View
2
Download
0
Category
Preview:
Citation preview
Funderburgh et al page 1
Keratocyte Phenotype Mediates Proteoglycan Structure:
A Role for Fibroblasts in Corneal Fibrosis
James L. Funderburgh*, Mary M. Mann, Nirmala Sundarraj, Martha L.
Funderburgh
Department of Ophthalmology
University of Pittsburgh
Pittsburgh, PA
Supported by: National Institutes of Health Grant EY09368 (to JLF), EY003263 (to
NS), 30-EY08098 (University of Pittsburgh, Department of Ophthalmology
Core Grant), Research to Prevent Blindness, and Eye and Ear Foundation
of Pittsburgh. JLF is a Jules and Doris Stein Research to Prevent
Blindness Professor.
* Corresponding Author: Department of Ophthalmology, University of Pittsburgh,
1011 Eye and Ear Institute, 203 Lothrop Street, Pittsburgh, PA 15213-
2588. Telephone: 412 647 3853. FAX 412 647 5880. Email:
jlfunder@pitt.edu
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on August 20, 2003 as Manuscript M303292200 by guest on July 13, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Funderburgh et al page 2
Running Title: Glycosaminoglycans and Keratocyte Phenotype
Abbreviations: Gal, galactose; Gn, N-acetylglucosamine; TGFß, transforming growth
factor beta; FACE, fluorophore assisted carbohydrate electrophoresis; ALDH, aldehyde
3 dehydrogenase, RT-PCR, reverse transcriptase polymerase chain reaction; SLRP,
small leucine-rich proteoglycan; ß-D-xyloside, 4-nitrophenyl- ß-D-xylopyranoside
Key Words: cornea, fibrosis, scar, wound healing, keratan sulfate, dermatan sulfate,
TGFß, glycosaminoglycans, proteoglycans, alpha smooth muscle actin
Acknowledgements: The authors appreciate the advice and collaboration of Dr. Anna
Plaas in development of the FACE analysis experiments and of Dr. R. Lindahl for the
gift of antibodies to ALDH.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 3
Summary:
In pathological corneas, accumulation of fibrotic extracellular matrix is characterized by
proteoglycans with altered glycosaminoglycans that contribute to the reduced
transparency of scarred tissue. During wound healing, keratocytes in the corneal
stroma transdifferentiate into fibroblasts and myofibroblasts. In this study, molecular
markers were developed to identify keratocyte, fibroblast, and myofibroblast phenotypes
in primary cultures of corneal stromal cells, and the structure of glycosaminoglycans
secreted by these cells was characterized. Quiescent primary keratocytes expressed
abundant protein and mRNA for keratocan and aldehyde dehydrogenase class 3, and
secreted proteoglycans containing macromolecular keratan sulfate. Expression of these
marker compounds was reduced in fibroblasts and also in TGFß-induced
myofibroblasts, which expressed high levels of a-smooth muscle actin, biglycan, and
the EDA (EIIIA) form of cellular fibronectin. Collagen types I and III mRNAs were
elevated in both fibroblasts and in myofibroblasts. Expression of these molecular
markers clearly distinguishes the phenotypic states of stromal cells in vitro.
Glycosaminoglycans secreted by fibroblasts and myofibroblasts were qualitatively
similar and differed from those of keratocytes. Chondroitin/dermatan sulfate abundance,
chain-length, and sulfation were increased as keratocytes became fibroblasts and
myofibroblasts. Fluorophore-assisted carbohydrate electrophoresis (FACE) analysis
demonstrated increased N-acetylgalactosamine sulfation at both 4- and 6- carbons.
Hyaluronan, absent in keratocytes, was secreted by fibroblasts and myofibroblasts.
Keratan sulfate biosynthesis, chain length, and sulfation were significantly reduced in
both fibroblasts and myofibroblasts. The qualitatively similar expression of
glycosaminoglycans shared by fibroblasts and myofibroblasts suggests a role for
fibroblasts in deposition of non-transparent fibrotic tissue in pathological corneas.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 4
The corneal stroma is a dense connective tissue with a highly organized
extracellular matrix responsible for the remarkable strength and light transparency of the
cornea. A notable feature of this matrix is its unique proteoglycan content, consisting of
proteins of the small leucine-rich proteoglycan (SLRP) family. Lumican, a SLRP protein
abundant in the stroma, has been implicated in formation of the small and highly regular
collagen fibrils required for corneal transparency (1). The glycosaminoglycans
modifying SLRPs also appear to have a role in corneal transparency. Keratan sulfate in
cornea is of higher polymer length and at least an order of magnitude more abundant
than the keratan sulfate found in other tissues (2). Corneal chondroitin/dermatan
sulfate, conversely, is low in abundance and sulfate content compared to the dermatan
sulfate of skin and sclera (3). This unusual glycosaminoglycan composition has long
been considered important in corneal transparency, an hypothesis consistent with
several heritable disease conditions. Individuals with macular corneal dystrophy, for
example, develop cloudy corneas as a result of an inability to produce keratan sulfate
(4,5). In Hurler’s and Scheie’s syndromes, lack of glycosaminoglycan-degradative
enzymes results in accumulation of highly sulfated dermatan sulfate in the cornea,
causing corneal opacity at an early age (6,7).
Corneal proteoglycans are also implicated in the pathology of corneal scarring.
As a result of trauma or chronic corneal inflammation the stroma develops fibrotic
deposits that disrupt visual acuity. Such corneal scars are long-lasting and often
constitute the cause for corneal transplantation. A number of early studies showed that
corneal wound healing resulted in a reduction of keratan sulfate and in accumulation of
highly sulfated chondroitin/dermatan sulfate in the scar (3,8-14). More recent studies on
scars developing during the chronic stress associated with keratoconus showed a
glycosaminoglycan profile similar to that occurring in acute healing (15-19).
Corneal wound healing is associated with appearance in the stroma of cells with
phenotypes clearly distinct from those of the normal tissue. In the normal cornea
keratocytes are flattened, quiescent, neural crest-derived cells with a stellate
morphology. Extensive cellular processes link adjacent cells via gap junctions (20).
Filamentous actin is confined to the cortical region and is not organized into stress
fibers (21). In response to wounding, keratocytes become motile and mitotic and
develop actin cytoskeletal fibers associated with fibronectin in the extracellular matrix
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 5
(21). These fibroblastic cells also secrete metalloproteinases, thought to initiate tissue
remodeling (22). In latter stages of healing, keratocyte-derived fibroblasts express a-
smooth muscle actin incorporated into cytoplasmic stress fibers (23-27). These cells,
known as myofibroblasts, exhibit reduced motility and cell division compared to the
repair fibroblasts and may contribute to the contractile force involved in wound closure
(28,29). Myofibroblastic cells appear in response to transforming growth factor beta
(TGFß) and are associated with secretion of fibrotic extracellular matrix both in the
cornea and in other tissues.
In vitro, primary keratocytes can be maintained in serum-free or low-
mitogen serum-containing culture media in a quiescent state exhibiting a cellular
morphology and matrix secretion similar to keratocytes in vivo (21,30). When stromal
cells are subjected to serial passage in media containing fetal bovine serum they lose
the dendritic morphology typical of keratocytes, develop actin stress fibers, and begin
secretion of metalloproteinases (31,32). In response to endogenous or exogenous
TGFß, stromal fibroblasts become myofibroblasts, expressing a-smooth muscle actin
(33,34).
Cultures of quiescent primary keratocytes secrete proteoglycans similar to those
found in vivo, including all three of the proteoglycans bearing keratan sulfate- lumican,
keratocan, and mimecan (30,31,35). It has long been observed that keratan sulfate
secretion is greatly reduced or absent in serially passaged corneal fibroblasts (36) and
we recently demonstrated that freshly isolated primary bovine keratocytes exhibit a loss
of sulfated keratan sulfate-proteoglycans and an increase in sulfated
chondroitin/dermatan sulfate-containing proteoglycans during transdifferentiation from
keratocytes to myofibroblasts (35). That previous study showed that myofibroblasts
exhibit reduced expression of keratocan, a keratan sulfate-linked proteoglycan and
upregulate biglycan, a dermatan sulfate proteoglycan. These proteins, however,
represent minor components of the total cellular proteoglycan, and the overall
expression of core proteins modified by keratan sulfate and chondroitin/dermatan
sulfate was not greatly altered in myofibroblasts compared to keratocytes. Incorporation
of labeled sulfate into proteoglycans, however, did exhibit marked differences between
the two phenotypes with chondroitin/dermatan sulfate increased and keratan sulfate
decreased. This observation lead to the hypothesis that a major feature of the alteration
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 6
in corneal proteoglycan profile during the phenotypic transition in wound healing arises
via modulation of the structure of the glycosaminoglycan chains modifying the core
proteins.
The present study addresses this hypothesis by characterization of keratan
sulfate and chondroitin/dermatan sulfate chains modifying proteoglycans secreted by
stromal cells of different phenotypes. Primary, non-passaged keratocyte cultures were
characterized using molecular markers to identify the keratocyte, fibroblast, and
myofibroblast phenotypes. Structural analyses of glycosaminoglycans secreted by the
three cell types demonstrated a marked increase in chain length and sulfation of
chondroitin/dermatan sulfate in both fibroblasts and myofibroblasts and a reduction in
both sulfation and chain length of the keratan sulfate secreted by fibroblasts and
myofibroblasts. These results establish the key link between cells observed in
pathological corneas and specific alterations in biosynthesis of corneal
glycosaminoglycans.
Experimental Procedures
Cell culture. Primary keratocytes were obtained from fresh bovine corneal
stromae by collagenase digestion as previously described (35). The cells were diluted
in serum-free DME/F12 medium containing antibiotics and cultured on tissue culture-
treated plastic at 4 x 104 cells/cm2 (keratocytes) or 1 x 104/cm2 (fibroblasts and
myofibroblasts) in a humidified atmosphere containing 5% CO2. Culture medium was
changed after 24 hr (day 1) to DMEM/F12 with antibiotics (35) for keratocytes, or the
same containing 2% fetal bovine serum for fibroblasts and 2% fetal bovine serum with 2
ng/ml recombinant human TGFß1 (Sigma-Aldrich, Inc.) to induce myofibroblast
formation. These media were changed at day 4 and cultures were harvested at day 5
or 6 as noted in the figure legends.
Glycosaminoglycans. Cultures were labeled with 100 µCi/ml carrier-free 35S-
sulfate (DuPont/NEN) added on day 5 and the medium collected on day 6. In some
experiments 0.5 mM 4-nitrophenyl-ß-D-xylopyranoside (Sigma-Aldrich, #N2132) was
added 1 hr before labeling. Proteoglycans in the culture medium were purified by ion
exchange chromatography, dialyzed against water, and lyophilized. For
chondroitin/dermatan sulfate quantitation, glycosaminoglycans from 6 identical 9.5 cm2
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 7
cultures were dissolved and combined to make triplicate samples of 100 µl in 0.1M Tris-
acetate pH 8. These were digested with 2 µl of chondroitinase ABC (Sigma-Aldrich
#C3667), 10 units/ml, for 2 hr at 37º C. Digested products were recovered by
ultrafiltration with Microcon YM-3 microfiltration devices (Millipore). Keratan sulfate was
digested in a similar manner using a mixture of 0.2 mU of E Freundii endo-ß-
galactosidase and 0.2 mU keratanase II (Seikagaku) in 0.05 M sodium acetate, pH 6.5,
at 37º C, overnight. The amount of labeled fragments liberated by digestion was
determined by scintillation counting, corrected for non-digested controls, and normalized
to protein content of the cells as described below.
For size determination, chondroitin/dermatan sulfate proteoglycans were
separated from total 35S-labeled proteoglycans by selective alcohol precipitation without
enzymatic digestion of keratan sulfate (37). Protein was hydrolyzed with 20 µg/ml
proteinase K twice for 30 minutes at 45º C in 0.1M Tris-HCl, pH 7.4, containing 0.1%
SDS. Chondroitin/dermatan sulfate from xyloside-treated cultures were analyzed in the
same manner. Keratan sulfate chains were obtained from total 35S-proteoglycans by
treatment with chondroitinase ABC (as above), dialysis, lyophilization, and proteinase K
digestion in a similar manner. The protein-free 35S-glycosaminoglycan chains were
subjected to SDS-PAGE on 4-20% gels (chondroitin/dermatan sulfate) or 10-20% gels
(keratan sulfate), electrotransferred in buffer without methanol to Genescreen Plus
charged nylon membranes (DuPont NEN), and subjected to autoradiography as
previously described (35).
FACE analysis of glycosaminoglycans. Non-labeled proteoglycans were purified
from media of triplicate 75 cm2 cultures, conditioned on days 4-6 as described above.
These were digested with chondroitinase ABC in 0.1M ammonium acetate, pH 7.5 or
with combined keratanase II and endo-ß-galactosidase in 0.1M ammonium acetate, pH
6.5, followed by collection of the products by ultrafiltration as described above. Dried
aliquots of the digestion products were fluorescently labeled with 5 µl of 0.1M 2-
aminoacridone in 3:17 acetic acid:dimethylsulfoxide for 15 min followed by 5 µl of
freshly dissolved cyanoborohydride 1M at 37º overnight (38). Borohydride was
quenched with 30 µl of 25% glycerol and 2 µl of 1 mg/ml bromphenol blue. The
derivitized digestion products were separated on 8 x 10 x 0.05 cm gels of 28.5%
acrylamide: 0.76% bisacrylamide containing 0.1 M Tris-HCl, pH 8. The running buffer
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 8
was 0.089 M Tris-borate, 2 mM EDTA, pH 8.4, chilled to 4º C. This formulation
duplicates the separation previously described for gels from Glyco Corp (38) which are
no longer available. Electrophoresis was carried out on ice at 5 watts constant power
per gel. Fluorescent bands were immediately photographed using a 12 bit BioRad
FluorS Max imaging system and quantification was accomplished with Biorad Quantity
One software. FACE bands generated by chondroitinase were identified by co-
electrophoresis with purified standards of fragments from chondroitin sulfate and
hyaluronan (Sigma-Aldrich, Inc.). Monosaccharide standards for keratan sulfate
analysis were purchased from Sigma. Disaccharide standards were produced by
digestion of purified bovine corneal keratan sulfate (Seikagaku) with endo-ß-
galactosidase or keratanase II, purified by size exclusion chromatography on a
Superdex-Peptide column (Pharmacia), and identified by FACE analysis as previously
described (38). Molecular mass of the disaccharide keratan sulfate standards was
confirmed by MALDI/TOFF mass spectroscopy (39).
Histology. Cellular morphology was observed after 2 days in cultures fixed in
100% methanol, 20 min and then stained with 1% crystal violet in 20% ethanol for 30
minutes followed by destaining in water. The cells were photographed by brightfield
optics with a 20x objective. For cytoskeletal analysis, cells after 2 days culture were
fixed in room temperature paraformaldehyde (35) and double-stained with Alexa-488
labeled phalloidin (Molecular Probes) and with anti-vinculin clone hVIN-1 (Sigma-
Aldrich, Inc) followed by goat anti-mouse labeled with Alexa-546 (Molecular Probes)
using procedures previously described (35). Six-day cultures were similarly fixed and
stained for a-smooth muscle actin with anti-smooth muscle actin (clone asm-1, Sigma-
Aldrich) followed by Alexa-546-goat anti-mouse antibody in a similar manner.
Cytoskeletal photographs were acquired on a Biorad Laser Scanning Confocal
microscope using a 60x oil objective.
Real-time Reverse Transcriptase PCR. Cells were collected by centrifugation
after scraping into cold saline and RNA isolated using RNeasy Mini kit (Qiagen). RNA
was treated with DNase I (Ambion) according to supplier’s protocol and then
concentrated by alcohol precipitation in the presence of GlycoBlue (Ambion). RNA was
quantified by fluorimetry using RiboGreen (Molecular Probes).
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 9
RNA (400 ng) was transcribed to cDNA in a 100ul reaction containing 1X PCR II
buffer (Roche), 5mM MgCl2, 800 µM dNTP mix, (Roche); 2.5 µM random hexamers
(Invitrogen), 0.4 U RNase inhibitor, and 125 U SuperScript II reverse transcriptase
(Invitrogen). PCR was carried out for 40 cycles of 15’ @ 95º, 60’ @ 60º after an initial
incubation at 95º for 10 min in an ABI7700 thermocycler. Reaction volume was 50 µl
containing 1 x TaqMan Buffer A (Applied Biosystems), 5 mM MgCl2, 300 µM each
dNTP, 0.025 U/ml AmpliTaq Gold polymerase and 5 µl of cDNA. Forward and reverse
primers and fluorescent internal hybridization probes for each gene, as shown in Table
I, were used at optimized concentrations. Sequences for these genes were obtained
from GenBank except for that of the EDA form of bovine fibronectin. This information
was obtained by direct sequencing of RT-PCR amplification products obtained from
myofibroblast cDNA using primers based on published flanking sequence data. The
bovine EDA sequence thus obtained was deposited in GenBank with accession number
AY221633. Amplification efficiency for each of the primer pairs shown was determined
to be >90%.
For each gene/cDNA combination, amplifications without reverse transcriptase
were carried out as negative controls. Amplification of 18S ribosomal RNA was carried
out for each cDNA (in triplicate) for normalization of RNA content. Threshold cycle
number (Ct) of amplification in each sample was determined by ABI software. Relative
mRNA abundance was calculated as the Ct for amplification of a gene-specific cDNA
minus average Ct for 18S, expressed as a power of 2; i.e., 2DCt
. Three individual gene-
specific values, thus calculated, were averaged to obtain standard errors.
Immunoblotting. Proteoglycans from culture media collected at days 4-6 were digested
with chondroitinase ABC or keratanase II and endo-ß-galactosidase as described
above. Samples from the digests, normalized for cell number (by total cell DNA
content), were separated on 10% SDS-PAGE gels and transferred to PVDF
membranes, subjected to immunoblotting as previously described. Keratan sulfate,
biglycan and keratocan were detected in proteoglycans pooled from 3-4 individual
cultures. Biglycan was examined in chondroitinase digests and keratocan after digestion
of keratan sulfate. Cell layers were lysed directly in 1% SDS sample buffer. Protein
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 10
was determined using the Micro BCA assay (Pierce) and DNA by fluorimitry with
PicoGreen (Molecular Probes). Equal amounts of protein were separated by SDS-
PAGE, 10% gels for ALDH and a-smooth muscle actin, 4-20% for keratan sulfate and
fibronectin. Proteins were either stained with Coomassie Blue (40) or alternately
electrotransferred to PVDF membranes and subjected to immunodetection (35) with
antibodies to cellular fibronectin (clone IST-9, Accurate Chemical), ALDH (41), antibody
J36 against keratan sulfate (37), a peptide antibody to biglycan (42), or monoclonal
antibody to a-smooth muscle actin (Clone 1A4, Sigma-Aldrich, Inc.). Keratocan was
detected using an antibody generated against a mixture of 10 synthetic peptides each
encoding a unique amino acid sequence of bovine keratocan linked to KLH carrier. This
antiserum was prepared and affinity purified as described for anti-lumican peptide
antibodies (43).
Results
Morphology of corneal phenotypes in vitro. Primary bovine keratocytes isolated from
fresh stroma by collagenase digestion and cultured in absence of serum, exhibited a
dendritic (stellate) morphology (Figure 1A) with multiple extended processes
interconnecting individual cells. Phalloidin staining (Figure 1D) revealed filamentous
actin in the cortical region and associated with the cell-cell contacts at the intersection of
the cell processes. Vinculin staining was weak, diffuse, and mostly perinuclear in
localization. When cells prepared in a similar manner were exposed to 2% fetal bovine
serum for 2 days the cells became larger, flattened with a reduction in processes
(Figure 1B). Many cells were polarized with pseudopodial extensions (arrows)
indicating motility. In these cells, filamentous actin formed stress fibers traversing the
cell body (Fig 1E). Vinculin was focally localized at the terminus of the actin fibers as is
typical for matrix-adherent fibroblasts. Keratocyte cultures exposed to both fetal bovine
serum and TGFß1 contained larger, less refractile cells with a polygonal appearance.
Fewer obviously motile cells were observed (Figure 1C). Filamentous actin fibers were
thicker and fewer in number than in fibroblastic cells (Fig 1F). Vinculin accumulation in
focal adhesion was denser and larger than in fibroblasts. After 5 days of culture
numerous cells were observed in which actin fibers stained with antibodies to a-smooth
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 11
muscle actin (Figure 1G). Cells in serum free medium (keratocyte phenotype) or grown
in the fibroblastic phenotype did not exhibit a-smooth muscle actin staining (not shown).
Expression of Phenotypic Markers. Primary stromal cells in conditions similar to
those in Figure 1 exhibited differential expression of a number of marker molecules.
a-Smooth muscle actin, cellular fibronectin, and biglycan are associated with
myofibroblasts in vitro and in vivo. Immunoblotting showed a marked abundance of
these three proteins in TGFß-induced myofibroblasts compared with keratocyte and
fibroblast cultures (Figure 2A, 2B, 2C). Accumulation of ALDH was recently reported to
be a distinguishing feature of keratocytes in vivo (44). This protein, described as a
corneal crystallin, represents one of the major soluble proteins in keratocytes but is
reduced in fibroblasts populating healing wounds. ALDH was detected in all of the
cultured bovine stromal cells but its concentration was markedly elevated in cells
maintained in the keratocyte morphology (Fig 2D). The immunostained ALDH band
corresponded to a major protein of about 54 kDa, visualized by Coomassie blue
staining, prominent in keratocyte cell lysates but not apparent in lysates from fibroblasts
and myofibroblasts (Fig 2E).
Keratan sulfate glycosaminoglycan chains and keratocan, a SLRP core of
corneal keratan sulfate proteoglycan, are extracellular products highly enriched in the
corneal stroma. Immunoblotting using monoclonal antibody J36 to keratan sulfate
revealed heterogeneous high molecular weight keratan sulfate in proteoglycans isolated
from keratocyte culture media (Fig 2F). In fibroblasts, J36 epitopes were reduced in
molecular size to a band of 50-60 kDa. In myofibroblasts the J36 keratan sulfate epitope
was not detected. Keratan sulfate-linked proteins secreted by keratocytes also
contained abundant keratocan in the proteoglycans isolated from quiescent cultures of
keratocytes (Fig 2G). Keratocan was decreased in fibroblasts and almost undetected in
myofibroblast cultures.
Real-time quantitative RT-PCR analysis assays were designed to detect mRNA
for the five proteins identified in Figure 2. Relative abundance of the transcript pools for
these five proteins (Table II) showed that the protein expression levels detected by
Western blotting was consistent with differences in mRNA pools for these proteins.
Pools for a-smooth muscle actin, biglycan and cellular fibronectin were increased 12 to
39 fold in myofibroblasts compared to keratocytes. Fibroblasts, however, had little
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 12
increase in these mRNAs compared to keratocytes. Keratocan transcripts were
decreased 15 fold in fibroblasts and 50 fold in myofibroblasts as compared to
keratocytes. Similarly, ALDH transcript abundance was 700- and 2000 -fold lower in
fibroblasts and myofibroblasts, respectively, compared to keratocytes. These assays
link gene expression associated with in vivo cell phenotypes with the cell culture model.
Collagen Expression. Collagen type I represents the major fibrillar collagen of
the cornea, but synthetic levels of collagen I are low in adult non-wounded corneas (45).
Collagen III is a fibrillar cornea present in fetal and wounded cornea but only a very
minor component of adult corneal stroma (45). We previously found by that mRNA and
protein for collagen I and III were upregulated in myofibroblasts compared to
keratocytes (35). Real-time PCR analysis of the mRNA pools for these collagens
(Table II) confirmed these increases in myofibroblasts. These assay also showed that,
unlike other myofibroblastic markers, mRNA pools for collagens are upregulated in
fibroblasts as well as myofibroblasts.
Glycosaminoglycan biosynthesis by corneal cells. Proteoglycans were
metabolically labeled for 18 hr with 35S-sulfate and isolated from culture media by ion
exchange chromatography. In initial experiments greater than 95% of sulfated
glycosaminoglycan isolated from the media of the cultures was determined to be
keratan sulfate and chondroitin/dermatan sulfate (data not shown). Thus heparan
sulfate does not constitute a significant fraction of the soluble glycosaminoglycan
secreted by these cultures. Keratan sulfate in the labeled proteoglycans, determined by
sensitivity to endo-ß-galactosidase and keratanase II, was reduced by about 40% in
fibroblasts and about 60% in myofibroblasts compared to keratocytes (Figure 3A).
Conversely, 35S-labeled chondroitin/dermatan sulfate, measured by sensitivity to
chondroitinase ABC, was increased 3-3.5 fold in fibroblasts and myofibroblasts
compared with keratocytes. In the presence of nitrophenyl-ß-D-xyloside, a synthetic
initiator of chondroitin polymerization, chondroitin/dermatan sulfate biosynthesis was
increased >5 fold in all cultures as compared to cultures without this initiator (data not
shown) suggesting that (as with many cell types) chain initiation represents a rate-
limiting step in chondroitin and dermatan sulfate synthesis. In the presence of ß-
xyloside, fibroblasts continued to incorporate about 3-fold more sulfate than keratocytes
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 13
(Figure 3C) but myofibroblasts increased the relative biosynthesis to almost 6-fold that
of keratocytes.
The size of the 35S-labeled glycosaminoglycan chains was determined by
polyacrylamide gel electrophoresis after proteolytic removal of the core proteins.
Keratan sulfate produced by fibroblasts and myofibroblasts decreased compared to that
of keratocytes, whereas chondroitin/dermatan sulfate chain length increased (Figure 4A
and 4B). Chondroitin/dermatan sulfate made in the presence of ß-xyloside was smaller
than that without this initiator, but did not increase in fibroblasts and myofibroblasts
(Figure 4C). These results suggest a relationship between rate of chain initiation and
final chain length in chondroitin/dermatan sulfate.
Analysis of non-labeled chondroitin/dermatan sulfate secreted by the keratocyte
cultures was carried out by FACE analysis after chondroitinase digestion. As shown in
Figure 5A, keratocyte cultures contained sulfated and non-sulfated disaccharides in
about a 3:2 ratio. Sulfation was primarily on the 4 position of the N-acetylgalactosamine.
In fibroblasts the non-sulfated component was significantly lower and both 4-O and 6-O
sulfation increased. In myofibroblasts 4-O sulfation represented the majority of the
moieties and unsulfated chondroitin disaccharide was reduced to <5% of the total.
Quantitation of chondroitin disaccharides is depicted in Figure 5B. Hyaluronan was also
detected in this analysis, and quantitation of hyaluronan secreted by the different
cultures is shown in Figure 5C. As shown, hyaluronan was not detected in keratocyte
culture media, but hyaluronan represented 1.5% and 4.5% of the chondroitinase-
sensitive glycosaminoglycan in fibroblast and myofibroblast cultures.
A large number of fragments is generated by enzymatic depolymerization of
keratan sulfate (46-48). Characterization of these has employed a variety of analytical
approaches including FACE, a technique which can be used to quantitate major
components of corneal keratan sulfate (38,49). Digestion of keratan sulfate from
keratocyte culture media with mixed keratanase II and endo-ß-galactosidase generated
eleven major bands visualized on FACE (Figure 6A). Of these, mono- and
disaccharides involved in keratan sulfate chain extension constituted about 60% of
fragments secreted by keratocyte cultures (Fig 6B – black bars). The abundance of this
set of fragments dropped about 5-fold in the media from fibroblast and myofibroblast
cultures. The abundance of these chain extension fragments as a proportion of the total
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 14
fragments was also reduced in the fibroblasts and myofibroblasts. Based on previous
studies of keratan sulfate structure, it seems likely that most of the unidentified bands
(Fig 6B- gray bars) released by enzyme digestion represent moieties capping the non-
reducing terminus of keratan sulfate. A variety of such capping structures has been
documented in corneal keratan sulfate by NMR and these components also are present
in FACE analysis of keratan sulfate (38). These components showed no significant
decrease in fibroblasts and myofibroblasts compared to keratocytes (Fig 6B). Reduction
of keratan sulfate chain length would reduce the ratio of chain extension moieties to
capping fragments. Thus the altered ratio of chain extension moieties to total
degradation products in fibroblasts and myofibroblasts shown in Fig 6B is consistent
with a reduced keratan sulfate chain length as seen in Fig 4.
Discussion
For more than half a century the unique glycosaminoglycan composition of the
cornea has been thought to be important to corneal transparency. Studies of
pathological corneas, hereditary diseases, and knockout mouse mutations have helped
confirm this hypothesis. During the last decade, studies have identified distinct
phenotypes of stromal cells present in healing wounds (50). In the current study we set
out to manipulate primary cultures of stromal cells to reproduce these phenotypic
characteristics observed in vivo, and to characterize their glycosaminoglycan
biosynthesis. Although there are numerous previous studies of glycosaminoglycan
biosynthesis in cultured corneal cells, an important aspect of this study is the use of
primary cells without subculture, and the linking of cultured cells to in vivo phenotypes
using molecular markers. Previous studies have not employed such stringent criteria,
thus comparisons extracellular matrix biosynthesis in our model system are likely to
reflect the pathological process more accurately than earlier studies.
The phenotype of the cultured cells was clearly distinguishable by the molecular
markers they expressed. The ALDH family of proteins is highly expressed in corneal
epithelium and stroma and may serve a non-enzymatic function (44,51). ALDH is
downregulated during wound healing making it a marker for the quiescent keratocyte in
vivo (44,52). In our study, both ALDH protein and mRNA were dramatically
downregulated as quiescent keratocytes were activated by serum to become
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 15
fibroblastic. Keratocan, a SLRP protein highly expressed in the corneal stroma, served
as a second marker of the keratocyte phenotype. Both protein and mRNA pools for this
protein were reduced in the fibroblasts and myofibroblasts suggesting regulation of
expression at the nucleic acid level. A third marker of importance is the use of a
monoclonal antibody to keratan sulfate. Although many such antibodies have been
described, none yet has proved useful for detection of corneal keratan sulfate made in
vitro. The finding that antibody J36 can serve such a function provides an important tool
for non-disruptive screening of cultured keratocytes. It should be noted that expression
of the J36 epitope does not correlate with total abundance of keratan sulfate chains as
determined in Figs 3,4,6. As with previously described monoclonal antibodies(53) J36
probably recognizes a series of sulfated disaccharides in the some keratan sulfate
chains. In the shorter, less highly sulfate chains these structures may be absent. Thus
the J36 antibody is valuable as a qualitative but not quantitative assessment of keratan
sulfate expression.
Fibroblasts were readily distinguished from keratocytes by the development of
actin cytoskeleton, focal adhesions and the loss of keratocyte gene marker expression.
Myofibroblasts share these characteristics with fibroblasts but, in addition, express
protein and mRNA for a-smooth muscle actin. Such expression serves as a de facto
definition of myofibroblasts. The alternately spliced form of cellular fibronectin that
contains the type III extra domain A (EDA or EIIIA) is associated with healing wounds
and fibrosis in cornea and other tissues (54-56). Expression of this matrix molecule
serves as a marker of fibrotic extracellular matrix that is closely linked to intracellular a-
smooth muscle actin expression in granulation tissue myofibroblasts (57). Biglycan, a
SLRP protein that is modified with chondroitin/dermatan sulfate, similarly, is associated
with tissue fibrosis, corneal scars, and was previously identified as a product of corneal
myofibroblasts (19,35,58,59). The combination of a-smooth muscle actin, biglycan, and
cellular fibronectin provides a powerful set of tools for distinguishing myofibroblasts from
fibroblasts.
The availability of these three well-characterized phenotypes of primary cells
from corneal stroma allows us to pose important questions regarding extracellular
matrix synthesis by these cells. A long-time observation regarding healing corneal
wound and corneal scar tissue is the reduction or disappearance of stromal
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 16
proteoglycans containing keratan sulfate. This change may be key to corneal
transparency in view of recent studies linking loss of a keratan sulfate-specific
sulfotransferase to macular corneal dystrophy (60). Our previous work has
demonstrated that the corneal SLRP proteins to which keratan sulfate is attached
continue to be expressed by keratocytes both in vivo and in vitro. In spite of dramatic
changes keratocan, total keratan sulfate-linked protein does not change dramatically as
keratocytes become myofibroblasts (35) suggesting changes in the keratan sulfate
chains. Earlier studies typically expressed keratan sulfate biosynthesis as a proportion
of the total glycosaminoglycan biosynthesis. Our current data documents that keratan
sulfate and chondroitin/dermatan biosynthetic rates are independent and altered in
opposite directions. These results are consistent with the data showing these
glycosaminoglycans to be synthesized by different glycosyl- and sulfotransferases and
implies that activity of the enzymes is regulated independently.
Metabolic labeling with sulfate and western blotting with anti-keratan sulfate
antibodies suggested that keratan sulfate chains produced by fibroblasts and
myofibroblasts are shorter and contained less sulfate than the keratan sulfate made by
keratocytes. FACE analysis supported these conclusions. Figure 6 shows a reduction in
the ratio of sulfated disaccharides involved in chain elongation and components
associated with non-reducing terminus of the chains. This ratio is consistent with shorter
keratan sulfate chains observed directly by electrophoresis in Figure 4. Keratan sulfate-
linked SLRP proteins are not greatly reduced in myofibroblasts, nor are the compounds
in the FACE gels in Figure 6 representing non-reducing termini of these chains. The
conclusion from these observations is that alteration of keratan sulfate in fibroblasts and
myofibroblasts (and be implication, in corneal scars) is due almost entirely to a
shortening of the keratan sulfate length and not a reduction in the number of chains.
Corneal keratan sulfate biosynthesis exhibits a strong link between glucosamine
sulfation and chain elongation (38,60). Chick stromal cells in culture exhibit a loss in
chain elongation associated with decreased sulfotransferase activity (61). Our results
are consistent with a similar alteration in bovine keratocytes as they become fibroblasts.
Increases in chondroitin/dermatan sulfate have been reported in corneal scar
tissue, a change that appears to be stable for extended periods of time beyond active
wound healing (10-12,19). Here we observed increases in chondroitin/dermatan
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 17
sulfation and chain length in both fibroblasts and myofibroblasts. The differential in
sulfate incorporation was maintained in the presence of saturating levels of ß-D-xyloside
suggesting that differences between the cell phenotypes result from an altered
biosynthetic capacity in the fibroblastic and myofibroblastic cells rather than an increase
in the availability of core protein initiation sites. The fact that differences in
chondroitin/dermatan sulfate molecular size were eliminated in the presence of xyloside
suggests that the chain length may be a function both chain elongation capacity and the
abundance of initiation sites.
Relative sulfation of the chondroitin/dermatan chains increased in addition to the
chain length. The ratio between 4-O and 6-O sulfation was not altered and there was
no detection of disulfated disaccharides in the chondroitin/dermatan sulfate from
fibroblastic and myofibroblastic cells. Simultaneous sulfation of 4-O and 6-O moieties in
chondroitin/dermatan sulfate is unusual (62). Our current data do not distinguish if the
4-O and 6-O sulfation is in same molecule of the or of a mixture of chains modified only
on one site. The relative sulfation was increased in fibroblasts and myofibroblasts in
both untreated and xyloside treated cultures (data not shown). Thus unlike keratan
sulfate, chain extension and sulfation in chondroitin/dermatan may be regulated
independently.
Increased amount and sulfation of chondroitin/dermatan sulfate in corneal scars
has been reported in several studies but the finding of increased molecular size is
novel. Presence of larger chondroitin/dermatan sulfate molecules in scar tissue is
consistent with the appearance of exceptionally large chondroitinase-sensitive cuprolinic
blue stained filaments in the interfibrillar spaces fibrotic regions of pathological corneas
(63). Because chondroitin/dermatan proteoglycans bind water more tightly than
keratan sulfate an accumulation of these large more highly sulfated molecules could
disrupt critical stromal collagen spacing due to their hydrodynamic volume.
Hyaluronan has been characterized in healing corneas but the source has not
been identified (3,10,14,64). The current study suggests that keratocytes activated into
the fibroblastic or myofibroblastic phenotypes could be a source of the wound-healing
hyaluronan. The identification of diverse biological effects of hyaluronan including
stimulation of cell motility lends a potential importance of this observation to cellular
events in healing wounds.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 18
Overall both fibroblasts and myofibroblasts exhibited a qualitatively similar
alteration in glycosaminoglycan biosynthesis compared to keratocytes. Keratan sulfate
was reduced in amount, chain length, and sulfation whereas chondroitin/dermatan
sulfate was increased in abundance, chain length and sulfation. The differences
between fibroblasts and myofibroblasts were quantitative rather than qualitative. This
pattern was similar to that observed with collagen mRNA pool. This observation is
significant in terms of the concept of the myofibroblast as a fibrogenic phenotype.
Transforming growth factor ß and the myofibroblastic cells that appear in response to
this cytokine are generally recognized to be associated with connective tissue
deposition, scar tissue formation and fibrosis (65,66). Fibroblasts, conversely have
been associated with metalloproteinase secretion and tissue remodeling (22,50). Our
results suggest that neither myofibroblasts nor TGFß is required for stromal cells to
secrete glycosaminoglycans and collagens similar to those of scar tissue. Thus
myofibroblastic cells may not be the sole source of all the molecular components of scar
tissue.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 19
References
1. Chakravarti, S., Petroll, W. M., Hassell, J. R., Jester, J. V., Lass, J. H., Paul, J., and
Birk, D. E. (2000) Invest Ophthalmol Vis Sci 41, 3365-3373
2. Funderburgh, J. L., Caterson, B., and Conrad, G. W. (1987) J Biol Chem 262,
11634-11640
3. Hassell, J. R., Cintron, C., Kublin, C., and Newsome, D. A. (1983) Arch Biochem
Biophys 222, 362-369
4. Hassell, J. R., Newsome, D. A., Krachmer, J. H., and Rodrigues, M. M. (1980) Proc
Natl Acad Sci U S A 77, 3705-3709
5. Nakazawa, K., Hassell, J. R., Hascall, V. C., Lohmander, L. S., Newsome, D. A.,
and Krachmer, J. (1984) J Biol Chem 259, 13751-13757
6. Huang, Y., Bron, A. J., Meek, K. M., Vellodi, A., and McDonald, B. (1996) Exp Eye
Res 62, 377-387
7. Quantock, A. J., Meek, K. M., Fullwood, N. J., and Zabel, R. W. (1993) Can J
Ophthalmol 28, 266-272
8. Cintron, C., Gregory, J. D., Damle, S. P., and Kublin, C. L. (1990) Invest Ophthalmol
Vis Sci 31, 1975-1981
9. Anseth, A. (1969) Exp Eye Res 8, 310-314
10. Anseth, A., and Fransson, L. A. (1969) Exp Eye Res 8, 302-309
11. Anseth, A. (1969) Exp Eye Res 8, 438-441
12. Anseth, A. (1972) Isr J Med Sci 8, 1543-1544
13. Funderburgh, J. L., Cintron, C., Covington, H. I., and Conrad, G. W. (1988) Invest
Ophthalmol Vis Sci 29, 1116-1124
14. Funderburgh, J. L., and Chandler, J. W. (1989) Invest Ophthalmol Vis Sci 30, 435-
442
15. Funderburgh, J. L., Funderburgh, M. L., Rodrigues, M. M., Krachmer, J. H., and
Conrad, G. W. (1990) Invest Ophthalmol Vis Sci 31, 419-428
16. Yue, B. Y., Sugar, J., and Schrode, K. (1988) Curr Eye Res 7, 81-86
17. Wollensak, J., and Buddecke, E. (1990) Graefes Arch Clin Exp Ophthalmol 228,
517-523
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 20
18. Rodrigues, M., Nirankari, V., Rajagopalan, S., Jones, K., and Funderburgh, J.
(1992) Am J Ophthalmol 114, 161-170
19. Funderburgh, J. L., Hevelone, N. D., Roth, M. R., Funderburgh, M. L., Rodrigues, M.
R., Nirankari, V. S., and Conrad, G. W. (1998) Invest Ophthalmol Vis Sci 39, 1957-
1964
20. Watsky, M. A. (1995) Invest Ophthalmol Vis Sci 36, 2568-2576
21. Jester, J. V., Barry, P. A., Lind, G. J., Petroll, W. M., Garana, R., and Cavanagh, H.
D. (1994) Invest Ophthalmol Vis Sci 35, 730-743
22. Girard, M. T., Matsubara, M., Kublin, C., Tessier, M. J., Cintron, C., and Fini, M. E.
(1993) J Cell Sci 104 ( Pt 4), 1001-1011
23. Jester, J. V., Rodrigues, M. M., and Herman, I. M. (1987) Am J Pathol 127, 140-148
24. Garana, R. M., Petroll, W. M., Chen, W. T., Herman, I. M., Barry, P., Andrews, P.,
Cavanagh, H. D., and Jester, J. V. (1992) Invest Ophthalmol Vis Sci 33, 3271-3282
25. Ishizaki, M., Zhu, G., Haseba, T., Shafer, S. S., and Kao, W. W. (1993) Invest
Ophthalmol Vis Sci 34, 3320-3328
26. Jester, J. V., Petroll, W. M., Barry, P. A., and Cavanagh, H. D. (1995) Invest
Ophthalmol Vis Sci 36, 809-819
27. Latvala, T., Barraquer-Coll, C., Tervo, K., and Tervo, T. (1996) J Refract Surg 12,
677-683
28. Jester, J. V., Barry-Lane, P. A., Petroll, W. M., Olsen, D. R., and Cavanagh, H. D.
(1997) Cornea 16, 177-187
29. Vaughan, M. B., Howard, E. W., and Tomasek, J. J. (2000) Exp Cell Res 257, 180-
189.
30. Beales, M. P., Funderburgh, J. L., Jester, J. V., and Hassell, J. R. (1999) Invest
Ophthalmol Vis Sci 40, 1658-1663
31. Long, C. J., Roth, M. R., Tasheva, E. S., Funderburgh, M., Smit, R., Conrad, G. W.,
and Funderburgh, J. L. (2000) J Biol Chem 275, 13918-13923
32. Cook, J. R., Mody, M. K., and Fini, M. E. (1999) Invest Ophthalmol Vis Sci 40, 3122-
3131
33. Jester, J. V., Barry-Lane, P. A., Cavanagh, H. D., and Petroll, W. M. (1996) Cornea
15, 505-516
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 21
34. Masur, S. K., Dewal, H. S., Dinh, T. T., Erenburg, I., and Petridou, S. (1996) Proc
Natl Acad Sci U S A 93, 4219-4223
35. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., Corpuz, L., and Roth, M. R.
(2001) J Biol Chem 276, 44173-44178
36. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., Prakash, S., and Conrad, G.
W. (1996) J Biol Chem 271, 31431-31436
37. Sundarraj, N., Chao, J., Gregory, J. D., and Damle, S. P. (1986) J Histochem
Cytochem 34, 971-976
38. Plaas, A. H., West, L. A., and Midura, R. J. (2001) Glycobiology 11, 779-790
39. Harvey, D. J. (2000) J Am Soc Mass Spectrom 11, 900-915
40. Funderburgh, J. L., and Conrad, G. W. (1990) J Biol Chem 265, 8297-8303
41. Boesch, J. S., Lee, C., and Lindahl, R. G. (1996) J Biol Chem 271, 5150-5157
42. Roughley, P. J., White, R. J., Magny, M. C., Liu, J., Pearce, R. H., and Mort, J. S.
(1993) Biochem J 295 ( Pt 2), 421-426
43. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., and Conrad, G. W. (1991) J
Biol Chem 266, 14226-14231
44. Jester, J. V., Moller-Pedersen, T., Huang, J., Sax, C. M., Kays, W. T., Cavangh, H.
D., Petroll, W. M., and Piatigorsky, J. (1999) J Cell Sci 112, 613-622.
45. Chen, C., Michelini-Norris, B., Stevens, S., Rowsey, J., Ren, X., Goldstein, M., and
Schultz, G. (2000) Invest Ophthalmol Vis Sci 41, 4108-4116
46. Huckerby, T. N., Tai, G. H., and Nieduszynski, I. A. (1998) Eur J Biochem 253, 499-
506.
47. Tai, G. H., Huckerby, T. N., and Nieduszynski, I. A. (1996) J Biol Chem 271, 23535-
23546.
48. Tai, G. H., Nieduszynski, I. A., Fullwood, N. J., and Huckerby, T. N. (1997) J Biol
Chem 272, 28227-28231.
49. Plaas, A. H., West, L. A., Thonar, E. J., Karcioglu, Z. A., Smith, C. J., Klintworth, G.
K., and Hascall, V. C. (2001) J Biol Chem 276, 39788-39796
50. Fini, M. E. (1999) Prog Retin Eye Res 18, 529-551.
51. Piatigorsky, J. (2000) J Ocul Pharmacol Ther 16, 173-180.
52. Stramer, B. M., Cook, J. R., Fini, M. E., Taylor, A., and Obin, M. (2001) Invest
Ophthalmol Vis Sci 42, 1698-1706.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 22
53. Mehmet, H., Scudder, P., Tang, P. W., Hounsell, E. F., Caterson, B., and Feizi, T.
(1986) Eur J Biochem 157, 385-391
54. Perez-Santonja, J. J., Linna, T. U., Tervo, K. M., Sakla, H. F., Alio y Sanz, J. L., and
Tervo, T. M. (1998) J Refract Surg 14, 602-609
55. Tuori, A., Virtanen, I., Aine, E., and Uusitalo, H. (1997) Graefes Arch Clin Exp
Ophthalmol 235, 222-229
56. Koukoulis, G. K., Shen, J., Virtanen, I., and Gould, V. E. (1995) Ultrastruct Pathol
19, 37-43
57. Dugina, V., Fontao, L., Chaponnier, C., Vasiliev, J., and Gabbiani, G. (2001) J Cell
Sci 114, 3285-3296.
58. Venkatesan, N., Ebihara, T., Roughley, P. J., and Ludwig, M. S. (2000) Am J Respir
Crit Care Med 161, 2066-2073
59. Venkatesan, N., Roughley, P. J., and Ludwig, M. S. (2002) Am J Physiol Lung Cell
Mol Physiol 283, L806-814
60. Akama, T. O., Nishida, K., Nakayama, J., Watanabe, H., Ozaki, K., Nakamura, T.,
Dota, A., Kawasaki, S., Inoue, Y., Maeda, N., Yamamoto, S., Fujiwara, T., Thonar,
E. J., Shimomura, Y., Kinoshita, S., Tanigami, A., and Fukuda, M. N. (2000) Nat
Genet 26, 237-241.
61. Nakazawa, K., Takahashi, I., and Yamamoto, Y. (1998) Arch Biochem Biophys 359,
269-282
62. Cheng, F., Heinegard, D., Malmstrom, A., Schmidtchen, A., Yoshida, K., and
Fransson, L. A. (1994) Glycobiology 4, 685-696
63. Sawaguchi, S., Yue, B. Y., Chang, I., Sugar, J., and Robin, J. (1991) Invest
Ophthalmol Vis Sci 32, 1846-1853
64. Fitzsimmons, T. D., Molander, N., Stenevi, U., Fagerholm, P., Schenholm, M., and
von Malmborg, A. (1994) Invest Ophthalmol Vis Sci 35, 2774-2782
65. Badid, C., Mounier, N., Costa, A. M., and Desmouliere, A. (2000) Histol Histopathol
15, 269-280
66. Powell, D. W., Mifflin, R. C., Valentich, J. D., Crowe, S. E., Saada, J. I., and West,
A. B. (1999) Am J Physiol 277, C1-9
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 23
Figure Legends
Figure 1. Morphology and cytoskeletal organization of cultured corneal keratocytes,
fibroblasts and myofibroblasts. Primary cultures of bovine keratocytes were established
under conditions that either maintain the keratocyte phenotype or that initiate
transdifferentiation to fibroblast or myofibroblastic phenotypes as described under
Experimental Procedures. Micrographs A,B,C illustrate morphology of cells after
staining with crystal violet. Panels D, E, F show cells stained with phalloidin (green) and
anti-vinculin (red). In G myofibroblasts were stained with antibodies to a-smooth
muscle alpha actin. Keratocytes and fibroblasts were negative for a-smooth muscle
alpha staining. White bars in C and F are 50 µm.
Figure 2. Immunoblotting of phenotypic marker proteins. Cellular fibronectin, 200 kDa,
A; a-smooth muscle alpha actin, 44 kDa, B; and aldehyde 3 dehydrogenase, 54 kDa, D
from cell lysates and keratan sulfate, F; keratocan, 50 kDa, G; and biglycan, 49 kDa, C
from conditioned media of cultured keratocyte (K), fibroblast (F) and myofibroblasts (M)
were detected by immunoblotting after separation on SDS-PAGE as described in
Experimental Procedures. Panel E shows a Coomassie stained separation of cell
extracts similar to that immunoblotted for ALDH in D. Arrow marks a prominent 54kDa
band in keratocytes corresponding to ALDH in the blot.
Figure 3. Incorporation of 35S-sulfate into keratocyte glycosaminoglycans as a function
of cell phenotype. Incorporation of 35S-sulfate into keratan sulfate and
chondroitin/dermatan sulfate during an 18 hr labeling period was determined by
digestion of a purified proteoglycan fraction with keratanase II + endo-ß-galactosidase
(A) or chondroitinase ABC (B and C) as described in Experimental Procedures. Values
are corrected for cell protein, and error bars represent standard deviation of assays on
triplicate cultures. Values are normalized so that keratocyte = 100 in each assay. In C,
cultures were labeled in the presence of 0.5 mM 4-nitrophenyl-ß-D-xyloside.
Figure 4. Glycosaminoglycan chain size in cultured corneal cells. Proteoglycans from
culture media after labeling with 35S-sulfate under conditions similar to Figure 3, were
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 24
separated into keratan sulfate proteoglycans using chondroitinase digestion (A) or
chondroitin/dermatan sulfate using fractional alcohol precipitation (B and C) and then
glycosaminoglycan chains were released by proteinase digestion as described in
Experimental Procedures. Free glycosaminoglycan chains were separated SDS-PAGE
and detected by autoradiography. Molecular size markers represent protein standards
run in the same gels. In C, labeling was carried out in the presence of 0.5 mM 4-
nitrophenyl-ß-D-xyloside.
Figure 5. Analysis of hyaluronan and chondroitin/dermatan sulfate by fluorophore-
assisted carbohydrate electrophoresis (FACE). A. Unlabeled glycosaminoglycans were
digested with chondroitinase ABC and fragments derivitized with 2-aminoacridone,
separated by gel electrophoresis and visualized by fluorescence as described in
Experimental Procedures. Fragments were identified by co-electrophoresis with
standards. Di-HA, hyaluronan unsaturated disaccharide; Di-0S, chondroitin/dermatan
unsulfated unsaturated disaccharide; Di-4S, chondroitin/dermatan 4-O-sulfated
unsaturated disaccharide; Di-6S, chondroitin/dermatan 6-O-sulfated unsaturated
disaccharide. Di-diS, chondroitin/dermatan 4,6,-O-disulfated disaccharide. B. Relative
abundance of chondroitin/dermatan fragments was determined by quantitative image
analysis of fluorescent gels similar to those in A. The total chondroitin/dermatan
fragments in each lane was normalized to 100. Error bars show standard deviation of
analyses of triplicate cultures. White bars: Di-0S, Black bars, Di-6S; Gray bars, Di-4S.
C. Hyaluronan fragments were calculated as in B as a percentage of
chondroitin/dermatan sulfate in the same sample.
Figure 6. Analysis of keratan sulfate by fluorophore assisted carbohydrate
electrophoresis (FACE). A. Unlabeled keratan sulfate from keratocyte cultures was
digested with a mixture of keratanase II and endo-ß-galactosidase. Fragments were
derivitized with 2-aminoacridone, separated by gel electrophoresis and detected by
fluorescence as described in Experimental Procedures. Marked bands representing
>90% of the labeled products were used for quantitation. Bands were identified by co-
electrophoresis with commercial standards (Gal, GnSO4) or with fragments of purified
corneal keratan sulfate characterized as described in Experimental Procedures. MSE
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 25
and MSK, monosulfated fragments produced by endo-ß-galactosidase (GnSO4-Gal) and
keratanase II (Gal-GnSO4); USE, unsulfated endo-ß-galactosidase disaccharide (Gn-
Gal); DSK, disulfated keratanase II disaccharide (GalSO4-GnSO4). R, non-specific
reagent band; bands marked with (*) are keratan sulfate-derived components of non-
determined structure. B. Quantification of keratan sulfate bands in keratocyte,
fibroblasts, and myofibroblasts. Triplicate samples similar to that in Figure 6A were
analyzed for abundance of the 11 bands marked in 6A. White bars show the sum of all
components (excluding R). Black bars show sums of identified components of keratan
sulfate chain elongation and Gray bars show unidentified fragments, marked * in Fig
6A. The total for keratocytes (K) was set to 100.
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Funderburgh et al page 26
Table I
Primers and Probes for Real-time RT-PCR
Gene Name DNA SequenceALDH GGAAGCCATCCAGTTCATCA Forward
GTCTCCGCGATCATCTTCTT ReverseTGGCGCTCTACGTCTTCTCACCG Probe
Keratocan TGCTGGCCTTCCTTCTAGTG ForwardGATGAAGGTGCTGCAGATGA ReverseCAAAGGTCCCCAAAATCAGTGC Probe
Biglycan TCTCAGAGGCCAAGCTCACT ForwardTAGCTCGATTGCCTGGATTT ReverseCAATGAACTCCACCTGGACCACAACA Probe
Cellular Fibronectin TTGATCGCCCTAAAGGACTG ForwardCATCCTCAGGGCTCGAGTAG ReverseCCTGTGGGCTTTCCCAAGCAATTT Probe
a-Smooth Muscle Actin CACTCCCTGCTCTCTTGTCTG ForwardCAGAGCTTGGGCTAGGAATG ReverseTGAAGGCATTATTCCACAGAACATTCACA Probe
18S Ribosomal CCCTGTAATTGGAATGAGTCCAC ForwardGCTGGAATTACCGCGGCT ReverseTGCTGGCACCAGACTTGCCCTC Probe
Collagen Ia2 CAACCATGCCTCTCAGAACA ForwardGCCAGTTTCCTCATCCATGT ReverseCCTACCATTGCAAGAACAGCATTGCA Probe
Collagen III GTCCTGATGGTTCCCGTAAA ForwardTTCAGGATGGCAGAATTTCA ReverseCCCTGCACGGAACTGCAGGG Probe
Table II
Relative Abundance of mRNA
Keratocytes Fibroblasts Myofibroblasts
Smooth Muscle Actin 100 ± 7 51 ± 6 1271 ± 79Fibronectin-EDA 100 ± 37 229 ± 10 3948 ± 137Biglycan 100 ± 37 166 ± 101 1250 ± 535ALDH 100 ± 14 0.14 ± 0.1 0.05 ± 0.01Keratocan 100 ± 7.9 6.4 ± 0.6 1.8 ± 0.7Collagen I 100 ± 4.2 360 ± 18 572 ± 24Collagen III 100 ± 21 5583 ± 883 6437 ± 680
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
James L. Funderburgh, Mary M. Mann, Nirmala Sundarraj and Martha L. Funderburghcorneal fibrosis
Keratocyte phenotype mediates proteoglycan structure: A role for fibroblasts in
published online August 20, 2003J. Biol. Chem.
10.1074/jbc.M303292200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on July 13, 2020http://w
ww
.jbc.org/D
ownloaded from
Recommended