Originally published 6 January 2017; corrected 23 August 2018

www.sciencemag.org/content/355/6320/84/suppl/DC1

Supplementary Materials for

SOX2 promotes lineage plasticity and antiandrogen resistance in TP53-

and RB1-deficient prostate cancer

Ping Mu, Zeda Zhang, Matteo Benelli, Wouter R. Karthaus, Elizabeth Hoover, Chi-Chao

Chen, John Wongvipat, Sheng-Yu Ku, Dong Gao, Zhen Cao, Neel Shah, Elizabeth J.

Adams, Wassim Abida, Philip A. Watson, Davide Prandi, Chun-Hao Huang, Elisa de

Stanchina, Scott W. Lowe, Leigh Ellis, Himisha Beltran, Mark A. Rubin, David W.

Goodrich, Francesca Demichelis, Charles L. Sawyers*

*Corresponding author. Email: sawyersc@mskcc.org

Published 6 January 2017, Science 355, 84 (2017)

DOI: 10.1126/science.aah4307

This PDF file includes:

Materials and Methods

Figs. S1 to S11

Captions for Tables S1 to S3

References

Other Supplementary Material for this manuscript includes the following:

(available at www.sciencemag.org/content/355/6320/84/suppl/DC1)

Tables S1 to S3 (Excel files)

Correction: On page 3, there was an error in the sequence of the sgTP53 CRISPR guide

RNA, which has now been corrected. This error does not affect any of the data or

conclusions in the paper because the correct sequence was used in the relevant

experiments.

Materials and Methods

Cell lines and tissue culture

LNCaP/AR cell line was generated and maintained as previously described (31). The

CWR22Pc prostate cancer cell line was kindly provided by Marja Nevalainen (32). We

found that this cell line contained a subpopulation of cells with fibroblast-like

morphology that were EpCAM-negative and confirmed to be of mouse origin. In order to

remove these mouse cells, we plated CWR22Pc at 400-800 cells per well (6-well) in 50%

conditioned media. Numerous multi-clonal, cancer epithelial islands visually free of

fibroblasts were isolated by cloning cylinders and then pooled to derive the pure

epithelial subline, CWR22Pc-EP. Both cells were cultured at 37° C (5% CO2) in high-

glucose RPMI medium supplemented with 10% fetal bovine serum (FBS), 1% HEPES,

1% Sodium Pyruvate, 1% penicillin-streptomycin and 1% L-Glutamine. All cells were

passaged every 3 days. LNCaP/AR cells were cultured in same RPMI medium

supplemented with charcoal-stripped serum (CSS) when treated with enzalutamide.

The antibody we used is anti-human EpCAM-FITC antibody (Miltenyi Biotec, #130-098-

113) and the primers are:

human-specific AR: 5ʹ-GCAGGAAGCAGTATCCGAAG-3ʹ and 5ʹ

GACACCGACACTGCCTTACA-3ʹ;

mouse-specific Myc: 5ʹ CAACGTCTTGGAACGTCAGA-3ʹ and 5ʹ-

TCGTCTGCTTGAATGGACAG-3ʹ.

Plasmid construction and virus production

The following retroviral and lentiviral miR-E based expression vectors were generous

gifts from Dr. Johannes Zuber (Research Institute of Molecular Pathology, Vienna,

Austria): LEPG (pMSCV-miRE-PGK-PuroR-IRES-GFP), SGEP (pRRL-GFP-miRE-

PGK-PuroR) and LT3GEPIR (pRRL-TRE3G-GFP-miRE-PGK-PuroR-IRES-rtTA3).

LEPC, SCEP and LT3CEPIR vectors were made by switching the GFP cassette in the

previous three vectors with a mCherry cassette. At least two shRNA hairpins were used

in all experiments and the most representative ones were reported. The sequences of

shRNA hairpins are listed below:

shRENILLA.713(shNT):TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATC

TATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGC

CTCGGA

shRB1.81:TGCTGTTGACAGTGAGCGCGGAAAGGACATGTGAACTTATTAGTGA

AGCCACAGATGTAATAAGTTCACATGTCCTTTCCATGCCTACTGCCTCGGA

shRB1.88:TGCTGTTGACAGTGAGCGCGCAGTTCGATATCTACTGAAATAGTGA

AGCCACAGATGTATTTCAGTAGATATCGAACTGCTTGCCTACTGCCTCGGA

shRB1.1292:TGCTGTTGACAGTGAGCGCTAGGACTGTTATGAACACTATTAGTG

AAGCCACAGATGTAATAGTGTTCATAACAGTCCTAATGCCTACTGCCTCGGA

shTP53.326:TGCTGTTGACAGTGAGCGCCCACTACAACTACATGTGTAATAGTG

AAGCCACAGATGTATTACACATGTAGTTGTAGTGGATGCCTACTGCCTCGGA

shTP53.2057:TGCTGTTGACAGTGAGCGCGGAGGATTTCATCTCTTGTATTAGTG

AAGCCACAGATGTAATACAAGAGATGAAATCCTCCATGCCTACTGCCTCGGA

shSOX2.50:TGCTGTTGACAGTGAGCGAAGAGAAGAGAGTGTTTGCAAATAGTG

AAGCCACAGATGTATTTGCAAACACTCTCTTCTCTGTGCCTACTGCCTCGGAC

TTCAAGGGGCTAGAATTC

shSOX2.1983:TGCTGTTGACAGTGAGCGCTAGGACAGTTGCAAACGTGAATAGT

GAAGCCACAGATGTATTCACGTTTGCAACTGTCCTAATGCCTACTGCCTCGGA

CTTCAAGGGGCTAGAATTC

The first CRISPR/Cas9 vector used for inactivated RB1 gene was lentiCRISPR v2

purchased from Addgene (Plasmid #52961). The plasmid used for inactivated TP53 was

pLKO5.sgRNA.EFS.tRFP purchased from Addgene (Plasmid #57823). The empty vector

served as the sgNT control. The guide RNAs were designed using Feng Zhang’s CRISPR

guide design tool: http://crispr.mit.edu/ and were listed below:

sgRB1: (F) CACCGATAGGCTAGCCGATACACTG

sgTP53: (F) CACCGCCATTGTTCAATATCGTCCG

Human DYKDDDDK (Flag)-tagged-SOX2 expression lentivirus (cat #337402) was

purchased from Qiagen and used for direct cell transduction, following the

manufacturer’s instruction. A MOI of 1 is used for LNCaP/AR cell transduction

experiments.

Lentiviral particles expressing shRNA hairpins, and guide RNAs were generated as

previously described with some modifications using HEK-293T cells (33). One day

before transfection, 1 million HEK-293T cells were seeded in each well of 6-well plates

in regular DMEM to achieve 80% confluence 24 hours later. The next day, each well was

transfected with 2µg of plasmid expressing the desired shRNA or guide RNA, 2ug of

psPAX2 packaging plasmid and 1µg of pVSV-G plasmid with 12µl of Lipofectamine

2000 (ThermoFisher, cat #12566014). Retroviral particles expressing shRNAs were

generated similarly, except using HEK-293 cells and 1µg of pLEPG-shDGCR8. 24 hours

after transfection, the media was replaced with regular DMEM supplemented with 10%

FBS. Media containing viruses was harvested 24 hours afterwards. The supernatant was

then filtrated through a 0.45µm Steri-Flip filter (Millipore) and used for cell infection.

Lentiviral and Retroviral transduction

Lentiviral or Retroviral transduction of cells for shRNA or guide RNA experiments was

performed as previously described with some modifications (33). Human cells were

seeded at 800,000 cells per well in 2 ml of media in 6-well plates. The next day, media

was removed and replaced with media containing 50% of lentivirus and 50% of fresh

culture medium, along with 5μg/ml polybrene. The virus containing media was removed

after 24 hours and replaced with normal culture medium. The cells were selected with

2μg/ml puromycin for 4 days, 2 days post transduction. To generate TP53/RB1 double

knockdown cells, the transduced cells were sorted by Flow Cytometer for GFP/mCherry

double positive population 2 days post transduction.

Cell growth assay

Cell growth assays were conducted in two different protocols. The protocol A assessed

cell growth by plating 20,000 LNCaP/AR cells per well of a 24-well cell culture plate in

0.5ml of RPMI medium supplemented with charcoal-stripped serum (CSS) and treated

with vehicle (DMSO) control or enzalutamide (10 μM) for 6 days. Cell numbers were

counted using a Vi-CellTN XR cell viability analyzer (Beckman) on day 7 and the relative

cell growth (treated/control) was calculated. The protocol B assessed cell growth curve

similarly, except by plating 500,000 LNCaP/AR cells per well of a 6-well cell culture

plate on day 0. Cell numbers were counted on day 4 and then cells were diluted by 3 fold

and replated in a 6-well culture plate and re-counted on day 7. The final counted cells on

day 7 were multiplied by 3 to reflect the dilution. The cell growth assay performed using

CWR22Pc-EP cells were similar to protocol A with the exception being 200,000

CWR22Pc-EP cells per well of a 24-well cell culture plate were plated and cultured in

0.5ml of RPMI medium supplemented with full serum and treated with vehicle (DMSO)

control or enzalutamide (1μM). For protocol B, 2 million CWR22Pc-EP cells per well of

a 6-well cell culture plate were plated and treated with vehicle (DMSO) control or

enzalutamide (1μM). Cells were counted every 6 days and diluted by 3 fold and replated.

The final number of cells counted on day 18 were multiplied by 9 to reflect the two

dilutions. Cell growth assays were conducted in triplicate and SEMs were reported.

Cell cycle analysis

Cell cycle analysis was conducted by plating 5 million LNCaP/AR cells per 10cm cell

culture plate in 10ml of RPMI medium supplemented with charcoal-stripped serum

(CSS) and treated with vehicle (DMSO) control or enzalutamide (10μM) for 6 days, cells

were diluted and replated every 2 days. On day 7, culture medium was replaced with

medium having EdU and cultured for 2 hours before performing the cell cycle assay. The

EdU incorporation assay was performed using the Click-iT EdU Alexa Fluor 647

Cytometry Assay Kit (Life Technologies, cat # C10419) according to the manufacturer’s

instruction. The percentage of cells with positive EdU staining was assessed by flow

cytometry, which reflected the percentage of cells in S-phase.

LNCaP/AR xenograft experiment

In vivo xenograft experiments were done by subcutaneous injection of 2 × 106

LNCaP/AR cells (100 μl in 50% Matrigel [BD Biosciences, San Jose, CA] and 50%

growth media) into the flanks of castrated male SCID mice. Daily gavage treatment with

10mg/kg enzalutamide or Vehicle (using a formulation of 1% carboxymethyl cellulose,

0.1% Tween-80, 5% DMSO) was initiated on the day of injection. Once tumors were

palpable, tumor size was measured weekly by tumor measuring system Peira TM900

(Peira bvba, Belgium). All animal experiments were performed in compliance with the

guidelines of the Research Animal Resource Center of the Memorial Sloan Kettering

Cancer Center.

Organoids culture, transduction, viability assay and xenograft experiment

Murine organoids from the Trp53loxP/loxP , Rb1loxP/loxP mice were established (16), sorted,

cultured in 3D and transduced with lentiviruses as described previously (34). Organoids

were transduced with lentivirus coding for either Cre or DsRed (Empty) as a control.

Organoids were selected with 1 μg/ml puromycin for 5 days, 2 days post transduction.

Organoids H&E staining was done by the MSKCC Molecular Cytology Core. Organoids

were moved to 2D culture and response to enzalutamide treatment was assessed using

CellTiter-Glo luminescent cell viability assay (Promega cat #7570). 1000 cells were

seeded in 96-well dish and treated with 5µM enzalutamide for 3 days before performing

the assay. For in vivo xenograft experiment, cultured organoids were digested using

trypsin and 1 × 106 cells were injected subcutaneously into the flanks of male SCID mice.

Mice were castrated on week 10 and daily gavage treatment with 10mg/kg enzalutamide

or Vehicle (using a formulation of 1% carboxymethyl cellulose, 0.1% Tween-80, 5%

DMSO) was initiated one day after castration. Tumor size was measured weekly by

tumor measuring system Peira TM900 (Peira bvba, Belgium). All animal experiments

were performed in compliance with the guidelines of the Research Animal Resource

Center of the Memorial Sloan Kettering Cancer Center.

Gene detection by qPCR

Total RNA from cells or homogenized tissues was extracted using Trizol (Ambion, Cat

15596018) following manufacturer’s instructions. The high capacity cDNA Reverse

Transcriptase Kit (Applied Biosciences, 4368813) was used following manufacturer’s

instructions, using RNA that was diluted to 200ng/ul. Enzyme used in amplification was

2X SYBR green quantfast PCR Mix (Qiagen 1044154). Assays were performed on a

minimum of three biological replicates and normalized to β-Actin. Qiagen RT2 qPCR

primer assays are used as primers for all the gene expression detection. Individual primer

assays are listed: TP53 (PPH00213F), RB1(PPH00228F), SOX2 (PPH02471A), CK5

(PPH02625F), CK14(PPH02389A), TP63(PPH01032F), SYP(PPH00717A), CHGA

(PPH01181A), NSE (PPH02058A), AR(PPH01016A), CK8(PPH02214F), CK18

(PPH00452F), NKX3.1 (PPH02267C), TMPRSS2 (PPH02262C),

TIPARP(PPH07883A), NDRG1 (PPH02202B), FKBP5 (PPH02277A), ATF5

(PPH05770B), BHLHE40 (PPH00409A), CC2D1A (PPH15400F), KLF10

(PPH00410A), HES1 (PPH00850A), HSF2 (PPH00465A), ENO1 (PPH01708A), ACTB

(PPH00073G).

Chromatin Immunoprecipitation (ChIP) qPCR

ChIP experiments were performed as previously described (11), using SDS-based

buffers. Antibodies were used at a concentration of 5ug per 1mL of IP buffer, which

encompassed approximately 8 million cells per IP. Antibodies used were: AR (Santa

Cruz, N-20, cat sc-816). For ChIP-PCR analysis, three primers were designed and tested

to cover SOX2 gene locus, similar results were observed and the primer on promoter was

displayed in Fig S10B. SOX2-P1: F-GAGAGTGTTGGCACCTGTAA, R-

TCATTGTTCTCCCGCTCATC; SOX2-P2: F-CGTCACATGGATGGTTGTCTA, R-

CCCTTTCTTTCTCTCTCCTCTTC; SOX2-P3: F-AATGCCTTCATGGTGTGGTC, R-

GCTTAGCCTCGTCGATGAAC; Primers for KLK3 and FKBP5 were shown below,

both on enhancer region: KLK3: F- TGGGACAACTTGCAAACCTG, R-

CCAGAGTAGGTCTGTTTTCAATCCA; FKBP5: F-

CCCCCTATTTTAATCGGAGTAC, R-TTTTGAAGAGCACAGAACACCCT.

Western Blot

Proteins were measured with Pierce BCA Protein Assay Kit (cat #23225) according to kit

directions. 4 volumes of protein were mixed with 5X laemmli buffer and boiled. Proteins

were run on pre made gels (Novex Life Technology) using Novex sharp pre-stained

protein standards as a marker (Invitrogen, LC8500) and 1X MOPS as running buffer,

diluted from 20X MOPS (Teknova M1088). Gels were run at 120 volts. Gels were

transferred in 1X Transfer buffer (1/4 mole Tris Base + 1.91 mole Glycine) diluted with

water and ethanol. Nitrocullulose membrane paper (Immobilon IPVH00010) was used

and was activated with 100% methanol (Fisher, A412-20). Transfer occurred at 4C for 1

hour at 100 volts. Membranes were blocked in 5% milk for 15 minutes prior to addition

of primary antibody and washed with 1X TBST (10X stock from Teknova, T9511).

Antibodies used for western blot are: Sox2 antibody (CST, cat #3579), Rb (CST, cat

#9309), p53 (Leica, NCL-p53-DO1), Gapdh (CST, cat # 2118), Ck5 (abcam, cat #

ab24647), Synaptophsin (pierce, cat # MA5-16402), Ck8 (abcam, cat #9023), AR (CST,

cat #5153), p21 (CST, cat #2947), E2f1 (CST, cat # 3742), Actin (CST, cat #4970).

Immunofluorescence and Immunohistochemistry

For immunofluorescence, LNCaP/AR cells were cultured in 15cm2 dishes until 80%

confluence. Cells were co-spun down with matrigel in 15ml tube and fixed in 4%

Paraformaldehyde (Electron Microscopy Sciences) for 12 hours at room temperature.

Cell pellets were processed for paraffin embedding using Leica ASP6025 tissue

processor (Leica Biosystems). Freshly cut 5 micron paraffin sections were stained on

Leica Bond RX (Leica Biosystems) with CK14 antibody (Abcam, #ab7800, 1:100);

CK18 antibody (Abcam, #ab668, 1:100); AR antibody (Abcam, #3184-1, 1:100) and

Synaptophysin antibody (Cell Signaling Technology, #5461, 1:100) with appropriate

negative and positive controls. After washing in PBS, slides were mounted with Mowiol

and fluorescent images were acquired on a Leica SP5 laser scanning confocal microscope

with LAS AF 2.2 software. Immunofluorescence was independently performed twice and

a representative experiment is shown.

For Immunohistochemistry, collected tumors (n=3 for each group) were fixed in 4%

Paraformaldehyde (Electron Microscopy Sciences) for 12 hours at room temperature and

processed for paraffin embedding using Leica ASP6025 tissue processor (Leica

Biosystems). Freshly cut 5 micron paraffin sections were stained on Leica Bond RX

(Leica Biosystems) with CK5 antibody (Abcam, #ab24647, 1:100) and Synaptophysin

antibody (Cell Signaling Technology, #5461, 1:100) with appropriate negative and

positive controls. After washing in PBS, slides were mounted with Mowiol and images

were acquired on an Olympus BX46 microscope. Images of representative fields were

shown.

RNA-Seq and GSEA analysis

Total RNA from cells or homogenized tissues was extracted using Trizol (Ambion, Cat

15596018) following manufacturer’s instructions. RNA-Seq library construction and

sequencing was performed at the integrated genomics operation (IGO) Core at MSKCC

according to standard protocols. Approximately 10 million 50bp paired-end reads were

acquired per replicate condition for sequencing and Poly-A selection was performed.

Resulting RNA-Seq data was analyzed by removing adaptor sequences using

Trimmomatic. RNA-seq reads were then aligned to GRCh37.75(hg19) with STAR and

genome-wide transcript counting was performed by HTSeq to generate a matrix of

fragments per kilobase of exon per million fragments mapped (RPKM). GSEA statistical

analysis was carried out with publicly available software from the Broad Institute

(http://www.broadinstitute.org/gsea/index.jsp). Weighted GSEA enrichment statistic and

Diff_of_Classes metric for ranking genes were used. The luminal and basal gene

signatures were defined by combining the 50 luminal and basal signature genes of (30)

and 6 canonical lineage markers (each lineage) also tested in (30), which were listed in

Supplemental Table 1. The GEO accession number for gene expression data reported in

this paper is GSE89226.

Analysis of human prostate cancer datasets

All analysis of human prostate cancer data was conducted using previously published, de-

identified data from (6, 12, 13). RNA-seq data from 35 CRPC patients from the IPM

Cornell cohort (12) were processed as follows. Reads (FASTQ files) were mapped to the

human genome reference sequence (hg19/GRC37) using STAR v2.3.0e (35), and the

resulting alignment files were converted into Mapped Read Format (MRF) for gene

expression quantification using RSEQtools (36) and GENCODE v19

(http://www.gencodegenes.org/releases/19.html) as reference gene annotation set. A

composite model of genes based on the union of all exonic regions from all gene

transcripts was used, resulting in a set of 20,345 protein-coding genes. Expression levels

were estimated as FPKM. Processed SU2C-PCF RNA-seq data (n = 149) were

downloaded from cBioPortal (6).

To assess RB1/TP53 allele-specific copy number genomic status from Whole Exome

Sequencing (WES) data of SU2C-PCF we applied CLONET (37) upon segmentation of

tumor to normal exon read count ratios using EXCAVATOR (38). Briefly, allele-specific

copy number combines the log2 of the tumor to normal ratios with the allelic fraction of

individual’s germline heterozygous SNPs, assigning to each genomic segment the copy

number value of allele A and of allele B (cnA, cnB). CLONET quality filters were set to

≥ 10 SNPs and mean coverage ≥ 20 to call allele-specific status of a genomic segment.

Few borderline cases were visually inspected. Point mutation calls were downloaded

from cBioPortal. Gene altered status was considered in the presence of any of the

following: non-synonymous point mutations, hemizygous deletion, or homozygous

deletion (upon tumor ploidy and purity adjustment).

To identify Transcription Factors (TFs) potentially associated with the TP53/RB1 altered

phenotype, we first performed a ‘receiver-operator curve’ (ROC) analysis within the

CRPC IPM Cornell cohort. FPKM values were used as threshold parameter and the ‘area

under the curve’ (AUC) was calculated for each transcript. Starting from a list of 1,240

TFs, a total of 132 were identified with AUC ≥ 0.65 in IPM Cornell cohort, of which 66

were overexpressed (p-value < 0.05, Wilcoxon Mann Whitney test) in the TP53/RB1

altered phenotype (see Supplementary Table 2). We performed the same analysis in the

SU2C-PCF 2015 cohort transcript data; 63 TFs were identified against the phenotype of

which 40 were overexpressed in the TP53/RB1 altered phenotype (see Supplementary

Table 3). Eight TFs were common between the two lists of 66 and 40. The initial list of

1,240 TFs was downloaded from Ensembl Biomart (Ensembl release 83 - December

2015) (39) by filtering genes for the “GO:0003700” Gene Ontology (GO) Accession

Term.

Fig S1. Knockdown of TP53 and RB1 confers enzalutamide resistance in CWR22Pc-

EP cells: (A) Western blot showing TP53 and RB1 protein levels in CWR22Pc-EP cells

transduced with annotated hairpins. GAPDH serves as loading control. (B) Growth curve

of CWR22Pc-EP cells transduced with annotated hairpins in media supplemented with

full serum, following CWR22Pc-EP protocol B. Enz denotes 1μg/ml enzalutamide

treatment; Mock denotes DMSO treatment with same volume as enzalutamide. (C) Cell

number of CWR22Pc-EP cells transduced with annotated hairpins in a stable vector

system after 4 days treatments in media supplemented with full serum, following

CWR22Pc-EP protocol A and normalized to “-Enz” group. “+Enz” denotes 1μg/ml

enzalutamide treatment; “-Enz” denotes DMSO treatment with same volume as

enzalutamide. Mean ± s.e.m. is represented and p-values were calculated using multiple t-

tests.

Fig. S2. Loss of TP53 and RB1 restores tumor cell proliferation suppressed by

enzalutamide: (A) FACS plot showing percentage of cells actively proliferating (s-phase

cells stained positive for EdU incorporation). LNCaP/AR cells were transduced with

annotated hairpins and treated with 10μg/ml enzalutamide for 7 days in CSS medium. (B)

Percentage of cells actively proliferating compared to mock treatment (DMSO). Statistics

were calculated using data from 5 independent experiments. “+Enz” denotes 10μg/ml

enzalutamide; “-Enz” denotes DMSO treatment with same volume as enzalutamide.

Mean ± s.e.m. is represented and p-values were calculated using multiple t-tests.

FSC

EdU (% of cells in s-phase)

shNT shTP53

shRB1 shTP53/RB1

B

shNT shTP53

shRB1 shTP53/RB1

Mock Enz

A

0

20

40

60

80

100

Ce

lls in

S-P

hase

(% o

f Mo

ck)

p<0.0001 p=0.003 p<0.0001

shNT

shTP

53

shRB1

shTP

53/R

B1

Enz - + - + - + - +

Fig. S3. Deletion of TP53 and RB1 using CRISPR-Cas9 system confers resistance to

enzalutamide: (A) Western blot showing TP53 and RB1 protein levels in LNCaP/AR

cells transduced with annotated guide RNAs. GAPDH serves as loading control. (B) Cell

number of LNCaP/AR cells transduced with annotated guide RNAs, normalized to “-

Enz” group. Cells were treated with 7 days of enzalutamide in CSS medium, following

LNCaP/AR protocol A. “+Enz” denotes 10μg/ml enzalutamide treatment; “-Enz”

denotes DMSO treatment with same volume as enzalutamide. (C) Tumor growth curve of

xenografted LNCaP/AR cells transduced with annotated guide RNAs. Enz denotes

enzalutamide treatment at 10mg/kg orally one day after grafting. Mock denotes DMSO

treatment at same dosage. For all panels unless otherwise noted, mean ± s.e.m. is

represented and p-values were calculated using multiple t-tests.

Fig. S4. Murine organoids with Trp53 and Rb1 deletion lost epithelial features and

gained resistance to enzalutamide: (A) Bright field and H&E pictures of murine

organoids transduced with Cre or empty vector. (B) Cell number of murine organoids

transduced with Cre or empty vectors, normalized to “-Enz” group. Organoid were

cultured in 2D and treated with 5µM enzalutamide or DMSO for 3 days. “+Enz” denotes

enzalutamide treatment and “-Enz” denotes DMSO treatment with same volume as

enzalutamide. (C) Tumor growth curve of xenografted murine organoids transduced with

Cre or empty vector. Enz denotes enzalutamide treatment at 10mg/kg orally beginning on

the day of orchidectomy. Mock denotes DMSO treatment at same dosage. For all panels

unless otherwise noted, mean ± s.e.m. is represented and p-values were calculated using

multiple t-tests.

Fig. S5. Loss of TP53 and RB1 leads to increased cellular lineage plasticity in

LNCaP/AR and CWR22Pc-EP cell lines; LNCaP/AR xenograft models and CRPC

tumors from two independent cohorts: (A) Relative gene expression of lineage

markers in CWR22Pc-EP cells transduced with annotated hairpins in a stable vector

system. (B) Western blot of selected cellular lineage markers in CWR22Pc-EP cells

transduced with annotated hairpins in a stable vector system. GAPDH serves as loading

control. (C) Immunofluorescence staining of selected cellular lineage markers in

LNCaP/AR cells transduced with annotated hairpins. (D) Relative gene expression of

lineage markers in enz resistant tumors collected from the LNCaP/AR xenograft model.

(E) IHC staining of selected lineage markers on enz resistant tumors collected from the

LNCaP/AR xenograft model. (F) Western blot showing protein levels of selected cellular

lineage markers in LNCaP/AR cells transduced with annotated guide RNAs. GAPDH

serves as loading control. (G) Relative gene expression of lineage markers in LNCaP/AR

cells transduced with annotated guide RNAs. For all panels unless otherwise noted, mean

± s.e.m. is represented and p-values were calculated using multiple t-tests.

Fig. S6. Changes in cellular lineage plasticity are reversed when TP53 and RB1 are

restored: (A) Relative gene expression of lineage markers in LNCaP/AR cells

transduced with hairpins against TP53 and RB1 in an inducible vector system. Tick marks

on the Doxycycline Timeline (top) indicate time points at which RNA was collected.

“On Dox” denotes the samples were collected after 48 hours treatment of doxycycline.

“Off 1 day” denotes the samples were collected 1 day after the doxycline was removed

(48 hours on Dox followed by 1 day off Dox). Other data points are denoted in similar

way. (B) Relative gene expression of lineage markers in LNCaP/AR cells transduced

RB1

TP53

CK5

CK14

TP63

SYP

CHGA

NSE

AR

CK8

CK18

0

1

2

4

6

8

10

Re

lativ

e e

xp

ressio

n

No Dox

Doxycycline Timeline:

On Dox Off 1 day Off 2 day Off 3 day Off 4 day Off 9 days

p=0.0008 p<0.0001

p<0.0001

p<0.0001

p=0.0002

p=0.0008

p=0.0001

p=0.0002

RB1

TP53

CK5

CK14

TP63

SYP

CHG

ANSE

AR

CK8

CK18

0

1

2

10

20

Re

lative

exp

ressio

n

shNTInducible LNCaP/AR (48hrs on Dox)

shTP53/RB1shTP53shRB1

p<0.0001 p<0.0001

p=0.01

p<0.0001

p=0.05 p=0.002 p<0.0001p=0.0003 p=0.003

NS NS

Basal NE Luminal

Basal NE Luminal

A

B

with annotated hairpins in an inducible vector system for 48 hours. For all panels unless

otherwise noted, mean ± s.e.m. is represented and p-values were calculated using

multiple t-tests.

Fig. S7. SOX2 expression in patient samples: Expression levels of SOX2 across 162

prostate cancer samples of different pathologic classifications (130 CRPC-Adeno and 32

CPRC-NE). p-value refers to the ANOVA analysis of the linear regression of SOX2

expression levels versus the pathology class. Data are re-integrated using the IPM cohort

(12).

Fig. S8. SOX2 expression is increased in multiple preclinical models: (A) Relative

gene expression levels of SOX2 in enzalutamide resistant tumors collected from the

LNCaP/AR xenograft model. (B) Relative levels of RB1, TP53 and SOX2 gene

expression in LNCaP/AR cells transduced with annotated guide RNA using the CRISPR-

Cas9 system. (C) Relative gene expression of RB1, TP53 and SOX2 in LNCaP/AR cells

transduced with annotated hairpins in an inducible vector system. (D) Relative gene

expression of RB1, TP53 and SOX2 in LNCaP/AR cells transduced with hairpins against

TP53 and RB1 in an inducible vector system. “On Dox” denotes the samples were

collected after 48 hours treatment of doxycycline. “Off 1 day” denotes the samples were

collected 1 day after the doxycline was removed. Other data points are denoted in similar

way. For all panels unless otherwise noted, mean ± s.e.m. is represented and p-values

were calculated using multiple t-tests.

Fig. S9. SOX2 is the most highly upregulated among the 8 identified TFs in

TP53/RB1 altered patients: (A) Relative gene expression of 8 transcription factors in

LNCaP/AR cells transduced with annotated hairpins in a stable vector system. (B)

Relative gene expression of 8 transcription factors in CWR22Pc-EP cells transduced with

annotated hairpins in a stable vector system. (C) Relative gene expression of 8

transcription factors in Trp53loxP/loxP,Rb1loxP/loxP murine organoids transduced with Cre or

empty vector. For all panels unless otherwise noted, mean ± s.e.m. is represented and p-

values were calculated using multiple t-tests.

Fig. S10. AR inhibition is not sufficient to activate SOX2 expression: (A) Relative

expression of SOX2 in LNCaP/AR cells transduced with annotated hairpins, treated with

DMSO or Enzalutamide. Enz denotes enzalutamide treatment at 10uM. Mock denotes

DMSO treatment at same dosage. (B) AR ChIP-qPCR of the SOX2 genomic locus, as

well as the loci of two canonical AR target genes (KLK3, FKBP5) in LNCaP/AR cells.

For all panels unless otherwise noted, mean ± s.e.m. is represented and p-values were

calculated using multiple t-tests.

Fig. S11. SOX2 is sufficient to induce lineage plasticity and enzalutamide resistance:

(A) Relative gene expression of SOX2 and lineage marker genes in LNCaP/AR cells

transduced with annotated vectors in a stable vector system. (B) Cell numbers of

LNCaP/AR cells transduced with annotated vectors (parental vs. Flag-SOX2), normalized

to “-Enz” group. Cells were treated 7 days with enzalutamide or DMSO in CSS medium,

following LNCaP/AR protocol A. “+Enz” denotes 10μg/ml enzalutamide treatment; “-

Enz” denotes DMSO treatment with same volume as enzalutamide. (C) Relative gene

expression of iPS genes (SOX2, OCT4, KLF4, MYC) in LNCaP/AR cells transduced with

annotated vectors in a stable vector system. (D) Cell numbers of LNCaP/AR cells

transduced with annotated vectors, normalized to “-Enz” group. Cells were treated 7 days

with enzalutamide or DMSO in CSS medium, following LNCaP/AR protocol A. “+Enz”

denotes 10μg/ml enzalutamide treatment; “-Enz” denotes DMSO treatment with same

volume as enzalutamide. For all panels unless otherwise noted, mean ± s.e.m. is

represented and p-values were calculated using multiple t-tests.

Table. S1. Luminal and basal signature gene lists: The luminal and basal gene

signatures were defined by combining the 50 genes’ luminal and basal signatures of (30)

and 6 canonical lineage markers (each lineage) tested in (30).

Table. S2. A total of 132 Transcription Factors (TFs) were associated with the

TP53/RB1 altered phenotype in IPM cohort: ‘Receiver-operator curve’ (ROC) analysis

was performed within the IPM cohort. FPKMs was used as a threshold and ‘area under

the curve’ (AUC) was calculated. A total of 132 TFs were identified with AUC ≥ 0.65, of

which 66 were overexpressed in the TP53/RB1 altered phenotype.

Table. S3. A total of 63 Transcription Factors (TFs) were associated with the

TP53/RB1 altered phenotype in SU2C-PCF cohort: ‘Receiver-operator curve’ (ROC)

analysis was performed within the SU2C-PCF cohort. FPKMs was used as a threshold

and ‘area under the curve’ (AUC) was calculated. A total of 63 TFs were identified with

AUC ≥ 0.65, of which 40 were overexpressed in the TP53/RB1 altered phenotype.

References and Notes

1. W. Pao, V. A. Miller, K. A. Politi, G. J. Riely, R. Somwar, M. F. Zakowski, M. G. Kris, H.

Varmus, Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is

associated with a second mutation in the EGFR kinase domain. PLOS Med. 2, e73

(2005). doi:10.1371/journal.pmed.0020073 Medline

2. M. E. Gorre, M. Mohammed, K. Ellwood, N. Hsu, R. Paquette, P. N. Rao, C. L. Sawyers,

Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or

amplification. Science 293, 876–880 (2001). doi:10.1126/science.1062538 Medline

3. P. Lito, N. Rosen, D. B. Solit, Tumor adaptation and resistance to RAF inhibitors. Nat. Med.

19, 1401–1409 (2013). doi:10.1038/nm.3392 Medline

4. L. V. Sequist, B. A. Waltman, D. Dias-Santagata, S. Digumarthy, A. B. Turke, P. Fidias, K.

Bergethon, A. T. Shaw, S. Gettinger, A. K. Cosper, S. Akhavanfard, R. S. Heist, J.

Temel, J. G. Christensen, J. C. Wain, T. J. Lynch, K. Vernovsky, E. J. Mark, M. Lanuti,

A. J. Iafrate, M. Mino-Kenudson, J. A. Engelman, Genotypic and histological evolution

of lung cancers acquiring resistance to EGFR inhibitors. Sci. Transl. Med. 3, 75ra26

(2011). doi:10.1126/scitranslmed.3002003 Medline

5. H. Beltran, D. S. Rickman, K. Park, S. S. Chae, A. Sboner, T. Y. MacDonald, Y. Wang, K. L.

Sheikh, S. Terry, S. T. Tagawa, R. Dhir, J. B. Nelson, A. de la Taille, Y. Allory, M. B.

Gerstein, S. Perner, K. J. Pienta, A. M. Chinnaiyan, Y. Wang, C. C. Collins, M. E.

Gleave, F. Demichelis, D. M. Nanus, M. A. Rubin, Molecular characterization of

neuroendocrine prostate cancer and identification of new drug targets. Cancer Discov. 1,

487–495 (2011). doi:10.1158/2159-8290.CD-11-0130 Medline

6. D. Robinson, E. M. Van Allen, Y.-M. Wu, N. Schultz, R. J. Lonigro, J.-M. Mosquera, B.

Montgomery, M.-E. Taplin, C. C. Pritchard, G. Attard, H. Beltran, W. Abida, R. K.

Bradley, J. Vinson, X. Cao, P. Vats, L. P. Kunju, M. Hussain, F. Y. Feng, S. A. Tomlins,

K. A. Cooney, D. C. Smith, C. Brennan, J. Siddiqui, R. Mehra, Y. Chen, D. E. Rathkopf,

M. J. Morris, S. B. Solomon, J. C. Durack, V. E. Reuter, A. Gopalan, J. Gao, M. Loda, R.

T. Lis, M. Bowden, S. P. Balk, G. Gaviola, C. Sougnez, M. Gupta, E. Y. Yu, E. A.

Mostaghel, H. H. Cheng, H. Mulcahy, L. D. True, S. R. Plymate, H. Dvinge, R.

Ferraldeschi, P. Flohr, S. Miranda, Z. Zafeiriou, N. Tunariu, J. Mateo, R. Perez-Lopez, F.

Demichelis, B. D. Robinson, M. Schiffman, D. M. Nanus, S. T. Tagawa, A. Sigaras, K.

W. Eng, O. Elemento, A. Sboner, E. I. Heath, H. I. Scher, K. J. Pienta, P. Kantoff, J. S. de

Bono, M. A. Rubin, P. S. Nelson, L. A. Garraway, C. L. Sawyers, A. M. Chinnaiyan,

Integrative clinical genomics of advanced prostate cancer. Cell 161, 1215–1228 (2015).

doi:10.1016/j.cell.2015.05.001 Medline

7. P. A. Watson, V. K. Arora, C. L. Sawyers, Emerging mechanisms of resistance to androgen

receptor inhibitors in prostate cancer. Nat. Rev. Cancer 15, 701–711 (2015).

doi:10.1038/nrc4016 Medline

8. F. J. Meyers, P. H. Gumerlock, S. G. Chi, H. Borchers, A. D. Deitch, R. W. deVere White,

Very frequent p53 mutations in metastatic prostate carcinoma and in matched primary

tumors. Cancer 83, 2534–2539 (1998). doi:10.1002/(SICI)1097-

0142(19981215)83:12<2534:AID-CNCR19>3.0.CO;2-V Medline

9. C. Tran, S. Ouk, N. J. Clegg, Y. Chen, P. A. Watson, V. Arora, J. Wongvipat, P. M. Smith-

Jones, D. Yoo, A. Kwon, T. Wasielewska, D. Welsbie, C. D. Chen, C. S. Higano, T. M.

Beer, D. T. Hung, H. I. Scher, M. E. Jung, C. L. Sawyers, Development of a second-

generation antiandrogen for treatment of advanced prostate cancer. Science 324, 787–790

(2009). doi:10.1126/science.1168175 Medline

10. M. D. Balbas, M. J. Evans, D. J. Hosfield, J. Wongvipat, V. K. Arora, P. A. Watson, Y.

Chen, G. L. Greene, Y. Shen, C. L. Sawyers, Overcoming mutation-based resistance to

antiandrogens with rational drug design. eLife 2, e00499 (2013). doi:10.7554/eLife.00499

Medline

11. V. K. Arora, E. Schenkein, R. Murali, S. K. Subudhi, J. Wongvipat, M. D. Balbas, N. Shah,

L. Cai, E. Efstathiou, C. Logothetis, D. Zheng, C. L. Sawyers, Glucocorticoid receptor

confers resistance to antiandrogens by bypassing androgen receptor blockade. Cell 155,

1309–1322 (2013). doi:10.1016/j.cell.2013.11.012 Medline

12. H. Beltran, D. Prandi, J. M. Mosquera, M. Benelli, L. Puca, J. Cyrta, C. Marotz, E.

Giannopoulou, B. V. S. K. Chakravarthi, S. Varambally, S. A. Tomlins, D. M. Nanus, S.

T. Tagawa, E. M. Van Allen, O. Elemento, A. Sboner, L. A. Garraway, M. A. Rubin, F.

Demichelis, Divergent clonal evolution of castration-resistant neuroendocrine prostate

cancer. Nat. Med. 22, 298–305 (2016). doi:10.1038/nm.4045 Medline

13. The Cancer Genome Atlas Research Network, The molecular taxonomy of primary prostate

cancer. Cell 163, 1011–1025 (2015). doi:10.1016/j.cell.2015.10.025 Medline

14. A. M. Aparicio, L. Shen, E. L. N. Tapia, J.-F. Lu, H.-C. Chen, J. Zhang, G. Wu, X. Wang, P.

Troncoso, P. Corn, T. C. Thompson, B. Broom, K. Baggerly, S. N. Maity, C. J.

Logothetis, Combined tumor suppressor defects characterize clinically defined aggressive

variant prostate cancers. Clin. Cancer Res. 22, 1520–1530 (2016). doi:10.1158/1078-

0432.CCR-15-1259 Medline

15. H.-L. Tan, A. Sood, H. A. Rahimi, W. Wang, N. Gupta, J. Hicks, S. Mosier, C. D. Gocke, J.

I. Epstein, G. J. Netto, W. Liu, W. B. Isaacs, A. M. De Marzo, T. L. Lotan, Rb loss is

characteristic of prostatic small cell neuroendocrine carcinoma. Clin. Cancer Res. 20,

890–903 (2014). doi:10.1158/1078-0432.CCR-13-1982 Medline

16. Z. Zhou, A. Flesken-Nikitin, D. C. Corney, W. Wang, D. W. Goodrich, P. Roy-Burman, A.

Y. Nikitin, Synergy of p53 and Rb deficiency in a conditional mouse model for

metastatic prostate cancer. Cancer Res. 66, 7889–7898 (2006). doi:10.1158/0008-

5472.CAN-06-0486 Medline

17. A. F. Gazdar, T. K. Savage, J. E. Johnson, A. Berns, J. Sage, R. I. Linnoila, D. MacPherson,

D. G. McFadden, A. Farago, T. Jacks, W. D. Travis, E. Brambilla, The comparative

pathology of genetically engineered mouse models for neuroendocrine carcinomas of the

lung. J. Thorac. Oncol. 10, 553–564 (2015). doi:10.1097/JTO.0000000000000459

Medline

18. S. Kregel, K. J. Kiriluk, A. M. Rosen, Y. Cai, E. E. Reyes, K. B. Otto, W. Tom, G. P. Paner,

R. Z. Szmulewitz, D. J. Vander Griend, Sox2 is an androgen receptor-repressed gene that

promotes castration-resistant prostate cancer. PLOS ONE 8, e53701 (2013).

doi:10.1371/journal.pone.0053701 Medline

19. K. Takahashi, S. Yamanaka, A decade of transcription factor-mediated reprogramming to

pluripotency. Nat. Rev. Mol. Cell Biol. 17, 183–193 (2016). doi:10.1038/nrm.2016.8

Medline

20. C. M. Rudin, S. Durinck, E. W. Stawiski, J. T. Poirier, Z. Modrusan, D. S. Shames, E. A.

Bergbower, Y. Guan, J. Shin, J. Guillory, C. S. Rivers, C. K. Foo, D. Bhatt, J. Stinson, F.

Gnad, P. M. Haverty, R. Gentleman, S. Chaudhuri, V. Janakiraman, B. S. Jaiswal, C.

Parikh, W. Yuan, Z. Zhang, H. Koeppen, T. D. Wu, H. M. Stern, R. L. Yauch, K. E.

Huffman, D. D. Paskulin, P. B. Illei, M. Varella-Garcia, A. F. Gazdar, F. J. de Sauvage,

R. Bourgon, J. D. Minna, M. V. Brock, S. Seshagiri, Comprehensive genomic analysis

identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Nat. Genet. 44,

1111–1116 (2012). doi:10.1038/ng.2405 Medline

21. A. J. Bass, H. Watanabe, C. H. Mermel, S. Yu, S. Perner, R. G. Verhaak, S. Y. Kim, L.

Wardwell, P. Tamayo, I. Gat-Viks, A. H. Ramos, M. S. Woo, B. A. Weir, G. Getz, R.

Beroukhim, M. O’Kelly, A. Dutt, O. Rozenblatt-Rosen, P. Dziunycz, J. Komisarof, L. R.

Chirieac, C. J. Lafargue, V. Scheble, T. Wilbertz, C. Ma, S. Rao, H. Nakagawa, D. B.

Stairs, L. Lin, T. J. Giordano, P. Wagner, J. D. Minna, A. F. Gazdar, C. Q. Zhu, M. S.

Brose, I. Cecconello, U. Ribeiro Jr., S. K. Marie, O. Dahl, R. A. Shivdasani, M.-S. Tsao,

M. A. Rubin, K. K. Wong, A. Regev, W. C. Hahn, D. G. Beer, A. K. Rustgi, M.

Meyerson, SOX2 is an amplified lineage-survival oncogene in lung and esophageal

squamous cell carcinomas. Nat. Genet. 41, 1238–1242 (2009). doi:10.1038/ng.465

Medline

22. M. V. Russo, S. Esposito, M. G. Tupone, L. Manzoli, I. Airoldi, P. Pompa, L. Cindolo, L.

Schips, C. Sorrentino, E. Di Carlo, SOX2 boosts major tumor progression genes in

prostate cancer and is a functional biomarker of lymph node metastasis. Oncotarget 7,

12372–12385 (2016). Medline

23. H. Hong, K. Takahashi, T. Ichisaka, T. Aoi, O. Kanagawa, M. Nakagawa, K. Okita, S.

Yamanaka, Suppression of induced pluripotent stem cell generation by the p53-p21

pathway. Nature 460, 1132–1135 (2009). doi:10.1038/nature08235 Medline

24. M. S. Kareta, L. L. Gorges, S. Hafeez, B. A. Benayoun, S. Marro, A. F. Zmoos, M. J.

Cecchini, D. Spacek, L. F. Batista, M. O’Brien, Y. H. Ng, C. E. Ang, D. Vaka, S. E.

Artandi, F. A. Dick, A. Brunet, J. Sage, M. Wernig, Inhibition of pluripotency networks

by the Rb tumor suppressor restricts reprogramming and tumorigenesis. Cell Stem Cell

16, 39–50 (2015). Medline

25. H. Li, M. Collado, A. Villasante, K. Strati, S. Ortega, M. Cañamero, M. A. Blasco, M.

Serrano, The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature 460, 1136–

1139 (2009). doi:10.1038/nature08290 Medline

26. D. F. Tschaharganeh, W. Xue, D. F. Calvisi, M. Evert, T. V. Michurina, L. E. Dow, A.

Banito, S. F. Katz, E. R. Kastenhuber, S. Weissmueller, C.-H. Huang, A. Lechel, J. B.

Andersen, D. Capper, L. Zender, T. Longerich, G. Enikolopov, S. W. Lowe, p53-

dependent Nestin regulation links tumor suppression to cellular plasticity in liver cancer.

Cell 158, 579–592 (2014). doi:10.1016/j.cell.2014.05.051 Medline

27. E. Calo, J. A. Quintero-Estades, P. S. Danielian, S. Nedelcu, S. D. Berman, J. A. Lees, Rb

regulates fate choice and lineage commitment in vivo. Nature 466, 1110–1114 (2010).

doi:10.1038/nature09264 Medline

28. M. Gerlinger, A. J. Rowan, S. Horswell, J. Larkin, D. Endesfelder, E. Gronroos, P. Martinez,

N. Matthews, A. Stewart, P. Tarpey, I. Varela, B. Phillimore, S. Begum, N. Q.

McDonald, A. Butler, D. Jones, K. Raine, C. Latimer, C. R. Santos, M. Nohadani, A. C.

Eklund, B. Spencer-Dene, G. Clark, L. Pickering, G. Stamp, M. Gore, Z. Szallasi, J.

Downward, P. A. Futreal, C. Swanton, Intratumor heterogeneity and branched evolution

revealed by multiregion sequencing. N. Engl. J. Med. 366, 883–892 (2012).

doi:10.1056/NEJMoa1113205 Medline

29. Y. J. Choi, C.-P. Lin, J. J. Ho, X. He, N. Okada, P. Bu, Y. Zhong, S. Y. Kim, M. J. Bennett,

C. Chen, A. Ozturk, G. G. Hicks, G. J. Hannon, L. He, miR-34 miRNAs provide a barrier

for somatic cell reprogramming. Nat. Cell Biol. 13, 1353–1360 (2011).

doi:10.1038/ncb2366 Medline

30. D. Zhang, D. Park, Y. Zhong, Y. Lu, K. Rycaj, S. Gong, X. Chen, X. Liu, H.-P. Chao, P.

Whitney, T. Calhoun-Davis, Y. Takata, J. Shen, V. R. Iyer, D. G. Tang, Stem cell and

neurogenic gene-expression profiles link prostate basal cells to aggressive prostate

cancer. Nat. Commun. 7, 10798 (2016). doi:10.1038/ncomms10798 Medline

31. C. D. Chen, D. S. Welsbie, C. Tran, S. H. Baek, R. Chen, R. Vessella, M. G. Rosenfeld, C. L.

Sawyers, Molecular determinants of resistance to antiandrogen therapy. Nat. Med. 10,

33–39 (2004). doi:10.1038/nm972 Medline

32. A. Dagvadorj, S.-H. Tan, Z. Liao, L. R. Cavalli, B. R. Haddad, M. T. Nevalainen, Androgen-

regulated and highly tumorigenic human prostate cancer cell line established from a

transplantable primary CWR22 tumor. Clin. Cancer Res. 14, 6062–6072 (2008).

doi:10.1158/1078-0432.CCR-08-0979 Medline

33. D. B. Wheeler, R. Zoncu, D. E. Root, D. M. Sabatini, C. L. Sawyers, Identification of an

oncogenic RAB protein. Science 350, 211–217 (2015). doi:10.1126/science.aaa4903

Medline

34. W. R. Karthaus, P. J. Iaquinta, J. Drost, A. Gracanin, R. van Boxtel, J. Wongvipat, C. M.

Dowling, D. Gao, H. Begthel, N. Sachs, R. G. J. Vries, E. Cuppen, Y. Chen, C. L.

Sawyers, H. C. Clevers, Identification of multipotent luminal progenitor cells in human

prostate organoid cultures. Cell 159, 163–175 (2014). doi:10.1016/j.cell.2014.08.017

Medline

35. A. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson,

T. R. Gingeras, STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21

(2013). doi:10.1093/bioinformatics/bts635 Medline

36. L. Habegger, A. Sboner, T. A. Gianoulis, J. Rozowsky, A. Agarwal, M. Snyder, M. Gerstein,

RSEQtools: A modular framework to analyze RNA-Seq data using compact, anonymized

data summaries. Bioinformatics 27, 281–283 (2011). doi:10.1093/bioinformatics/btq643

Medline

37. D. Prandi, S. C. Baca, A. Romanel, C. E. Barbieri, J.-M. Mosquera, J. Fontugne, H. Beltran,

A. Sboner, L. A. Garraway, M. A. Rubin, F. Demichelis, Unraveling the clonal hierarchy

of somatic genomic aberrations. Genome Biol. 15, 439 (2014). doi:10.1186/s13059-014-

0439-6 Medline

38. A. Magi, L. Tattini, I. Cifola, R. D’Aurizio, M. Benelli, E. Mangano, C. Battaglia, E. Bonora,

A. Kurg, M. Seri, P. Magini, B. Giusti, G. Romeo, T. Pippucci, G. De Bellis, R. Abbate,

G. F. Gensini, EXCAVATOR: Detecting copy number variants from whole-exome

sequencing data. Genome Biol. 14, R120 (2013). doi:10.1186/gb-2013-14-10-r120

Medline

39. A. Yates, W. Akanni, M. R. Amode, D. Barrell, K. Billis, D. Carvalho-Silva, C. Cummins, P.

Clapham, S. Fitzgerald, L. Gil, C. G. Girón, L. Gordon, T. Hourlier, S. E. Hunt, S. H.

Janacek, N. Johnson, T. Juettemann, S. Keenan, I. Lavidas, F. J. Martin, T. Maurel, W.

McLaren, D. N. Murphy, R. Nag, M. Nuhn, A. Parker, M. Patricio, M. Pignatelli, M.

Rahtz, H. S. Riat, D. Sheppard, K. Taylor, A. Thormann, A. Vullo, S. P. Wilder, A.

Zadissa, E. Birney, J. Harrow, M. Muffato, E. Perry, M. Ruffier, G. Spudich, S. J.

Trevanion, F. Cunningham, B. L. Aken, D. R. Zerbino, P. Flicek, Ensembl 2016. Nucleic

Acids Res. 44, D710–D716 (2016). doi:10.1093/nar/gkv1157 Medline