FEMS Microbiology Letters 233 (2004) 107–113
www.fems-microbiology.org
PknH, a transmembrane Hank�s type serine/threonine kinasefrom Mycobacterium tuberculosis is differentially expressed
under stress conditions
Kirti Sharma a,b, Harish Chandra a, Pradeep K. Gupta a,b, Monika Pathak a,Azeet Narayan a, Laxman S. Meena a, Rochelle C.J. D�Souza a, Puneet Chopra a,
S. Ramachandran a, Yogendra Singh a,*
a Institute of Genomics and Integrative Biology, Mall Road, Near Jubilee Hall, Delhi 110 007, Indiab Dr. B.R. Ambedkar Centre for Biomedical Research, University of Delhi, Delhi, India
Received 13 October 2003; received in revised form 22 December 2003; accepted 27 January 2004
First published online 14 February 2004
Abstract
Serine/threonine protein kinases (STPKs) represent a burgeoning concept in prokaryotic signaling and have been implicated in a
range of control mechanisms. This paper describes the enzymatic and molecular characterization of PknH, a mycobacterial STPK.
After cloning and expression as a Glutathione-S-transferase fusion protein in E. coli, PknH was found to phosphorylate itself and
exogenous substrates like myelin basic protein and histone. The kinase activity of PknH was inhibited by the kinase inhibitors
staurosporine and H-7. The results confirmed that PknH is a transmembrane protein and is restricted to members of the Myco-
bacterium tuberculosis complex. In addition, transcriptional analysis of pknH in M. tuberculosis under various stress conditions
revealed that exposure to low pH and heat shock decreased the level of pknH transcription significantly. This is the first report
describing differential expression of a mycobacterial kinase in response to stress conditions which can indicate its ability to regulate
cellular events promoting bacterial adaptation to environmental change.
� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Ser/Thr kinase; Tuberculosis; Mycobacterium; Hank�s type; Stress; PknH
1. Introduction
Modification of proteins by phosphorylation, cata-
lyzed by protein kinases, is often used as a molecular
switch for translating extracellular signals into cellular
responses. The existence of numerous protein kinases
suggests a central role of protein phosphorylation in
regulating virtually every function in a living cell. Basedon sequence similarity and enzymatic specificity, protein
kinases can be grouped into two sub-families namely,
protein histidine kinases and protein serine/threonine or
* Corresponding author. Tel.: +91-11-2766-6156; fax: +91-11-2766-
7471.
E-mail addresses: [email protected], [email protected] (Y.
Singh).
0378-1097/$22.00 � 2004 Federation of European Microbiological Societies
doi:10.1016/j.femsle.2004.01.045
tyrosine kinases. Signal transduction systems in pro-
karyotes use histidine kinases, whereas phosphorylation
at serine, threonine or tyrosine residues was thought to be
limited to eukaryotes [1]. However, recent studies and
analysis of bacterial genome sequences now available
have demonstrated the presence of similar serine/threo-
nine protein kinases (STPKs) in prokaryotes as well [2–5].
All STPKs share the catalytic kinase domain which is250–300 amino acid residues long and contains 11 con-
served subdomains [6]. These STPKs have been found to
regulate stress responses, developmental processes and
pathogenicity in several micro-organisms [7,8].
Genome sequence data of Mycobacterium tuberculo-
sis have predicted the presence of 11 such eukaryotic-
like STPKs [9]. Although very little is known about their
cellular functions, these kinases are proposed to be
. Published by Elsevier B.V. All rights reserved.
108 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113
regulators of metabolic processes, including transcrip-
tion, cell division, and interaction with host cells
[8,12,14]. To date, six of these kinases (pknA, pknB,
pknD, pknE, pknF and pknG) have been biochemically
characterized [11–16].PknH is one of the 11 STPKs of M. tuberculosis.
Analysis of the promoter region of PknH has shown
that the transcription from the pknH promoter is spe-
cifically initiated by rA, the principal sigma factor of
mycobacteria [16]. This paper describes the enzymatic
and molecular characterization of PknH and shows that
it is a transmembrane protein. In addition, we also show
that this kinase is differentially expressed under certainstress conditions. These results indicate that PknH may
be important as a signaling molecule acting between the
external environment and bacterial adaptation to the
changed environment, especially acid or heat stress
during which the kinase is differentially expressed.
2. Materials and methods
2.1. Bacterial culture and growth conditions
Mycobacterial strains (M. tuberculosis Erdman, M.
tuberculosis H37Rv, M. tuberculosis H37Ra, M. bovis
BCG and M. smegmatis, obtained from Dr. J.S. Tyagi,
AIIMS, New Delhi, M. avium ATCC 25291, M. fortui-
tum ATCC 6841) were grown in Middlebrook 7H9broth supplemented with 0.5% glycerol and 10% ADC
at 37 �C with shaking at 220 rpm for 3–4 weeks.
2.2. Plasmid construction and mutagenesis
M. tuberculosis genomic DNA was used as template
for amplification of the gene coding for PknH
(Rv1266c). The pknH gene was amplified in two frag-
ments using primers: 50GAGGATCAGCGCTCGA
GTATGAGCGAC carrying XhoI site at the 50 end
(forward primer) and 50CCGAATGCGGCGGCCGCT
CATTCCTTGTT carrying an NotI site at the 30 end(reverse primer). Internal primers were 50TCCAGCC
GGCACCAAAGCCGTCCTACA and 50TGTAGGAC
GGCTTTGGTGCCG GCTGGA. The amplified frag-
ment was digested with XhoI and NotI and ligated to
XhoI–NotI digested pGEX-5X-3 plasmid (Amersham-
Pharmacia Biotech, India). The resulting plasmid car-
rying pknH was designated as pGEX-pknH.
To create a substitution of methionine for lysine atcodon 45 of pknH, the oligonucleotide used was: 50CAC
CGCGACGTCATGCCGCAAAACATT (underlined
bases mark the mutation from lysine to methionine) [13]
and the resulting plasmid was designated as pGEX-
pknH-K45M. The sequences of clones were confirmed
by DNA sequencing using an Automated Sequence
Analyzer (ABI, Model 3100).
2.3. Expression and purification of proteins
The proteins, GST-PknH and GST-PknH-K45M,
were affinity purified using glutathione–Sepharose-4B
resin as described earlier [13]. In brief, the transformantswere grown at 37 �C under shaking until the A600
reached 0.6 and induced with IPTG for varying time
intervals. Purified PknH was used to raise polyclonal
anti-PknH antibody in a rabbit.
2.4. Kinase activity of PknH
The kinase activity of purified PknH was determinedby in vitro protein kinase assays [13]. The kinase reac-
tions routinely contained 500 ng of the enzyme in the
kinase buffer (25 mM Tris/HCl, pH 7.4, 10 mM MgCl2,
1 mM DTT) with 10 lg of each substrate and 2 lCi of[c-32P]ATP (BRIT, Hyderabad, India) and incubated
for 30 min at 37 �C. The reactions were stopped by
addition of SDS sample buffer, and proteins were sep-
arated by 10% SDS–PAGE (autophosphorylation as-say) or 15% SDS–PAGE (substrate phosphorylation),
electroblotted onto nitrocellulose membranes and visu-
alized by autoradiography.
Phosphoamino acid residues of autophosphorylated
PknH and histone phosphorylated by PknH were ana-
lyzed by immunoblotting using monoclonal antibodies
against phosphoserine, phosphothreonine and phos-
photyrosine (Sigma).
2.5. Transcriptional analysis of pknH in M. tuberculosis
in response to various stress conditions
The expression of pknH during various stress condi-
tions in M. tuberculosis was examined by RT-PCR. The
cultures were grown as described and RNA was isolated
using the RNeasy Mini Kit (Qiagen, Hilden, Germany).
Various stress conditions used to examine pknH ex-
pression included exposure to oxidative stress (10 mM
H2O2), nutrient deprivation (incubation in PBS), acid
stress (7H9 medium adjusted to a pH of 4.5), heat shock(incubation at 42 �C), and hypoxia. For hypoxia studies,
cultures were grown to an OD600 of 0.5 and inoculated
into 10 ml media in 15 ml Corning Polystyrene tubes
and incubated for 15 days at 37 �C without shaking and
correspondingly, a control culture was grown with
shaking at 220 rpm. Another set of control cultures
contained methylene blue (1.5 lg ml�1) to monitor the
depletion of oxygen. For other stress conditions, earlylogarithmic phase cultures were exposed to the indicated
conditions for 4 h prior to RNA extraction. RNA
samples that yielded an equivalent degree of amplifica-
tion of 23S rRNA transcripts were used in RT-PCR.
The analysis was carried out with the number of cycles
at which the band intensity increased linearly with
the amount of mRNA used. The amplimers used for
Fig. 1. Schematic presentation of the main structural components of
PknH. The positions of different domains and the topology of the
PknH protein are shown. TM refers to the transmembrane region and
Pro-rich indicates the proline-rich region.
K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 109
detecting pknH transcripts were; 50AGCGCCGGCA
CACTGGT (forward primer) and 50GGGTTG
GTTTTGCGCGGGGTCTG (reverse primer). The
amplification products were electrophoresed on a 1.5%
agarose gel and visualized by ethidium bromide staining.Negative control reactions with RNA without Reverse
Transcriptase (to rule out DNA contamination) or
without RNA but with Reverse Transcriptase were also
included (data not shown).
2.6. Localization of PknH in mycobacterial cells
Equal amount of protein from cell membrane, cyto-plasmic fraction ofM. tuberculosisH37Rv and whole cell
lysates from M. smegmatis, M. tuberculosis H37Rv and
M. tuberculosis H37Ra were prepared [17] and separated
by 10% SDS–PAGE. The proteins were electroblotted
onto a nitrocellulose membrane and incubated with
polyclonal antibodies raised against PknH. The mem-
branes were developed using an Enhanced Chemilumi-
nescence kit according to the manufacturer�sinstructions.
2.7. Analysis of prevalence of pknH in other mycobacte-rial strains
The prevalence of pknH homologues in various my-
cobacterial species was examined by Southern blot
analysis as described earlier [13]. Genomic DNA (1 lgeach) from M. tuberculosis H37Rv, M. tuberculosis
H37Ra, M. bovis BCG, M. avium, M. smegmatis LR222,
and M. fortuitum were digested with restriction enzyme
(NotI) and separated by electrophoresis on a 1% agarose
gel at 25–30 V for 16 h. The DNA fragments were
transferred onto Hybond-N membrane (Amersham),
crosslinked by UV irradiation, and hybridized with a32P-labeled fragment containing the complete codingregion of pknH, in 50% formamide at 42 �C for 16 h.
Blots were washed once with 2� SSC, 0.1% SDS at
room temperature for 30 min followed by two washes
with 0.1� SSC, 0.5% SDS at 65 �C for 30 min and vi-
sualized by autoradiography.
Fig. 2. Overexpression and purification of wild-type GST-PknH and its
active-site-mutant GST-PknH-K45M. E. coli cells harboring pGEX-
pknH or pGEX-pknH-K45M were grown in LB medium and induced
with 1 mM IPTG for different time intervals. Total lysates of E. coli
expressing fusion proteins were purified to homogeneity using GST
beads. Protein samples at various stages of purification were subjected
to 10% SDS–PAGE and visualized by Coomassie staining. Lane 2,
uninduced cell lysate; lane 3, cell lysate after 4 h of IPTG induction ;
lane 4, cell lysate after 30 min of IPTG induction; lane 5, GST-PknH;
lane 6, GST-PknH-K45M; lane 1, molecular weight markers were run
in parallel and the size of marker proteins is indicated.
3. Results
3.1. In silico analysis
The pknH gene encodes a protein of 626 amino acids
with a predicted pI of 6.3. The PknH protein sequence
possesses the protein kinase �signature�, including all 11
subdomains that are conserved throughout the family
[7,8]. These sub-domains of PknH, which are present inall protein kinases, are located in the N-terminal 300
amino acids. Sequence alignment of this 300 amino acid
region using BLAST (NCBI) showed significantly high
scores with other known eukaryotic as well as pro-
karyotic Ser/Thr protein kinases. The rest of the se-
quence, however, showed no significant homology with
any other known protein sequence, indicating that
conservation of kinase domains is related to the mech-anism of phosphorylation.
Interestingly, unlike other mycobacterial STPKs,
PknH has a proline-rich region between residues 297
and 403, in a segment adjacent to the catalytic domain
as determined by analysis programs: Scan Prosite
(http://www.expasy.org/cgi-bin/scanprosite) and MO-
TIF (http://www.motif.genome.ad.jp) (Fig. 1). This re-
gion of 107 amino acid residues contains 38 proline
110 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113
residues, with a very high density in the region ranging
from position 297 to 327.
The topology of this membrane spanning protein, as
predicted using various topology prediction programs
like TMHMM, HMMTOP etc, is �N-terminus intracel-lular and C-terminus extracellular� (Fig. 1).
3.2. Expression and purification of PknH
PknH was purified as a GST-fusion protein using
glutathione–Sepharose-4B beads. To characterize the
kinase activity of PknH, a mutant of this kinase, pGEX-
pknH-K45M, was also engineered by site-directed mu-
Fig. 3. Protein kinase activity of PknH. (a) Autophosphorylation of Pkn
[c-32P]ATP as described in Section 2. The proteins were separated by 10%
staining. The left panel shows Coomassie blue staining and the right pane
marker; lane 2, GST-PknH; lane 3, GST-PknH-K45M. (b) Phosphorylation
formed to examine the ability of PknH to phosphorylate exogenous kinase
electrophoresed (left half: Coomassie blue staining) and autoradiographed (
GST-PknH-K45M; lane 5, GST-PknH with MBP; lane 6, GST-PknH with hi
with histone. (c) Effect of Mg2þ ion on the Histone phosphorylation by Pkn
concentrations of MgCl2. The labeled proteins were separated by SDS–PAG
labeling (lower panel). (d) Effect of kinase inhibitors. GST-PknH was preinc
sporine, or 0.1/1/10 lM of H-7 and used for phosphorylation of histone. (e
kinase assay was performed by incubating PknH and histone with [c-32P]ATP
on a 15% SDS–PAGE. The amino acids phosphorylated by PknH were d
phosphothreonine, phosphoserine and phosphotyrosine residues. (In each pa
half is the corresponding autoradiogram.)
tagenesis and subsequently purified using the same
strategy.
Gel electrophoretic analysis of the purified proteins,
GST-PknH and GST-PknH-K45M, revealed the pres-
ence of a band of 97 kDa (Fig. 2, lanes 5 and 6) in ac-cordance with the predicted size of GST-PknH fusion
protein (68 kDa for the PknH protein and 29 kDa for
the attached N-terminal GST protein). Interestingly,
another band of approximately 75 kDa was also ob-
served after 4 h induction by IPTG. On Western blot
analysis this 75 kDa band was also recognized by the
monoclonal anti-GST antibodies (data not shown). A
decreased induction period (30 min, after addition ofIPTG), however, yielded only full-length 97 kDa protein
H. Purified GST-PknH and GST-PknH-K45M were incubated with
SDS–PAGE and visualized by autoradiography or Coomassie blue
l shows the corresponding autoradiogram. Lane 1, molecular weight
of exogenous substrates by PknH. An in vitro kinase assay was per-
substrates in the presence of [c-32P]ATP. The labeled proteins were
right half). Lane 1, MBP; lane 2, histone ; lane 3, GST-PknH; lane 4,
stone; lane 7, GST-PknH-K45M with MBP; lane 8, GST-PknH-K45M
H. In vitro kinase assays were performed in the presence of indicated
E and visualized by Coomassie blue staining (upper panel) or c-32P-ubated for 30 min at room temperature with 1/10/100 lM of Stauro-
) Identification of the amino acids phosphorylated by PknH. In vitro
in kinase assay buffer. After 30 min incubation, samples were separated
etected by immunoblot analysis with monoclonal antibodies against
nel, the left half is the Coomassie stained SDS–PAGE gel and the right
Fig. 4. Gene expression analysis of M. tuberculosis pknH gene in re-
sponse to various stress conditions. RT-PCR analysis using primers
specific for pknH was performed on total RNA samples isolated from
M. tuberculosis cultures exposed to the indicated stress conditions. 23S
rRNA was used as an internal control. The results were confirmed by
three independent experiments.
Fig. 5. Expression and localization of PknH in mycobacteria. Immu-
noblot analysis of various cellular fractions of M. tuberculosis H37Rv,
M. tuberculosis H37Ra and M. smegmatis using polyclonal antisera
against PknH. The blots were developed by ECL reagents. Lane 1,
cytoplasmic fraction (M. tuberculosis H37Rv); lane 2, cell membrane
fraction (M. tuberculosis H37Rv); lane 3, whole cell lysate from M.
tuberculosis H37Rv; lane 4, whole cell lysate from M. tuberculosis
H37Ra; lane 5, whole cell lysate fromM. smegmatis; lane 6, GST-PknH
(as positive control).
K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 111
which was used in all subsequent experiments (Fig. 2,
lanes 2–4).
3.3. Protein kinase activity of PknH
The kinase activity of PknH was examined by incu-
bating purified GST-PknH or GST-PknH-K45M with
[c-32P]. After incubation, the reaction products were
separated on a 10% SDS–PAGE gel (autophosphory-
lation assay) or 15% SDS–PAGE gel (substrate phos-
phorylation), and autoradiographed. GST-PknH
phosphorylated itself whereas the GST-PknH-K45M
mutant did not exhibit such activity (Fig. 3a). Moreover,unlike GST-PknH-K45M mutant, GST-PknH phos-
phorylated exogenous substrates like MBP and histone
demonstrating the importance of conserved lysine resi-
due in the catalytic domain (Fig. 3b).
The kinase activity of PknH was found to be divalent
ion dependent as no phosphorylation was detected in the
absence of divalent ions and maximal kinase activity was
obtained in the presence of 10 mM Mg2þ (Fig. 3c).Phosphorylation of PknH occurred only in presence of
Mg2þ or Mn2þ as similar concentrations of other cations
failed to substitute for Mn2þ/Mg2þ (data not shown).
The effect of two protein kinase inhibitors, stauro-
sporine and H-7 [11,18], was examined on in vitro pro-
tein phosphorylation. Pre-incubation of these inhibitors
with the GST-PknH inhibited its kinase activity in a
dose-dependent manner with complete inhibition of ki-nase activity in the presence of 0.1 mM staurosporine or
10 lM H-7 (Fig. 3d).
The nature of amino acid residues phosphorylated
by PknH was examined by Western blotting using
monoclonal antibodies against phosphoserine, phos-
phothreonine and phosphotyrosine. Monoclonal anti-
phosphoserine and anti-phosphothreonine antibodies
recognized PknH (autophosphorylated) and histonephosphorylated by PknH whereas, these were not de-
tected by anti-phosphotyrosine antibody. Thus, PknH is
a STPK which phosphorylates itself and histone at serine
and threonine residues (Fig. 3e).
3.4. Transcriptional analysis of pknH in M. tuberculosis
in response to various stress conditions
To examine whether pknH is involved in stress-med-
iated signaling in M. tuberculosis, the expression of
pknH was studied in response to a variety of stress
conditions. RNA samples extracted from exponentially
growing cultures and those adapted to various stress
conditions were evaluated for gene expression. As
shown (Fig. 4), exposure to low pH and incubation at 42
�C decreased the level of pknH transcription to a sig-nificant extent. On the contrary, oxidative stress, nutri-
ent deprivation and hypoxia had no effect on the
transcription levels of pknH.
3.5. Localization of PknH in mycobacterial cells
The hydropathy profile of PknH revealed the presence
of a unique short hydrophobic domain, located between
amino acids L404 and I426, suggesting that it could corre-
spond to a transmembrane region anchoring PknH to the
membrane (Fig. 1). PknH antisera were used for the lo-
calization of PknH amongst different cellular fractions ofM. tuberculosis H37Rv. PknH was also observed as a 68
kDa protein predominantly in the cell membrane fraction
but a faint signal was also observed in the cytoplasmic
fraction (Fig. 5, lanes 1 and 2). These results suggested
that PknH is a transmembrane protein predominantly
localized in the cell envelope of M. tuberculosis H37Rv.
PknH was also detected in the whole cell lysates of M.
tuberculosisH37Rv andM. tuberculosisH37Ra, but not inthose of M. smegmatis. (Fig. 5, lanes 3–5)
3.6. Analysis of prevalence of pknH in other mycobacte-rial strains
Blast search against the unfinished genome sequence
of M. smegmatis (http://tigrblast.tigr.org/ufmg/index.
cgi?database¼msmegmatisŒseq) revealed the presence
Fig. 6. Presence of pknH in other mycobacterial strains. Genomic
DNA samples from mycobacterial species were digested with NotI,
separated on agarose gels and transferred to nitrocellulose membrane
as described in Section 2. Hybridization was performed with 32P-ra-
diolabeled pknH probe and autoradiography. Lane 1, M. tuberculosis
H37Rv; lane 2, M. tuberculosis H37Ra; lane 3, M. bovis BCG; lane 4,
M. avium; lane 5, M. smegmatis LR222; and lane 6, M. fortuitium.
112 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113
of a sequence with significant homology in the N-
terminus kinase domain but not in the C-terminus re-
gion. However, Southern analysis demonstrated that
gene homologous to pknH was absent in the saprophytic
fast growing M. smegmatis and M. fortuitum and pres-
ent in all the members of the M. tuberculosis complex
analyzed in this study (Fig. 6).
4. Discussion
Phosphorylation and dephosphorylation, catalyzed
by protein kinases and protein phosphatases, can alter
the function of a protein in almost every conceivable
way; for example, by stabilizing it or marking it for
destruction, by increasing or decreasing its biologicalactivity, or by initiating or terminating protein–protein
interactions. Based on the demonstrated importance
of protein phosphorylation, the prokaryotic STPKs
have been implicated in regulation of develop-
ment, response to stress conditions and pathogenicity
[8,19].
The occurrence of phosphorylated proteins [20] and
functional STPKs [11] was illustrated before release ofthe complete genome of M. tuberculosis. From the ge-
nome sequence the presence of 11 STPKs was predicted
[8] and a recent study based on bioinformatic analysis
predicts that most of these STPKs are essential for
survival of M. tuberculosis inside the host cell [21]. Six of
these kinases have been characterized biochemically [10–
15]. Here, we report the cloning, expression and char-
acterization of pknH gene, a mycobacterial STPK. Invitro kinase assays demonstrated that pknH encodes a
functional STPK. The purified PknH phosphorylates
itself by an autocatalytic mechanism and is capable of
phosphorylating exogenous substrates (Figs. 3a and b).
PknH was sensitive to kinase inhibitors like stauro-
sporine and H-7, both of which impeded the kinase
activity in a dose-dependent manner (Fig. 3d). All my-
cobacterial STPKs other than PknI, possess a lysine inthe ATP-binding site, which is characteristic of this
family of kinases [8]. The mutation of this highly con-
served lysine residue to methionine abrogated the kinase
activity of PknH (Figs. 3a and b).
In silico analysis of the polypeptide sequence of PknH
illustrated that immediately adjacent to the catalytic
domain is a proline-rich sequence (Fig. 1) which may
simply function as a ‘‘linker’’ sequence between the N-
terminal catalytic domain and the C-terminal domain.Alternatively, this region may play a role in the binding
of PknH to other proteins, such as substrates, regula-
tors, or cofactors [22].
In addition, the bioinformatic analysis also suggested
that PknH is a transmembrane protein with a predicted
topology of �N-in, C-out�. It was reported earlier that the
environment sensing kinases are generally transmem-
brane and their extracellular C-terminus senses the sig-nal and the intracellular N-terminus carrying the kinase
domain transduces this signal into the cellular response
thereby facilitating adaptation to the prevailing condi-
tions [5,8,23,24]. The localization of PknH was analyzed
by immunoblot analysis of different subcellular fractions
and it was confirmed that PknH is a transmembrane
protein (Fig. 5). The topology prediction for PknH was
supported by the appearance of 97 and 75 kDa fusionproteins (Fig. 2). The cleaved off 22 kDa region of 97
kDa fusion protein is equivalent to the predicted size of
the C-terminal region of PknH which is extracellular
and cleaved by the extracellular proteases. This is in
consensus with similar observations made for PknD and
PknE, other mycobacterial STPKs [11,15]. However,
further experimental validation is required to confirm
these topology predictions. In addition, the Southernblot analysis revealed the presence of pknH homologues
in members of the M. tuberculosis complex analyzed in
this study, but they were absent in the saprophytic fast-
growing M. smegmatis and M. fortuitum (Fig. 6). This
observation was further confirmed by Western blot
analysis in which PknH was detected in the whole cell
lysates of pathogenic mycobacterial species but not in
those of M. smegmatis (Fig. 5).A number of kinases have been shown to play a role
in stress-mediated signaling in eukaryotes as well as
prokaryotes [25,26]. For pathogens, such environmental
sensing apparatus is fundamental for their intracellular
survival. To examine whether pknH is involved in stress-
mediated signaling in M. tuberculosis, its expression was
studied in response to a variety of stress conditions. In
particular, acidic and heat stress decreased the level ofpknH transcription to a significant extent whereas other
stress conditions like hypoxia, oxidative stress and nu-
trient deprivation had no effect on the transcription
levels of pknH (Fig. 4). These observations in the
pathogenic M. tuberculosis H37Rv are in consensus with
previous studies done with the pknH promoter using
Gfp transcriptional fusion assays in M. smegmatis [27].
Differential expression during stress conditions,transmembrane localization and its absence in non-
pathogenic strains suggest possible roles of PknH in
processes that are unique to the pathogenic strains and
K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 113
their environmental sensing mechanisms. More experi-
mental evidences will be necessary to confirm that PknH,
like other STPKs, acts as a protein receptor sensing en-
vironmental signals, especially the acidic or heat stress,
enabling bacterial adaptation to the changed environ-ment. �Knock out� studies, further functional character-ization and identification of the downstream substrates of
PknH are in progress, all of which might provide in-
triguing insights into the fundamental question as to the
significance of PknH in M. tuberculosis and add to our
understanding of mycobacterial pathogenicity.
Acknowledgements
Financial support for the project was provided by
NMITLI, Council of Scientific and Industrial Research
(CSIR). Rochelle was recipient of Rajiv Gandhi Science
Talent Research Fellowship.
References
[1] Krebs, E.G. and Fischer, E.H. (1989) The phosphorylase b to a
converting enzyme of rabbit skeletal muscle, 1956. Biochim.
Biophys. Acta 1000, 302–309.
[2] Matsumoto, A., Hong, S.K., Ishizuka, H., Horinouchi, S. and
Beppu, T. (1994) Phosphorylation of the AfsR protein involved in
secondary metabolism in Streptomyces species by a eukaryotic-
type protein kinase. Gene 146, 47–56.
[3] Han, G. and Zhang, C.C. (2001) On the origin of Ser/Thr kinases
in a prokaryote. FEMS Microbiol Lett. 200, 79–84.
[4] Madec, E., Laszkiewicz, A., Iwanicki, A., Obuchowski, M. and
Seror, S. (2002) Characterization of a membrane-linked Ser/Thr
protein kinase in Bacillus subtilis, implicated in developmental
processes. Mol. Microbiol. 46, 571–586.
[5] Inouye, S., Jain, R., Ueki, T., Nariya, H., Xu, C.Y., Hsu, M.Y.,
Fernandez-Luque, B.A., Munoz-Dorado, J., Farez-Vidal, E. and
Inouye, M. (2000) A large family of eukaryotic-like protein Ser/
Thr kinases of Myxococcus xanthus, a developmental bacterium.
Microb. Comp. Genomics 5, 103–120.
[6] Hanks, S. and Quinn, A.M. (1991) Protein kinase catalytic
domain sequence database: identification of conserved features of
primary structure and classification of family members. Methods
Enzymol. 200, 38–62.
[7] Bakal, C.J. and Davies, J.E. (2000) No longer an exclusive club:
eukaryotic signalling domains in bacteria. Trends Cell Biol. 10,
32–38.
[8] Av-Gay, Y. and Everett, M. (2000) The eukaryotic-like Ser/Thr
protein kinases of Mycobacterium tuberculosis. Trends Microbiol.
8, 238–244.
[9] Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C.,
Harris, D., Gordon, S.V., Eiglmeier, K., Gas, S., Barry III, C.E.,
Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth,
T., Connor, R., Davies, R., Devlin, K., Feltwell, T.S., Gentles, N.,
Hamlin, S., Holroyd, T., Hornsby, K., Jagels, Krogh, A., Mclean,
J., Moule, J., Murphy, L., Oliver, K., Osborne, J., Quail, M.A.,
Rajandream, M.A., Rogers, J., Rutter, S., Seeger, K., Skelton, J.,
Squares, R., Squares, S., Sulston, J.E., Taylor, K., Whitehead, S.
and Barrell, B.G. (1998) Deciphering the biology of Mycobacte-
rium tuberculosis from the complete genome sequence. Nature 393,
537–544.
[10] Young, T.A., Delagoutte, B., Endrizzi, J.A., Falick, A.M. and
Alber, T. (2003) Structure of Mycobacterium tuberculosis PknB
supports a universal activation mechanism for Ser/Thr protein
kinases. Nat. Struct. Biol. 10, 168–174.
[11] Peirs, P., De Wit, L., Braibant, M., Huygen, K. and Content, J.
(1997) A serine/threonine protein kinase from Mycobacterium
tuberculosis. Eur. J. Biochem. 244, 604–612.
[12] Av-Gay, Y., Jamil, S. and Drews, S.J. (1999) Expression and
characterization of the Mycobacterium tuberculosis
serine/threonine protein kinase PknB. Infect. Immun. 67, 5676–
5682.
[13] Koul, A., Choidas, A., Tyagi, A.K., Drlica, K., Singh, Y. and
Ullrich, A. (2001) Serine/threonine protein kinases PknF and
PknG of Mycobacterium tuberculosis: characterization and local-
ization. Microbiology 147, 2307–2314.
[14] Chaba, R., Raje, M. and Chakraborti, P.K. (2002) Evidence that a
eukaryotic-type serine/threonine protein kinase from Mycobacte-
rium tuberculosis regulates morphological changes associated with
cell division. Eur. J. Biochem. 269, 1078–1085.
[15] Molle, V., Girard-Blanc, C., Kremer, L., Doublet, P., Cozzone,
A.J. and Prost, J.F. (2003) Protein PknE, a novel transmembrane
eukaryotic-like serine/threonine kinase from Mycobacterium tu-
berculosis. Biochem. Biophys. Res. Commun. 308, 820–825.
[16] Agarwal, N. and Tyagi, A.K. (2003) Role of 50-TGN-30 motif in
the interaction of mycobacterial RNA polymerase with a pro-
moter of �extended -10� class. FEMS Microbiol. Lett. 225,
75–83.
[17] Dahl, J.L., Wei, J., Moulder, J.W., Laal, S. and Friedman, R.L.
(2001) Subcellular localization of the intracellular survival-en-
hancing Eis protein ofMycobacterium tuberculosis. Infect. Immun.
69, 4295–4302.
[18] Drews, S.J., Hung, F. and Av-Gay, Y. (2001) A protein kinase
inhibitor as an antimycobacterial agent. FEMS Microbiol Lett.
205, 369–374.
[19] Hakansson, S., Galyov, E.E., Rosqvist, R. and Wolf-Watz, H.
(1996) The Yersinia YpkA Ser/Thr kinase is translocated and
subsequently targeted to the inner surface of the HeLa cell plasma
membrane. Mol. Microbiol. 20, 593–603.
[20] Chow, K., Ng, D., Strokes, R. and Johnson, P. (1994) Protein
tyrosine phosphorylation in Mycobacterium smegmatis. FEMS
Microbiol. Lett. 124, 203–208.
[21] Lamichhane, G., Zignol, M., Blades, N.J., Geiman, D.E.,
Dougherty, A., Grosset, J., Broman, K.W. and Bishai, W.R.
(2003) A postgenomic method for predicting essential genes at
subsaturation levels of mutagenesis: application toMycobacterium
tuberculosis. Proc. Natl. Acad. Sci. U S A 100, 7213–7218.
[22] Williamson, M.P. (1994) The structure and function of proline-
rich regions in proteins. Biochem. J. 297, 249–260.
[23] Nadvornik, R., Vomastek, T., Janecek, J., Technikova, Z. and
Branny, P. (1999) Pkg2, a novel transmembrane protein Ser/Thr
kinase of Streptomyces granaticolor. J. Bacteriol. 181,
15–23.
[24] Umeyama, T., Lee, P.C. and Horinouchi, S. (2002) Protein serine/
threonine kinases in signal transduction for secondary metabolism
and morphogenesis in Streptomyces. Appl. Microbiol. Biotechnol.
59, 419–425.
[25] Kang, C.M., Brody, M.S., Akbar, S., Yang, X. and Price, C.W.
(1996) Homologous pairs of regulatory proteins control activity of
Bacillus subtilis transcription factor rB in response to environ-
mental stress. J. Bacteriol. 178, 3846–3853.
[26] Iordanov, M.S. and Magun, B.E. (1999) Different mechanisms of
c-Jun NH(2)-terminal kinase-1 (JNK1) activation by ultraviolet-B
radiation and by oxidative stressors. J. Biol. Chem. 274, 25801–
25806.
[27] Cowley, S.C. and Av-Gay, Y. (2001) Promoter activity and
protein localization in Mycobacterium spp. using green fluorescent
protein. Gene 264, 225–231.