Chromosomes found in the Chromosomes found in the nucleus carry the nucleus carry the hereditary hereditary

materialmaterial -- DNA -- DNA DNA (deoxyribonucleic acid) - DNA DNA (deoxyribonucleic acid) - DNA

controls cellular activity by controls cellular activity by influencing the production of influencing the production of enzymesenzymes. .

Basically, DNA tells your body how to Basically, DNA tells your body how to grow! grow!

--DNA is a very long --DNA is a very long chain polymer made chain polymer made up of thousands of up of thousands of repeating units called repeating units called nucleotidesnucleotides. .

--Nucleotide Unit is --Nucleotide Unit is composed of a composed of a phosphatephosphate group, a group, a pentose (5 Carbon) pentose (5 Carbon) sugar (deoxyribose) sugar (deoxyribose) , , and a and a nitrogenous nitrogenous basebase. .

--The Nitrogenous --The Nitrogenous Bases are; Bases are; adenineadenine (A) (A) thyminethymine (T) (T) guanineguanine (G) (G) cytosinecytosine (C) (C)

DNA is a very long chain polymer made up of DNA is a very long chain polymer made up of thousands of repeating units called thousands of repeating units called nucleotidesnucleotides. .

Nucleotide Unit is composed of:Nucleotide Unit is composed of:– aa phosphate phosphate group group– a a pentose (5 Carbon) sugar (deoxyribose) pentose (5 Carbon) sugar (deoxyribose) – a a nitrogenous basenitrogenous base. .

The Nitrogenous Bases areThe Nitrogenous Bases are– adenineadenine (A) (A) – thyminethymine (T) (T) – guanineguanine (G) (G) – cytosinecytosine (C) (C)

DNA nucleotidesDNA nucleotides

Phosphate group

Pentose sugarNitrogenous base

Sugar phosphate backbone

Nucleotide

Polynucleotide chain

** Consists of two chains ** Consists of two chains of nucleotide units in a of nucleotide units in a twisted twisted ladder-like ladder-like structurestructure. (spiral . (spiral staircase) staircase)

This spiral staircase is This spiral staircase is called an called an alpha helixalpha helix. .

The sides of the ladder The sides of the ladder are made up of are made up of alternating deoxyribose alternating deoxyribose sugar -- sugar -- phosphatephosphate group group units. units.

The rungs of the ladder The rungs of the ladder are made of 2 are made of 2 nitrogenous bases per nitrogenous bases per rung linked together by rung linked together by a a weak hydrogen bondweak hydrogen bond. .

Only 2 combinations of Only 2 combinations of base pairs can form the base pairs can form the rungs of the DNA rungs of the DNA molecule. molecule.

Adenine - Thymine (A-Adenine - Thymine (A-T)T)

AND AND Guanine – Cytosine (G-C)Guanine – Cytosine (G-C)

This specific matching up This specific matching up of the nitrogenous bases of the nitrogenous bases is called is called complementary complementary basebase pairing. pairing.

Okay… show the resulting base pairings Okay… show the resulting base pairings below!below!

ATGCCTACGTTAGATTACAACCTAAGCAATATGCCTACGTTAGATTACAACCTAAGCAATTACGGATGCAATCTAATGTTGGATTCGTTATACGGATGCAATCTAATGTTGGATTCGTTA

Did you find the hidden word?! Did you find the hidden word?!

DNA makes ProteinDNA makes Protein ** One gene codes for one ** One gene codes for one

polypeptide chain. polypeptide chain.

gene = the sequence of gene = the sequence of nucleotides in a DNA molecule nucleotides in a DNA molecule necessary to synthesize a necessary to synthesize a polypeptide (protein)polypeptide (protein)

DNA ultimately determines the DNA ultimately determines the sequence of amino acids in sequence of amino acids in specific proteins. specific proteins.

Enzymes are specific because of their protein makeup

Cell function is specialized Cell function is specialized because of its enzymesbecause of its enzymes

Therefore, DNA determines Therefore, DNA determines function of cells in an organism. function of cells in an organism.

Aim: Review the structure and function of DNADo Now: •Complete lab pages P1-P2 pages O9 and with signature for modelor •work on pages DD2-DD3 questions 17-27

ProteinsProteins The work of a cell The work of a cell

is carried out by is carried out by the many different the many different kinds of molecules kinds of molecules it assembles, it assembles, mostly proteins.   mostly proteins.  

Proteins are long, Proteins are long, folded molecules folded molecules made up of up to made up of up to 20 different kinds 20 different kinds of amino acids of amino acids which interact to which interact to produce specific produce specific protein shapes. protein shapes.

The specific shape of The specific shape of the protein (exs. the protein (exs. enzymes and enzymes and hormones) determines hormones) determines the specific function of the specific function of that protein. that protein.

Offspring resemble Offspring resemble their parents because their parents because they inherit similar they inherit similar genes that code for the genes that code for the production of proteins production of proteins that form similar that form similar structures and perform structures and perform similar functions. similar functions.

History of the MoleculeHistory of the Molecule James Watson and Francis CrickJames Watson and Francis Crick won won

the Nobel Prize by determining the the Nobel Prize by determining the structure of the DNA molecule (early structure of the DNA molecule (early 1950's) with X-Ray images provided 1950's) with X-Ray images provided by by Rosalind FranklinRosalind Franklin

determined the structure of the DNA determined the structure of the DNA molecule - figured out that DNA looks molecule - figured out that DNA looks like like two threads twisted around each two threads twisted around each otherother, held together by many , held together by many bridgesbridges between the strandsbetween the strands