Created by: Mr. Ankitkumar Upadhyaya (M.sc Bioinformatics)

Overview of Sicke-Cell Anemia

Sickle cell anemia is a disease in which the patient's red blood cells have an abnormal shape much like that of a sickle.

The abnormal shape of the cells in individuals with sickle cell anemia comes from a defective protein within the blood cells themselves.

This defective protein is hemoglobin. The normal hemoglobin protein is made up of four parts, and therefore called a tetramer.

Each part of the tetramer has the ability to bind an oxygen molecule and carry it from the lungs to the tissues in which oxygen is needed.

When the defective hemoglobin in sickle cell anemia, referred to as Hb S, does not have an oxygen molecule bound, it tends to form a precipitate made up of lots of hemoglobin proteins stuck to each other.

This precipitate is what causes the red blood cells to become sickle-shaped.

Which gene responsible???

HBB: The Gene Associated with Sickle Cell Anemia.

Official Gene Symbol: HBB

Name of Gene Product: hemoglobin, beta

Alternate Name of Gene Product: beta globin

Locus: 11p15.5 - The HBB gene is found in region 15.5 on the short (p) arm of human chromosome 11.

Sickle cell anemia

Sickle cell anemia is a disease in which the patient's red blood cells have an abnormal shape much like that of a sickle.

The abnormal shape of the cells in individuals with sickle cell anemia comes from a defective protein within the blood cells themselves. This defective protein is hemoglobin. The normal hemoglobin protein is made up of four parts, and therefore called a tetramer. Each part of the tetramer has the ability to bind an oxygen molecule and carry it from the lungs to the tissues in which oxygen is needed. When the defective hemoglobin in sickle cell anemia, referred to as Hb S, does not have an oxygen molecule bound, it tends to form a precipitate made up of lots of hemoglobin proteins stuck to each other. This precipitate is what causes the red blood cells to become sickle-shaped

Mutation in the sequence

Find the position

Step:

1) Open the http://workbench.sdsc.edu

2) End of the page click “protein tool”

3) Select the Ndjinn-multiple database search

4) Click run button & select the pdbfinder option & type the hemoglobin & click on search button .

5) There are display the 455 structure .find (select)the normal hemoglobin structure (1hab)as well as sickle cell hemoglobin structure(2hbs) .

6) Click on “show record” & select the beta chain of the both record.

7) select the clustalw tool & import the both sequences.

8) Change the parameter which you want ..

9) Click on run button

Whether a person has sickle cell anemia or not is determined by the person's genes. The DNA sequences you looked at for the normal and sickle cell hemoglobin are two versions of the gene for hemoglobin. However, it's not as simple as saying that if a person has the sickle cell hemoglobin gene, then they have the disease.

Since each person has two sets of genes, one from the mother and one from the father, there are two copies of the gene for hemoglobin. This is important because a person can have two of the sickle cell anemia gene, or a normal and a disease gene, or two normal genes. Each of these combinations results in a different situation for the person. If a person has two of the same genes, either two normal or two sickle cell genes, they are "homozygous" (homo=the same). If a person has two different genes for hemoglobin, then they are called "heterozygous" (hetero=different).

A person who is heterozygous for the hemoglobin gene will have a few sickle-shaped red blood cells, and a very mild case of sickle cell anemia. Meanwhile, a person who is homozygous for the sickle cell hemoglobin will have lots of sickled cells and have a full-blown case of the disease. A person who is homozygous for normal hemoglobin will have completely normal red blood cells

Anemia. Sickle cells are fragile. They break apart easily and die, leaving you chronically short on red blood cells. Red blood cells usually live for about 120 days before they die and need to be replaced. However, sickle cells die after only 10 to 20 days. The result is a chronic shortage of red blood cells, known as anemia. Without enough red blood cells in circulation, your body can't get the oxygen it needs to feel energized. That's why anemia causes fatigue.

Episodes of pain. Periodic episodes of pain, called crises, are a major symptom of sickle cell anemia. Pain develops when sickle-shaped red blood cells block blood flow through tiny blood vessels to your chest, abdomen and joints. Pain can also occur in your bones. The pain may vary in intensity and can last for a few hours to a few weeks. Some people experience only a few episodes of pain. Others experience a dozen or more crises a year. If a crisis is severe enough, you may need hospitalization so that pain medication can be injected into your veins (intravenously).

Hand-foot syndrome. Swollen hands and feet may be the first signs of sickle cell anemia in babies. The swelling is caused by sickle-shaped red blood cells blocking blood flow out of their hands and feet.

Jaundice. Jaundice is a yellowing of the skin and eyes that occurs because of liver damage or dysfunction. Occasionally, people who have sickle cell anemia have some degree of jaundice because the liver, which filters harmful substances from the blood, is overwhelmed by the rapid breakdown of red blood cells. In people with dark skin, jaundice is visible mostly as yellowing of the whites of the eyes.

Frequent infections. Sickle cells can damage your spleen, an organ that fights infection. This may make you more vulnerable to infections. Doctors commonly give infants and children with sickle cell anemia antibiotics to prevent potentially life-threatening infections, such as pneumonia.

Delayed growth. Red blood cells provide your body with the oxygen and nutrients you need for growth. A shortage of healthy red blood cells can slow growth in infants and children and delay puberty in teenagers.

Vision problems. Some people with sickle cell anemia experience vision problems. Tiny blood vessels that supply your eyes may become plugged with sickle cells. This can damage the retina — the portion of the eye that processes visual images.

When to see a doctor Although sickle cell anemia is usually diagnosed in infancy, if you or your child develops any of the following problems, see your doctor right away or seek emergency medical care.

Any signs or symptoms of stroke. If you notice any one-sided paralysis or weakness in the face, arms or legs, confusion, trouble walking or talking, sudden vision problems .

Stroke. A stroke can occur if sickle cells block blood flow to an area of your brain. Stroke is one of the most serious complications of sickle cell anemia. Signs of stroke include seizures, weakness or numbness of your arms and legs, sudden speech difficulties, and loss of consciousness. If your baby or child has any of these signs and symptoms, seek medical treatment immediately. A stroke can be fatal.

Acute chest syndrome. This life-threatening complication of sickle cell anemia causes chest pain, fever and difficulty breathing. Acute chest syndrome can be caused by a lung infection or by sickle cells blocking blood vessels in your lungs. It requires emergency medical treatment with antibiotics, blood transfusions and drugs that open up airways in your lungs. Recurrent attacks can damage your lungs.

Pulmonary hypertension. About one-third of people with sickle cell anemia will eventually develop high blood pressure in their lungs (pulmonary hypertension). Shortness of breath and difficulty breathing are common symptoms of this condition, which can ultimately lead to heart failure.

Organ damage. Sickle cells can block blood flow through blood vessels, immediately depriving an organ of blood and oxygen. In sickle cell anemia, blood is also chronically low on oxygen. Chronic deprivation of oxygen-rich blood can damage nerves and organs in your body, including your kidneys, liver and spleen. Organ damage can be fatal.

Blindness. Tiny blood vessels that supply your eyes can get blocked by sickle cells. Over time, this can damage the retina — the portion of the eye that processes visual images — and lead to blindness.

Skin ulcers. Sickle cell anemia can cause open sores, called ulcers, on your legs.

Gallstones. The breakdown of red blood cells produces a substance called bilirubin. Bilirubin is responsible for yellowing of the skin and eyes (jaundice) in people with sickle cell anemia. A high level of bilirubin in your body can also lead to gallstones.

Diagnosis &Treatment

Blood test - More than 40 states now perform a simple,

inexpensive blood test for sickle cell disease on all newborn

infants. This test is performed at the same time and from the same

blood samples as other routine newborn-screening tests.

Hemoglobin electrophoresis is the most widely used diagnostic

test. If the test shows the presence of sickle hemoglobin, a second

blood test is performed to confirm the diagnosis. These tests also tell whether or not the child

carries the sickle cell trait.

Treatment most important three method…..

• Blood Transfusions

• Oral Antibiotics

• Hydroxyurea

• Bone marrow is the flexible tissue found in the hollow interior of bones. In adults, marrow in large bones produces new blood cells. It constitutes 4% of the total body weight of humans.

• Type of the Bone Marrow:

1)Red Bone Marrow :

2)Yellow Bone Marrow :

Stroma:

• The stroma of the bone marrow is all tissue not directly involved in the primary function of hematopoiesis. The yellow bone marrow belongs here, and makes the majority of the bone marrow stroma, in addition to stromal cells located in the red bone marrow. Yellow bone marrow is found in the Medullary cavity

• If the family of a child with sickle cell disease is considering bone marrow transplantation, it must first meet three requirements

The bone marrow donor must

a) be a sibling

b) be an immunologic match (HLA type match)

c) not have sickle cell disease.

Donation &Tranplantation: • It is possible to take hematopoietic stem cells from one person and then

infuse them into another person (Allogenic) or into the same person at a later time (Autologous).

• If donor and recipient are compatible, these infused cells will then travel to the bone marrow and initiate blood cell production.

• Transplantation from one person to another is performed in severe cases of disease of the bone marrow

Continue……

• The patient's marrow is first killed off with drugs or radiation, and then the new stem cells are introduced

• Before radiation therapy or chemotherapy in cases of cancer, some of the patient's hematopoietic stem cells are sometimes harvested and later infused back when the therapy is finished to restore the immune system

• procedure is risky: Between 5 and 10 percent of children who undergo the process don't survive because of a major infection, uncontrollable bleeding, or organ failure involving the liver, kidney, lungs.

• Another 8 to 12 percent reject the graft (the term used to describe the transplanted bone marrow).

• These dangers restrict bone marrow transplants to children in relatively good physical condition and who suffer such serious complications from sickle cell disease that their families feel the risks are worth taking

• Siblings hold the key: • A full HLA (or immunologic) match between brothers or sisters offer the best

chances for a successful bone marrow transplant (BMT).

• two negative side effects:

1) Graft rejection: in which your child goes through the transplantation

process, only to have her own bone marrow grow back.

2) Graft vs. Host Disease, in which the transplanted marrow perceives the rest of your child's body as foreign tissue and attacks it. This condition can be mild and treated with a brief course of immune-suppressant medications, or it can be quite severe and cause life-threatening damage to the body. Occasionally, it can be a chronic problem and require long-term treatment

• This procedure replaces bone marrow affected by sickle cell anemia with healthy bone marrow from a donor who doesn't have the disease.

• It can be a cure, but the procedure is risky, and it's difficult to find suitable donors.

• Researchers are still studying bone marrow transplants for people with sickle cell anemia.

• Currently, the procedure is recommended only for people who have significant symptoms and problems from sickle cell anemia.

• Bone marrow transplant requires a lengthy hospital stay. After the transplant, you'll need drugs to help prevent rejection of the donated

marrow.

• Hydroxyurea is an anti-cancer ("antineoplastic" or "cytotoxic") chemotherapy drug. Hydroxyurea is classified as an "antimetabolite."

• HbF, also called fetal hemoglobin, is the form of hemoglobin present in the fetus and small infants.

• Most HbF disappears early in childhood, although some HbF may persist. Fetal hemoglobin is able to block the sickling action of red blood cells. Because of this, infants with sickle cell disease do not develop symptoms of the illness until.

• HbF levels have dropped. Adults who have sickle cell disease but still retain high levels of hemoglobin F generally have mild disease

• Hydroxyurea (Droxia) is a drug that reduces the severity of sickle cell disease by stimulating production of HbF. It is currently the only drug in general use to prevent acute sickle cell crises

• One mechanism of action is believed to be based on its reduction of production of deoxyribonucleotides[1] via inhibition of the enzyme ribonucleotide reductase by scavenging tyrosyl free radicals as they are involved in the reduction NDPs.[2]

• In the treatment of sickle-cell disease, hydroxycarbamide increases the concentration of fetal haemoglobin.

• The precise mechanism of action is not yet clear, but it appears that hydroxycarbamide increases nitric oxide levels, causing soluble guanylyl cyclase activation with a resultant rise in cyclic GMP, and the activation of gammaglobulin synthesis necessary for fetal hemoglobin (by removing the rapidly dividing cells that preferentially produce sickle hemoglobin).[2][3]

• This prescription drug, normally used to treat cancer, may be helpful for adults with severe disease.

• When taken daily, it reduces the frequency of painful crises and may reduce the need for blood transfusions.

• It seems to work by stimulating production of fetal hemoglobin — a type of hemoglobin found in newborns that helps prevent the formation of sickle cells.

• There is some concern about the possibility that long-term use of this drug may cause tumors or leukemia in certain people.

• Your doctor can help you determine if this drug may be beneficial for you

• These side effects are less common side effects (occurring in about 10-29%) of patients receiving Hydroxyurea:

• Hair loss (mild thinning)

• Nausea and vomiting

• Diarrhea

• Mouth sores

• Poor appetite

• Nail thickening, nail banding (see skin reactions)

• Discoloration of the skin or nails (see skin reactions)

• Darkening of the skin where previous radiation treatment has been given. (radiation recall - see skin reactions

• Gene therapy. Because sickle cell anemia is caused by a defective gene, researchers are exploring whether inserting a normal gene into the bone marrow of people with sickle cell anemia will result in the production of normal hemoglobin. Scientists are also exploring the possibility of turning off the defective gene while reactivating another gene responsible for the production of fetal hemoglobin — a type of hemoglobin found in newborns that prevents sickle cells from forming.

• Butyric acid. Normally used as a food additive, butyric acid may increase the amount of fetal hemoglobin in the blood.

• Clotrimazole. This over-the-counter antifungal medication helps prevent a loss of water from red blood cells, which may reduce the number of sickle cells that form.

• Nitric oxide. Sickle cell anemia causes low levels of nitric oxide, a gas that helps keep blood vessels open and reduces the stickiness of red blood cells. Treatment with nitric oxide may prevent sickle cells from clumping together.

• Nicosan. This is an herbal treatment in early trials in the U.S. Nicosan has been used to prevent sickle crises in Nigeria

Develop a simple inexpensive DNA test for sickle cell allele

• develop DNA probe

• test for presence of sickle cell mutation

• use bioinformatics tools

• online databases of DNA sequences

• UCSC Genome Browser

• probe design tool

• Primer3

2004-2005

DNA double helix

A–T, C–G

base pair bonds can be broken by heating to 100°C

separate strands

denature, or melt

2004-2005 5’ 3’

Probe

short, single stranded DNA molecule

mix with denatured DNA

DNA Hybridization

probe bonds to complementary DNA sequence

Label

probe is labeled for easy detection

labeled probe

genomic DNA G A T C A G T A G

C T A G T C A T C

2004-2005

Allele specific probes

probes require matched sequences

can detect single base differences in alleles

single mis-matched base near middle of probe greatly reduces hybridization efficiency

5’ 3’

labeled probe

genomic DNA X

C T A G T C A T C

Genomic DNA

denature DNA

bind DNA from cells on filter paper

DNA hybridization

wash probe over filter paper

if complementary sequence present, probe binds to genomic DNA

expose on X-ray film

dark spots show bound probe

2004-2005

UCSC Genome Browser human genome database

http://genome.ucsc.edu/ UCSC Genome Browser home page

click on link to Genome Browser

in genome pulldown menu, choose “Human”

for position text box, type “HBB” (hemoglobin )

hit “submit”

Listing of genes & sequences in database Click on “RefSeq” gene for HBB (NM_000518)

Position of HBB in genome

at base 5.2 million on chromosome 11

Move & zoom tools zoom out ~30x to see more of chromosome 11

2004-2005

Cluster of hemoglobin genes on chromosome 11

HBD, HBG1, HBG2 & HBE1

what are these genes?

Click on the HBB RefSeq gene

HBB RefSeq summary page

Click on “Genomic Sequence from assembly”

Sequence Formatting Options

“exons in upper case, everything else in lower case”

hit “submit”

Genomic DNA

lower case = introns

spliced out of mRNA before translation

upper case = exons

translated into polypeptide chain

2004-2005

>hg16_refGene_NM_000518 range=chr11:5211005-5212610 5'pad=0 3'pad=0 revComp=TRUE

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC

ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG

CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtat

caaggttacaagacaggtttaaggagaccaatagaaactgggcatgtgga

gacagagaagactcttgggtttctgataggcactgactctctctgcctat

tggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAG

AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG

CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG

ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT

GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgag

tctatgggacgcttgatgttttctttccccttcttttctatggttaagtt

catgtcataggaaggggataagtaacagggtacagtttagaatgggaaac

agacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttctt

ttatttgctgttcataacaattgttttcttttgtttaattcttgctttct

ttttttttcttctccgcaatttttactattatacttaatgccttaacatt

gtgtataacaaaaggaaatatctctgagatacattaagtaacttaaaaaa

aaactttacacagtctgcctagtacattactatttggaatatatgtgtgc

ttatttgcatattcataatctccctactttattttcttttatttttaatt

gatacataatcattatacatatttatgggttaaagtgtaatgttttaata

tgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaa

aaaatgctttcttcttttaatatacttttttgtttatcttatttctaata

ctttccctaatctctttctttcagggcaataatgatacaatgtatcatgc

ctctttgcaccattctaaagaataacagtgataatttctgggttaaggca

atagcaatatctctgcatataaatatttctgcatataaattgtaactgat

first 50 bases are untranslated “leader” sequence

actual protein coding sequence starts at base 51

starting with letters ATG

2004-2005

Sickle cell mutation

single base mutation

6th amino acid: glutamic acid valine

need DNA sequence to design probe

SNPs

single nucleotide polymorphisms

“variations and repeats” section: pack

several SNPs of HBB gene

need mutation in exon

near beginning of HBB protein

rs334 = Hb S mutation

2004-2005

“Sequence in Assembly” = normal sequence

“Alternate Sequence” = sickle cell sequence

Line up sequences

sequence fragment is enough to design DNA probes for normal & mutant sequences

Normal: catggtgcacctgactcctgAggagaagtctgccgttactg HBB: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG Mutant: catggtgcacctgactcctgTggagaagtctgccgttactg

2004-2005

Primer3

free on Web from MIT http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi

powerful tool for primer design

paste in sequence fragment

2004-2005

Need 2 probes

normal allele probe

sickle cell allele probe

choose hybridization probes

Customize probes

12-16 bases

40°-60°C

longer probes are stable at higher temperatures

Ready to order!

Place an order at your local DNA lab!