morbidity and socio-demographic and health

characteristics.

It was observed that average number of illness per person

was 1.32. Other studies among elderly in South and North

India reported it as 2.426 and 2.62

6 respectively. Religion

wise distribution showed that there were more Muslims

(66.5%) when compared to Hindus (23.7%) and Christians

(9.8%). Religion wise sex distribution of the geriatric

patients showed that (Table 3 & Figure 3) there were

(11.0%) females and (9.2%) males belongs to Christian

religion. Among Hindus, about (28.8%) were females and

(21.1%) were males and among Muslims, about (60.2%)

were females and 159 (69.7%) were males (Table 3 &

Figure 3).

In our study we found that majority of the elderly

patients (Table 4 & Figure 4) suffered from COPD 91

(20.72%), IHD 86 (19.6%), cataract & diminished vision 6

(13.9%), arthritis 27 (6.2%), diabetes mellitus 19 (4.32%),

cancer 14 (3.2%), hemiplegia 13 (3%) & a host of

miscellaneous diseases 128 (29.15%). Highest number of

cases 91 (20.72%) was chronic obstructive pulmonary

disease (COPD). More number of males 53 (23.2%)

suffered from COPD when compared to the females 14

(11.9%).

Table.1.Religion wise Distribution Table.2.Sex wise Distribution Religion Frequency Percent

Christian 34 9.8

Hindu 82 23.7

Muslim 230 66.5

Total 346 100.0

Gender Frequency Percent

Female 118 34.1

Male 228 65.9

Total 346 100.0

Table.3.Religion wise Sex Distribution

Religion Sex (%Count within Sex)

Total Female Male

Christian 13(11.0%) 21(9.2%) 34(9.8%)

Hindu 34 (28.8%) 48(21.1%) 82(23.7%)

Muslim 71(60.2%) 159 (69.7%) 230(66.5%)

Table.4.Distribution of aged persons according to different morbidity & ICD-10 classification

Disease ICD-10 Frequency Percent

COPD J44.9 91 20.72

IHD 120-125 86 19.6

Cataract & diminished H 26.9 61 13.9

Arthritis M 13.9 27 6.2

Diabetes E 14 19 4.32

Cancer C 80 14 3.2

Hemiplegia G81.9 13 3.0

Miscellaneous 128 29.15



Figure.1.Religion wise distribution Figure.2.Sex wise Distribution

Figure.3.Religion wise Sex Distribution

Figure.4.Distribution of aged persons according to different morbidity & ICD-10 classification

0

10

20

30

40

50

60

70

CHRISTIAN HINDU MUSLIM

0

5

10

15

20

25

30

35

Hemiplegia Cancer Diabetes Arthritis Cataract & Diminished

vision

IHD COPD Others



CONCLUSION

There is a growing need for interventions to

ensure the health of this vulnerable group & to create a

policy to meet the care & needs of the disabled elderly.

Further research, especially qualitative research, is needed

to explore the depth of the problems of the elderly.

ACKNOWLEDGEMENT

The author is thankful to Dr. Radha Y Aras, HOD,

Department of Community Medicine, Yenepoya Medical

College, Yenepoya Univeresity, Mangalore, for providing

support and Medical Record Department, Yenepoya

Medical College, Yenepoya Univeresity, Mangalore for

providing the necessary data for doing this study.

REFERENCES

Jadhav V.S, Mundada V.D, Gaikwad A.V, Doibale

M.K, Kulkani A.P.A Study Of Morbidity Profile Of

Geriatric Population In The Field Practice Area Of

Rural Health Training Centre, Paithan Of Govt.

Medical College, Aurangabad, IOSR Journal of

Pharmacy, 2(2), 2012, 184-188.

Niranjan GV, Vasundhra MK, A study of health status of

aged persons in slums of urban field practice area,

Bangalore, Indian J Com Med, 21, 1996, 1-4.

Padda AS, Mohan V, Singh J, Health profile of aged

persons in urban and rural field practice area of medical

college Amritsar, Indian J Com Med, 23, 1998, 72-76.

Pathak JD, Inquiry into Disorders of the Old, Ind Jour

of Community Med, 1-54, 1975.

WHO, Epidemiology and prevention of cardiovascular

diseases in elderly people, Technical report series, 1995,

853, 5, 2-3,21.

World Health Organisation, ICD-10 Classifications

of Mental and Behavioural Disorder: Clinical

Descriptions and Diagnostic Guidelines. Geneva,

World Health Organisation, 1992.

Rajkumar et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


TESTICULAR GENE EXPRESSION PROFILING OF PHENYTOIN TREATED

ALBINO RATS USING cDNA MICROARRAY Rajkumar R

1*, Vathsala Venkatesan

2, Sriram Thanigai

3

1. Research Scholar, Bharath University,Chennai-600073

2. Department of Anatomy, Sri Balaji Medical College &Hospitals, Chennai- 600044.

3. Department of Orthopedics, SRM.Medical college, and Research Centre Kattankulathur 603203.

* Corresponding Author E-mail: [email protected]

ABSTRACT

To propose Testicular gene expression profiling of phenytoin treated albino rats using cDNA microarray

analysis. Phenytoin is a commonly used antiepileptic. Phenytoin controls the abnormal brain activity observed in

seizure by decreasing electrical conductance among brain cells by stabilizing the inactive state of voltage-gated

sodium channels. Phenytoin may alter the secretion and functions of different hormones which may attribute to

sexual dysfunction In order to evaluate the effects of phenytoin on the reproductive system of rats at molecular

level in detail, cDNA microarray analysis was used in which about 44000 genes of test and control samples were

analysed for differential regulation by comparing test with control samples. In this study, the albino rats were

divided into two groups, control and test. The test group was given 120mgs/kg /body weight of phenytoin orally

and equal amount of normal saline was given for the control group. After 45 days with the rat under deep

anaesthesia, the testis were removed from the scrotum and stored in liquid nitrogen. The stored specimens of testis

of control and tests group were subjected to cDNA microarray analysis and also small quantity of the tissue was

subjected for Histopathological examination. This study showed the differential expression of genes in test group

when compared with the control group. Out of 44000 genes analysed, 2273 were up regulated and 4430 genes

were down regulated and further gene cluster analysis was performed to identify testis specific differentially

regulated genes and the histopathological examination also revealed histopathological changes in the Test group.

Key words: Testicular gene expression, Phenytoin, DNA probe, Microarray

INTRODUCTION

Phenytoin is an antiepileptic drug. It is useful to

treat partial seizures and generalized tonic-clonic seizures

but not primary generalized seizures such as absence

seizures or myoclonic seizures. Phenytoin can reduce

sexual interest and impair the quality of sexual

experiences. In fact, in a recent study, researchers found

that phenytoin can decrease testosterone levels in men,

which in turn can diminish libido (sexual drive) and may

impair sexual function.

DNA Probe: DNA microarray are very useful to study the

expression of large number of genes simultaneously in an

organism It is a particular series of small spots fixed on a

solid surface to detect and screen mRNAs and genomic

DNAs in samples. In one chip about 4x44000 probes are

fixed in an area of 12 cm2. Therefore DNA chips can be

used to detect around 44000 genes of four different

samples. The probe DNAs are isolated separately from

open reading frames (orfs) of the genome. They are

amplified by PCR technique. All these DNA probes are

filled in separate test tubes and the tubes are kept in a

proper order. The duplex DNAs are denatured into single

strands by alkali treatment. The solid surface of glass slide

is coated with polyacrylamide. The DNA probes are then

spotted as small dots on the solid surface with the help of

a robot arm called Microarrayer. The glass slide thus

prepared is called microarray. The objective of the study

to explore Testicular Gene Expression Profile of

phenytoin treated albino rats using cDNA microarray.


Animal treatment and sample collection: Male adult

albino rats were segregated into control and test groups.

The test groups were treated with phenytoin 120mgs/kg

body weight/day orally for 45 days similarly control

groups were given equal amount of normal saline. In life

study protocols, including animal housing, dosage,

sacrifice and tissue harvesting were as per IAEC

guidelines. After 45 days the tissue samples from test and

control were collected in Rnase free tubes and snap

frozen in liquid nitrogen .Frozen tissues were stored in

RNA later solution at-70 c until processed for RNA

extraction. RNAlater® solution is an aqueous, nontoxic

tissue storage reagent that rapidly permeates tissues to

stabilize and protect cellular RNA. RNAlater® solution

minimises the need to immediately process tissue samples

or to freeze samples in liquid nitrogen for later processing.

Tissue pieces can be harvested and submerged in

RNAlater® solution for storage without damaging the

quality or quantity of RNA obtained after subsequent

RNA isolation and also small quantity of the tissue was

subjected for Histopathological examination.

RNA isolation and DNA microarray hybridization and

analysis:

http://en.wikipedia.org/wiki/Antiepileptic

https://en.wikipedia.org/wiki/Antiepileptic



RNA Isolation, cDNA Synthesis and Fluorescent Dye

Tagging: RNA was extracted from the testis by Trizol

method preserved in RNA later solution and checked for

purity and concentration using spectrophotometer. In

order to determine gene expression profiles associated

with phenytoin exposure, testis total RNA have been

pooled following the specified dose and period of

phenytoin exposure. To reduce variability in the level of

gene expressions of control and test groups have been

pooled and used for hybridizations. The mRNA isolated

from test and control samples were converted cDNAs by

reverse PCR separately. The cDNAs of control samples

were labeled with green fluorescent dye (CY3) and the

cDNAs of test samples were labeled with red fluorescent

dye (CY5).These two preparations were mixed together

before hybridization

Microarray Hybridization: Hybridisation performed in a

device called hybridization cassette.A hybridization buffer

is poured in

C over

night to establish hybridization. The fluorescent

complementary strands in the sample underwent base

pairing with probe DNAs to form duplex DNA which are

called Hybrid DNAs. These Hybrid DNAs emitted

fluorescence. After hybridization Microarray was washed

with a wash buffer to remove fluorescent DNAs which did

not take part in hybridization.

Microarray Scanning: The Microarray was inserted into

the slide port of the Microarray Scanner The scanner emits

a laser beam on the Microarray spots and captured the

fluorescence emitted from the spots with the photo

multiplier tube coupled with a confocal microscope. The

scanned image of the microarray was captured in the

computer screen. Fluroscent spots indicated the presence

of corresponding DNA in the sample, whereas no

fluorescence indicated that the particular gene was not

expressed in the samples. The level of gene expression

was analysed from the individual spots. The intensity of

the fluorescence corresponds to rate of expression of the

gene.

Comprehensive Data Analysis:

Principle: The signals emitted from green dye (control)

and red dye (Test) were measured and recorded

automatically. The ratio of green to red dye was calculated

by the computer, if the signals of green and red dyes are in

equal proportions, the ratio is 1:1 and the expression of the

gene is equal in both test and control samples. If the

signals of green dye exceed red dye the expression of the

gene in the control is relatively higher than that in the test

sample. If the signals of red dye exceed the green dye the

expression of the gene in the test sample is relatively

higher than that in the control sample. Data analysis

includes automated feature extraction using Agilent

feature extraction Software. Data analysis has been done

using GeneSpring GX version 12.0 and Microsoft Excel.

Normalisation and statistical analysis:

Normalization: The normalization was done using Gene

Spring GX 12.0 Software.

Normalization Method Used: Percentile Shift

Normalization

Percentile shift normalization is a global normalization,

where the locations of all the spot intensities in an array

are adjusted. This normalization takes each column in an

experiment independently, and computes the percentile of

the expression values for this array, across all spots (where

n has a range from 0-100 and n=75 is the median). It

subtracts this value from the expression value of each

entity. Analysis is done with respect to control samples.

Pathway Genelist: Biointerpreter - Biological Annotation

Report

Significant pathways for differentially regulated genes

were generated using Biointerpreter.

About Biointerpreter: Biointerpreter is a user-friendly

web-based Biological interpretation tool developed by

Genotypic for any microarray data. It significantly reduces

the biological analysis time from weeks to hours. Helps

derive full value of Microarray study. Automated

biological analysis of Microarray data saves weeks

without compromising on depth of information Web-

based, easy to use tool. It is Specially designed for the

users who are most likely to be biologist. It is the Only

tool providing curated gene expression data. It has the

flexibility to query with more than 15 gene identifier

types. Provides more than 15 biological views of the genes

viz. function, pathway, disease.It is Biologist friendly and

so Advanced Excel and database skills not required

Gene Annotation: The suggestions and requirements of

microarray users worldwide have been translated to a user

friendly product. It contains comprehensive and verified

annotations from sequence and annotation databases.

Contains microarray data tables from over hundreds of

publications and is constantly growing. Data curated from

over 500,000 Pubmed abstracts and topic specific

databases are used to index genes for Disease, function,

drug associations and other150 classes. The database is

updated every month.

RESULTS

Microarray: O g ’ m 44k

microarray which contains 44000 rat genes. The results



obtained from microarray analysis revealed significant

gene expression changes and brought out expression

changes and biological function relationships. Out of

44000 genes analysed 2273 genes were up regulated and

4430 genes were down regulated in test group of rat testis

when compared with control group of rat testis samples.

Samples hybridized Up Down

Testis 2273 4430

Histopathological: Histopathological examinations

I L g’ , m g

Sertoli cells were damaged in phenytoin treated Test

groups.

Discussion: Microarray technology has been used to

examine the effects of phenytoin exposure in a variety of

organisms. Although phenytoin regulated gene expression

has been documented, in many organ system, there is

inadequate information regarding the genome response to

this antiepileptic drug in testis. In the present study out of

44000 genes analysed 2273 genes were up regulated and

4430 genes were down regulated in test group of rat testis

when compared with control group of rat testis samples.

After identifying the group of genes involved in

differential expression of phenytoin treated group Genelist

pathway analysis was done which sub categorised the

group of genes which are similar in function .After

determining a list of genes involved in a given biological

process the next step is to map these genes to known

pathways/Gene Ontology terms and determine which

pathways are overrepresented in a given set of genes.

Gene Cluster Analysis: Cluster analysis was performed

to identify testis specific differentially regulated genes

following phenytoin exposure to pick the candidates for

RT-PCR analysis

Clusters for differentials: Genes with similar expression

patterns functions clustered together, which helps in

further understanding of the genes. Algorithm used is

Hierarchical. The most similar expression profiles are

joined together to form a group. These are further joined

in a tree structure, until all data forms a single group.

Clustering is based on Average- Distance between two

clusters is the average of the pair-wise distance between

entities in the two clusters. Similarity measure clustering

algorithm based on Pearson correlation coefficient

measures the similarity (difference) between entities or

condition.

Table.1.Functinal classification of Down regulated genes of phenytoin treated test samples. GO

ACCESSION

GO Term p-value Count in

Selection

% Count in

Selection

Count in

Total

3798 GO:0005488 binding 4.6E-18 1978 73.2864 10728

13189 GO:0030695 GTPase regulator activity 3.71E-14 102 3.779177 295

27210 GO:0060589 nucleoside-triphosphatase regulator activity 2.55E-13 102 3.779177 303

14996 GO:0032559 adenyl ribonucleotide binding 1.51E-12 304 11.26343 1264

13066 GO:0030554 adenyl nucleotide binding 1.85E-12 320 11.85624 1347

1106 GO:0001882 nucleoside binding 2.31E-12 328 12.15265 1390

3819 GO:0005524 ATP binding 2.58E-12 298 11.04113 1239

1107 GO:0001883 purine nucleoside binding 3.49E-12 325 12.0415 1379

14992 GO:0032555 purine ribonucleotide binding 1.35E-11 360 13.33827 1574

Table.2.Functional classification of Up regulated genes of phenytoin treate test samples GO ID GO

ACCESSION

GO Term p-value Count in

Selection

% Count in

Selection

Count in

Total

3839 GO:0005576 extracellular region 4.29E-29 316 14.15771 1265

20284 GO:0044421 extracellular region part 3.29E-23 198 8.870968 725

1562 GO:0002376 immune system process 1.02E-19 193 8.646954 741

3875 GO:0005615 extracellular space 1.09E-19 151 6.765233 527

4960 GO:0006950 response to stress 5.97E-19 319 14.29211 1457

4961 GO:0006952|

GO:0002217|

GO:0042829

defense response 5.69E-18 122 5.46595 405

6839 GO:0009617

|GO:0009618

|GO:0009680

response to bacterium 2.78E-16 87 3.89785 259

6831 GO:0009607 response to biotic stimulus 1.49E-14 111 4.973118 390

25208 GO:0051239 regulation of multicellular

organismal process 2.3E-14 242 10.84229 1107



Figure.1.Full view cluster

Figure.2.Microarray scanned image-test sample

Figure.3.Testis control H&E

Stain 10X Magnification

Figure.4.Testis control H&E Stain

40x Magnification

Figure.5.H&E Tesis Test Phenytoin

treated H&E Stain 40X Magnification

Figure.6.Testis Control Trichrome Stain

40X Magnification

Figure.7.Testis Test Phenytoin treated Trichrome Stain

40X Magnification



CONCLUSION

Histopathological examination: Phenytoin directly affect

brain regions that mediate sexuality. It changes the

concentrations of sex steroid hormones. It also causes

histopathological changes in testis which causes

disturbances in spermatogenesis. It causes sexual

dysfunction by inducing secondary effects on reproductive

hormones. Testis is externally covered by Tunica

albuginea and within tunica albuginea many lobules are

present. Each lobule contains many convoluted tubules

called seminiferous tubule. Each seminiferous tubule

contains various generations of spermatogenic cells that

gives rise to spermatozoans and sertoli cells that supports,

nourishes and protects the spermatozoans.Between the

m I L g’

L g’

secretion. Many research works have proved that

phenytoin decreases the testosterone secretion, which

decreases sexuality and libido. In our study

Histopathological examination by Haemotoxylon and

E g m ’ m g

method showed necrotic changes like pyknotic nucleus

and shrunken cytoplasm., in spermatogenic cells, sertoli

cells and Leydig cells of phenytoin treated test group,

whereas control group presented normal histological

picture.

cDNA Microarray Analysis: In our study about 2273

genes were up regulated and about 4430 genes were down

regulated in the test group of animals.

Functional Classification of Upregulated Genes of

Testis Samples: The majority of the up regulated genes

were represented by extracellular region, extracellular

region part, immune system process, extracellular space,

response to stress, defense response, response to

bacterium, response to biotic stimulus, which are

concerned with immunity and secretions of extracellular

substances secreted by testis which suggests there is an

increased immune response or hypersensitivity to

phenytoin treatment in test group of animals, when

compared to control group.

Functional Classification of Downregulated Genes of

Testis Samples: The majority of the down regulated

genes were represented by Binding, GTPase regulator

activity ,nucleoside-triphosphatase regulator activity,

adenyl ribonucleotide binding, adenyl nucleotide binding,

nucleoside binding, ATP binding, purine nucleoside

binding ,purine ribonucleotide binding genes which are

concerned with protein synthesis ,metabolism and

molecular functions suggesting disturbances in hormone

synthesis by testis and cytodifferentiation during

spermatogenesis by meiosis and mitosis in the test group

when compared to control group.

Gene Cluster Analysis: In Cluster analysis for testis

specific differentially regulated genes showed about 51

genes were differentially regulated out of which about 17

genes were up regulated and about 34 genes were down

regulated. TheTEX15 TESK2 and Crh genes showed

significant down regulation by more than-2.5 folds and

Stat5a genes and pate4 genes were up regulated by more

than 3 folds. Among the down regulated genes TEX15

genes by-3.02 folds, TESK2 genes by -2.72 folds and Crh

genes by -5.87 folds respectively and Stat5a genes by 3.82

folds and pate4 genes by 4.18 folds up regulated

respectively.

TEX15 Gene: During meiosis, homologous chromosomes

undergo synapsis and recombination. It is identified in

earlier studies that TEX15 as a novel protein which is

required for chromosomal synapsis and meiotic

recombination. Loss of TEX15 function causes early

meiotic arrest in males but not in females. Specifically,

TEX15-deficient spermatocytes exhibit a failure in

chromosomal synapsisin .In our study pate4 gene was

down regulated by-3.02 folds in phenytoin treated test

group, suggesting that phenytoin disturbs spermatogenesis

by interfering in its meiotic activity.

TESK2 Gene: TESK2 is expressed predominantly in non

germinal Sertoli cells, the TESK2 along with TESK1 are

two Protein kinases which are expressed exclusively

during the cytodifferentiation of late spermatids to sperms,

the TESK2 is involved in various stages of

spermatogenesis, predominantly in the control of meiosis.

In our study pate4 gene was down regulated by-2.72 folds

in phenytoin treated test group which explains that TESK2

disturbs normal spermatogenesis by interfering

spermiogenesis, the process of production of sperms from

spermatids.

CRH Gene: CRH is synthesized in the testis and is

present in Leydig cells, it is likely that locally produced

CRF could exert negative autocrine modulation on the

stimulatory action of luteinizing hormone on Leydig cell

function. CRH acts as an antireproductive hormone and as

a major local inhibitory regulator of Leydig cell function.

In our study it was proved histopathologically that the

leydig cells which contains crh were damaged in

phenytoin treated test group which is responsible for down

regulation of crh genes by-5.87 folds.

Stat5 Gene: Stat5 is considered as pleotropic gene which

is a single gene that can influence multiple functions.

Stat5 is concerned with cellular functions of proliferation,

differentiation and apoptosis with relevance to processes

of hematopoiesis and immune regulation, reproduction,

and lipid metabolism. The exact function and status in

phenytoin treated test group can only be explained by

gene knock out technology studies.



Hexb Gene: Hexb gene is responsible for the secretion of

beta hexaminidase which is a kind of lysosomal enzyme

which plays important role in cell apoptosis and also

tumor cell necrosis, in our study as there is increased

cellular damage due to phenytoin administration these

genes are up regulated by 3 folds.

ACKNOWLEDGEMENT

The authors are to acknowledge Dr.

A.K.Munirajan and his Research scholars of university of

Madras for sample preparation and. M/SGenotypic

Technology (P) Ltd, Bangalore, India, for Gene

microarray analysis .

REFERENCES

Fang Yang, Sigrid Eckardt, N. Adrian Leu K. John

McLaughlin, and Peijing Jeremy Wang Mouse TEX15 is

essential for DNA double-strand break repair and

chromosomal synapsis during male meiosis Journal of

Cell Biology, 18, 2008, 4673-679.

Grimley PM, Dong F, Rui H.Stat5a and Stat5b: fraternal

twins of signal transduction and transcriptional activation,

Cytokine Growth Factor Reviews, 10(2), 1999, 131-57.

Groner B, Fritsche M, Stöcklin E, Berchtold S, Merkle C,

Moriggl R, Pfitzner E Regulation of the trans-activation

potential of STAT5 through its DNA-binding activity and

interactions with heterologous transcription factors,

Growth Hormone & IGF Research, 10, 2000, 15-20.

Jung JW, Park JS, Hwang JW, Kang KS, Lee YS, Song

BS, Lee GJ, Yeo CD, Kang JS, Lee WS, Jeon KS, Um

CH, Kim YS, Oh MJ, Youn JP, Li P, Park JE, Hwang SY,

Lin JX, Leonard WJ, The role of Stat5a and Stat5b in

signaling by IL-2 family cytokines, Oncogene, 19(21),

2000, 2566-76.

Jung JW, Park JS, Hwang JW, Kang KS, Lee YS, Song

BS, Lee GJ, Yeo CD, Kang JS, Lee WS, Jeon KS, Um

CH, Kim YS, Oh MJ, Youn JP, Li P, Park JE, Hwang SY,

Gene expression analysis of peroxisome proliferators- and

phenytoin-induced hepatotoxicity using cDNA

microarray, The Journal of Veterinary Medical Science,

66(11), 2004, 1329-33.

Margalit M, Yogev L, Yavetz H, Lehavi O, Hauser R,

Botchan A, Barda S, Levitin F, Weiss M, Pastan I,

Wreschner DH, Paz G, Kleiman SE Involvement of the

prostate and testis expression (PATE)-like proteins in

sperm-oocyte interaction. Human Reproduction, 27(5),

2012, 1238-48.

Mariotti V, Melissari E, Amar S, Conte A, Belmaker RH,

Agam G, Pellegrini S. Rajesh A, Yenugu S.Genomic

organization, tissue distribution and functional

characterization of the rat Pate gene cluster, PLoS One,

7(3), 2012, 633.

Mariotti V, Melissari E, Amar S, Conte A, Belmaker

RH, Agam G, Pellegrini S Effect of prolonged phenytoin

administration on rat brain gene expression assessed by

DNA microarrays, Experimental Biology and Medicine,

235(3), 2010, 300-10.

Swamy SM, Tan P, Zhu YZ, Lu J, Achuth HN,

Moochhala S.Role of phenytoin in wound healing:

microarray analysis of early transcriptional responses in

human dermal fibroblasts, Biochemical and Biophysical

Research Communication, 13, 2004, 314(3):661-6.

Toshima J, Ohashi K, Okano I, Nunoue K, Kishioka M,

Kuma K, Miyata T, Hirai M, Baba T, Mizuno

KIdentification and characterization of a novel protein

kinase, TESK1, specifically expressed in testicular germ

cells, The Journal of biological chemistry, 270(52), 1995,

31331-7.

http://jcb.rupress.org/search?author1=Fang+Yang&sortspec=date&submit=Submit

http://jcb.rupress.org/search?author1=Sigrid+Eckardt&sortspec=date&submit=Submit

http://jcb.rupress.org/search?author1=N.+Adrian+Leu&sortspec=date&submit=Submit

http://jcb.rupress.org/search?author1=K.+John+McLaughlin&sortspec=date&submit=Submit

http://jcb.rupress.org/search?author1=K.+John+McLaughlin&sortspec=date&submit=Submit

http://jcb.rupress.org/search?author1=Peijing+Jeremy+Wang&sortspec=date&submit=Submit

http://www.ncbi.nlm.nih.gov/pubmed?term=Grimley%20PM%5BAuthor%5D&cauthor=true&cauthor_uid=10743504

http://www.ncbi.nlm.nih.gov/pubmed?term=Dong%20F%5BAuthor%5D&cauthor=true&cauthor_uid=10743504

http://www.ncbi.nlm.nih.gov/pubmed?term=Rui%20H%5BAuthor%5D&cauthor=true&cauthor_uid=10743504


http://www.ncbi.nlm.nih.gov/pubmed?term=Groner%20B%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Fritsche%20M%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=St%C3%B6cklin%20E%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Berchtold%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Merkle%20C%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Moriggl%20R%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Pfitzner%20E%5BAuthor%5D&cauthor=true&cauthor_uid=10984248

http://www.ncbi.nlm.nih.gov/pubmed?term=Jung%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20JS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang%20KS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Song%20BS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944


http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20GJ%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Yeo%20CD%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang%20JS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20WS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Jeon%20KS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Um%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=15585944


http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Oh%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Youn%20JP%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20P%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20JE%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20SY%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Lin%20JX%5BAuthor%5D&cauthor=true&cauthor_uid=10851055

http://www.ncbi.nlm.nih.gov/pubmed?term=Leonard%20WJ%5BAuthor%5D&cauthor=true&cauthor_uid=10851055


http://www.ncbi.nlm.nih.gov/pubmed?term=Jung%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20JS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang%20KS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944



http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20GJ%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Yeo%20CD%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang%20JS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20WS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Jeon%20KS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944



http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Oh%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Youn%20JP%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20P%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20JE%5BAuthor%5D&cauthor=true&cauthor_uid=15585944

http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20SY%5BAuthor%5D&cauthor=true&cauthor_uid=15585944


http://www.ncbi.nlm.nih.gov/pubmed?term=Margalit%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Yogev%20L%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Yavetz%20H%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Lehavi%20O%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Hauser%20R%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Botchan%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Barda%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Levitin%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Weiss%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Pastan%20I%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Wreschner%20DH%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Paz%20G%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Kleiman%20SE%5BAuthor%5D&cauthor=true&cauthor_uid=22402205

http://www.ncbi.nlm.nih.gov/pubmed?term=Mariotti%20V%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Melissari%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Amar%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Conte%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Belmaker%20RH%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Agam%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Pellegrini%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Rajesh%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22479333

http://www.ncbi.nlm.nih.gov/pubmed?term=Yenugu%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22479333


http://www.ncbi.nlm.nih.gov/pubmed?term=Mariotti%20V%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Melissari%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Amar%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Conte%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20404047



http://www.ncbi.nlm.nih.gov/pubmed?term=Agam%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Pellegrini%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20404047

http://www.ncbi.nlm.nih.gov/pubmed?term=Swamy%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

http://www.ncbi.nlm.nih.gov/pubmed?term=Tan%20P%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhu%20YZ%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

http://www.ncbi.nlm.nih.gov/pubmed?term=Achuth%20HN%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

http://www.ncbi.nlm.nih.gov/pubmed?term=Moochhala%20S%5BAuthor%5D&cauthor=true&cauthor_uid=14741686

https://www.google.co.in/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&ved=0CCgQFjAA&url=http%3A%2F%2Fwww.sciencedirect.com%2Fscience%2Fjournal%2F0006291X&ei=3E52UvaRM8mGrgfTz4A4&usg=AFQjCNFS2UBZN8S0dBfFll6r9oWjrcC6Pw&bvm=bv.55819444,d.bmk

https://www.google.co.in/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&ved=0CCgQFjAA&url=http%3A%2F%2Fwww.sciencedirect.com%2Fscience%2Fjournal%2F0006291X&ei=3E52UvaRM8mGrgfTz4A4&usg=AFQjCNFS2UBZN8S0dBfFll6r9oWjrcC6Pw&bvm=bv.55819444,d.bmk

http://www.unboundmedicine.com/medline/?st=M&author=Toshima%20J

http://www.unboundmedicine.com/medline/?st=M&author=Ohashi%20K

http://www.unboundmedicine.com/medline/?st=M&author=Okano%20I

http://www.unboundmedicine.com/medline/?st=M&author=Nunoue%20K

http://www.unboundmedicine.com/medline/?st=M&author=Kishioka%20M

http://www.unboundmedicine.com/medline/?st=M&author=Kuma%20K

http://www.unboundmedicine.com/medline/?st=M&author=Miyata%20T

http://www.unboundmedicine.com/medline/?st=M&author=Hirai%20M

http://www.unboundmedicine.com/medline/?st=M&author=Baba%20T

http://www.unboundmedicine.com/medline/?st=M&author=Mizuno%20K

http://www.unboundmedicine.com/medline/?st=M&author=Mizuno%20K

http://www.unboundmedicine.com/medline/?st=M&journal=J%20Biol%20Chem

Manikanta and Narendra Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND IN-VITRO EVALUATION OF LORNOXICAM IMMEDIATE

RELEASE AND DICLOFENAC SODIUM SUSTAINED RELEASE BILAYERED

TABLETS B. Manikanta Anil*, K. Narendra Kumar reddy

College of Pharmacy, Mother Theresa educational society group of institutions, Nunna,Vijayawada(Rural) , india.


ABSTRACT

The aim of the present work is to prepare bilayered tablet of Lornoxicam and Diclofenac sodium for

treatment of rheumatoid arthritis. The bilayered tablet of which Lornoxicam is immediate layer and Diclofenac

sodium is sustained release layer was prepare by direct compression due to good flow properties of the prepared

blend. Initially drug is release from immediate release layer and loading dose is provideded by slow release of

drug from sustained layer.the sustained release of drug is attained by the use of polymers like HPMC k100,

metolose, manucol among this three polymers metolose shows better drug release. The prepared tablets were

evaluated for post compression studies like thickness, hardness, friability, drug content, weight variation and

invitro dissolution studies which show satisfactory results all are within the limits. The in-vitro dissolution studies

were carried out by using type-2USP dissolution apparatus using 0.1N hydrochloric acid and 7.4 pH phosphate

buffer as dissolution mediums for lornoxicam and diclofenac sodium. Among all the formulations f7 shows better

drug release in intial hours and sustained drug action upto 12hrs.The drug release from optimized formulation

followed zero-order, Higuchi model which indicates drug release from bilayered was Fickian diffusion. In

conclusion, results indicate that prepared bilayered tablet could perform therapeutically better than conventional

and sustained tablets with improved efficacy and better patient compliance.

Key words: Diclofenac sodium, Lornoxicam, Rheumatoid arthritis

INTRODUCTION

Lonoxicam and diclofenac sodium are non

steroidal anti-inflammatory drugs with analgesic, anti-

inflammatory and anti-pyretic properties. lornoxicam is

potent inhibition of prostaglandin biosynthesis through the

inhibition of both cox-1 and cox-2 and Diclofenac sodium

is potent non-selective cyclooxygenase inhibitor. Both

these drugs are used for treatment of rheumatoid arthritis

(Wadher S J., 2008).


Lornoxicam and Diclofenac sodium were gift samples

from richer pharmaceuticals, Hyderabad. Metolose,

Manucol, Hpmck100, MCC, crospovidone, sodium starch

glycolate were gift samples from Otto chemicals,

Mumbai.

Formulation of bilayer tablets by direct compression

method: The ingredients in the formula are weighed

accurately and mixed to form a homogeneous blend of

drug and excipients separately for both layers. First

compressed the Sustained release layer and followed by

immediate release layer using Manstey 16 station

machine to produce round tablets weighing 300mg (flat

punch 12mm).( Patel A., 2011)

Table.1.Formulation table of Bilayer tablets of Lornoxicam and Diclofenac sodium Ingridients Immidiate Ralease Layer

Formulation code F1 F2 F3 F4

Lornoxicam 4 4 4 4

S.S.G --- 3 --- 6

MCC 91 91 88 88

Crospovidone 3 --- 6 ---

Aerosil 0.5 0.5 0.5 0.5

Magnesium stearate 1.5 1.5 1.5 1.5

Ingridients Sustained Release Layer

Formulation code F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12

Diclofenac sodium 50 50 50 50 50 50 50 50 50 50 50 50

Metolose 60 --- --- 20 --- --- 10 5 -- 5 --- --

HPMCK100M --- --- 60 - -- --- 20 --- --- 5 5 --- 10

Manucol --- 60 --- --- 20 --- --- 5 5 --- 10 ---

PVPK30 10 10 10 10 10 10 10 10 10 10 10 10

D.C.P 76 76 76 116 116 116 126 126 126 126 126 126

Aerosil 1 1 1 1 1 1 1 1 1 1 1 1

Magnesium stearate 3 3 3 3 3 3 3 3 3 3 3 3



Post compression studies: All the prepared formulations

were tested for Physical parameters like Hardness,

thickness, Weight Variation, Friability and found to be

within the Pharmacopoeias limits. The results of the tests

were tabulated. The drug content of all the formulations

was determined and was found to be within the

permissible limit. This study indicated that all the

prepared formulations were good (Kumar A, 2003).

Weight variation and Thickness: The weight variation

of bi-layer tablets was found to be in the range of 299 to

301 mg and the thickness of bi-layer tablets was found to

be in the range of 6.506±0.04to 6.86 ± 0.03mm for all the

formulations (F1 TO F12).

Hardness and friability: Hardness was affecting the

release of drug from formulations. The hardness of bi-

layer tablets was found to be in the range of 6.7±0.5

kg/cm2 to 7.3± 0.5 kg/ cm

2 and friability of bi-layer tablets

was found in the range of 0.19% to 0.46% for all the

formulations (F1 TO F12). (Young Hoon Kim, 2007)

Drug content: Drug content of bi-layer tablets was

estimated by assay using UV method. The amount of was

found to be in the range of 97.23% to 101.3%for all the

formulations (F1 TO F12).

In-vitro Drug Release Studies: The in vitro drug release

study was performed for the Bilayered tablets using USP

Type II dissolution apparatus of rpm -50, at a temperature

37±0.5 ºC, using 0.1N Hcl, 7.4 pH phosphate buffer as

dissolution mediums. At predetermined time intervals

samples (5 ml) were collected and replenished with same

volume of fresh media. The drug content in the samples

was estimated using UV-spectrophotometer at 373 nm,

276nm (Wang Z, 1993).

Table.2.Physical parameters of Bilayer tablets of Lornoxicam and Diclofenac sodium

Table.3.Cumulative percentage drug release of Lornoxicam immediate release layer

Table.4.Cumulative percentage drug release of Diclofenac sodium sustained release layer Time

(Hours)

Cumulative percentage drug release

F1 F2 F3 F4 F5 F6 F7 F11 F12

0 0 0 0 0 0 0 0 0 0

1 2.337369 1.947807 1.168684 3.603444 1.704331 2.191284 8.326877 2.264326 2.4835

2 2.873016 2.045198 1.801722 4.187786 2.386064 3.019101 10.46946 3.311273 4.0417

3 8.132096 4.187786 5.405165 21.43132 7.255582 6.330374 26.68496 10.66425 31.603

4 11.05381 6.232984 8.667743 30.23971 11.88162 7.499058 33.89146 21.91283 37.641

5 12.1738 8.034705 11.05381 34.86575 15.43637 8.765133 43.57946 32.47969 43.679

6 15.33898 10.1286 13.78074 39.83266 17.82244 9.398171 51.75946 55.41512 46.601

7 17.62766 11.88162 16.94592 44.79957 22.69196 32.18752 57.15946 55.41512 58.093

8 20.69545 13.78074 19.2346 57.75249 38.95615 44.94566 68.89946 60.28464 65.397

9 22.59457 15.97202 22.05892 64.56981 45.62739 60.96637 73.26946 64.6672 79.519

10 28.63277 17.53027 27.80495 72.36104 59.84638 74.60102 86.9209 73.43234 87.310

11 34.03793 19.38068 35.30401 81.61313 66.66371 81.41835 93.73823 78.78881 94.127

12 39.68658 24.2502 38.90745 85.50874 70.07237 84.82701 99.82513 82.68442 96.952

Formulation code Weight variation

(mg)(n=10)

Hardness

(kg/cm2)(n=3)

Thickness

(mm)(n=3)

Friability

(%)

Assay

(%)

F7 300.2±1.19 7.1±0.5 6.68±0.05 0.30 101.3

Time (Minutes) Cumulative percentage drug release

F1 F2 F3 F4

0 0 0 0 0

5 5.8538±0.16 20.195±0.67 23.415±0.27 38.049±0.81

10 17.561±0.45 49.757±0.44 46.830±0.53 55.61±0.125

15 20.488±0.36 52.684±0.35 58.538±0.16 76.099±0.61

20 26.342±0.17 64.391±0.98 67.318±0.89 96.587±0.97

25 29.26±0.908 70.24±0.58 93.66±0.106 99.807±0.57

30 35.12±0.29 76.099±0.61 99.807±0.57

40 40.976±0.71 81.953±0.43

50 52.684±0.35 84.88±0.34

60 61.46±0.507 87.807±0.24



Drug excipient compatibility studies:

Fourier Transform Infrared (FTIR) Spectroscopy: The Fourier transform infrared (FTIR) spectra of samples

were obtained using FTIR spectrophotometer (Perkin

Elmer). Pure drug, individual polymers and optimised

formulations were subjected to FTIR study. About 2–3

mg of sample was mixed with dried potassium bromide of

equal weight and compressed to form a KBr disk. The

samples were scanned from 400 to 4000 cm−1

.

Figure.1.FTIR of Lornoxicam immediate release layer

Figure.2.FTIR of Diclofenac sodium sustained release layer

CONCLUSION

Solubility studies showed Lornoxicam is soluble

in 0.1N HCL & methanol but poorly soluble in water.

Solubility studies showed Diclofanac sodium is soluble in

7.4PH & methanol but sparingly soluble in water. FTIR

studies showed no incompatibility between drug, polymer

and various excipients used in the formulations.

Precompressional studies were separately conducted for

both the layers separately, gave satisfactory results.

Bilayer formulations of Lornoxicam & Diclofenac sodium

were successfully prepared with super disintegrates like

SSG, CP and hydrophilic polymers like HPMC K100M,

Metolose and Manucol by simple direct compression

method. Formulated tablets gave satisfactory results for

various evaluation parameters like hardness, weight

variation, friability, content uniformity, and in-vitro drug

release. Other parameters like hardness, thickness, assay,

friability were found within limits and well satisfactory.

The kinetic study results suggest that, the best linearity

was found in Higuchi’s equation plot (r2 =0.989)

indicating the release of drug from matrix fallow Higuchi

model kinetics i.e, Fickian diffusion. The drugs release

pattern from the optimized formulations (F7) was Fickian

transport, obeying Higuchi equation. Bilayer tablet

showed an initial burst effect to provide the loading dose

of the drug followed by sustained release for 12hr,

indicating a promising in patient compliance. It can be

concluded that, the formulation retained for longer periods

of time in the GI tract and provides controlled release of

the drug. Hence, improve the therapeutic effect of the drug

may lead to increasing its bioavailability and reduce

patient compliance.

REFERENCES

Fijalek Z, Wyszecka‐Kaszuba E, Warowna‐Grzeskiewicz

M, HPLC with amperometric detection for the

determination of 4‐ aminophenol, the main impurity of

Paracetamol in multicomponent analgesic preparation, J

Pharm Boimed Anal, 32, 2003, 1081‐1086.

Ghada M, Hadad, Samy Emara, Waleed, Mahmand M M,

Stability indicating RP‐HPLC method for determination of

Paracetamol with dantrolene and Cetrizine and

Pseudoephedrine in two pharmaceutical dosage forms,

Talanta, 79, 2009, 1360‐1367.



Ibrahim Çetin, Nisa Koçak, Sule Aycan, Polarographic

determination of lornoxicam in pharmaceutical

formulations, C B U J Sci, 5(1), 2009, 11-18.

Lotfi Monser, Frida Darghouth, Simultaneous LC

determination of Paracetamol and related compound in

pharmaceutical formulation using carbon based column, J

of Pharm Biomed Anal, 27, 2002, 851‐860.

Patel A, Sahoo U, Patel N et al. Development and

Validation of Analytical Methods for the Simultaneous

Estimation of Lornoxicam and Paracetamol from their

Pharmaceutical Dosage Forms. Current pharma research,

1(2), 2011, 140-144.

Shulin Zahao, Dan Xiao, Wenling Bai, Hongyan Yuan,

Capillary electrophoresis with chemiluminescence

detection of Paracetamol, Anal Chim Acta, 559, 2006,

195‐199.

Subramanian G, Vasudevan M, Ravishankar S, Suresh B,

Validation of RP‐HPLC method for simultaneous

determination of Paracetamol, Methocarbamol, Diclofenac

potassium in tablets, Indian J Pharm Sci, 67(2), 2005,

260‐263.

Udupa N, Karthik A, Subramanian G, Ranjith Kumar A,

Simultaneous estimation of Paracetamol and

Domperidone by HPLC method, Indian J Pharm Sci,

69(1), 2007, 140‐144.

Vasudevan M, Ravisankar S, Ravibabu T, Nagarajan,

Estimation of acetaminophen, dextropropoxyphene and

oxyphenbutazone in combined dosage form by HPLC

method, Indian J Pharm Sci, 62(2), 2000, 122‐125.

Wadher S J, Pathankar P R, Puranik M, Simultaneous

spectrophotometric estimation of Paracetamol and

Metoclopromide HCl in solid dosage form, Indian J of

Pharm Sci, 70(3), 2008, 393‐395.

Divya et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND EVALUATION OF CEFPODOXIME PROXETIL SUSTAINED

RELEASE MATRIX TABLETS Divya Palparthi*, K. Narendra Kumar Reddy

College of Pharmacy, Mother Theresa educational society group of institutions, Nunna,Vijayawada(Rural), India.


ABSTRACT

Formulation of Cefpodoxime proxetil extended release matrix tablets. The aim of the present study is to

develop a pharmaceutically stable, once a day robust formulation which will have similar clinical efficacy as that

of twice a day formulation of 200mg strength and can reduce dosage frequency. Cefpodoxime proxetil is used in

the treatment of respiratory and urinary tract infections. In the present study, the polysaccharides guargum and

xanthum gum were evaluated as carriers for colon targeting by formulating matrix tablets of cefpodoxime

proxetil with different concentrations (5%,10%,20%,40%) of the above polysaccharides. Tablets were prepared

by wet granulation method. Formulation containing 40% guargum is considered as optimized formulation as it

releases less amount of drug in first 2 hours compared to other formulations. The optimized formulation was

subjected to stability studies as per ICH guidelines at accelerated condition for 3 months and was found to be

stable.

Key words: Cefpodoxime Proxetil, Sustained Release, Polysaccharides, Drug Release

INTRODUCTION

Oral drug delivery is the most desirable and

preferred method of administering therapeutic agents for

their systemic effects. Oral delivery can be classified into

three categories, immediate release is designed for

immediate release of drug for rapid absorption, sustained

release pharmaceutical products which are designed on the

basis of spansule coating technology for extended

absorption and sustained release systems include any drug

delivery system that achieves slow release of drug over an

extended period of time. The onset of its pharmacologic

action is often delayed and the duration of its therapeutic

effect is sustained.

Matrix tablets: Matrix tablet has given a new

breakthrough for novel drug delivery system in the field of

pharmaceutical technology. It excludes complex

production procedures such as coating and pelletization

during manufacturing and drug release rate from the

dosage form is controlled mainly by the type and

proportion of polymer used in the preparations. These are

the type of controlled drug delivery systems, which

release the drug in continuous manner by dissolution

controlled as well as diffusion controlled mechanisms.

The drug is dispersed in swellable hydrophilic substances,

an insoluble matrix of rigid swellable hydrophobic

materials or plastic materials. The materials most widely

used in preparing matrix systems include both hydrophilic

and hydrophobic polymers. Commonly available polymers

include hydroxyethyl cellulose, hydroxy propyl methyl

cellulose, hydroxyl propyl cellulose, xanthan gum, sodium

alginate, polyethylene oxide and cross linked

homopolymers and copolymers of Acrylic acid.

Cefpodoxime is a broad spectrum oral third

generation cephalosporin antibiotic. Cefpodoxime proxetil

is a prodrug of cefpodoxime. It is well tolerated and is one

of the third generation cephalosporins to be available in

oral form. Cefpodoxime is bactericidal and acts by

inhibition of bacterial synthesis. It passes through ion

channels in the bacterial cell wall and binds to the

penicillin binding proteins (PBP) in the cell membrane

causing acylation of membrane bound transpeptidase

enzymes; this prevents cross linkage of peptidoglycan

chains, which is necessary for bacterial cell wall strength

and rigidity. This leads to reduced synthesis of

peptidoglycans and result in damage to cell wall.

Cefpodoxime is stable in the presence of beta-lactamase

enzymes.

MATERIALS AND METHODS Guar Gum, Xanthan Gum, Lactose, Magnesium Stearate,

Talc and Cefpodoxime proxetil

Preparation of matrix tablet by Wet granulation

method: The ingredients were weighed accurately and

mixed thoroughly. Granulation was done with a solvent

blend of water and methanol (1:1). The wet mass was

passed through sieve no.12 for the preparation of granules.

The granules were dried in a conventional hot air oven at

40 c. The dried granules were subjected to dry screening

by passing through mesh no.22, blended with a mixture of

talc and magnesium stearate and compressed into tablets

using 6 station rotary tablet punching machine. The total

weight of each tablet was 500mg.

Table.1. Composition of matrix tablets of Cefpodoxime proxetil

Ingredients (mg) F4

Cefpodoximeproxetil 200

Guar gum 200

Xanthan gum -

Lactose 80

Magnesium stearate 10

Talc 10




Evaluation of precompression parameters:

Angle of repose: The height and the radius of the pile

were measured and the angle of repose was calculated

using the equation, θ = tan-1

(h/r); where θ is the angle of

repose, h and r are the height and radius of the pile.

Bulk density and tapped density: The bulk density and

tapped density were calculated by the following formula:

Bulk density (ρb) = Weight of granules (g)/Bulk volume

(ml) (Vb)Tapped density (ρt) = Weight of granules

(g)/tapped volume (ml) (Vt)Where (Vb) is bulk volume of

the powder and (Vt) is tapped volume of the powder.

Carr’s index and Hausner’s ratio: Carr’s index and

hausner ratio are calculated by using following formula:

Carr’s index = [(Tapped density – Bulk density)/(Tapped

density)] * 100

Hausner’s ratio = ρt / ρb Where ρt is tapped density, ρb is

bulk density

Evaluation of tablets: Tablets were tested for hardness

using Monsanto hardness tester,thickness using

verniercalipers,friability using roche friabilator ,weight

variation usinga electronic balance .

Estimation of drug content: Ten tablets from each

formulation were powdered. The powder equivalent to

100mg of cefpodoxime proxetil was weighed and

transferred into 100ml volumetric flask. The powder was

dissolved in ph 6.8 phosphate buffer. The solution was

filtered and suitable dilutions were prepared and the

solution was analysed spectrophotometrically at 236nm

using uv visible spectrophotometer.

Swelling behavior of matrix tablets: Percent weight gain

by the tablet was calculated using formula:

S.I = {(Mt –M0) / M0} x 100Where S.I is swelling index,

Mt is weight of tablet at time t and M0 is weight of tablet

at time t=0

In-vitro drug release studies: Dissolution studies of all

the batches were performed employing USP type II

Dissolution testing apparatus (LABINDIA DS 8000). The

dissolution test was performed using 900 ml of 0.1 N

HCL(for 2hrs) followed by phosphate buffer pH 6.8 up to

24 hrs at 37oC ±0.5

oC and 50 rpm. A 5ml aliquot of the

sample was withdrawn periodically at suitable time

intervals andvolume replaced with an equivalent amount

of the dissolution medium. The samples were analyzed

spectrophotometrically at 236nm using UV Visible

spectrophotometer.

Table.2. In-vitro drug release data of formulation F4

Time (Hours) Cumulative % Drug Release ± SD of

Formulation 4

1 15.25±0.26

2 23.00±0.15

3 31.42±0.34

4 34.46±0.28

5 38.28±0.21

6 42.20±0.13

7 50.72±0.41

8 52.12±0.15

9 53.28±0.39

10 54.78±0.34

11 56.78±0.27

12 57.71±0.34

14 62.32±0.16

16 67.52±0.31

20 73.77±0.24

24 79.80±0.15

Table.3. Characterization of drug release from Cefpodoxime proxetil matrix tablets

Formulation

Code

Correlation Co-efficient (r) value Korsmeyer - Peppas

Zero order First order Higuchi Hixon crowell r value n value

F4 0.868 0.977 0.989 0.952 0.985 0.533

The angle of repose was found to be in the range

of 21.43 ± 0.32 to 27.82 ± 2.14 having good flow

property.The bulk density and tapped density were found

to be in the range of 0.31 ± 0.01 to 0.40 ±0.02 gm/cc and



0.34 ± 0.02 to 0.44± 0.02 gm/cc respectively. The

compressibility index and hausner’s ratio were found to be

6.23 ± 2.08 to 13.02 ± 2.53 and 1.07 ± 0.02 to 1.15 ±

0.03.All the results of precompression parameters were

within the prescribed limits indicating good flow

properties of granules. The thickness of the tablet ranged

from 2.70 ± 0.10 to 2.90 ± 0.10 mm showed uniform

thickness. The hardness of the tablet was found between

4.17 ± 0.29 to 5.33 ± 0.29 kg/cm2. The friability was

found to be 0.30±0.06 to 0.49 ± 0.36%, which indicates

satisfactory mechanical resistance of tablets. The drug

content estimation values range of 97.57±0.12 to 100.01 ±

0.39% which reflects good uniformity in drug content.

The in-vitro drug release studies it was observed

that increasing the amount of gum in the formulation,

resulted in slower rate and decreased amount of drug

release from the tablet. The formulations containing low

concentration of gums failed to control the drug release in

first 2hrs in ph 1.2.The formulations F4, F8, F12

containing polymer in the concentration of 40% succeeded

in the drug release up to 24hrs. However formulation F4

containing 40% Guar gum is considered as optimized

formulation as it released less amount of drug in first 2hrs

in ph 1.2 compared to other formulations. This shows that

Guar gum is capable of protecting the drug from being

completely released in the physiological environment of

stomach.

CONCLUSION

The present study was aimed to develop once a

day formulation which will have similar clinical efficacy

as that of twice a day formulation of 200mg strength and

can reduce dosage frequency which proved to be an ideal

formulation, F4 containing polymer in the concentration

of 40% succeeded in sustaining the drug release upto

24hrs. Therefore the formulation F4 was found to be

stable.

REFERENCES

Brahma N. Singh, Kwon H. Kim, Drug delivery - oral

route, Encyclo Pharm Tech, 2002, 886-900.

Charles S.L. Chiao and Joesph R. Robinson, Sustained -

release drug delivery systems, Remington’s

Pharmaceutical Sciences, 19th ed., Mac Publishing

Company, 1999, 1660-3.

Mathiowitz E, Encyclopedia of controlled drug delivery,

Johnwiley and Sons, Canada, 1999, 493-543.

Mc Conville JT, Recent trends in oral drug delivery, Dru

Del Re, 2005, 24-2.

Shalin A. Modi, P. D. Gaikwad, V. H. Bankar, S. P.

Pawar, Sustained release drug delivery system: A review,

IJPRD, 2(12), 2011, 147-160

Wise D.L., Handbook of Pharmaceutical Controlled

Release Technology, New York: Marcel Dekker, Inc; First

ed. Indian reprint, 2005, 211,431.

Yie W. Chein, Oral drug delivery and delivery systems,

2nd

ed. Marcel Dekker – Inc, New York, 1992, 139-1.

Yie W. Chein, Rate controlled drug delivery systems, Ind.

J. Pharm.Sci, 1988, 63-5.

Hingmire and Sakarkar Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)


FORMULATION AND DEVELOPMENT OF SUSTAINED RELEASE MATRIX

TABLET USING NATURAL POLYMERS L. P. Hingmire

*, D. M. Sakarkar

Dept. of Pharmacy, Jagdish Prasad JhabarmalTibrewala University,Chudela, Dist.Jhunjhunu, Rajasthan, India

*Corresponding author: E-mail: [email protected], phone no. +91-9422169470

ABSTRACT

In the present investigation, an attempt has been made to increase therapeutic efficacy, reduce

frequency of administration, and improve patient compliance, by developing sustained release matrix tablets of

diclofenac sodium using natural polymers such as Xanthan gum, locust bean gum, sodium alginate. Sustained

release matrix tablets of diclofenac sodium, were developed by using different drug: polymer ratios, such as

1:0.5; 1:1 and 1:1.5. Xanthan gum, locust bean gum, sodium alginate, combination of locust and xanthan,

locust and sodium alginate were used as matrix former, the tablets were compressed by direct compression

method using 8 mm flat faced punches. Compressed tablets were evaluated for uniformity of weight, content

of active ingredient, friability, hardness, thickness, swelling index & in vitro dissolution using paddle method,

and swelling index. All the formulations showed compliance with pharmacopoeial standards. Among these

formulations, formulation containing combination of locust bean gum and Xanthan gum (6:4) showed

sustained release of drug for 12 hours with release of 98.95 %. Optimized formulation was subjected

toaccelrated stability studies. Thus, locust bean and Xanthan gum combination can be used as an effective

matrix former, to extend the release of diclofenac sodium.

KEYWORDS: Sustained release, Xanthan gum, locust bean gum, Sodium alginate, diclofenac sodium.

INTRODUCTION

Matrix system is the most innumerable method

used in the development of Sustained release

formulations. It is the release system, which prolongs

and control release of drug that is dissolved or dispersed.

In fact, a matrix is defined as a well-mixed composite of

one or more drugs with a gelling agent i.e. hydrophilic

polymer. The natural polymers are been extensively used

in the field of drug delivery because they are readily

available, cost effective, eco-friendly, capable of

multitude of chemical modifications, potentially

degradable and compatible due to their natural origin.

Past research was done on various natural gums like agar

agar, guar gum, chitosan, for potential pharmaceutical

and biomedical applications.

Diclofenac sodium is a most widely used

NSAID, useful in the treatment of rheumatic disorders,

and is characterized by rapid systemic clearance, and

thus warrants the use of a Sustained Release formulation

for prolonged action, and to improve patient compliance.

Various experimental reports such as solubility, ph, half-

life, indicated diclofenac sodium as a good candidate for

SR formulation. Few SR formulations of diclofenac

sodium (100 mg) are also available commercially. In this

study locust, Xanthan gum, Sodium alginate were used

alone and combination of locust bean gum with xanthan

and sodium alginate were used as a hydrophilic matrix

polymers for controlling release of sparingly water

soluble diclofenac sodium was studied, together with

different factors affecting drug release, from the

hydrophilic matrix tablets.

MATERIAL AND METHODS

Diclofenac sodium (DS) was obtained as gift

sample from Alkem Laboratories Mumbai. The Locust

bean gum, Xanthan gum, was obtained from Crystal

colloids Ltd. Mumbai. Sodium alginate Sulbha gums

Bangalore other materials used was of analytical grade,

and procured from commercial sources..

Determination of Viscosity of combination of

different gums by brook field viscometer: Before

using the combination of gums the viscosity of 0.5%w/v

solution of gums indivisiuals &in combinations were

determined, Using brook field viscometer with spindle

No.3 at 37 o C. The highest viscosity combination was

considered suitable for good polymer for dosage form.

(FIG.1)

Preparation of sustained release matrix tablet using

natural gums: Matrix tablets were prepared by direct

compression method. Tables No. 1 shows composition

of each tablet formulation .The formulations are

composed of various concentrations of natural gum in

the ratios as drug and polymers 1: 0.5, 1: 1 and 1: 1.5 in

various percentages. The drug and excipients weighed

separately and passed through 100- mesh sieve. Drug

was added to the lactose and the polymer mixture and

then blended for 20 min. at last the lubricants were

added & subjected to compression using 8 mm standard

flat punch (single punch tablet machine) in to tablets.

Evaluation of post compression parameters: All

prepared matrix tablets were evaluated for uniformity of




weight and drug content, as per I.P. Friability, hardness,

thickness, was determined.

In-vitro dissolution study: In-Vitro drug release studies

for all formulations as well as marketed formulation was

carried out using dissolution test apparatus USP Type-II

at 50 rpm. The dissolution medium consisted of 900 ml

of Standard buffer pH 1.2 for the first 2 hrs, followed by

pH 6.8 for remaining period of time. Temperature

maintained at 370C ± 0.5

0C. Aliquots of 5ml were

withdrawn at predetermined time intervals & an

equivalent amount of fresh dissolution fluid equilibrated

at the same temperature was replaced. Aliquots

withdrawn were diluted up to 50 ml with buffer, filtered

and analyzed by measuring the absorbance at 278 nm.

Kinetic treatment to dissolution data: In order to

investigate the mode of release from tablets, the release

data of optimized formulation was analyzed with the

following mathematical models: Q = Kot (Zero order

kinetic), ln (100-Q) = lnQo-K 1 t (First order kinetic)

and Q = Kptn (Korsmeyer and Peppas equation), where,

Q is the percent of drug released at time t and Ko and K

1 are the coefficients of the equations. Kp is constant

incorporating structural and geometric characteristics of

the release device, and n is the release exponent

indicative of mechanism of drug release.

Swelling study: As the release of drug is proportionate

to matrix form, the swelling index was determined by

equilibrium weight gain method. The study was carried

out in the USP/NF dissolution Apparatus I. The polymer

matrices were accurately weighed, placed in dissolution

baskets, immersed in pH 6.8 phosphate buffers and

maintained at 37± 0.50C in the dissolution vessels. At

regular intervals of 2, 4, 6, 8, 10 and 12 hours, the pre-

weighed basket matrix system was withdrawn from the

dissolution vessels, lightly blotted with a tissue paper to

remove excess test liquid and re-weighed. The swelling

index was estimated at each time point using following

equation:

Where, Ws is the weight of the swollen matrix at time t,

Wi is the initial weight of matrix.

Accelerated Stability Study: For determination of

stability of prepared different formulations, accelerated

stability studies were carried out on optimized

formulation. Tablets were stored at 40 ± 20

C/75 ± 5 %

RH for duration of one month. After completion of one

month sample was withdrawn and tested for different

tests such as thickness, hardness, drug content and in-

vitro drug release (Fassihi R., 1997).


The formulated matrix tablets met the

pharmacopeial requirement of uniformity of weight. All

the tablets conformed to the requirement of assay, as per

I.P. Hardness, % friability, and thickness, drug content

were well within acceptable limits

In-vitro dissolution study: All the formulations were

subjected to in-vitro dissolution studies and results are

shown in Figure 3-7. From dissolution study it revealed

that the formulation F1, F2 and F3 containing Xanthan

gum alone showed 101.05±0.65 for 7 hours,

102.43±0.32 for 9 hours and 98.12±0.45 for 10 hours

respectively. This showed that as concentration of

natural gum as release modifier increases the rate of drug

release from tablet decreases.

This may be because of an increase in polymer

concentration causes an increase in the viscosity of the

gel as well as the formation of gel layer with a longer

diffusional path. This may cause as decreased in the

effective diffusion co - efficient of the drug and therefore

a reduction in the drug release rate.Similarly formulation

F4, F5 and F6 containing Locust bean gum alone

showed 94.37±0.12, 92.67±0.52 and 87.34±0.21 in 12

hours respectively. Formulation F7, F8 and F9

containing Sodium alginate alone showed 102.34±0.78

for 9 hours, 99.24±0.78 for 9 hours and 104.74±0.96 for

11 hours respectively.

From this result it was found that Locust bean

gum retard more drug as compared to Xanthan gum and

Sodium alginate. Hence drug release retardation from

these three gums was found to be in following order.

Locust bean gum>Sodium alginate>Xanthan gum:

Results also showed that, formulation F10, F11 and F12

containing combination of Locust bean gum and

Xanthan gum in the ratio of 6:4 showed 103.85±0.15 for

11 hours, 98.95±0.42 for 12 hours and 87.64±0.85 for 11

hours. Similarly, formulation F13, F14 and F15

containing combination Locust bean gum and Sodium

alginate in the ratio of 9:1 showed 107.64±0.23 for 11

hours, 90.24±0.42 for 12 hours and 85.12±0.17 for 12

hours. This showed that combination of Locust bean

gum and Xanthan gum showed more drug retardation

than that of combination of Locust bean gum and

sodium alginate. Hence drug release retardation from

these combinations of gums was found to be in

following order

(Locust bean gum+ Xanthan gum) > (Locust bean

gum+ Sodium alginate): In-vitro drug release of all

formulations (F1-F15) was also compared with the

marketed preparation. The results showed that the drug

release profile of formulation F11 resembles with that of



marketed formulation. Hence formulation F11

containing combination of Locust bean gum and

Xanthan gum in the ratio of 6:4 was considered as

optimized formulation used for further study.

The kinetic treatment reflected that release data

of F11 showed R2 value of 0.9542 and 0.9920for first

order, and zero order equation respectively, indicating

that release of drug follows zero order kinetic Further

Korsmeyer and Peppas equation resulted into the value

of n = 0.3490, which is close to 1, indicating that the

drug release was approaching zero order kinetics.

Accelerated stability study on F11 formulation showed

that there was no considerable change in thickness,

hardness and drug content also there was no any

difference found between dissolution profile before and

after stability. Hence tablet prepared by using natural

gums as release modifier was found to be stable.

Table.1. Matrix tablet Formulation table Ingredients

(mg)

Drug Xanthan

Gum

Locust Bean

gum

Sodium

Alginate

Locust+

Xanthan

Gum(6:4)

Locust

+Sodium

Alginate (9:1)

Lactose Magnesium

Stearate

Total Wt

F1 100 50 - - - - 147 3 300

F2 100 100 - - - - 97 3 300

F3 100 150 - - - - 47 3 300

F4 100 - 50 - - - 147 3 300

F5 100 - 100 - - - 97 3 300

F6 100 - 150 - - - 47 3 300

F7 100 - - 50 - - 147 3 300

F8 100 - - 100 - - 97 3 300

F9 100 - - 150 - - 47 3 300

F10 100 - - - 50 - 147 3 300

F11 100 - - - 100 - 97 3 300

F12 100 - - - 150 - 47 3 300

F13 100 - - - - 50 147 3 300

F14 100 - - - - 100 97 3 300

F15 100 - - - - 150 47 3 300

Figure.1.Viscosity of various gums in combination with Locust

bean gum, AA: Agar agar, SA: Sodium alginate, GG: Guar gum,

GGh: Gum Ghutti

Figure.2.Viscosity of various gums in combination with Locust

bean gum, GA: Gum Acacia, GT: Gum tragacanth, XG: Xanthan

gum, GK: Gum karaya

Figure.3.Dissolution profile of formulation F1, F2, F3 and

marketed product

Figure.4.Dissolution profile of formulation F4, F5, F6

marketed product




marketed product


and marketed product

Figure.7.Dissolution profile of formulation F13, F14, F15 and marketed product

CONCLUSION

The Dissolution profile of formulation F10, F11, F12

and marketed product are compared and found satisfied with

norms as per dissolution profile so can be taken as ideal

product formulation and confirmed for further tablet studies.

REFERENCES

Behl A K, Dhake A.S, Formulation and Release

characteristics of sustained release Ofloxacin tablets,

Indian Drugs, 42 (5), 2005, 316-318.

Chien YW, Novel drug delivery system, Informa

Healthcare, 2nd edition revised and expanded, 50, 2010,

139-140.

Costa P, Lobo JM, Review-modeling and comparison of

diffusion profiles, Eur. J. Pharm. Sci, 13, 2001, 123-133.

Cremer K, Pharmaceutical application of layer tablet,

AAPS Pharm Sci Tech, 1, 2001, 1-10.

Dandgi P M, Mastiholimath V S, Studies Development

and evaluation of theophylline and salbutamol sulphate

sustained release matrix tablet, I. J. Pharm. Sci, (67)5,

2005, 598-602.

Durga prasad pattanayak, Subash C dinda, Bilayer tablet

formulation of metformin hydrochloride and

glimepiride: anovel approach toimprove therapeutic

efficacy, international journal of drug discovery and

herbal res earch, ijddhr, 1(1), 2011, 1-4.

Fassihi R, Yang L, Venkatesh G. Compaction simulator

study of a novel triplelayer tablet matrix for industrial

tableting, Int. J. Pharm, 1997; 152, 45-52.

Kavitha K, Rakesh K Deore and Theetha G

Tamizhmani, Preparation and Evaluation of Sustained

Release Matrix Tablets of Tramadol Hydrochloride

Using Compritol 888 ATO by Melt Granulation

Technique, Research Journal of Pharmaceutical,

Biological and Chemical Sciences, 1(3), 2010 , 431.

KPRChowdary, Murali KMN, Synthesis and evaluation

of starch-urea-borate as rate controlling matrix for

controlled release, Int. J. Pharm. Sci. Nano Tech, 1(2),

2008, 167-170.


Mobile: 00 91 9490717845 Email:[email protected]

MEMBERSHIP APPLICATION Dear Editor,

I/We wish to be Annual member of INDIAN JORNAL OF RESEARCH IN PHARMACY AND

BIOTECHNOLOGY from the year_____________ month_______________

1. Name in full/ Name of the organization:

2. Academic Qualifications and experience:

3. Corresponding Address:

4. Phone: E-mail:

Membership Fees per one year

(6 issues) from the date of

subscription

India Foreign

Individual/ Institution 2000 Indian Rupees

100 USD

Rs. / $/ ________________________________ remitted by Bank Draft No. Cheque No. /Cash / M.O. Receipt No.

________________Date ________________Banker’s Name___________________

Place: ____________________

Date: _____________________

(Signature of the applicant)

Note: DD should be drawn in favour of BADA PRAGATI KUMAR, payable at Vijayawada, Andhra Pradesh, India.

Kindly send the DD/ Cheque /M.O to the following address:

F.NO:501, PARAMESWARI TOWERS,

WEST IBRAHIMPATNAM,

IBRAHIMPATNAM MANDAL,

KRISHNA DISTRICT,

ANDHRA PRADESH, INDIA.

PINCODE: 521456

MOBILE: 00 91 9490717845