Originally published 6 January 2017; corrected 23 August 2018
www.sciencemag.org/content/355/6320/84/suppl/DC1
Supplementary Materials for
SOX2 promotes lineage plasticity and antiandrogen resistance in TP53-
and RB1-deficient prostate cancer
Ping Mu, Zeda Zhang, Matteo Benelli, Wouter R. Karthaus, Elizabeth Hoover, Chi-Chao
Chen, John Wongvipat, Sheng-Yu Ku, Dong Gao, Zhen Cao, Neel Shah, Elizabeth J.
Adams, Wassim Abida, Philip A. Watson, Davide Prandi, Chun-Hao Huang, Elisa de
Stanchina, Scott W. Lowe, Leigh Ellis, Himisha Beltran, Mark A. Rubin, David W.
Goodrich, Francesca Demichelis, Charles L. Sawyers*
*Corresponding author. Email: [email protected]
Published 6 January 2017, Science 355, 84 (2017)
DOI: 10.1126/science.aah4307
This PDF file includes:
Materials and Methods
Figs. S1 to S11
Captions for Tables S1 to S3
References
Other Supplementary Material for this manuscript includes the following:
(available at www.sciencemag.org/content/355/6320/84/suppl/DC1)
Tables S1 to S3 (Excel files)
Correction: On page 3, there was an error in the sequence of the sgTP53 CRISPR guide
RNA, which has now been corrected. This error does not affect any of the data or
conclusions in the paper because the correct sequence was used in the relevant
experiments.
Materials and Methods
Cell lines and tissue culture
LNCaP/AR cell line was generated and maintained as previously described (31). The
CWR22Pc prostate cancer cell line was kindly provided by Marja Nevalainen (32). We
found that this cell line contained a subpopulation of cells with fibroblast-like
morphology that were EpCAM-negative and confirmed to be of mouse origin. In order to
remove these mouse cells, we plated CWR22Pc at 400-800 cells per well (6-well) in 50%
conditioned media. Numerous multi-clonal, cancer epithelial islands visually free of
fibroblasts were isolated by cloning cylinders and then pooled to derive the pure
epithelial subline, CWR22Pc-EP. Both cells were cultured at 37° C (5% CO2) in high-
glucose RPMI medium supplemented with 10% fetal bovine serum (FBS), 1% HEPES,
1% Sodium Pyruvate, 1% penicillin-streptomycin and 1% L-Glutamine. All cells were
passaged every 3 days. LNCaP/AR cells were cultured in same RPMI medium
supplemented with charcoal-stripped serum (CSS) when treated with enzalutamide.
The antibody we used is anti-human EpCAM-FITC antibody (Miltenyi Biotec, #130-098-
113) and the primers are:
human-specific AR: 5ʹ-GCAGGAAGCAGTATCCGAAG-3ʹ and 5ʹ
GACACCGACACTGCCTTACA-3ʹ;
mouse-specific Myc: 5ʹ CAACGTCTTGGAACGTCAGA-3ʹ and 5ʹ-
TCGTCTGCTTGAATGGACAG-3ʹ.
Plasmid construction and virus production
The following retroviral and lentiviral miR-E based expression vectors were generous
gifts from Dr. Johannes Zuber (Research Institute of Molecular Pathology, Vienna,
Austria): LEPG (pMSCV-miRE-PGK-PuroR-IRES-GFP), SGEP (pRRL-GFP-miRE-
PGK-PuroR) and LT3GEPIR (pRRL-TRE3G-GFP-miRE-PGK-PuroR-IRES-rtTA3).
LEPC, SCEP and LT3CEPIR vectors were made by switching the GFP cassette in the
previous three vectors with a mCherry cassette. At least two shRNA hairpins were used
in all experiments and the most representative ones were reported. The sequences of
shRNA hairpins are listed below:
shRENILLA.713(shNT):TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATC
TATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGC
CTCGGA
shRB1.81:TGCTGTTGACAGTGAGCGCGGAAAGGACATGTGAACTTATTAGTGA
AGCCACAGATGTAATAAGTTCACATGTCCTTTCCATGCCTACTGCCTCGGA
shRB1.88:TGCTGTTGACAGTGAGCGCGCAGTTCGATATCTACTGAAATAGTGA
AGCCACAGATGTATTTCAGTAGATATCGAACTGCTTGCCTACTGCCTCGGA
shRB1.1292:TGCTGTTGACAGTGAGCGCTAGGACTGTTATGAACACTATTAGTG
AAGCCACAGATGTAATAGTGTTCATAACAGTCCTAATGCCTACTGCCTCGGA
shTP53.326:TGCTGTTGACAGTGAGCGCCCACTACAACTACATGTGTAATAGTG
AAGCCACAGATGTATTACACATGTAGTTGTAGTGGATGCCTACTGCCTCGGA
shTP53.2057:TGCTGTTGACAGTGAGCGCGGAGGATTTCATCTCTTGTATTAGTG
AAGCCACAGATGTAATACAAGAGATGAAATCCTCCATGCCTACTGCCTCGGA
shSOX2.50:TGCTGTTGACAGTGAGCGAAGAGAAGAGAGTGTTTGCAAATAGTG
AAGCCACAGATGTATTTGCAAACACTCTCTTCTCTGTGCCTACTGCCTCGGAC
TTCAAGGGGCTAGAATTC
shSOX2.1983:TGCTGTTGACAGTGAGCGCTAGGACAGTTGCAAACGTGAATAGT
GAAGCCACAGATGTATTCACGTTTGCAACTGTCCTAATGCCTACTGCCTCGGA
CTTCAAGGGGCTAGAATTC
The first CRISPR/Cas9 vector used for inactivated RB1 gene was lentiCRISPR v2
purchased from Addgene (Plasmid #52961). The plasmid used for inactivated TP53 was
pLKO5.sgRNA.EFS.tRFP purchased from Addgene (Plasmid #57823). The empty vector
served as the sgNT control. The guide RNAs were designed using Feng Zhang’s CRISPR
guide design tool: http://crispr.mit.edu/ and were listed below:
sgRB1: (F) CACCGATAGGCTAGCCGATACACTG
sgTP53: (F) CACCGCCATTGTTCAATATCGTCCG
Human DYKDDDDK (Flag)-tagged-SOX2 expression lentivirus (cat #337402) was
purchased from Qiagen and used for direct cell transduction, following the
manufacturer’s instruction. A MOI of 1 is used for LNCaP/AR cell transduction
experiments.
Lentiviral particles expressing shRNA hairpins, and guide RNAs were generated as
previously described with some modifications using HEK-293T cells (33). One day
before transfection, 1 million HEK-293T cells were seeded in each well of 6-well plates
in regular DMEM to achieve 80% confluence 24 hours later. The next day, each well was
transfected with 2µg of plasmid expressing the desired shRNA or guide RNA, 2ug of
psPAX2 packaging plasmid and 1µg of pVSV-G plasmid with 12µl of Lipofectamine
2000 (ThermoFisher, cat #12566014). Retroviral particles expressing shRNAs were
generated similarly, except using HEK-293 cells and 1µg of pLEPG-shDGCR8. 24 hours
after transfection, the media was replaced with regular DMEM supplemented with 10%
FBS. Media containing viruses was harvested 24 hours afterwards. The supernatant was
then filtrated through a 0.45µm Steri-Flip filter (Millipore) and used for cell infection.
Lentiviral and Retroviral transduction
Lentiviral or Retroviral transduction of cells for shRNA or guide RNA experiments was
performed as previously described with some modifications (33). Human cells were
seeded at 800,000 cells per well in 2 ml of media in 6-well plates. The next day, media
was removed and replaced with media containing 50% of lentivirus and 50% of fresh
culture medium, along with 5μg/ml polybrene. The virus containing media was removed
after 24 hours and replaced with normal culture medium. The cells were selected with
2μg/ml puromycin for 4 days, 2 days post transduction. To generate TP53/RB1 double
knockdown cells, the transduced cells were sorted by Flow Cytometer for GFP/mCherry
double positive population 2 days post transduction.
Cell growth assay
Cell growth assays were conducted in two different protocols. The protocol A assessed
cell growth by plating 20,000 LNCaP/AR cells per well of a 24-well cell culture plate in
0.5ml of RPMI medium supplemented with charcoal-stripped serum (CSS) and treated
with vehicle (DMSO) control or enzalutamide (10 μM) for 6 days. Cell numbers were
counted using a Vi-CellTN XR cell viability analyzer (Beckman) on day 7 and the relative
cell growth (treated/control) was calculated. The protocol B assessed cell growth curve
similarly, except by plating 500,000 LNCaP/AR cells per well of a 6-well cell culture
plate on day 0. Cell numbers were counted on day 4 and then cells were diluted by 3 fold
and replated in a 6-well culture plate and re-counted on day 7. The final counted cells on
day 7 were multiplied by 3 to reflect the dilution. The cell growth assay performed using
CWR22Pc-EP cells were similar to protocol A with the exception being 200,000
CWR22Pc-EP cells per well of a 24-well cell culture plate were plated and cultured in
0.5ml of RPMI medium supplemented with full serum and treated with vehicle (DMSO)
control or enzalutamide (1μM). For protocol B, 2 million CWR22Pc-EP cells per well of
a 6-well cell culture plate were plated and treated with vehicle (DMSO) control or
enzalutamide (1μM). Cells were counted every 6 days and diluted by 3 fold and replated.
The final number of cells counted on day 18 were multiplied by 9 to reflect the two
dilutions. Cell growth assays were conducted in triplicate and SEMs were reported.
Cell cycle analysis
Cell cycle analysis was conducted by plating 5 million LNCaP/AR cells per 10cm cell
culture plate in 10ml of RPMI medium supplemented with charcoal-stripped serum
(CSS) and treated with vehicle (DMSO) control or enzalutamide (10μM) for 6 days, cells
were diluted and replated every 2 days. On day 7, culture medium was replaced with
medium having EdU and cultured for 2 hours before performing the cell cycle assay. The
EdU incorporation assay was performed using the Click-iT EdU Alexa Fluor 647
Cytometry Assay Kit (Life Technologies, cat # C10419) according to the manufacturer’s
instruction. The percentage of cells with positive EdU staining was assessed by flow
cytometry, which reflected the percentage of cells in S-phase.
LNCaP/AR xenograft experiment
In vivo xenograft experiments were done by subcutaneous injection of 2 × 106
LNCaP/AR cells (100 μl in 50% Matrigel [BD Biosciences, San Jose, CA] and 50%
growth media) into the flanks of castrated male SCID mice. Daily gavage treatment with
10mg/kg enzalutamide or Vehicle (using a formulation of 1% carboxymethyl cellulose,
0.1% Tween-80, 5% DMSO) was initiated on the day of injection. Once tumors were
palpable, tumor size was measured weekly by tumor measuring system Peira TM900
(Peira bvba, Belgium). All animal experiments were performed in compliance with the
guidelines of the Research Animal Resource Center of the Memorial Sloan Kettering
Cancer Center.
Organoids culture, transduction, viability assay and xenograft experiment
Murine organoids from the Trp53loxP/loxP , Rb1loxP/loxP mice were established (16), sorted,
cultured in 3D and transduced with lentiviruses as described previously (34). Organoids
were transduced with lentivirus coding for either Cre or DsRed (Empty) as a control.
Organoids were selected with 1 μg/ml puromycin for 5 days, 2 days post transduction.
Organoids H&E staining was done by the MSKCC Molecular Cytology Core. Organoids
were moved to 2D culture and response to enzalutamide treatment was assessed using
CellTiter-Glo luminescent cell viability assay (Promega cat #7570). 1000 cells were
seeded in 96-well dish and treated with 5µM enzalutamide for 3 days before performing
the assay. For in vivo xenograft experiment, cultured organoids were digested using
trypsin and 1 × 106 cells were injected subcutaneously into the flanks of male SCID mice.
Mice were castrated on week 10 and daily gavage treatment with 10mg/kg enzalutamide
or Vehicle (using a formulation of 1% carboxymethyl cellulose, 0.1% Tween-80, 5%
DMSO) was initiated one day after castration. Tumor size was measured weekly by
tumor measuring system Peira TM900 (Peira bvba, Belgium). All animal experiments
were performed in compliance with the guidelines of the Research Animal Resource
Center of the Memorial Sloan Kettering Cancer Center.
Gene detection by qPCR
Total RNA from cells or homogenized tissues was extracted using Trizol (Ambion, Cat
15596018) following manufacturer’s instructions. The high capacity cDNA Reverse
Transcriptase Kit (Applied Biosciences, 4368813) was used following manufacturer’s
instructions, using RNA that was diluted to 200ng/ul. Enzyme used in amplification was
2X SYBR green quantfast PCR Mix (Qiagen 1044154). Assays were performed on a
minimum of three biological replicates and normalized to β-Actin. Qiagen RT2 qPCR
primer assays are used as primers for all the gene expression detection. Individual primer
assays are listed: TP53 (PPH00213F), RB1(PPH00228F), SOX2 (PPH02471A), CK5
(PPH02625F), CK14(PPH02389A), TP63(PPH01032F), SYP(PPH00717A), CHGA
(PPH01181A), NSE (PPH02058A), AR(PPH01016A), CK8(PPH02214F), CK18
(PPH00452F), NKX3.1 (PPH02267C), TMPRSS2 (PPH02262C),
TIPARP(PPH07883A), NDRG1 (PPH02202B), FKBP5 (PPH02277A), ATF5
(PPH05770B), BHLHE40 (PPH00409A), CC2D1A (PPH15400F), KLF10
(PPH00410A), HES1 (PPH00850A), HSF2 (PPH00465A), ENO1 (PPH01708A), ACTB
(PPH00073G).
Chromatin Immunoprecipitation (ChIP) qPCR
ChIP experiments were performed as previously described (11), using SDS-based
buffers. Antibodies were used at a concentration of 5ug per 1mL of IP buffer, which
encompassed approximately 8 million cells per IP. Antibodies used were: AR (Santa
Cruz, N-20, cat sc-816). For ChIP-PCR analysis, three primers were designed and tested
to cover SOX2 gene locus, similar results were observed and the primer on promoter was
displayed in Fig S10B. SOX2-P1: F-GAGAGTGTTGGCACCTGTAA, R-
TCATTGTTCTCCCGCTCATC; SOX2-P2: F-CGTCACATGGATGGTTGTCTA, R-
CCCTTTCTTTCTCTCTCCTCTTC; SOX2-P3: F-AATGCCTTCATGGTGTGGTC, R-
GCTTAGCCTCGTCGATGAAC; Primers for KLK3 and FKBP5 were shown below,
both on enhancer region: KLK3: F- TGGGACAACTTGCAAACCTG, R-
CCAGAGTAGGTCTGTTTTCAATCCA; FKBP5: F-
CCCCCTATTTTAATCGGAGTAC, R-TTTTGAAGAGCACAGAACACCCT.
Western Blot
Proteins were measured with Pierce BCA Protein Assay Kit (cat #23225) according to kit
directions. 4 volumes of protein were mixed with 5X laemmli buffer and boiled. Proteins
were run on pre made gels (Novex Life Technology) using Novex sharp pre-stained
protein standards as a marker (Invitrogen, LC8500) and 1X MOPS as running buffer,
diluted from 20X MOPS (Teknova M1088). Gels were run at 120 volts. Gels were
transferred in 1X Transfer buffer (1/4 mole Tris Base + 1.91 mole Glycine) diluted with
water and ethanol. Nitrocullulose membrane paper (Immobilon IPVH00010) was used
and was activated with 100% methanol (Fisher, A412-20). Transfer occurred at 4C for 1
hour at 100 volts. Membranes were blocked in 5% milk for 15 minutes prior to addition
of primary antibody and washed with 1X TBST (10X stock from Teknova, T9511).
Antibodies used for western blot are: Sox2 antibody (CST, cat #3579), Rb (CST, cat
#9309), p53 (Leica, NCL-p53-DO1), Gapdh (CST, cat # 2118), Ck5 (abcam, cat #
ab24647), Synaptophsin (pierce, cat # MA5-16402), Ck8 (abcam, cat #9023), AR (CST,
cat #5153), p21 (CST, cat #2947), E2f1 (CST, cat # 3742), Actin (CST, cat #4970).
Immunofluorescence and Immunohistochemistry
For immunofluorescence, LNCaP/AR cells were cultured in 15cm2 dishes until 80%
confluence. Cells were co-spun down with matrigel in 15ml tube and fixed in 4%
Paraformaldehyde (Electron Microscopy Sciences) for 12 hours at room temperature.
Cell pellets were processed for paraffin embedding using Leica ASP6025 tissue
processor (Leica Biosystems). Freshly cut 5 micron paraffin sections were stained on
Leica Bond RX (Leica Biosystems) with CK14 antibody (Abcam, #ab7800, 1:100);
CK18 antibody (Abcam, #ab668, 1:100); AR antibody (Abcam, #3184-1, 1:100) and
Synaptophysin antibody (Cell Signaling Technology, #5461, 1:100) with appropriate
negative and positive controls. After washing in PBS, slides were mounted with Mowiol
and fluorescent images were acquired on a Leica SP5 laser scanning confocal microscope
with LAS AF 2.2 software. Immunofluorescence was independently performed twice and
a representative experiment is shown.
For Immunohistochemistry, collected tumors (n=3 for each group) were fixed in 4%
Paraformaldehyde (Electron Microscopy Sciences) for 12 hours at room temperature and
processed for paraffin embedding using Leica ASP6025 tissue processor (Leica
Biosystems). Freshly cut 5 micron paraffin sections were stained on Leica Bond RX
(Leica Biosystems) with CK5 antibody (Abcam, #ab24647, 1:100) and Synaptophysin
antibody (Cell Signaling Technology, #5461, 1:100) with appropriate negative and
positive controls. After washing in PBS, slides were mounted with Mowiol and images
were acquired on an Olympus BX46 microscope. Images of representative fields were
shown.
RNA-Seq and GSEA analysis
Total RNA from cells or homogenized tissues was extracted using Trizol (Ambion, Cat
15596018) following manufacturer’s instructions. RNA-Seq library construction and
sequencing was performed at the integrated genomics operation (IGO) Core at MSKCC
according to standard protocols. Approximately 10 million 50bp paired-end reads were
acquired per replicate condition for sequencing and Poly-A selection was performed.
Resulting RNA-Seq data was analyzed by removing adaptor sequences using
Trimmomatic. RNA-seq reads were then aligned to GRCh37.75(hg19) with STAR and
genome-wide transcript counting was performed by HTSeq to generate a matrix of
fragments per kilobase of exon per million fragments mapped (RPKM). GSEA statistical
analysis was carried out with publicly available software from the Broad Institute
(http://www.broadinstitute.org/gsea/index.jsp). Weighted GSEA enrichment statistic and
Diff_of_Classes metric for ranking genes were used. The luminal and basal gene
signatures were defined by combining the 50 luminal and basal signature genes of (30)
and 6 canonical lineage markers (each lineage) also tested in (30), which were listed in
Supplemental Table 1. The GEO accession number for gene expression data reported in
this paper is GSE89226.
Analysis of human prostate cancer datasets
All analysis of human prostate cancer data was conducted using previously published, de-
identified data from (6, 12, 13). RNA-seq data from 35 CRPC patients from the IPM
Cornell cohort (12) were processed as follows. Reads (FASTQ files) were mapped to the
human genome reference sequence (hg19/GRC37) using STAR v2.3.0e (35), and the
resulting alignment files were converted into Mapped Read Format (MRF) for gene
expression quantification using RSEQtools (36) and GENCODE v19
(http://www.gencodegenes.org/releases/19.html) as reference gene annotation set. A
composite model of genes based on the union of all exonic regions from all gene
transcripts was used, resulting in a set of 20,345 protein-coding genes. Expression levels
were estimated as FPKM. Processed SU2C-PCF RNA-seq data (n = 149) were
downloaded from cBioPortal (6).
To assess RB1/TP53 allele-specific copy number genomic status from Whole Exome
Sequencing (WES) data of SU2C-PCF we applied CLONET (37) upon segmentation of
tumor to normal exon read count ratios using EXCAVATOR (38). Briefly, allele-specific
copy number combines the log2 of the tumor to normal ratios with the allelic fraction of
individual’s germline heterozygous SNPs, assigning to each genomic segment the copy
number value of allele A and of allele B (cnA, cnB). CLONET quality filters were set to
≥ 10 SNPs and mean coverage ≥ 20 to call allele-specific status of a genomic segment.
Few borderline cases were visually inspected. Point mutation calls were downloaded
from cBioPortal. Gene altered status was considered in the presence of any of the
following: non-synonymous point mutations, hemizygous deletion, or homozygous
deletion (upon tumor ploidy and purity adjustment).
To identify Transcription Factors (TFs) potentially associated with the TP53/RB1 altered
phenotype, we first performed a ‘receiver-operator curve’ (ROC) analysis within the
CRPC IPM Cornell cohort. FPKM values were used as threshold parameter and the ‘area
under the curve’ (AUC) was calculated for each transcript. Starting from a list of 1,240
TFs, a total of 132 were identified with AUC ≥ 0.65 in IPM Cornell cohort, of which 66
were overexpressed (p-value < 0.05, Wilcoxon Mann Whitney test) in the TP53/RB1
altered phenotype (see Supplementary Table 2). We performed the same analysis in the
SU2C-PCF 2015 cohort transcript data; 63 TFs were identified against the phenotype of
which 40 were overexpressed in the TP53/RB1 altered phenotype (see Supplementary
Table 3). Eight TFs were common between the two lists of 66 and 40. The initial list of
1,240 TFs was downloaded from Ensembl Biomart (Ensembl release 83 - December
2015) (39) by filtering genes for the “GO:0003700” Gene Ontology (GO) Accession
Term.
Fig S1. Knockdown of TP53 and RB1 confers enzalutamide resistance in CWR22Pc-
EP cells: (A) Western blot showing TP53 and RB1 protein levels in CWR22Pc-EP cells
transduced with annotated hairpins. GAPDH serves as loading control. (B) Growth curve
of CWR22Pc-EP cells transduced with annotated hairpins in media supplemented with
full serum, following CWR22Pc-EP protocol B. Enz denotes 1μg/ml enzalutamide
treatment; Mock denotes DMSO treatment with same volume as enzalutamide. (C) Cell
number of CWR22Pc-EP cells transduced with annotated hairpins in a stable vector
system after 4 days treatments in media supplemented with full serum, following
CWR22Pc-EP protocol A and normalized to “-Enz” group. “+Enz” denotes 1μg/ml
enzalutamide treatment; “-Enz” denotes DMSO treatment with same volume as
enzalutamide. Mean ± s.e.m. is represented and p-values were calculated using multiple t-
tests.
Fig. S2. Loss of TP53 and RB1 restores tumor cell proliferation suppressed by
enzalutamide: (A) FACS plot showing percentage of cells actively proliferating (s-phase
cells stained positive for EdU incorporation). LNCaP/AR cells were transduced with
annotated hairpins and treated with 10μg/ml enzalutamide for 7 days in CSS medium. (B)
Percentage of cells actively proliferating compared to mock treatment (DMSO). Statistics
were calculated using data from 5 independent experiments. “+Enz” denotes 10μg/ml
enzalutamide; “-Enz” denotes DMSO treatment with same volume as enzalutamide.
Mean ± s.e.m. is represented and p-values were calculated using multiple t-tests.
FSC
EdU (% of cells in s-phase)
shNT shTP53
shRB1 shTP53/RB1
B
shNT shTP53
shRB1 shTP53/RB1
Mock Enz
A
0
20
40
60
80
100
Ce
lls in
S-P
hase
(% o
f Mo
ck)
p<0.0001 p=0.003 p<0.0001
shNT
shTP
53
shRB1
shTP
53/R
B1
Enz - + - + - + - +
Fig. S3. Deletion of TP53 and RB1 using CRISPR-Cas9 system confers resistance to
enzalutamide: (A) Western blot showing TP53 and RB1 protein levels in LNCaP/AR
cells transduced with annotated guide RNAs. GAPDH serves as loading control. (B) Cell
number of LNCaP/AR cells transduced with annotated guide RNAs, normalized to “-
Enz” group. Cells were treated with 7 days of enzalutamide in CSS medium, following
LNCaP/AR protocol A. “+Enz” denotes 10μg/ml enzalutamide treatment; “-Enz”
denotes DMSO treatment with same volume as enzalutamide. (C) Tumor growth curve of
xenografted LNCaP/AR cells transduced with annotated guide RNAs. Enz denotes
enzalutamide treatment at 10mg/kg orally one day after grafting. Mock denotes DMSO
treatment at same dosage. For all panels unless otherwise noted, mean ± s.e.m. is
represented and p-values were calculated using multiple t-tests.
Fig. S4. Murine organoids with Trp53 and Rb1 deletion lost epithelial features and
gained resistance to enzalutamide: (A) Bright field and H&E pictures of murine
organoids transduced with Cre or empty vector. (B) Cell number of murine organoids
transduced with Cre or empty vectors, normalized to “-Enz” group. Organoid were
cultured in 2D and treated with 5µM enzalutamide or DMSO for 3 days. “+Enz” denotes
enzalutamide treatment and “-Enz” denotes DMSO treatment with same volume as
enzalutamide. (C) Tumor growth curve of xenografted murine organoids transduced with
Cre or empty vector. Enz denotes enzalutamide treatment at 10mg/kg orally beginning on
the day of orchidectomy. Mock denotes DMSO treatment at same dosage. For all panels
unless otherwise noted, mean ± s.e.m. is represented and p-values were calculated using
multiple t-tests.
Fig. S5. Loss of TP53 and RB1 leads to increased cellular lineage plasticity in
LNCaP/AR and CWR22Pc-EP cell lines; LNCaP/AR xenograft models and CRPC
tumors from two independent cohorts: (A) Relative gene expression of lineage
markers in CWR22Pc-EP cells transduced with annotated hairpins in a stable vector
system. (B) Western blot of selected cellular lineage markers in CWR22Pc-EP cells
transduced with annotated hairpins in a stable vector system. GAPDH serves as loading
control. (C) Immunofluorescence staining of selected cellular lineage markers in
LNCaP/AR cells transduced with annotated hairpins. (D) Relative gene expression of
lineage markers in enz resistant tumors collected from the LNCaP/AR xenograft model.
(E) IHC staining of selected lineage markers on enz resistant tumors collected from the
LNCaP/AR xenograft model. (F) Western blot showing protein levels of selected cellular
lineage markers in LNCaP/AR cells transduced with annotated guide RNAs. GAPDH
serves as loading control. (G) Relative gene expression of lineage markers in LNCaP/AR
cells transduced with annotated guide RNAs. For all panels unless otherwise noted, mean
± s.e.m. is represented and p-values were calculated using multiple t-tests.
Fig. S6. Changes in cellular lineage plasticity are reversed when TP53 and RB1 are
restored: (A) Relative gene expression of lineage markers in LNCaP/AR cells
transduced with hairpins against TP53 and RB1 in an inducible vector system. Tick marks
on the Doxycycline Timeline (top) indicate time points at which RNA was collected.
“On Dox” denotes the samples were collected after 48 hours treatment of doxycycline.
“Off 1 day” denotes the samples were collected 1 day after the doxycline was removed
(48 hours on Dox followed by 1 day off Dox). Other data points are denoted in similar
way. (B) Relative gene expression of lineage markers in LNCaP/AR cells transduced
RB1
TP53
CK5
CK14
TP63
SYP
CHGA
NSE
AR
CK8
CK18
0
1
2
4
6
8
10
Re
lativ
e e
xp
ressio
n
No Dox
Doxycycline Timeline:
On Dox Off 1 day Off 2 day Off 3 day Off 4 day Off 9 days
p=0.0008 p<0.0001
p<0.0001
p<0.0001
p=0.0002
p=0.0008
p=0.0001
p=0.0002
RB1
TP53
CK5
CK14
TP63
SYP
CHG
ANSE
AR
CK8
CK18
0
1
2
10
20
Re
lative
exp
ressio
n
shNTInducible LNCaP/AR (48hrs on Dox)
shTP53/RB1shTP53shRB1
p<0.0001 p<0.0001
p=0.01
p<0.0001
p=0.05 p=0.002 p<0.0001p=0.0003 p=0.003
NS NS
Basal NE Luminal
Basal NE Luminal
A
B
with annotated hairpins in an inducible vector system for 48 hours. For all panels unless
otherwise noted, mean ± s.e.m. is represented and p-values were calculated using
multiple t-tests.
Fig. S7. SOX2 expression in patient samples: Expression levels of SOX2 across 162
prostate cancer samples of different pathologic classifications (130 CRPC-Adeno and 32
CPRC-NE). p-value refers to the ANOVA analysis of the linear regression of SOX2
expression levels versus the pathology class. Data are re-integrated using the IPM cohort
(12).
Fig. S8. SOX2 expression is increased in multiple preclinical models: (A) Relative
gene expression levels of SOX2 in enzalutamide resistant tumors collected from the
LNCaP/AR xenograft model. (B) Relative levels of RB1, TP53 and SOX2 gene
expression in LNCaP/AR cells transduced with annotated guide RNA using the CRISPR-
Cas9 system. (C) Relative gene expression of RB1, TP53 and SOX2 in LNCaP/AR cells
transduced with annotated hairpins in an inducible vector system. (D) Relative gene
expression of RB1, TP53 and SOX2 in LNCaP/AR cells transduced with hairpins against
TP53 and RB1 in an inducible vector system. “On Dox” denotes the samples were
collected after 48 hours treatment of doxycycline. “Off 1 day” denotes the samples were
collected 1 day after the doxycline was removed. Other data points are denoted in similar
way. For all panels unless otherwise noted, mean ± s.e.m. is represented and p-values
were calculated using multiple t-tests.
Fig. S9. SOX2 is the most highly upregulated among the 8 identified TFs in
TP53/RB1 altered patients: (A) Relative gene expression of 8 transcription factors in
LNCaP/AR cells transduced with annotated hairpins in a stable vector system. (B)
Relative gene expression of 8 transcription factors in CWR22Pc-EP cells transduced with
annotated hairpins in a stable vector system. (C) Relative gene expression of 8
transcription factors in Trp53loxP/loxP,Rb1loxP/loxP murine organoids transduced with Cre or
empty vector. For all panels unless otherwise noted, mean ± s.e.m. is represented and p-
values were calculated using multiple t-tests.
Fig. S10. AR inhibition is not sufficient to activate SOX2 expression: (A) Relative
expression of SOX2 in LNCaP/AR cells transduced with annotated hairpins, treated with
DMSO or Enzalutamide. Enz denotes enzalutamide treatment at 10uM. Mock denotes
DMSO treatment at same dosage. (B) AR ChIP-qPCR of the SOX2 genomic locus, as
well as the loci of two canonical AR target genes (KLK3, FKBP5) in LNCaP/AR cells.
For all panels unless otherwise noted, mean ± s.e.m. is represented and p-values were
calculated using multiple t-tests.
Fig. S11. SOX2 is sufficient to induce lineage plasticity and enzalutamide resistance:
(A) Relative gene expression of SOX2 and lineage marker genes in LNCaP/AR cells
transduced with annotated vectors in a stable vector system. (B) Cell numbers of
LNCaP/AR cells transduced with annotated vectors (parental vs. Flag-SOX2), normalized
to “-Enz” group. Cells were treated 7 days with enzalutamide or DMSO in CSS medium,
following LNCaP/AR protocol A. “+Enz” denotes 10μg/ml enzalutamide treatment; “-
Enz” denotes DMSO treatment with same volume as enzalutamide. (C) Relative gene
expression of iPS genes (SOX2, OCT4, KLF4, MYC) in LNCaP/AR cells transduced with
annotated vectors in a stable vector system. (D) Cell numbers of LNCaP/AR cells
transduced with annotated vectors, normalized to “-Enz” group. Cells were treated 7 days
with enzalutamide or DMSO in CSS medium, following LNCaP/AR protocol A. “+Enz”
denotes 10μg/ml enzalutamide treatment; “-Enz” denotes DMSO treatment with same
volume as enzalutamide. For all panels unless otherwise noted, mean ± s.e.m. is
represented and p-values were calculated using multiple t-tests.
Table. S1. Luminal and basal signature gene lists: The luminal and basal gene
signatures were defined by combining the 50 genes’ luminal and basal signatures of (30)
and 6 canonical lineage markers (each lineage) tested in (30).
Table. S2. A total of 132 Transcription Factors (TFs) were associated with the
TP53/RB1 altered phenotype in IPM cohort: ‘Receiver-operator curve’ (ROC) analysis
was performed within the IPM cohort. FPKMs was used as a threshold and ‘area under
the curve’ (AUC) was calculated. A total of 132 TFs were identified with AUC ≥ 0.65, of
which 66 were overexpressed in the TP53/RB1 altered phenotype.
Table. S3. A total of 63 Transcription Factors (TFs) were associated with the
TP53/RB1 altered phenotype in SU2C-PCF cohort: ‘Receiver-operator curve’ (ROC)
analysis was performed within the SU2C-PCF cohort. FPKMs was used as a threshold
and ‘area under the curve’ (AUC) was calculated. A total of 63 TFs were identified with
AUC ≥ 0.65, of which 40 were overexpressed in the TP53/RB1 altered phenotype.
References and Notes
1. W. Pao, V. A. Miller, K. A. Politi, G. J. Riely, R. Somwar, M. F. Zakowski, M. G. Kris, H.
Varmus, Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is
associated with a second mutation in the EGFR kinase domain. PLOS Med. 2, e73
(2005). doi:10.1371/journal.pmed.0020073 Medline
2. M. E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P. N. Rao, C. L. Sawyers,
Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or
amplification. Science 293, 876–880 (2001). doi:10.1126/science.1062538 Medline
3. P. Lito, N. Rosen, D. B. Solit, Tumor adaptation and resistance to RAF inhibitors. Nat. Med.
19, 1401–1409 (2013). doi:10.1038/nm.3392 Medline
4. L. V. Sequist, B. A. Waltman, D. Dias-Santagata, S. Digumarthy, A. B. Turke, P. Fidias, K.
Bergethon, A. T. Shaw, S. Gettinger, A. K. Cosper, S. Akhavanfard, R. S. Heist, J.
Temel, J. G. Christensen, J. C. Wain, T. J. Lynch, K. Vernovsky, E. J. Mark, M. Lanuti,
A. J. Iafrate, M. Mino-Kenudson, J. A. Engelman, Genotypic and histological evolution
of lung cancers acquiring resistance to EGFR inhibitors. Sci. Transl. Med. 3, 75ra26
(2011). doi:10.1126/scitranslmed.3002003 Medline
5. H. Beltran, D. S. Rickman, K. Park, S. S. Chae, A. Sboner, T. Y. MacDonald, Y. Wang, K. L.
Sheikh, S. Terry, S. T. Tagawa, R. Dhir, J. B. Nelson, A. de la Taille, Y. Allory, M. B.
Gerstein, S. Perner, K. J. Pienta, A. M. Chinnaiyan, Y. Wang, C. C. Collins, M. E.
Gleave, F. Demichelis, D. M. Nanus, M. A. Rubin, Molecular characterization of
neuroendocrine prostate cancer and identification of new drug targets. Cancer Discov. 1,
487–495 (2011). doi:10.1158/2159-8290.CD-11-0130 Medline
6. D. Robinson, E. M. Van Allen, Y.-M. Wu, N. Schultz, R. J. Lonigro, J.-M. Mosquera, B.
Montgomery, M.-E. Taplin, C. C. Pritchard, G. Attard, H. Beltran, W. Abida, R. K.
Bradley, J. Vinson, X. Cao, P. Vats, L. P. Kunju, M. Hussain, F. Y. Feng, S. A. Tomlins,
K. A. Cooney, D. C. Smith, C. Brennan, J. Siddiqui, R. Mehra, Y. Chen, D. E. Rathkopf,
M. J. Morris, S. B. Solomon, J. C. Durack, V. E. Reuter, A. Gopalan, J. Gao, M. Loda, R.
T. Lis, M. Bowden, S. P. Balk, G. Gaviola, C. Sougnez, M. Gupta, E. Y. Yu, E. A.
Mostaghel, H. H. Cheng, H. Mulcahy, L. D. True, S. R. Plymate, H. Dvinge, R.
Ferraldeschi, P. Flohr, S. Miranda, Z. Zafeiriou, N. Tunariu, J. Mateo, R. Perez-Lopez, F.
Demichelis, B. D. Robinson, M. Schiffman, D. M. Nanus, S. T. Tagawa, A. Sigaras, K.
W. Eng, O. Elemento, A. Sboner, E. I. Heath, H. I. Scher, K. J. Pienta, P. Kantoff, J. S. de
Bono, M. A. Rubin, P. S. Nelson, L. A. Garraway, C. L. Sawyers, A. M. Chinnaiyan,
Integrative clinical genomics of advanced prostate cancer. Cell 161, 1215–1228 (2015).
doi:10.1016/j.cell.2015.05.001 Medline
7. P. A. Watson, V. K. Arora, C. L. Sawyers, Emerging mechanisms of resistance to androgen
receptor inhibitors in prostate cancer. Nat. Rev. Cancer 15, 701–711 (2015).
doi:10.1038/nrc4016 Medline
8. F. J. Meyers, P. H. Gumerlock, S. G. Chi, H. Borchers, A. D. Deitch, R. W. deVere White,
Very frequent p53 mutations in metastatic prostate carcinoma and in matched primary
tumors. Cancer 83, 2534–2539 (1998). doi:10.1002/(SICI)1097-
0142(19981215)83:12<2534:AID-CNCR19>3.0.CO;2-V Medline
9. C. Tran, S. Ouk, N. J. Clegg, Y. Chen, P. A. Watson, V. Arora, J. Wongvipat, P. M. Smith-
Jones, D. Yoo, A. Kwon, T. Wasielewska, D. Welsbie, C. D. Chen, C. S. Higano, T. M.
Beer, D. T. Hung, H. I. Scher, M. E. Jung, C. L. Sawyers, Development of a second-
generation antiandrogen for treatment of advanced prostate cancer. Science 324, 787–790
(2009). doi:10.1126/science.1168175 Medline
10. M. D. Balbas, M. J. Evans, D. J. Hosfield, J. Wongvipat, V. K. Arora, P. A. Watson, Y.
Chen, G. L. Greene, Y. Shen, C. L. Sawyers, Overcoming mutation-based resistance to
antiandrogens with rational drug design. eLife 2, e00499 (2013). doi:10.7554/eLife.00499
Medline
11. V. K. Arora, E. Schenkein, R. Murali, S. K. Subudhi, J. Wongvipat, M. D. Balbas, N. Shah,
L. Cai, E. Efstathiou, C. Logothetis, D. Zheng, C. L. Sawyers, Glucocorticoid receptor
confers resistance to antiandrogens by bypassing androgen receptor blockade. Cell 155,
1309–1322 (2013). doi:10.1016/j.cell.2013.11.012 Medline
12. H. Beltran, D. Prandi, J. M. Mosquera, M. Benelli, L. Puca, J. Cyrta, C. Marotz, E.
Giannopoulou, B. V. S. K. Chakravarthi, S. Varambally, S. A. Tomlins, D. M. Nanus, S.
T. Tagawa, E. M. Van Allen, O. Elemento, A. Sboner, L. A. Garraway, M. A. Rubin, F.
Demichelis, Divergent clonal evolution of castration-resistant neuroendocrine prostate
cancer. Nat. Med. 22, 298–305 (2016). doi:10.1038/nm.4045 Medline
13. The Cancer Genome Atlas Research Network, The molecular taxonomy of primary prostate
cancer. Cell 163, 1011–1025 (2015). doi:10.1016/j.cell.2015.10.025 Medline
14. A. M. Aparicio, L. Shen, E. L. N. Tapia, J.-F. Lu, H.-C. Chen, J. Zhang, G. Wu, X. Wang, P.
Troncoso, P. Corn, T. C. Thompson, B. Broom, K. Baggerly, S. N. Maity, C. J.
Logothetis, Combined tumor suppressor defects characterize clinically defined aggressive
variant prostate cancers. Clin. Cancer Res. 22, 1520–1530 (2016). doi:10.1158/1078-
0432.CCR-15-1259 Medline
15. H.-L. Tan, A. Sood, H. A. Rahimi, W. Wang, N. Gupta, J. Hicks, S. Mosier, C. D. Gocke, J.
I. Epstein, G. J. Netto, W. Liu, W. B. Isaacs, A. M. De Marzo, T. L. Lotan, Rb loss is
characteristic of prostatic small cell neuroendocrine carcinoma. Clin. Cancer Res. 20,
890–903 (2014). doi:10.1158/1078-0432.CCR-13-1982 Medline
16. Z. Zhou, A. Flesken-Nikitin, D. C. Corney, W. Wang, D. W. Goodrich, P. Roy-Burman, A.
Y. Nikitin, Synergy of p53 and Rb deficiency in a conditional mouse model for
metastatic prostate cancer. Cancer Res. 66, 7889–7898 (2006). doi:10.1158/0008-
5472.CAN-06-0486 Medline
17. A. F. Gazdar, T. K. Savage, J. E. Johnson, A. Berns, J. Sage, R. I. Linnoila, D. MacPherson,
D. G. McFadden, A. Farago, T. Jacks, W. D. Travis, E. Brambilla, The comparative
pathology of genetically engineered mouse models for neuroendocrine carcinomas of the
lung. J. Thorac. Oncol. 10, 553–564 (2015). doi:10.1097/JTO.0000000000000459
Medline
18. S. Kregel, K. J. Kiriluk, A. M. Rosen, Y. Cai, E. E. Reyes, K. B. Otto, W. Tom, G. P. Paner,
R. Z. Szmulewitz, D. J. Vander Griend, Sox2 is an androgen receptor-repressed gene that
promotes castration-resistant prostate cancer. PLOS ONE 8, e53701 (2013).
doi:10.1371/journal.pone.0053701 Medline
19. K. Takahashi, S. Yamanaka, A decade of transcription factor-mediated reprogramming to
pluripotency. Nat. Rev. Mol. Cell Biol. 17, 183–193 (2016). doi:10.1038/nrm.2016.8
Medline
20. C. M. Rudin, S. Durinck, E. W. Stawiski, J. T. Poirier, Z. Modrusan, D. S. Shames, E. A.
Bergbower, Y. Guan, J. Shin, J. Guillory, C. S. Rivers, C. K. Foo, D. Bhatt, J. Stinson, F.
Gnad, P. M. Haverty, R. Gentleman, S. Chaudhuri, V. Janakiraman, B. S. Jaiswal, C.
Parikh, W. Yuan, Z. Zhang, H. Koeppen, T. D. Wu, H. M. Stern, R. L. Yauch, K. E.
Huffman, D. D. Paskulin, P. B. Illei, M. Varella-Garcia, A. F. Gazdar, F. J. de Sauvage,
R. Bourgon, J. D. Minna, M. V. Brock, S. Seshagiri, Comprehensive genomic analysis
identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Nat. Genet. 44,
1111–1116 (2012). doi:10.1038/ng.2405 Medline
21. A. J. Bass, H. Watanabe, C. H. Mermel, S. Yu, S. Perner, R. G. Verhaak, S. Y. Kim, L.
Wardwell, P. Tamayo, I. Gat-Viks, A. H. Ramos, M. S. Woo, B. A. Weir, G. Getz, R.
Beroukhim, M. O’Kelly, A. Dutt, O. Rozenblatt-Rosen, P. Dziunycz, J. Komisarof, L. R.
Chirieac, C. J. Lafargue, V. Scheble, T. Wilbertz, C. Ma, S. Rao, H. Nakagawa, D. B.
Stairs, L. Lin, T. J. Giordano, P. Wagner, J. D. Minna, A. F. Gazdar, C. Q. Zhu, M. S.
Brose, I. Cecconello, U. Ribeiro Jr., S. K. Marie, O. Dahl, R. A. Shivdasani, M.-S. Tsao,
M. A. Rubin, K. K. Wong, A. Regev, W. C. Hahn, D. G. Beer, A. K. Rustgi, M.
Meyerson, SOX2 is an amplified lineage-survival oncogene in lung and esophageal
squamous cell carcinomas. Nat. Genet. 41, 1238–1242 (2009). doi:10.1038/ng.465
Medline
22. M. V. Russo, S. Esposito, M. G. Tupone, L. Manzoli, I. Airoldi, P. Pompa, L. Cindolo, L.
Schips, C. Sorrentino, E. Di Carlo, SOX2 boosts major tumor progression genes in
prostate cancer and is a functional biomarker of lymph node metastasis. Oncotarget 7,
12372–12385 (2016). Medline
23. H. Hong, K. Takahashi, T. Ichisaka, T. Aoi, O. Kanagawa, M. Nakagawa, K. Okita, S.
Yamanaka, Suppression of induced pluripotent stem cell generation by the p53-p21
pathway. Nature 460, 1132–1135 (2009). doi:10.1038/nature08235 Medline
24. M. S. Kareta, L. L. Gorges, S. Hafeez, B. A. Benayoun, S. Marro, A. F. Zmoos, M. J.
Cecchini, D. Spacek, L. F. Batista, M. O’Brien, Y. H. Ng, C. E. Ang, D. Vaka, S. E.
Artandi, F. A. Dick, A. Brunet, J. Sage, M. Wernig, Inhibition of pluripotency networks
by the Rb tumor suppressor restricts reprogramming and tumorigenesis. Cell Stem Cell
16, 39–50 (2015). Medline
25. H. Li, M. Collado, A. Villasante, K. Strati, S. Ortega, M. Cañamero, M. A. Blasco, M.
Serrano, The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature 460, 1136–
1139 (2009). doi:10.1038/nature08290 Medline
26. D. F. Tschaharganeh, W. Xue, D. F. Calvisi, M. Evert, T. V. Michurina, L. E. Dow, A.
Banito, S. F. Katz, E. R. Kastenhuber, S. Weissmueller, C.-H. Huang, A. Lechel, J. B.
Andersen, D. Capper, L. Zender, T. Longerich, G. Enikolopov, S. W. Lowe, p53-
dependent Nestin regulation links tumor suppression to cellular plasticity in liver cancer.
Cell 158, 579–592 (2014). doi:10.1016/j.cell.2014.05.051 Medline
27. E. Calo, J. A. Quintero-Estades, P. S. Danielian, S. Nedelcu, S. D. Berman, J. A. Lees, Rb
regulates fate choice and lineage commitment in vivo. Nature 466, 1110–1114 (2010).
doi:10.1038/nature09264 Medline
28. M. Gerlinger, A. J. Rowan, S. Horswell, J. Larkin, D. Endesfelder, E. Gronroos, P. Martinez,
N. Matthews, A. Stewart, P. Tarpey, I. Varela, B. Phillimore, S. Begum, N. Q.
McDonald, A. Butler, D. Jones, K. Raine, C. Latimer, C. R. Santos, M. Nohadani, A. C.
Eklund, B. Spencer-Dene, G. Clark, L. Pickering, G. Stamp, M. Gore, Z. Szallasi, J.
Downward, P. A. Futreal, C. Swanton, Intratumor heterogeneity and branched evolution
revealed by multiregion sequencing. N. Engl. J. Med. 366, 883–892 (2012).
doi:10.1056/NEJMoa1113205 Medline
29. Y. J. Choi, C.-P. Lin, J. J. Ho, X. He, N. Okada, P. Bu, Y. Zhong, S. Y. Kim, M. J. Bennett,
C. Chen, A. Ozturk, G. G. Hicks, G. J. Hannon, L. He, miR-34 miRNAs provide a barrier
for somatic cell reprogramming. Nat. Cell Biol. 13, 1353–1360 (2011).
doi:10.1038/ncb2366 Medline
30. D. Zhang, D. Park, Y. Zhong, Y. Lu, K. Rycaj, S. Gong, X. Chen, X. Liu, H.-P. Chao, P.
Whitney, T. Calhoun-Davis, Y. Takata, J. Shen, V. R. Iyer, D. G. Tang, Stem cell and
neurogenic gene-expression profiles link prostate basal cells to aggressive prostate
cancer. Nat. Commun. 7, 10798 (2016). doi:10.1038/ncomms10798 Medline
31. C. D. Chen, D. S. Welsbie, C. Tran, S. H. Baek, R. Chen, R. Vessella, M. G. Rosenfeld, C. L.
Sawyers, Molecular determinants of resistance to antiandrogen therapy. Nat. Med. 10,
33–39 (2004). doi:10.1038/nm972 Medline
32. A. Dagvadorj, S.-H. Tan, Z. Liao, L. R. Cavalli, B. R. Haddad, M. T. Nevalainen, Androgen-
regulated and highly tumorigenic human prostate cancer cell line established from a
transplantable primary CWR22 tumor. Clin. Cancer Res. 14, 6062–6072 (2008).
doi:10.1158/1078-0432.CCR-08-0979 Medline
33. D. B. Wheeler, R. Zoncu, D. E. Root, D. M. Sabatini, C. L. Sawyers, Identification of an
oncogenic RAB protein. Science 350, 211–217 (2015). doi:10.1126/science.aaa4903
Medline
34. W. R. Karthaus, P. J. Iaquinta, J. Drost, A. Gracanin, R. van Boxtel, J. Wongvipat, C. M.
Dowling, D. Gao, H. Begthel, N. Sachs, R. G. J. Vries, E. Cuppen, Y. Chen, C. L.
Sawyers, H. C. Clevers, Identification of multipotent luminal progenitor cells in human
prostate organoid cultures. Cell 159, 163–175 (2014). doi:10.1016/j.cell.2014.08.017
Medline
35. A. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson,
T. R. Gingeras, STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21
(2013). doi:10.1093/bioinformatics/bts635 Medline
36. L. Habegger, A. Sboner, T. A. Gianoulis, J. Rozowsky, A. Agarwal, M. Snyder, M. Gerstein,
RSEQtools: A modular framework to analyze RNA-Seq data using compact, anonymized
data summaries. Bioinformatics 27, 281–283 (2011). doi:10.1093/bioinformatics/btq643
Medline
37. D. Prandi, S. C. Baca, A. Romanel, C. E. Barbieri, J.-M. Mosquera, J. Fontugne, H. Beltran,
A. Sboner, L. A. Garraway, M. A. Rubin, F. Demichelis, Unraveling the clonal hierarchy
of somatic genomic aberrations. Genome Biol. 15, 439 (2014). doi:10.1186/s13059-014-
0439-6 Medline
38. A. Magi, L. Tattini, I. Cifola, R. D’Aurizio, M. Benelli, E. Mangano, C. Battaglia, E. Bonora,
A. Kurg, M. Seri, P. Magini, B. Giusti, G. Romeo, T. Pippucci, G. De Bellis, R. Abbate,
G. F. Gensini, EXCAVATOR: Detecting copy number variants from whole-exome
sequencing data. Genome Biol. 14, R120 (2013). doi:10.1186/gb-2013-14-10-r120
Medline
39. A. Yates, W. Akanni, M. R. Amode, D. Barrell, K. Billis, D. Carvalho-Silva, C. Cummins, P.
Clapham, S. Fitzgerald, L. Gil, C. G. Girón, L. Gordon, T. Hourlier, S. E. Hunt, S. H.
Janacek, N. Johnson, T. Juettemann, S. Keenan, I. Lavidas, F. J. Martin, T. Maurel, W.
McLaren, D. N. Murphy, R. Nag, M. Nuhn, A. Parker, M. Patricio, M. Pignatelli, M.
Rahtz, H. S. Riat, D. Sheppard, K. Taylor, A. Thormann, A. Vullo, S. P. Wilder, A.
Zadissa, E. Birney, J. Harrow, M. Muffato, E. Perry, M. Ruffier, G. Spudich, S. J.
Trevanion, F. Cunningham, B. L. Aken, D. R. Zerbino, P. Flicek, Ensembl 2016. Nucleic
Acids Res. 44, D710–D716 (2016). doi:10.1093/nar/gkv1157 Medline