PCR-based detection of Colletotrichum acutatum

S.NANDHA KUMAR

B.TECH (BIOTECHNOLOGY)

TNAU

Colletotrichum acutatum

Plant pathogenic fungi.

DISEASES CAUSED-Anthracnose, black spot, terminal crook disease, leaf curl, crown rot.

The species has a very wide host range, but is economically most important on strawberries.

The disease is significant worldwide on strawberry on which it is considered the second most important pathogen.

Case study

PCR-based detection of Colletotrichumacutatum on strawberry.

The causal agent of strawberry anthracnose in the UK and continental Europe is C.acutatum.

While C.fragariae and C.gleosporioides also incite the disease in the USA.

All consignments of strawberries imported into UK are tested for blackspot at Central science Laboratory.

During this diagnosis period fresh plant prone to lose its viability.

In order to shorten this storage period they go for PCR-based detection method .

Generation of PCR primer from the Internal transcribed spacer(ITS)1 region of rDNArepeat unit of C.acutatum for specific detection of this pathogen on infected strawberry.

For accurate identification of C.acutatum and its detection on other host plants.

Internal Transcribed Spacer (ITS)ITS refers to a piece of non-functional RNA

situated between structural rRNAs.

ITS has proven especially useful for elucidating relationships among congeneric species and closely related genera in Asteraceae.

ITS region is the most widely sequenced DNA region in fungi.

Continued....

Sequence comparison of the ITS region is widely used because it

a) is easy to amplify even from small quantities of DNA ,

b) has a high degree of variation even between closely related species.

Hence species-specific primers were designed using this regions.

DNA extraction

Fungal mycelium was produced in glucose casamino acid liquid medium and DNA extracted from freeze dried mycelial powder.

From C.acutatum infected strawberry leaves and fruits.

DNA from uninfected strawberry tissues used as a control.

Amplification of DNA

Primers ITS1 (TCCGTAGGTGAACCTGCGG), ITS2(GCTGCGTTCTTCATCGATGC), ITS4 (TCCTCCGCTTATTGATATGC) and C.acutatuminternal primers from the ITS1 region (calnt1 and calnt2) were used.

PCR reactions (100µL) were undertaken with primers ITS1/ITS2 and species specific primer/ITS4.

Continued...

PCR mixtures contained genomic DNA (40-50ng),reaction buffer,200µmol/L of each dNTP,0.5µmol/L each of primers ITS1 and ITS2 or species specific primer and ITS4 and 2.5 units of Taq DNA polymerase.

For 30 cycles of 1.5min at 94⁰C,2min at 55⁰C and 3 min at 72⁰C.

Hybridization

• After electrophoresis,PCR products generated with the primers were transferred to nylon membranes by capillary transfer.

• A probe labelled with [alpha-P]deoxy –adenosine 5’-triphosphate using the prime-a-gene labelling system.

• It was prepared from the PCR product amplified from C.acutatum(isolate 397) genomic DNA with primers Calnt2 and ITS4.

Results and discussion

Selection of a C.acutatum- specific primer

Suitable regions were chosen for designing species-specific primers.

Primer Calnt1(20 bases) from isolate 397 had four base differences compared with the same region of isolate NI90.

Primer Calnt1 and ITS4 were used in PCR with genomic DNA from a range of C.acutatum isolates from strawberry and other hosts and isolate of other Colletotrichum spp.

Continued....At annealing temp of 45-55⁰C a fragment was

well amplified from the C.acutatum 397 group of isolates but amplification was only moderately good with DNA from the NI90 group.

The second primer Calnt2 from ITS1 region of isolate 397 had only one base difference from isolate NI90.

Continued....In conjugation with ITS4 primer,a fragment of

490bp was equally well amplified with DNA from all the C.acutatum isolates tested.

The primer was specific to C.acutatum and no amplification products were obtained with genomic DNA from other Colletotrichum spp.

Amplification of C.acutatum specific fragmentfrom infected strawberry

A product of identical size to that amplified from fungal DNA was produced when primers Calnt2 and ITS4 were used in PCR with total DNA extracted from strawberry leaves infected with C.acutatum.

Hybridization analysis confirms the that the product amplified contained the target sequence of the fungal DNA.

Conclusion

The species specific primer(Calnt2) developed in this work could be used for the accurate identification of C.acutatum and its detection on other host plants.

References

• S.Sreenivasaprasad,K.Sharada,A.E.Brown and P.R.Mills 1996.PCR-based detection of Colletotrichum acutatum on strawberry.PlantPathology 45,650-655.

THANK YOU