CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CTGGACT
An important mechanism that is now well established for many repeat expansion diseases is the toxicity of RNAs that contain expanded repeat sequences. In these diseases, the RNAs that contain expanded repeats interact with different RNA-binding proteins
(coloured shapes) to produce disease. This is a 'trans-dominant' model of RNA toxicity: the interaction of mutant RNA with RNA-binding proteins is envisioned to interfere with the functions of the interacting proteins,
which leads to abnormalities in the pathways regulated by the RNA-binding proteins
UCDVia Bioquimica Datos Clinicos
6q23 Arg1.
Role en asma y metabolismo de NO.
Leve a moderada NH4, progresiva espasticidad,convulsiones y fallo en el desarrollo intelectual debido al alto nivel de CGG.
CGG alto, NH4 L-M.
Recommended