Download pdf - Pregnancy specific glycoprotein 18 induces IL10 expression in murine macrophages

0014-2980/00/0707-1830$17.50+.50/0 © WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2000

Pregnancy specific glycoprotein 18 induces IL-10expression in murine macrophages

Jennifer Wessells1, David Wessner1, Roseann Parsells1, Kimberly White1, DanielaFinkenzeller2, Wolfgang Zimmermann2 and Gabriela Dveksler1

1 Department of Pathology, Uniformed Services University of the Health Sciences, Bethesda,USA

2 Institute of Molecular Medicine and Cell Research, University of Freiburg, Freiburg, Germany

Pregnancy specific glycoproteins (PSG) are secreted into the maternal circulation and mayfunction to regulate the immune system to ensure survival of the fetal allograft. In this study,we have cloned and determined by in situ hybridization the placental sites of expression ofPsg18, a murine member of the PSG family that belongs to the Ig superfamily. RecombinantPSG18 and a truncated form containing only the N-terminal domain (PSG18N) were used totreat peritoneal elicited macrophages and RAW 264.7 cells. PSG18 and PSG18N inducedIL-10 mRNA expression in the presence and absence of lipopolysaccharide (LPS). IL-10 pro-tein was also detected in the supernatant of macrophages and RAW 264.7 cells followingPSG18N treatment, albeit higher concentrations were required in the absence of LPS. Incontrast, treatment of these cells with PSG18N resulted in no change in the expression ofIL-1 g , TNF- § , inducible NO synthase, IL-12p40 and TGF- g mRNA. Taken together, theseresults suggest that PSG18 selectively up-regulates IL-10 production by macrophages, pro-viding a possible mechanism by which this protein helps promote successful pregnancy.

Key words: Pregnancy specific glycoprotein / IL-10 / Macrophage

Received 27/9/99Revised 17/3/00Accepted 23/3/00

[I 20143]

Abbreviations: GST: Glutathione S-transferase PSG:Pregnancy specific glycoprotein CEA: Carcinoembryonicantigen iNOS: Inducible NO synthase RT: Reverse tran-scription d.p.c.: Day post coitum

1 Introduction

Pregnancy specific glycoproteins (PSG) are a group ofhighly similar placental proteins originally isolated fromthe circulation of pregnant women [1, 2]. PSG are a sub-family of the carcinoembryonic antigen (CEA) family thatbelongs to the Ig superfamily. Low levels of PSG areassociated with certain pathological conditions such asspontaneous abortion [3], intrauterine growth retardationand pre-eclampsia [4]. Of the 14 murine Psg genes, full-length cDNA for only Psg17 (formerly Cea2) and Psg19(formerly Cea4) have been reported [5]. Recent studiesshowed that a peptide derived from the N-terminaldomain of human PSG11 binds to human monocytesand cells of the promonocyte lineage, but not to T or Bcells [6].

Several theories that address the immunological aspectsof pregnancy have been contemplated over the years.The conceptus has been likened to an immunologically

tolerized foreign graft [7]. Munn et al. [8] proposed thattrophoblasts suppress maternal T cell responses bycatabolizing tryptophan. Placental products were alsosuggested to result in the activation of the maternalinnate immune system with monocytes having an impor-tant role in this process [9]. Maintenance of a successfulpregnancy in mice and humans has also been attributedto the anti-inflammatory environment that exists in theuterus during pregnancy, resulting from a shift from Th1type response to a Th2 type reactivity [10–15].

Macrophages are one of the cell types known to be prev-alent in the uterus during pregnancy and there areincreased numbers of circulating monocytes from thefirst trimester onwards [16, 17]. Hormones have beenshown to modulate macrophage function and to inducethe production of Th2 cytokines by T cells [18–20]. Otherimmunomodulators have also been reported to contrib-ute to a successful pregnancy [21, 22].

In the present study, we report the cloning of Psg18 (for-merly Cea3) and the identification of its sites of expres-sion in the placenta. We also investigated whetherPSG18 modifies the expression of immune mediators inmurine macrophages and a murine macrophage cell line.Both PSG18 and PSG18N induce murine macrophagesand RAW 264.7 cells to produce IL-10 mRNA and protein

1830 J. Wessells et al. Eur. J. Immunol. 2000. 30: 1830–1840

Fig. 1. Amino acid sequence comparison (in one letter code) of the N1 exons of all known murine Psg genes. The putative borderbetween the leader peptide (L) and the N-terminal end of the mature N1 domain is indicated by an arrow. Identical amino acidsare represented by a dash, deletions by an underline. The regions corresponding to the RGD motif in the human PSGare highlighted by a black bar, and the two highly conserved amino acids (R, D) which are supposed to form a salt bridge by blackboxes.

Fig. 2. Recombinant PSG18, PSG18N and XylE fusion pro-teins produced in insect cells. Hi 5 insect cells were infectedwith the PSG18, PSG18N, or the XylE virus stock. Cellsupernatants or lysates, containing the respective fusionproteins, were harvested 72 h post-infection and 15 ? l wereloaded on a 4–20% NuPAGE gel. Recombinant proteinswere detected by immunoblotting with an anti-GST antibodyor anti-His antibody (A) followed by horseradish peroxidase-conjugated goat anti-mouse antibody and the Super Sig-nal detection reagent. Con A-Sepharose-precipitated GST-PSG18N is also depicted (A). Coomassie-stained gel show-ing the PSG18N fusion proteins before (lane 1) and afterpurification (lanes 2 and 3 B). The molecular weight stan-dards are in kDa.

in a dose-dependent manner while expression of IL-1 g ,TNF- § , TGF- g , inducible NO synthase (iNOS) and IL-12mRNA remains unchanged. Our results suggest thatPSG may have an important role in modulating theimmune response during pregnancy.

2 Results

2.1 Cloning and expression of PSG18

We obtained the full-length Psg18 cDNA by reverse tran-scription (RT)-PCR using a primer based on the previ-ously published 5' sequence and a consensus down-stream primer (data not shown) [23]. PSG18 has adomain organization similar to that of murine PSG17 andPSG19, consisting of 463 amino acids and 7 potential N-linked glycosylation sites. The N1 domains of the variousmurine Psg genes share between 53.9 % (Psg16/Psg29)and 94.1% (Psg21/Psg23) of their predicted amino acidsequences (Fig. 1). We used the baculovirus expressionsystem to generate recombinant PSG18, PSG18N andXylE proteins as glutathione S-transferase (GST) and/or6×His fusion proteins (Fig. 2A). Full-length GST-PSG18has a molecular mass of 84 kDa, and the control GST-His-XylE of 70 kDa. PSG18N-His and GST-PSG18N, thetruncated versions of PSG18 that contain only the N1domain with the specified tag, have been estimated tohave a molecular mass 24 kDa and 45 kDa, respectively.These proteins were purified to homogeneity (Fig. 2B)and used for the treatments described below. TheCon A-Sepharose-precipitated GST-PSG18N shown inthe anti-GST immunoblot indicates that PSG18N is gly-cosylated.

Eur. J. Immunol. 2000. 30: 1830–1840 Induction of IL-10 by murine PSG18 1831

Fig. 3. Expression of Psg18, 4311, and P1-I in trophoblast tissue during placental development. Unfixed uteri or placentae frompregnant BALB/c mice 6.5 d.p.c. (a, d, g), 8.5 d.p.c. (b, e, h) or 14.5 d.p.c. (c, f, i) were cryosectioned. In situ hybridization wasperformed with digoxigenin-labeled antisense Psg 18, 4311 or P1-I RNA probes. The hybridized RNA was visualized by reactionwith an anti-digoxigenin alkaline phosphatase-conjugated antibody and subsequent incubation with NBT/BCIP. At 6.5 d.p.c. theembryo and trophoblast cells are outlined by a dashed line in (a). e, embryo; epc, ectoplacental cone; spp, spongiotrophoblastprecursor cells; pgi, fetal primary trophoblast giant cells; sgi, secondary trophoblast giant cells; sp, spongiotrophoblast; bl, bloodlacunae; d, decidua; la, labyrinth zone; v, blood vessel. Scale bar in parts a, d, and g is 0.25 mm and for the rest is 0.5 mm.

2.2 Sites of Psg18 expression during placentaldevelopment

Digoxigenin-labeled Psg18 RNA probes were hybridizedto cryosections of placental tissues at various develop-mental stages. Strong hybridization signals could bedetected at 6.5 days post coitum (d.p.c.) in primary tro-phoblast giant cells (Fig. 3a). No signal was observedwith the Psg18 probe in day 5.5 embryos (data notshown). In comparison, the trophoblast giant cell marker,placental lactogen I (Pl-I) probe [24], labeled both pri-mary and secondary trophoblast giant cells in 6.5 d.p.c.embryos (Fig. 3g). At day 8.5 of development, Psg18mRNA was predominantly expressed in most of the pri-mary trophoblast giant cells surrounding the embryo andto a lesser extent in secondary giant cells on the meso-metrial edge of the ectoplacental cone and in presumedspongiotrophoblast precursor cells (Fig. 3b). This patterncorrelated with Pl-I mRNA that was, however, not foundin spongiotrophobast precursor cells (Fig. 3h). Expres-sion of 4311 mRNA, a marker of spongiotrophoblastcells and their precursors, which are observed from day7.5 onwards, was only found in a few trophoblast cells at

a lower level at both gestational ages (Fig. 3d and e).At 10.5 d.p.c., Psg18 expression was detected in pri-mary and secondary trophoblast giant cells, as well asspongiotrophoblast precursor cells which lie on top ofthe ectoplacental cone (data not shown). At later stagesof placental development, Psg18 mRNA was stronglyexpressed in the spongiotrophoblast cells, which formtypical peg-like extensions protruding into the labyrinthzone of the placenta and surround large vessels (Fig. 3c).Lower expression was observed in individual, presumedtrophoblast cells in the maternal layer of the placentanext to the fetal spongiotrophoblast. This layer is sepa-rated by large blood lacunae, which contain maternalblood and are formed by the dissolution of the maternalvasculature in this region of the murine placenta. Themost distal decidual layer was devoid of Psg18 mRNA-positive cells (not shown). Expression continued until16.5 d.p.c., the latest stage analyzed in this study(data not shown). Psg18 and 4311 had a very similarexpression pattern in the mature placenta as exemplifiedfor day 14.5 (Fig. 3f). No hybridization signal wasapparent for the P1-I probe in the 14.5 d.p.c. placenta(Fig. 3i).


Fig. 4. PSG18 and PSG18N induced expression of IL-10 mRNA in RAW 264.7 cells and C3H/HeJ thioglycollate-elicited perito-neal macrophages. RAW 264.7 cells (A) and C3H/HeJ peritoneal macrophages (B) were treated with 10 ? g/ml GST-XylE control,GST-PSG18 or GST-PSG18N alone or in the presence of 10 ng/ml LPS. RNA was harvested at 2 h post-treatment and expres-sion of IL-10 and GAPDH mRNA were analyzed by RT-PCR after 22 and 14 cycles, respectively. All data shown are representativeof at least three independent experiments (*p X 0.05).

2.3 The N-terminal domain of PSG18 is sufficientto induce expression of IL-10

We assessed the ability of the full-length GST-PSG18and the truncated GST-PSG18N to up-regulate IL-10mRNA in RAW 264.7 cells and thioglycollate-elicitedperitoneal macrophages. Cells were treated with recom-binant GST-PSG18, GST-PSG18N or the GST-XylE con-trol in the presence and absence of 10 ng/ml LPS. RNAwas harvested at 2 h post-treatment and expression ofglyceraldehyde-3-phosphate dehydrogenase (GAPDH)and IL-10 was analyzed by RT-PCR. In the absence ofLPS, treatment with 10 ? g/ml of PSG18 or PSG18Ncaused a 5- to 10-fold increase in IL-10 mRNA over cellstreated with GST-XylE in RAW 264.7 cells (Fig. 4A) and inmacrophages isolated from the LPS-hyporesponsiveC3H/HeJ mice (Fig. 4B). Similar results were obtainedwith macrophages isolated from BALB/c and C3H/OuJmice (data not shown). Treatment of cells with 25 ? g/mlGST-PSG18N or PSG18N-His resulted in a 50-foldincrease in IL-10 mRNA expression over the control (datanot shown). When PSG treatment of RAW 264.7 cellswas performed in the presence of LPS, PSG18 andPSG18N showed a 2- to 3-fold increase of IL-10 expres-sion over the cells treated with GST-XylE plus LPS(Fig. 4A).

2.4 Kinetics of IL-10 mRNA expression inducedby PSG18N

We next examined the kinetics of IL-10 mRNA expres-sion in RAW 264.7 and C3H/HeJ thioglycollate-elicitedperitoneal macrophages. Cell monolayers were incu-

bated with 10 ? g/ml GST-PSG18N or GST-XylE in thepresence or absence of 5 ng/ml LPS. RNA was har-vested at 1, 2, 4, 6 and 12 h post-treatment and expres-sion of GAPDH and IL-10 was analyzed. IL-10 mRNAwas detected at 1 h post-treatment with GST-PSG18Nand peaked at 2 h post-treatment in RAW 264.7 cells(Fig. 5A). A small increase in the expression of IL-10mRNA was also recorded at 4 h post-PSG18N treat-ment. Furthermore, the peak expression of IL-10 mRNAin response to PSG18N was evident at 2 h post-treatment in C3H/HeJ macrophages (Fig. 5B). No signifi-cant increase in the expression of IL-10 mRNA wasobserved at 6 and 12 h after PSG18N treatment. RAW264.7 cells treated with PSG18N showed a similar trendof IL-10 expression in the presence of 5 ng/ml LPS (datanot shown). However, the addition of LPS significantlyincreased the level of mRNA induction at all time pointsassayed. The induction of IL-10, after incubation of RAW264.7 cells with LPS and the XylE control, was highest at4 h post-treatment and was identical to that observedafter treatment with LPS alone (data not shown).

2.5 PSG18N does not induce expression of othercytokines

To investigate whether PSG18N alters the expression ofIL-1 g , TNF- § , IL-12, iNOS or TGF- g mRNA in RAW 264.7cells and C3H/HeJ macrophages, RNA was extractedfrom cells that had been treated with GST-PSG18N,PSG18N-His or GST-XylE in the presence or absence of5 ng/ml LPS. No significant changes in expression ofIL-1 g , TNF- § , IL-12, iNOS or TGF- g mRNA weredetected after treatment with GST-PSG18N (Fig. 6) or


Fig. 5. Kinetics of PSG18N-induced expression of IL-10 mRNA. RAW 264.7 cell (A) and thioglycollate-elicited C3H/HeJ perito-neal macrophage (B) cultures were incubated with 10 ? g/ml GST-PSG18N or GST-XylE control for the indicated times (1–12 h) inthe presence or absence of 5 ng/ml LPS. (C) Southern blots of IL-10 and GAPDH RT-PCR products from the representativeexperiment depicted in (A). RAW 264.7 cells treated with GST-XylE (lanes 1 and 4) or GST-PSG18N (lanes 2 and 3) in the pres-ence (lanes 3, 4) or absence (lanes 1, 2) of 5 ng/ml LPS. Data expressed are representative of three to four independent experi-ments (*p X 0.05).

PSG18N-His (data not shown) for either cell type. GST-PSG18N and PSG18N-His did not increase the expres-sion of these immune mediators over the control even inthe presence of LPS.

2.6 PSG18N induces secretion of IL-10 protein ina dose-dependent manner

A dose-response analysis was performed to determinethe sensitivity of RAW 264.7 cells and BALB/c thio-glycollate-elicited peritoneal macrophages to GST-PSG18N. Increasing doses of GST-PSG18N or GST-XylE, from 2.5 to 20 ? g/ml, were used to treat RAW 264.7cells or peritoneal macrophages. In 24-h supernatants,treatment with doses up to 10 ? g/ml GST-PSG18N orPSG18N-His did not increase IL-10 secretion. However,treatment of RAW 264.7 cells and BALB/c macrophageswith 20 ? g/ml GST-PSG18N or PSG18N-His resulted ina significant induction of IL-10 at 6 and 24 h post-treatment (data not shown). Treatment with 2.5 to 20 ? g/ml GST-PSG18N in combination with 1 ng/ml LPS forRAW 264.7 cells or 100 ng/ml LPS for BALB/c macro-phages resulted in a significant increase in IL-10 (Fig. 7).

In addition, treatment with a suboptimal dose of LPS(0.5 ng/ml) and 10 ? g/ml GST-PSG18N resulted in a levelof IL-10 protein greater than treatment with either GST-PSG18N or LPS alone (data not shown).

3 Discussion

The present study was undertaken to determine thepotential role of PSG as inducers of immunomodulatorsas a first step towards understanding the function of thisfamily of proteins. In particular, we tested whetherrecombinant murine PSG18 regulates the expression ofcytokines by macrophages. PSG18 selectively inducedthe expression of IL-10 in peritoneal macrophages aswell as in the macrophage cell line RAW 264.7. Althoughthe concentration of murine PSG in the serum of preg-nant mice is unknown, the concentration of human PSGreaches 200–400 ? g/ml in the serum of pregnant women[2]. This high concentration, along with reports that anti-bodies to PSG induced abortions in mouse and mon-keys, suggest that PSG may be critical to maintain a suc-cessful pregnancy [25].


Fig. 6. PSG18N does not up-regulate expression of IL-1 g ,IL-12, iNOS, TNF- § or TGF- g mRNA. C3H/HeJ peritonealmacrophages (A) or RAW 264.7 cells (B) were treated with10 ? g/ml GST-PSG18N or GST-XylE for 2 h and the expres-sion of IL-1 g , IL-12p40, iNOS, TNF- § and TGF- g was ana-lyzed by semi-quantitative RT-PCR after 17, 22, 20, 17 and30 cycles, respectively. PSG18N treatments were performedin the presence and absence of 5 ng/ml LPS.

Fig. 7. Dose response of IL-10 secretion by PSG18N-stimulated RAW 264.7 cells and BALB/c thioglycollate-elicited peritoneal macrophages. Monolayers were treatedwith the indicated concentration (2.5–20 ? g/ml) of GST-PSG18N or GST-XylE control in the presence of LPS. Cellculture supernatants were collected at 24 h post-treatmentand assayed for IL-10 protein by ELISA. RAW 264.7 cellswere stimulated with 1 ng/ml LPS (A) and BALB/c peritonealmacrophages were stimulated with 100 ng/ml LPS (B). Inboth cell types, treatment with LPS alone produced IL-10protein values equivalent to the values shown for GST-XylEin the presence of LPS.First, we cloned and expressed the full-length cDNA

encoding murine Psg18 and the truncated PSG18N,which contains only the N1 domain, as fusion proteinsusing a baculovirus expression system. The high degreeof sequence similarity present in the N1 domain of thedifferent murine PSG suggests that they may have a highlevel of functional redundancy (Fig. 1). The function ofsome human PSG has been associated with the pres-ence of the RGD tripeptide sequence in their N domain[6]. This sequence is present in a variety of extracellularmatrix proteins and is critical for binding to integrinreceptors [26]. Murine PSG18 has an RGE sequence inthe N1 domain that shares a common spatial and chargepattern with the RGD motif. However, currently there isno evidence that these motifs have any role in the func-tional activity of PSG. Interestingly, functional studies,including the results reported here, showed that the ste-rically exposed N-terminal domain of proteins in the CEAfamily appears to be crucial for the interaction with theirrespective targets [27–30].

In humans, PSG are synthesized and secreted into thebloodstream by the syncytiotrophoblast cell layer [31].Although murine Psg were demonstrated to be specifi-cally expressed in the placenta, it had not been deter-mined which cells are responsible for their secretion,especially at early stages of gestation [23]. We found thatPsg18 mRNA is synthesized shortly after implantation(which occurs at day 4.5 of murine embryonic develop-ment) in primary and, at a lower level, in secondary tro-phoblast giant cells. At later stages of development, it isalso expressed in spongiotrophoblast cells and their pre-cursors. This cell lineage is also derived from theembryo. The expression pattern of Psg18 differs fromthe expression pattern of Pl-I, which codes for a lacto-genic hormone, and Mash-2 that encodes for a marker ofthe chorion and ectoplacental cone [24, 32, 33]. There-fore, Psg18 represents an independent trophoblast cell


lineage marker with a unique spatiotemporal expressionthat is compatible with its suggested immunomodulatoryfunction. Since a large family of closely related PSGgenes exists in the mouse, it is possible that the Psg18probe used for the in situ hybridization experiments maydetect additional Psg mRNA. However, all murine Psggenes are coordinately expressed (W. Zimmermann,unpublished results).

We found that the full-length PSG18 and PSG18N bothup-regulate IL-10 mRNA in murine macrophages andRAW 264.7cells and that treatment with 20 ? g/mlPSG18N was sufficient to induce IL-10 protein as earlyas 6 h post-treatment. When cells were treated withPSG18N at concentrations lower than 20 ? g/ml, low lev-els of LPS were required to observe significant increasesin IL-10 protein. The levels of IL-10 secretion demon-strated in the cell line were dramatically higher thanthose observed in BALB/c peritoneal macrophages. Thiscorrelates with our observations that RAW 264.7 cellsrequire 1 ng/ml of LPS to secrete significant amounts ofIL-10, while peritoneal macrophages require an LPS con-centration of 100 ng/ml. In peritoneal macrophages, lowlevels of IL-10 protein despite high levels of IL-10 mRNAhave been observed for many macrophage activators,including LPS [34]. Macrophages isolated from differentmouse strains differed in their ability to secrete IL-10 inresponse to PSG18N and to the LPS control. Althoughwe observed an increase in IL-10 mRNA expression, wewere not able to detect IL-10 protein following treatmentof C3H/OuJ and C3H/HeJ macrophages with 5 ? g/mlPSG18N in the presence or absence of LPS. Treatmentwith higher concentrations of PSG18N may be requiredto stimulate the production of detectable levels of IL-10protein in these cells. At present, we do not knowwhether macrophages at the maternal-fetal interfacerespond to PSG differently than peritoneal macrophagesor circulating monocytes. Bioactive TGF- g is present inmurine decidua and this suppressor cytokine has beenshown to enhance the ability of macrophages to produceIL-10 [35, 36]. Therefore, it is possible that macrophagesin the pregnant uterus are more primed to secrete IL-10in response to PSG than circulating monocytes. HumanPSG may also function to induce IL-10 in mononuclearphagocytes. Treatment of human monocytes with 5 ? g/ml PSG11 and LPS induced expression of IL-10 [37].

IL-10 is present at high levels during pregnancy and ithas been postulated that the local secretion of IL-10contributes to the generation of a maternal immune statecompatible with a successful pregnancy [38]. IL-10decreases the local production of IFN- + and TNF- § ,cytokines known to be harmful to pregnancy [10]. IL-10also inhibits the expression of MHC class II and B7 mole-cules on macrophages, making them unable to function

as accessory cells for NK cells [39–41]. On the otherhand, IL-10 induces HLA-G expression, which inhibitslysis by maternal NK cells in trophoblasts and mono-cytes [42]. Interestingly, induction of NK and LAK cellactivity has been linked to spontaneous fetal resorptionin mice [43]. In addition, IL-10 has been shown to inhibithuman placental cytotrophoblast invasiveness andmetalloproteinase production in human mononuclearphagocytes and a deficiency in placental IL-10 wasassociated with pre-eclampsia [44–46].

Although IL-10 knockout mice appear to reproducenormally, these animals are maintained as inbredstrains where no allotypic challenges exist [47]. BreedingIL-10–/– mice with different haplotypes would be neces-sary to further understand the role of this cytokine inpregnancy. In addition, it is possible that other anti-inflammatory factors such as TGF- g have overlappingfunctions with IL-10 or that IL-10–/– mice develop com-pensatory mechanisms, which substitute for the ab-sence of this gene during pregnancy. Through their abil-ity to induce IL-10, PSG could contribute to the suppres-sion of Th1 type responses during pregnancy and couldhave a role in controlling placental invasion. In addition,one could speculate that PSG might also bind to cytotro-phoblast cells, inducing them to produce IL-10. Resultsfrom our laboratory indicate that two trophoblast celllines derived from the outbred laboratory strain, Swiss-Webster, and the inbred strain of mice C57BL/6×129 [48]produce both PSG and IL-10 (data not shown).

It is important to emphasize that PSG18N did not induceexpression of IL-1 g , TNF- § , IL-12 and iNOS. Induction ofmRNA in response to treatment with LPS was easilydetected for all these cytokines with the exception ofIL-12p40 mRNA, which is not up-regulated by LPS inRAW 264.7 cells (C. Salkowski, personal communica-tion). We did not explore whether PSG18 alters theexpression of IL-1 g , TNF- § and iNOS beyond 2 h afterPSG18 treatment. IL-10 has been reported to down-regulate the expression of these immune mediators inmacrophage/monocytes [39, 49]. Therefore, an effect ontheir expression may not be directly attributed to PSG.

Elevated production of anti-inflammatory cytokines likeIL-10, present during pregnancy, significantly alters theexpression of many autoimmune diseases. Antibody-mediated diseases are exacerbated during pregnancy.On the other hand, cell-mediated autoimmune diseasessuch as rheumatoid arthritis and multiple sclerosis tendto improve during pregnancy [12, 50]. These findingssupport the notion that PSG, together with hormones,may have a role in regulating maternal autoimmunity.


4 Materials and methods

4.1 Animals and cells

Five- to six-week-old C3H/HeJ and C3H/OuJ female micewere obtained from Jackson Laboratories (Bar Harbor, ME).BALB/c mice were obtained from NCI (Frederick, MD). Peri-toneal exudate macrophages were obtained by peritoneallavage with sterile saline 4 days after i.p. injection of 3 mlsterile 3% thioglycollate broth (Difco, Detroit, MI). Cells werewashed, resuspended in RPMI 1640 supplemented with100 U/ml penicillin, 100 ? g/ml streptomycin, 10 mM Hepes,0.3% sodium bicarbonate, and 2% heat-inactivated FBSand seeded in 24-well tissue culture plates at 1.0×106 or1.5×106 cells per well. After an 18-h incubation, the nonad-herent cells were removed by washing. This procedure rou-tinely yielded G 95% macrophages. RAW 264.7 cells werepurchased and maintained as specified by American TypeCulture Collection.

4.2 IL-10 ELISA

Supernatants were harvested at 6 or 24 h from 1×106 BALB/c peritoneal macrophages or RAW 264.7 cells treated for 4 hwith the indicated concentrations of GST-PSG18, GST-PSG18N, PSG18N-His, or the control protein GST-His-XylE,in the presence or absence of 100 ng/ml or 1 ng/ml LPS,respectively. The treatment was performed in a total volumeof 300 ? l. After the initial 4 h treatment, 700 ? l media wereadded to each well for the remaining time. Macrophagesupernatants were concentrated threefold using a microcon3 (Millipore, Bedford, MA) and the RAW 264.7 cell superna-tants were diluted threefold prior to IL-10 ELISA (Endogen,Woburn, MA).

4.3 Semi-quantitative RT-PCR

RNA was extracted from macrophages and RAW 264.7 cellswith TRIzol reagent (Life Technologies, Rockville, MD)according to the manufacturer’s protocol. Two microgramsof RNA were reverse transcribed using Ready-To-Go-YouPrime First-Strand beads and random hexamers (PharmaciaBiotech, Piscataway, NJ). PCR amplifications were per-formed using one tenth of the cDNA reaction, with AmpliTaqDNA polymerase (Perkin-Elmer, Foster City, CA) follow-ing the manufacturer’s recommendations. Primers wereselected from different exons and their sequences havebeen published previously for all the mRNA amplified exceptfor TGF- g [51–54]. The sequences of the oligonucleo-tides used for amplification and detection of TGF- gare 5’CTCCCACTCCCGTGGCTTCTAG, 5’GTTCCACATGT-TGCTCCACACTTG, and 5’CCGGGAGGCCAGCCG for theupstream and downstream primers and probe, respectively.Amplified products were separated on 1.5% agarose gels,transferred to Nytran membranes, and hybridized with an

internal 32P-labeled oligonucleotide probe. The signal wasquantitated using a Storm Phosphorimager (MolecularDynamics, Sunnyvale, CA). The relative quantity of mRNA ofinterest was normalized by comparison to GAPDH mRNAvalues.

4.4 Cloning of the full-length Psg18 cDNA

To obtain the 3’ end of the Psg18 cDNA, RNA was isolatedfrom 18-day placentas obtained from Swiss Webster miceusing the TRIzol reagent. Three micrograms of RNA werereverse transcribed with Superscript RT (Life Technologies)and a 3’ end degenerate antisense primer [5’TCACTCAT-TT(AG)TCACAGCCAG] which was designed based on thecDNA sequences of other murine PSG [5]. The cDNA wasthen amplified using Vent DNA polymerase (New EnglandBiolabs, Beverly, MA) with the same primer used for thereverse transcriptase reaction and a Psg18-specific primerdesigned based on the partial Psg18 5’ sequence (5’CTCCTCTCTTTTCATCTGT). The PCR product was clonedinto pCRScript (Statagene, La Jolla, CA) and both strandswere sequenced using the Taq DyeDeoxy Terminator CycleSequencing kit (Applied Biosystems Inc., Foster City, CA).The entire Psg18 cDNA coding sequence was obtained byligating the PCR product (encoding amino acid 143 to thestop codon) to the partial Psg18 cDNA (corresponding to thefirst 208 amino acids of Psg18) using a common SstI restric-tion site [5]. The Psg18 cDNA sequence GenBank accessionnumber is AF 128236.

4.5 In situ hybridization

Male and female BALB/c mice (Charles River, Sulzfeld, Ger-many) were mated and the next day was designated day 0.5of gestation. Plugged females were anesthetized and killedby cervical dislocation. Embryos and placentas wereembedded either in toto or after dissection in Tissue Freez-ing Medium (Jung, Nussloch, Germany) diluted 1:1 withwater prior to freezing in ethanol/dry ice. Tissues were cryo-sectioned (7- ? m sections) and placed on SuperFrost/Plus microscope slides (Roth, Karlsruhe, Germany). In situhybridization analyses were performed as described [55],except that RNA probes were not fragmented by hydrolysis.Briefly, RNA probes were synthesized in the presence ofdigoxigenin-labeled UTP (Boehringer Mannheim, Mann-heim, Germany) using T3, T7 or SP6 RNA polymerase. The1.6-kb Psg18 cDNA fragment (this study) served as a tem-plate for probe synthesis. The Pl-I probes were derived froma 0.8-kb fragment and the 4311 probes were derived from a0.7-kb cDNA [44, 56]. In situ hybridizations were carried outin the presence of 0.3 ng/ ? l antisense or sense RNA probesas negative controls. The sections were counter-stainedwith Nuclear Fast Red (Vector Laboratories, Burlingame, CA)and mounted in Kaiser’s glycerol gelatin (Merck, Darmstadt,Germany).


4.6 Cloning into the baculovirus vectors andtransfection into Sf9 cells

The Psg18 cDNA was amplified by PCR with the senseprimer 5’GAAGATCTCGAGTCACCATTGAATC containing aBglII site and the antisense primer 5’TCACTCATTT(AG)TCA-CAGCCAG. The BglII-digested PCR product was clonedinto the baculovirus vector pAcSecG2T (PharMingen, SanDiego, CA) resulting in pAcSecG2T-Psg18. Recombinantvirus expressing GST-PSG18 was obtained by co-transfection of pAcSEcG2T-Psg18 and BaculoGold DNAinto Sf9 cells, and progeny viruses were plaque-purified fol-lowing the manufacturer’s instructions (PharMingen). GST-PSG18N was generated by amplifying pAcSEcG2T-Psg18with oligonucleotides 5’GGGAATTCATGCTACTAGTAAAT-CAGTC and 5’ CCGGTACCTAAACAGATGCACGACGGG.The product was cloned into pFastBac1 (Life Technologies).PSG18N-His was generated by amplifying Psg18 withupstream primer 5’GAAGATCTAGAGATATGGAG(TG)TGTCand downstream primer 5’TCAGGTACCGGAGTACACGTG-CAAG which includes the stop codon. The PCR product wascloned into the BamHI-KpnI sites of pcDNA3.1(-) MycHis(Invitrogen), digested with PmeI and ligated to the StuI siteof pFastBac1. PSG18N-expressing virus was obtained bytransfection of Sf9 cells with cellFECTIN and high molecularweight DNA from pFastBac-GST-Psg18N or pFastBac-Psg18N-His. The recombinant virus, GST-His-XylE, wasobtained by co-transfection of BaculoGold DNA and thebaculovirus transfer vector pAcGHLT-XylE (Pharmingen) intoSf9 insect cells as indicated above for GST-PSG18.

4.7 Production and purification of recombinantproteins

PSG18N fusion proteins were produced and purified fromthe culture supernatants. The supernatants were concen-trated five- to tenfold with a centriprep 3 or 10. The concen-trated material was loaded onto an SDS-PAGE (10 or 12%polyacrylamide) gel in a 491 Prep Cell apparatus (Bio-Rad,Hercules, CA). Fractions containing the recombinant pro-teins were identified by immunoblot and the SDS wasremoved by electroelution using a Sialomed apparatus witha 10-kDa molecular weight cutoff membrane (Amika Corp.,Columbia, MD). After SDS removal, recombinant GST-PSG18N and PSG18N-His were concentrated to a 1–2 mlfinal volume. The control fusion protein, GST-His-XylE, waspurified from insect cell lysates in a similar manner. Infectedinsect cells were lysed with RIPA buffer (0.1 M NaCl,0.001 M EDTA, pH 7.4, 0.1% NP40, 0.1% deoxycholate, 1%phenylmethylsulfonyl fluoride and 1% aprotinin) for 45 minon ice. The final concentration of recombinant proteins wasdetermined by comparison to BSA standards after separa-tion on a 4–20% NuPAGE gel (Novex, San Diego, CA) andstaining with Gelcode Blue (Pierce), using the Eagle Eye IIsystem and Eagle Sight version 3.1 software (Statagene, LaJolla, CA). GST-PSG18 was produced in Sf9 cells grown inSf900 II media (Life Technologies) supplemented with 5%

FBS. The concentration of GST-PSG18 was estimated afterthe medium was concentrated several fold with a centriprep30 by comparison to known concentrations of GST-PSG18Non an anti-GST immunoblot. All protein preparations con-tained less then 0.1 ng/ml LPS as measured by the Limulusamebocyte lysate assay (Charles River Endosafe, Charles-ton, SC).

4.8 Con A-Sepharose precipitation and immunoblotanalysis

Insect cell supernatant containing recombinant GST-PSG18or GST-PSG18N was mixed with 100 ? l Con A-Sepharose4B (Sigma, Saint Louis, MO) and incubated overnight at 4°C.The beads were centrifuged at 1300×g, washed and elutedwith 0.5 M § -D-methylmannopyrannoside. The recombinantproteins were separated on 4–20% NuPAGE gels (Novex),transferred to nitrocellulose membranes, and blocked inTBST (25 mM Tris HCl, pH 7.6, 150 mM NaCl, 0.1% Tween-20) supplemented with 5% milk. The membranes were thenincubated with anti-GST mAb (PharMingen) or anti-His anti-body (Invitrogen) followed by horseradish peroxidase-conjugated goat anti-mouse antibody (Bio-Rad). The mem-branes were washed and developed using the Super Signalchemiluminescent detection system (Pierce).

4.9 Statistical analysis

Data were analyzed using the Sigma Plot statistical package(Jandel Scientific software). Comparisons between twogroups were made using the unpaired t-test. Values wereconsidered statistically significant if p X 0.05. All experimentswere repeated at least three times with similar results.

Acknowledgments: We are most grateful to Drs. W.C.Gause, S. Vogel, C. Salkowski, F. Rollwagen, and C. Dieffen-bach for many helpful discussions and to Dr. Joan S. Hunt(University of Kansas Medical Center) for providing us withthe murine trophoblast cell lines. The gift of the placentalmarker plasmids, which were obtained from Dr. Janet Ros-sant and Dr. Daniel Linzer through Dr. R. Fundele, isgratefully acknowledged. This work was supported by GrantHD35832 from the National Institutes of Health and GrantCO74ET from USUHS.

References

1 Bohn, H., Detection and characterization of pregnancy proteinsin the human placenta and their quantitative immunochemicaldetermination in sera from pregnant women. Arch. Gynakol.1971. 210: 440–457.

2 Lin, T. M., Halbert, S. P. and Spellacy, W. N., Measurement ofpregnancy-associated plasma proteins during human gestation.J. Clin. Invest. 1974. 54: 576–582.


3 Masson, G. M., Anthony, F. and Wilson, M., Value of Schwan-gerschaftsprotein 1 (SP1) and pregnancy-associated plasmaprotein-A (PAPP-A) in the clinical management of threatenedabortion. Br. J. Obstet. Gynaecol. 1983. 90: 146–149.

4 Silver, R. M., Heyborne, K. D. and Leslie, K. K., Pregnancy spe-cific beta 1 glycoprotein (SP-1) in maternal serum and amnioticfluid; pre-eclampsia, small for gestational age fetus and fetaldistress. Placenta 1993. 14: 583–589.

5 Rudert, F., Saunders, A. M., Rebstock, S., Thompson, J. A.and Zimmermann, W., Characterization of murine carcinoem-bryonic antigen gene family members. Mamm. Genome 1992.3: 262–273.

6 Rutherfurd, K. J., Chou, J. Y. and Mansfield, B. C., A motif inPSG11s mediates binding to a receptor on the surface of the pro-monocyte cell line THP-1. Mol. Endocrinol. 1995. 9: 1297–1305.

7 Medawar, P. B. (Ed.) Some immunological and endocrinologicalproblems raised by evolution of viviparity in vertebrates, Aca-demic Press, New York 1953.

8 Munn, D. H., Zhou, M., Attwood, J. T., Bondarev, I., Conway, S.J., Marshall, B., Brown, C. and Mellor, A. L., Prevention of allo-geneic fetal rejection by tryptophan catabolism. Science 1998.281: 1191–1193.

9 Sacks, G., Sargent, I. and Redman, C., An innate view of humanpregnancy. Immunol. Today 1999. 20: 114–118.

10 Wegmann, T. G., Lin, H., Guilbert, L. and Mosmann, T. R., Bidi-rectional cytokine interactions in the maternal-fetal relantionship:is successful pregnancy a TH2 phenomenon? Immunol. Today1993. 14: 353–356.

11 Raghupathy, R., Th1-type immunity is incompatible with suc-cessful pregnancy. Immunol. Today 1997. 18: 478–482.

12 Elenkov, I. J., Hoffman, J. and Wilder, R. L., Does differentialneuroendocrine control of cytokine production govern theexpression of autoimmune diseases in pregnancy and the post-partum period? Mol. Med. Today 1997. 3: 379–383.

13 Chaouat, G., Meliani, A. A., Martal, J., Raghupathy, R., Elliot,J., Mosmann, T. and Wegmann, T. G., IL-10 prevents naturallyoccuring fetal loss in the CBA X DBA/2 mating combination, andlocal defect in IL-10 production in this abortion-prone combina-tion is corrected by in vivo injection of IFN- ; J. Immunol. 1995.154: 4261–4268.

14 Piccinni, M.-P., Beloni, L., Livi, C., Maggi, E., Scarselli, G. andRomagnani, S., Defective production of both leukemia inhibitoryfactor and type 2 T-helper cytokines by decidual T cells in unex-plained recurrent abortions. Nature Med. 1998. 4: 1020–1024.

15 Hill, J. A., Polgar, K. and Anderson, D. J., T-helper 1-type immu-nity to trophoblast in women with recurrent spontaneous abor-tion. JAMA 1995. 273: 1933–1936.

16 Hunt, J. S. and Pollard, J. W., Macrophages in the uterus andplacenta. Curr. Top. Microbiol. Immunol. 1992. 181: 39–63.

17 Hunt, J., Immunologically relevant cells in the uterus. Biol.Reprod. 1994. 50: 461–466.

18 Piccinni, M. P., Giudizi, M. G., Biagiotti, R. et al., Progesteronefavors the development of human T helper cells producing Th2-type cytokines and promotes both IL-4 production and mem-brane CD30 expression in established Th1 cell clones. J. Immu-nol. 1995. 155: 128–133.

19 Miller, L. and Hunt, J. S., Sex steroid hormones and macro-phage function. Life Sci. 1996. 59: 1–14.

20 Gilmore, W., Weiner, L. P. and Correale, J., Effect of estradiol oncytokine secretion by proteolipid protein-specific T cell clonesisolated from multiple sclerosis patients and normal control sub-

jects. J. Immunol. 1997. 158: 446–451.

21 Krishnan, L., Sad, S. and Raghupathy, R., Characterization ofan immunosuppressive factor secreted by a human trophoblast-derived choriocarcinoma cell line. Cell. Immunol. 1995. 162:295–308.

22 Menu, E., Kinsky, R., Hoffman, M. and Chaouat, G., Immu-noactive products of human placenta. IV. Immunoregulatory fac-tors obtained from cultures of human placenta inhibit in vivo localand systemic allogeneic and graft versus-host reactions in mice.J. Reprod. Immunol. 1991. 20: 195–204.

23 Kromer, B., Finkenzeller, D., Wessels, J., Dveksler, G., Thomp-son, J. and Zimmermann, W., Coordinate expression of splicevariants of the murine pregnancy-specific glycoprotein (PSG)gene family during placental development. Eur. J. Biochem.1996. 242: 280–287.

24 Carney, E. W., Prideaux, V., Lye, S. J. and Rossant, J., Progres-sive expression of trophoblast-specific genes during formation ofmouse trophoblast giant cells in vitro. Mol. Reprod. Dev. 1993.34: 357–368.

25 Hau, J., Gidley-Baird, A. A., Westergaard, J. G. and Teisner,B., The effect on pregnancy of intrauterine administration of anti-bodies against two pregnancy-associated murine proteins:murine pregnancy-specific beta 1-glycoprotein and murinepregnancy-associated alpha 2-glycoprotein. Biomed BiochimActa 1985. 44: 1255–1259.

26 Hynes, R. O., Integrins: versatility, modulation, and signaling incell adhesion. Cell 1992. 69: 11–25.

27 Zhou, H., Fuks, A., Alcaraz, G., Bolling, T. J. and Stanners, C.P., Homophilic adhesion between Ig superfamily carcinoem-bryonic antigen molecules involves double reciprocal bonds.J. Cell. Biol. 1993. 122: 951–960.

28 Dveksler, G. S., Pensiero, M. N., Dieffenbach, C. W., Cardelli-chio, C. B., Basile, A. A., Elia, P. E. and Holmes, K. V., Mousehepatitis virus strain A59 and blocking antireceptor monoclonalantibody bind to the N-terminal domain of cellular receptor. Proc.Natl. Acad. Sci. USA 1993. 90: 1716–1720.

29 Teixeira, A. M., Fawcett, J., Simmons, D. L. and Watt, S. M.,The N-domain of the biliary glycoprotein (BGP) adhesion mole-cule mediates homotypic binding: domain interactions and epi-tope analysis of BGPc. Blood 1994. 84: 211–219.

30 Bos, M. P., Kuroki, M., Krop-Watorek, A., Hogan, D. and Bel-land, R. J., CD66 receptor specificity exhibited by neisserial Opavariants is controlled by protein determinants in CD66 N-domains. Proc. Natl. Acad. Sci. USA 1998. 95: 9584–9589.

31 Sasagawa, M., Yamazaki, T., Endo, M., Kanazawa, K. andTakeuchi, S., Immunohistochemical localization of HLA antigensand placental proteins (alpha hCG, beta hCG CTP, hPL and SP1in villous and extravillous trophoblast in normal human preg-nancy: a distinctive pathway of differentiation of extravillous tro-phoblast. Placenta 1987. 8: 515–528.

32 Guillemot, F., Nagy, A., Auerbach, A., Rossant, J. and Joyner,A. L., Essential role of Mash-2 in extraembryonic development.Nature 1994. 371: 33–336.

33 Lescisin, K. R., Varmuza, S. and Rossant, J., Isolation andcharacterization of a novel trophoblast-specific cDNA in themouse. Genes Dev. 1988. 2: 1639–1646.

34 Grunvald, E., Chiaramonte, M., Hieny, S., Wysocka, M., Trin-chieri, G., Vogel, S. N., Gazzinelli, R. T. and Sher, A., Biochemi-cal characterization and protein kinase C dependency ofmonokine-inducing activities of Toxoplasma gondii. Infect.Immun. 1996. 64: 2010–2018.


35 Maeda, H., Kuwahara, H., Ichimura, Y., Ohtsuki, M., Kurakata,S. and Shiraishi, A., TGF-beta enhances macrophage ability toproduce IL-10 in normal and tumor-bearing mice. J. Immunol.1995. 155: 4926–4932.

36 Suzuki, T., Hiromatsu, K., Ando, Y., Okamoto, T., Tomoda, Y.and Yoshikai, Y., Regulatory role of gamma delta T cells in uter-ine intraepithelial lymphocytes in maternal antifetal immuneresponse. J. Immunol. 1995. 154: 4476–4484.

37 Arnold, L. L., Doherty, T. M., Flor, A. W., Simon, J. A., Chou, J.Y., Chan, W. Y. and Mansfield, B. C., Pregnancy-specific glyco-protein gene expression in recurrent aborters: a potential correla-tion to interleukin-10 expression. Am. J. Reprod. Immunol. 1999.41: 174–182.

38 Rivera, D. L., Olister, S. M., Liu, X., Thompson, J. H., Zhang, X.J., Pennline, K., Azuero, R., Clark, D. A. and Miller, M. J.,Interleukin-10 attenuates experimental fetal growth restrictionand demise. FASEB J. 1998. 12: 189–197.

39 Fiorentino, D. F., Zlotnik, A., Vieira, P., Mosmann, T. R.,Howard, M., Moore, K. W. and O’Garra, A., IL-10 acts on theantigen-presenting cell to inhibit cytokine production by Th1cells. J. Immunol. 1991. 146: 3444–3451.

40 de Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G. andde Vries, J. E., Interleukin 10 inhibits cytokine synthesis byhuman monocytes: an autoregulatory role of IL-10 produced bymonocytes. J. Exp. Med. 1991. 174: 1209–1220.

41 Hsu, D. H., Moore, K. W. and Spits, H., Differential effects of IL-4and IL-10 on IL-2-induced IFN-gamma synthesis andlymphokine-activated killer activity. Int. Immunol. 1992. 4:563–569.

42 Moreau, P., Adrian-Cabestre, F., Menier, C., Guiard, V., Gou-rand, L., Dausset, J., Carosella, E. D. and Paul, P., IL-10 selec-tively induces HLA-G expression in human trophoblasts andmonocytes. Int. Immunol. 1999. 11: 803–811.

43 Kinsky, R., Delage, G., Rosin, N., Thang, M. N., Hoffmann, M.and Chaouat, G., A murine model of NK cell mediated resorp-tion. Am. J. Reprod. Immunol. 1990. 23: 73–77.

44 Lacraz, S., Nicod, L. P., Chicheportiche, R., Welgus, H. G. andDayer, J. M., IL-10 inhibits metalloproteinase and stimulatesTIMP-1 production in human mononuclear phagocytes. J. Clin.Invest. 1995. 96: 2304–2310.

45 Roth, I. and Fisher, S. J., IL-10 is an autocrine inhibitor of humanplacental cytotrophoblast MMP- 9 production and invasion. Dev.Biol. 1999. 205: 194–204.

46 Hennessy, A., Pilmore, H. L., Simmons, L. A. and Painter, D.M., A deficiency of placental IL-10 in preeclampsia. J. Immunol.1999. 163: 3491–3495.

47 Kuhn, R., Lohler, J., Rennick, D., Rajewsky, K. and Muller, W.,Interleukin-10-deficient mice develop chronic enterocolitis. Cell1993. 75: 263–274.

48 Rasmussen, C. A., Pace, J. L., Banerjee, S., Phillips, T. A. andHunt, J. S., Trophoblastic cell lines generated from tumournecrosis factor receptor- deficient mice reveal specific functionsfor the two tumour necrosis factor receptors. Placenta 1999. 20:213–222.

49 Bogdan, C., Vodovotz, Y. and Nathan, C., Macrophage deacti-vation by interleukin 10. J. Exp. Med. 1991. 174: 1549–1555.

50 Abramsky, O., Pregnancy and multiple sclerosis. Ann. Neurol.1994. 36: 38-41.

51 Svetic, A., Finkelman, F. D., Jian, Y. C., Dieffenbach, C. W.,Scott, D. E., McCarthy, K. F., Steinberg, A. D. and Gause, W.C., Cytokine gene expression after in vivo primary immunizationwith goat antibody to mouse IgD antibody. J. Immunol. 1991.147: 2391–2397.

52 Wynn, T. A., Eltoum, I., Cheever, A. W., Lewis, F. A., Gause, W.C. and Sher, A., Analysis of cytokine mRNA expression duringprimary granuloma formation induced by eggs of Schistosomamansoni. J. Immunol. 1993. 151: 1430–1440.

53 Dveksler, G. S., Basile, A. A. and Dieffenbach, C. W., Analysisof gene expression: use of oligonucleotide primers forglyceraldehyde-3-phosphate dehydrogenase. PCR MethodsAppl. 1992. 1: 283–285.

54 Manthey, C. L., Perera, P. Y., Henricson, B. E., Hamilton, T. A.,Qureshi, N. and Vogel, S. N., Endotoxin-induced early geneexpression in C3H/HeJ (Lpsd) macrophages. J. Immunol. 1994.153: 2653–2663.

55 Schaeren-Wiemers, N. and Gerfin-Moser, A., A single protocolto detect transcripts of various types and expression levels inneural tissue and cultured cells: in situ hybridization usingdigoxigenin-labelled cRNA probes. Histochemistry 1993. 100:431–440.

56 Colosi, P., Talamantes, F. and Linzer, D. I., Molecular cloningand expression of mouse placental lactogen I complementarydeoxyribonucleic acid. Mol. Endocrinol. 1987. 1: 767–776.

Correspondence: Gabriela Dveksler, Department of Pathol-ogy, Uniformed Services University of the Health Sciences,4301 Jones Bridge Rd., Bethesda, MD 20814, USAFax: +1-301–2951640e-mail: gdveksler — usuhs.mil
