Transcript
Page 1: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

St. Cecilia Church 20th Sunday in Ordinary Time

August 16, 2020

“O woman, great is your faith! Let it be done for you as your wish.” And the woman’s daughter was healed from that hour.

Sunday Vigil 5:00pm (Saturday)

6:30am, 8:00am, 9:30am, 11:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

Page 2: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner

PASTOR EMERITUS Reverend Msgr. Francis X. Dreger

PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond

PRINCIPAL Sister Catherine Irene Masino , IHM

VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.

https://www.facebook.com/St-Cecilia-Church-Fox-Chase

Mass Schedule for Weekend ~ August 22 & 23 Saturday (Vigil) 5:00pm Celebrant: Fr. Bonner Lector: Ed Sharp 6:30am Celebrant: Fr. Lucas Lector: Paula Potts 8:00am Celebrant: Fr. Lucas Lector: Paula Potts 9:30am Celebrant: Fr. Bonner Lector: Rose Messina 11:00am Celebrant: Fr. Bonner Lector: Michelle Riccobono

Mass is live-streamed 9:30am on Sundays

Lectors play a key role in the celebration of Mass. A lector is a Minister of the Word who pro-claims God’s Word to the assem-

bled faith community. Liturgical proclamation of the Word is an awesome responsibility to which one is called and into which one is formed.

Being a lector is more than reading. This ministry in-volves studying, preparing and gaining an understand-ing of God’s Word that can be transferred to the assem-bly in a clear and understandable manner. The vital role of the lector is to communicate the depth and im-portance of the scriptures.

Anyone interested in joining this ministry for Sunday Masses, please contact Dave Schein by stopping in the Sacristy on the weekend or call 215-725-0903.

Page 3: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

#179 3

20th Sunday in Ordinary Time The Liturgy of the Word First Reading Book of prophet Isaiah 56:1,6-7 Thus says the LORD: Observe what is right, do what is just; for my salvation is about to come, my justice, about to be revealed. The foreigners who join themselves to the LORD, ministering to him, loving the name of the LORD, and becoming his servants—all who keep the sabbath free from profanation and hold to my covenant, them I will bring to my holy mountain and make joyful in my house of prayer; their burnt offerings and sacrifices will be acceptable on my altar, for my house shall be called a house of prayer for all peoples. The word of the Lord. Thanks be to God. Responsorial Psalm O God, let all the nations praise you! Second Reading Letter of St. Paul to the Romans 11:13-15,29-32

Brothers and sisters: I am speaking to you Gentiles. Inasmuch as I am the apostle to the Gentiles, I glory in my ministry in order to make my race jealous and thus save some of them. For if their re-jection is the reconciliation of the world, what will their ac-ceptance be but life from the dead? For the gifts and the call of God are irrevocable. Just as you once disobeyed God but have now received mercy because of their diso-bedience, so they have now disobeyed in order that, by virtue of the mercy shown to you, they too may now receive mercy. For God delivered all to disobedience, that he might have mercy upon all. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 15: 21-28

At that time, Jesus withdrew to the region of Tyre and Sidon. And behold, a Canaanite woman of that district came and called out, “Have pity on me, Lord, Son of David! My daughter is tor-mented by a demon.” But Jesus did not say a word in answer to her. Jesus’ disciples came and asked him, “Send her away, for she keeps calling out after us.” He said in reply, “I was sent only to the lost sheep of the house of Israel.” But the woman came and did Jesus homage, saying, “Lord, help me.” He said in reply, “It is not right to take the food of the children and throw it to the dogs.” She said, “Please, Lord, for even the dogs eat the scraps that fall from the table of their masters.” Then Jesus said to her in reply, “O woman, great is your faith! Let it be done for you as you wish.” And the woman’s daughter was healed from that hour. The Gospel of the Lord. Praise to you, Lord Jesus Christ.

FOCUS: God’s grace and mercy are promised to all.

The readings today wrestle with the questions of who is in and who is out. When it comes to God’s grace, who will receive it? We learn that all who

accept the gift of faith are incorporated into the cove-nant relationship with God. LITURGY OF THE WORD: The Lord speaks through Isaiah giving his promise that all who hold to his covenant will be brought to his holy mountain. In the second reading, Saint Paul tells the Gentiles that God delivered all to disobedience, that he might have mercy upon all. In the Gospel, a Canaanite woman asks Christ to have pity on her, for her daugh-ter is tormented by a demon. In spite of initial rejec-tion, the woman perseveres in faith and Jesus heals her daughter.

REFLECTION: The Canaanite (Gentile) woman comes to plead for her tormented daughter. Her hun-ger and need are great. She comes to Jesus, the source of nourishment and healing. She is considered an out-sider and not one of "the chosen." But she is focused on Jesus and will not be dissuaded. She represents each of us today hungry for the bread from the table and longing for God.

So, we ask ourselves:

Where and when in our lives have we experi-enced being an "outsider?"

Who offered us a welcome?

Shall we give thanks today for the welcome we received?

God bless our newly baptized

Griffin Matthew Ishler Fiona Jayde Callahan

Second Collection this weekend is taken up for the Catholic University of America in Washington, DC. Thank you for your financial support. We also take this opportunity to thank everyone who continues to support Saint Cecilia Parish. You generosity both in church and mailing in your envelopes is very much appreciated. May God bless you for your kindness and continued support.

6 feet apart of course

Page 4: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

#179 4

Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)

Pre-Cana Attending a Pre-Cana session is re-quired for all engaged couples preparing to celebrate the Sacrament of Matrimo-ny. Maternity BVM Parish, located at 9220 Old Bustleton Avenue (19115) will be holding their Fall Pre-Cana Day on Saturday, September 26, 2020. Advance registration is necessary. To register, please call the rectory at 215-673-8127.

PREP Volunteers We are in need of volunteer PREP teachers for online instruction for the 2020-2021 school year. At this moment, classes will take place online and not in the classroom. Teachers will be instructed how to do virtual classes. If you are interested in volunteering your time for this very important min-istry, please contact the rectory at 215-725-1240.

Meditate at Home A regular meditation practice can bring a host of spiritual, psychological and physical benefits to your life. Meditation isn’t just for monks and mys-tics – anyone can learn it! Christian meditation allows us to spend more quality time with God. It teaches us to control our thought-life and helps us maintain our mental health and emotional well-being.

6 Reasons to Meditate 1. Reduce Stress - Modern life brings a lot of

stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-

tion can reduce or eliminate the need for anti-depressant medications.

3. Lessen Emotional Reactivity - Meditation can help you make better choices by responding mindfully instead of reacting impulsively.

4. Increase Focus - Meditation keeps you on task amidst the thousands of distractions you face every day.

5. Improve Relationships - Meditation can lead to greater self-awareness, emotional intelligence, and acceptance of yourself and others.

6. Strengthen Compassion - Christian meditation allows us to spend more quality time with God. A regular meditation practice can help you become kinder and more caring toward others and the natural world.

PREP Parish Religious Education Program

Register NOW for 2020-2021 year Deadline ~ Friday, August 21, 2020

Classes for the moment will be online via Zoom beginning Sunday, September 13.

Call the rectory at 215-725-1240 to register for PREP. A completed form along with payment, baptismal certifi-cate or permission from Pastor of another parish are due to the rectory no later than August 21. COST: $75 (one child) $125 (two children) $175 (three or more children) Study books will be available for pick up on Saturday, August 29 at the PREP office from 9:30am to 12:00 noon. This is the only day you will be able to pick up your books.

The Scriptural Rosary (from A Mi-nute in the Church by Gus Lloyd) The Rosary is a deeply meditative prayer. Each mystery recalls an event in the life of Jesus or His Mother. A wonderful way to meditate more deeply on the mysteries is by reflecting on Scripture. This can be done with the Scriptural rosary.

Here’s how it works: before praying each Hail Mary that corresponds with the mystery upon which you are meditat-ing, you read or say a passage of Scripture. Each Scripture passage is short—usually just one or two verses or even part of a verse. Since there are ten Hail Marys for each mystery, you will read 10 passages of Scripture for each mystery.

The Scripture passages tell the story of the mystery and help to familiarize you even more with God’s written Word. As St. Jerome said, “Ignorance of Scripture is ignorance of Christ.” With the Scripture passages added, a Scriptural Rosary may take a few minutes longer to pray. Enjoy the extra time spent in prayer!

There are many great resources—pamphlets, books, web-sites, etc. available to help you pray the Scriptural Rosary. You’ll find that combining God’s Word with the rosary will be a powerful way to enhance and deepen your prayer life!

Page 5: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

#179 5

Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111

A Christ-Center Community Committed to Academic Excellence

Extra Curricular Activities Student Council Future Cities Team Forensics Mathletes Altar Servers Service Commission School Band/Strings Program CYO Sports Scouting Reading Olympics

Academics Religious Education Archdiocesan Elementary Curriculum Honors Math Science Lab Program Technology Music Education Physical Education/Health Fine Arts

Special Services CARES (after school program) CORA (Educational & Counseling Services) SHALOM Program NDS Program (we offer FREE break-fast and lunch for students) Catapult (Title 1 Reading, ELL, Family Counseling )

Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care

Register NOW for 2020-2021 215-725-8588 (Main Office) 215-725-2201 (Tuition Office)

Sponsor a Student (2020-2021) This program helps our families who want to send their children to Saint Cecilia School and may have some financial difficulty along the way. With your help these families can keep their child in our school and receive a good Catholic education.

There are several gifting levels and payment options - You can make a one time payment or select any option you wish. We will identify those students with the greatest need and allocate the funds accordingly. For more information on this program or to give a tax de-ductible gift, please feel free to contact Lisa Hnat, Tuition Coordinator at 215-725-2201 or email at [email protected].

Page 6: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

After

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

MASSES FOR THE WEEK OF August 17

MONDAY, August 17 6:30am – Thomas Wagner 8:30am – Patrick McGettigan

TUESDAY, August 18 6:30am – Catherine McGinley 8:30am – Caterina & Domenico Tomeo

WEDNESDAY, August 19 6:30am – Helen Xibos 8:30am – Ethel Raffay & Dorothy Laut

THURSDAY, August 20 6:30am – Francisco Xavier Le & Ane Phung 8:30am – Thomas J. Costello & Kathleen Costello Bockol

FRIDAY, August 21 6:30am – Thomas Rush 8:30am – Rosemarie McKinney

SATURDAY, August 22 8:30am – Peter Della Vecchia 5:00pm – Richard Eidmann

Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones

Let us pray for the souls of all the faithful departed, especially Carolyn Robinson

Page 7: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBS

CITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting. This describes the power of...

ve, supuuuu portive, refefefefefefefferrals, relationshipppps,,,, affordable, repeeee etitious, versatile, last

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Patronize the Adve isers who make this bulletin possible!

BUILD YOUR COMMUNITY!

Patt o i e the A

SHOP LOCAL

To advertise your business in this weekly bulletin,contact us at 1.800.333.3166

or visit us at www.jppc.net

Page 8: St. Cecilia ChurchAug 16, 2020  · Reduce Stress - Modern life brings a lot of stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-tion can reduce

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

THOMAS A. CUNNINGHAM, ESQ.Attorney At Law

AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE

109 Huntingdon Pike • Rockledge, PA 19046215-722-6230

Traveling Hair DresserServicing Men, Women & Children

Parishioner for 48 years

215-806-8187

Krissy Tamaro

Reichwein

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

A Heavenly Hair Salon215-379-1880

Angel Cuts

See You Soon!930 Fox Chase Road, Rockledge

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Advertise Your Business Here

800-333-3166 ext. 161www.jppc.net