FEMS Microbiology Letters 233 (2004) 107–113

www.fems-microbiology.org

PknH, a transmembrane Hank�s type serine/threonine kinasefrom Mycobacterium tuberculosis is differentially expressed

under stress conditions

Kirti Sharma a,b, Harish Chandra a, Pradeep K. Gupta a,b, Monika Pathak a,Azeet Narayan a, Laxman S. Meena a, Rochelle C.J. D�Souza a, Puneet Chopra a,

S. Ramachandran a, Yogendra Singh a,*

a Institute of Genomics and Integrative Biology, Mall Road, Near Jubilee Hall, Delhi 110 007, Indiab Dr. B.R. Ambedkar Centre for Biomedical Research, University of Delhi, Delhi, India

Received 13 October 2003; received in revised form 22 December 2003; accepted 27 January 2004

First published online 14 February 2004

Abstract

Serine/threonine protein kinases (STPKs) represent a burgeoning concept in prokaryotic signaling and have been implicated in a

range of control mechanisms. This paper describes the enzymatic and molecular characterization of PknH, a mycobacterial STPK.

After cloning and expression as a Glutathione-S-transferase fusion protein in E. coli, PknH was found to phosphorylate itself and

exogenous substrates like myelin basic protein and histone. The kinase activity of PknH was inhibited by the kinase inhibitors

staurosporine and H-7. The results confirmed that PknH is a transmembrane protein and is restricted to members of the Myco-

bacterium tuberculosis complex. In addition, transcriptional analysis of pknH in M. tuberculosis under various stress conditions

revealed that exposure to low pH and heat shock decreased the level of pknH transcription significantly. This is the first report

describing differential expression of a mycobacterial kinase in response to stress conditions which can indicate its ability to regulate

cellular events promoting bacterial adaptation to environmental change.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Ser/Thr kinase; Tuberculosis; Mycobacterium; Hank�s type; Stress; PknH

1. Introduction

Modification of proteins by phosphorylation, cata-

lyzed by protein kinases, is often used as a molecular

switch for translating extracellular signals into cellular

responses. The existence of numerous protein kinases

suggests a central role of protein phosphorylation in

regulating virtually every function in a living cell. Basedon sequence similarity and enzymatic specificity, protein

kinases can be grouped into two sub-families namely,

protein histidine kinases and protein serine/threonine or

* Corresponding author. Tel.: +91-11-2766-6156; fax: +91-11-2766-

7471.

E-mail addresses: ysingh@igib.res.in, ysingh30@hotmail.com (Y.

Singh).

0378-1097/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2004.01.045

tyrosine kinases. Signal transduction systems in pro-

karyotes use histidine kinases, whereas phosphorylation

at serine, threonine or tyrosine residues was thought to be

limited to eukaryotes [1]. However, recent studies and

analysis of bacterial genome sequences now available

have demonstrated the presence of similar serine/threo-

nine protein kinases (STPKs) in prokaryotes as well [2–5].

All STPKs share the catalytic kinase domain which is250–300 amino acid residues long and contains 11 con-

served subdomains [6]. These STPKs have been found to

regulate stress responses, developmental processes and

pathogenicity in several micro-organisms [7,8].

Genome sequence data of Mycobacterium tuberculo-

sis have predicted the presence of 11 such eukaryotic-

like STPKs [9]. Although very little is known about their

cellular functions, these kinases are proposed to be

. Published by Elsevier B.V. All rights reserved.

108 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113

regulators of metabolic processes, including transcrip-

tion, cell division, and interaction with host cells

[8,12,14]. To date, six of these kinases (pknA, pknB,

pknD, pknE, pknF and pknG) have been biochemically

characterized [11–16].PknH is one of the 11 STPKs of M. tuberculosis.

Analysis of the promoter region of PknH has shown

that the transcription from the pknH promoter is spe-

cifically initiated by rA, the principal sigma factor of

mycobacteria [16]. This paper describes the enzymatic

and molecular characterization of PknH and shows that

it is a transmembrane protein. In addition, we also show

that this kinase is differentially expressed under certainstress conditions. These results indicate that PknH may

be important as a signaling molecule acting between the

external environment and bacterial adaptation to the

changed environment, especially acid or heat stress

during which the kinase is differentially expressed.

2. Materials and methods

2.1. Bacterial culture and growth conditions

Mycobacterial strains (M. tuberculosis Erdman, M.

tuberculosis H37Rv, M. tuberculosis H37Ra, M. bovis

BCG and M. smegmatis, obtained from Dr. J.S. Tyagi,

AIIMS, New Delhi, M. avium ATCC 25291, M. fortui-

tum ATCC 6841) were grown in Middlebrook 7H9broth supplemented with 0.5% glycerol and 10% ADC

at 37 �C with shaking at 220 rpm for 3–4 weeks.

2.2. Plasmid construction and mutagenesis

M. tuberculosis genomic DNA was used as template

for amplification of the gene coding for PknH

(Rv1266c). The pknH gene was amplified in two frag-

ments using primers: 50GAGGATCAGCGCTCGA

GTATGAGCGAC carrying XhoI site at the 50 end

(forward primer) and 50CCGAATGCGGCGGCCGCT

CATTCCTTGTT carrying an NotI site at the 30 end(reverse primer). Internal primers were 50TCCAGCC

GGCACCAAAGCCGTCCTACA and 50TGTAGGAC

GGCTTTGGTGCCG GCTGGA. The amplified frag-

ment was digested with XhoI and NotI and ligated to

XhoI–NotI digested pGEX-5X-3 plasmid (Amersham-

Pharmacia Biotech, India). The resulting plasmid car-

rying pknH was designated as pGEX-pknH.

To create a substitution of methionine for lysine atcodon 45 of pknH, the oligonucleotide used was: 50CAC

CGCGACGTCATGCCGCAAAACATT (underlined

bases mark the mutation from lysine to methionine) [13]

and the resulting plasmid was designated as pGEX-

pknH-K45M. The sequences of clones were confirmed

by DNA sequencing using an Automated Sequence

Analyzer (ABI, Model 3100).

2.3. Expression and purification of proteins

The proteins, GST-PknH and GST-PknH-K45M,

were affinity purified using glutathione–Sepharose-4B

resin as described earlier [13]. In brief, the transformantswere grown at 37 �C under shaking until the A600

reached 0.6 and induced with IPTG for varying time

intervals. Purified PknH was used to raise polyclonal

anti-PknH antibody in a rabbit.

2.4. Kinase activity of PknH

The kinase activity of purified PknH was determinedby in vitro protein kinase assays [13]. The kinase reac-

tions routinely contained 500 ng of the enzyme in the

kinase buffer (25 mM Tris/HCl, pH 7.4, 10 mM MgCl2,

1 mM DTT) with 10 lg of each substrate and 2 lCi of[c-32P]ATP (BRIT, Hyderabad, India) and incubated

for 30 min at 37 �C. The reactions were stopped by

addition of SDS sample buffer, and proteins were sep-

arated by 10% SDS–PAGE (autophosphorylation as-say) or 15% SDS–PAGE (substrate phosphorylation),

electroblotted onto nitrocellulose membranes and visu-

alized by autoradiography.

Phosphoamino acid residues of autophosphorylated

PknH and histone phosphorylated by PknH were ana-

lyzed by immunoblotting using monoclonal antibodies

against phosphoserine, phosphothreonine and phos-

photyrosine (Sigma).

2.5. Transcriptional analysis of pknH in M. tuberculosis

in response to various stress conditions

The expression of pknH during various stress condi-

tions in M. tuberculosis was examined by RT-PCR. The

cultures were grown as described and RNA was isolated

using the RNeasy Mini Kit (Qiagen, Hilden, Germany).

Various stress conditions used to examine pknH ex-

pression included exposure to oxidative stress (10 mM

H2O2), nutrient deprivation (incubation in PBS), acid

stress (7H9 medium adjusted to a pH of 4.5), heat shock(incubation at 42 �C), and hypoxia. For hypoxia studies,

cultures were grown to an OD600 of 0.5 and inoculated

into 10 ml media in 15 ml Corning Polystyrene tubes

and incubated for 15 days at 37 �C without shaking and

correspondingly, a control culture was grown with

shaking at 220 rpm. Another set of control cultures

contained methylene blue (1.5 lg ml�1) to monitor the

depletion of oxygen. For other stress conditions, earlylogarithmic phase cultures were exposed to the indicated

conditions for 4 h prior to RNA extraction. RNA

samples that yielded an equivalent degree of amplifica-

tion of 23S rRNA transcripts were used in RT-PCR.

The analysis was carried out with the number of cycles

at which the band intensity increased linearly with

the amount of mRNA used. The amplimers used for

Fig. 1. Schematic presentation of the main structural components of

PknH. The positions of different domains and the topology of the

PknH protein are shown. TM refers to the transmembrane region and

Pro-rich indicates the proline-rich region.

K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 109

detecting pknH transcripts were; 50AGCGCCGGCA

CACTGGT (forward primer) and 50GGGTTG

GTTTTGCGCGGGGTCTG (reverse primer). The

amplification products were electrophoresed on a 1.5%

agarose gel and visualized by ethidium bromide staining.Negative control reactions with RNA without Reverse

Transcriptase (to rule out DNA contamination) or

without RNA but with Reverse Transcriptase were also

included (data not shown).

2.6. Localization of PknH in mycobacterial cells

Equal amount of protein from cell membrane, cyto-plasmic fraction ofM. tuberculosisH37Rv and whole cell

lysates from M. smegmatis, M. tuberculosis H37Rv and

M. tuberculosis H37Ra were prepared [17] and separated

by 10% SDS–PAGE. The proteins were electroblotted

onto a nitrocellulose membrane and incubated with

polyclonal antibodies raised against PknH. The mem-

branes were developed using an Enhanced Chemilumi-

nescence kit according to the manufacturer�sinstructions.

2.7. Analysis of prevalence of pknH in other mycobacte-rial strains

The prevalence of pknH homologues in various my-

cobacterial species was examined by Southern blot

analysis as described earlier [13]. Genomic DNA (1 lgeach) from M. tuberculosis H37Rv, M. tuberculosis

H37Ra, M. bovis BCG, M. avium, M. smegmatis LR222,

and M. fortuitum were digested with restriction enzyme

(NotI) and separated by electrophoresis on a 1% agarose

gel at 25–30 V for 16 h. The DNA fragments were

transferred onto Hybond-N membrane (Amersham),

crosslinked by UV irradiation, and hybridized with a32P-labeled fragment containing the complete codingregion of pknH, in 50% formamide at 42 �C for 16 h.

Blots were washed once with 2� SSC, 0.1% SDS at

room temperature for 30 min followed by two washes

with 0.1� SSC, 0.5% SDS at 65 �C for 30 min and vi-

sualized by autoradiography.

Fig. 2. Overexpression and purification of wild-type GST-PknH and its

active-site-mutant GST-PknH-K45M. E. coli cells harboring pGEX-

pknH or pGEX-pknH-K45M were grown in LB medium and induced

with 1 mM IPTG for different time intervals. Total lysates of E. coli

expressing fusion proteins were purified to homogeneity using GST

beads. Protein samples at various stages of purification were subjected

to 10% SDS–PAGE and visualized by Coomassie staining. Lane 2,

uninduced cell lysate; lane 3, cell lysate after 4 h of IPTG induction ;

lane 4, cell lysate after 30 min of IPTG induction; lane 5, GST-PknH;

lane 6, GST-PknH-K45M; lane 1, molecular weight markers were run

in parallel and the size of marker proteins is indicated.

3. Results

3.1. In silico analysis

The pknH gene encodes a protein of 626 amino acids

with a predicted pI of 6.3. The PknH protein sequence

possesses the protein kinase �signature�, including all 11

subdomains that are conserved throughout the family

[7,8]. These sub-domains of PknH, which are present inall protein kinases, are located in the N-terminal 300

amino acids. Sequence alignment of this 300 amino acid

region using BLAST (NCBI) showed significantly high

scores with other known eukaryotic as well as pro-

karyotic Ser/Thr protein kinases. The rest of the se-

quence, however, showed no significant homology with

any other known protein sequence, indicating that

conservation of kinase domains is related to the mech-anism of phosphorylation.

Interestingly, unlike other mycobacterial STPKs,

PknH has a proline-rich region between residues 297

and 403, in a segment adjacent to the catalytic domain

as determined by analysis programs: Scan Prosite

(http://www.expasy.org/cgi-bin/scanprosite) and MO-

TIF (http://www.motif.genome.ad.jp) (Fig. 1). This re-

gion of 107 amino acid residues contains 38 proline

110 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113

residues, with a very high density in the region ranging

from position 297 to 327.

The topology of this membrane spanning protein, as

predicted using various topology prediction programs

like TMHMM, HMMTOP etc, is �N-terminus intracel-lular and C-terminus extracellular� (Fig. 1).

3.2. Expression and purification of PknH

PknH was purified as a GST-fusion protein using

glutathione–Sepharose-4B beads. To characterize the

kinase activity of PknH, a mutant of this kinase, pGEX-

pknH-K45M, was also engineered by site-directed mu-

Fig. 3. Protein kinase activity of PknH. (a) Autophosphorylation of Pkn

[c-32P]ATP as described in Section 2. The proteins were separated by 10%

staining. The left panel shows Coomassie blue staining and the right pane

marker; lane 2, GST-PknH; lane 3, GST-PknH-K45M. (b) Phosphorylation

formed to examine the ability of PknH to phosphorylate exogenous kinase

electrophoresed (left half: Coomassie blue staining) and autoradiographed (

GST-PknH-K45M; lane 5, GST-PknH with MBP; lane 6, GST-PknH with hi

with histone. (c) Effect of Mg2þ ion on the Histone phosphorylation by Pkn

concentrations of MgCl2. The labeled proteins were separated by SDS–PAG

labeling (lower panel). (d) Effect of kinase inhibitors. GST-PknH was preinc

sporine, or 0.1/1/10 lM of H-7 and used for phosphorylation of histone. (e

kinase assay was performed by incubating PknH and histone with [c-32P]ATP

on a 15% SDS–PAGE. The amino acids phosphorylated by PknH were d

phosphothreonine, phosphoserine and phosphotyrosine residues. (In each pa

half is the corresponding autoradiogram.)

tagenesis and subsequently purified using the same

strategy.

Gel electrophoretic analysis of the purified proteins,

GST-PknH and GST-PknH-K45M, revealed the pres-

ence of a band of 97 kDa (Fig. 2, lanes 5 and 6) in ac-cordance with the predicted size of GST-PknH fusion

protein (68 kDa for the PknH protein and 29 kDa for

the attached N-terminal GST protein). Interestingly,

another band of approximately 75 kDa was also ob-

served after 4 h induction by IPTG. On Western blot

analysis this 75 kDa band was also recognized by the

monoclonal anti-GST antibodies (data not shown). A

decreased induction period (30 min, after addition ofIPTG), however, yielded only full-length 97 kDa protein

H. Purified GST-PknH and GST-PknH-K45M were incubated with

SDS–PAGE and visualized by autoradiography or Coomassie blue

l shows the corresponding autoradiogram. Lane 1, molecular weight

of exogenous substrates by PknH. An in vitro kinase assay was per-

substrates in the presence of [c-32P]ATP. The labeled proteins were

right half). Lane 1, MBP; lane 2, histone ; lane 3, GST-PknH; lane 4,

stone; lane 7, GST-PknH-K45M with MBP; lane 8, GST-PknH-K45M

H. In vitro kinase assays were performed in the presence of indicated

E and visualized by Coomassie blue staining (upper panel) or c-32P-ubated for 30 min at room temperature with 1/10/100 lM of Stauro-

) Identification of the amino acids phosphorylated by PknH. In vitro

in kinase assay buffer. After 30 min incubation, samples were separated

etected by immunoblot analysis with monoclonal antibodies against

nel, the left half is the Coomassie stained SDS–PAGE gel and the right

Fig. 4. Gene expression analysis of M. tuberculosis pknH gene in re-

sponse to various stress conditions. RT-PCR analysis using primers

specific for pknH was performed on total RNA samples isolated from

M. tuberculosis cultures exposed to the indicated stress conditions. 23S

rRNA was used as an internal control. The results were confirmed by

three independent experiments.

Fig. 5. Expression and localization of PknH in mycobacteria. Immu-

noblot analysis of various cellular fractions of M. tuberculosis H37Rv,

M. tuberculosis H37Ra and M. smegmatis using polyclonal antisera

against PknH. The blots were developed by ECL reagents. Lane 1,

cytoplasmic fraction (M. tuberculosis H37Rv); lane 2, cell membrane

fraction (M. tuberculosis H37Rv); lane 3, whole cell lysate from M.

tuberculosis H37Rv; lane 4, whole cell lysate from M. tuberculosis

H37Ra; lane 5, whole cell lysate fromM. smegmatis; lane 6, GST-PknH

(as positive control).

K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 111

which was used in all subsequent experiments (Fig. 2,

lanes 2–4).

3.3. Protein kinase activity of PknH

The kinase activity of PknH was examined by incu-

bating purified GST-PknH or GST-PknH-K45M with

[c-32P]. After incubation, the reaction products were

separated on a 10% SDS–PAGE gel (autophosphory-

lation assay) or 15% SDS–PAGE gel (substrate phos-

phorylation), and autoradiographed. GST-PknH

phosphorylated itself whereas the GST-PknH-K45M

mutant did not exhibit such activity (Fig. 3a). Moreover,unlike GST-PknH-K45M mutant, GST-PknH phos-

phorylated exogenous substrates like MBP and histone

demonstrating the importance of conserved lysine resi-

due in the catalytic domain (Fig. 3b).

The kinase activity of PknH was found to be divalent

ion dependent as no phosphorylation was detected in the

absence of divalent ions and maximal kinase activity was

obtained in the presence of 10 mM Mg2þ (Fig. 3c).Phosphorylation of PknH occurred only in presence of

Mg2þ or Mn2þ as similar concentrations of other cations

failed to substitute for Mn2þ/Mg2þ (data not shown).

The effect of two protein kinase inhibitors, stauro-

sporine and H-7 [11,18], was examined on in vitro pro-

tein phosphorylation. Pre-incubation of these inhibitors

with the GST-PknH inhibited its kinase activity in a

dose-dependent manner with complete inhibition of ki-nase activity in the presence of 0.1 mM staurosporine or

10 lM H-7 (Fig. 3d).

The nature of amino acid residues phosphorylated

by PknH was examined by Western blotting using

monoclonal antibodies against phosphoserine, phos-

phothreonine and phosphotyrosine. Monoclonal anti-

phosphoserine and anti-phosphothreonine antibodies

recognized PknH (autophosphorylated) and histonephosphorylated by PknH whereas, these were not de-

tected by anti-phosphotyrosine antibody. Thus, PknH is

a STPK which phosphorylates itself and histone at serine

and threonine residues (Fig. 3e).

3.4. Transcriptional analysis of pknH in M. tuberculosis

in response to various stress conditions

To examine whether pknH is involved in stress-med-

iated signaling in M. tuberculosis, the expression of

pknH was studied in response to a variety of stress

conditions. RNA samples extracted from exponentially

growing cultures and those adapted to various stress

conditions were evaluated for gene expression. As

shown (Fig. 4), exposure to low pH and incubation at 42

�C decreased the level of pknH transcription to a sig-nificant extent. On the contrary, oxidative stress, nutri-

ent deprivation and hypoxia had no effect on the

transcription levels of pknH.

3.5. Localization of PknH in mycobacterial cells

The hydropathy profile of PknH revealed the presence

of a unique short hydrophobic domain, located between

amino acids L404 and I426, suggesting that it could corre-

spond to a transmembrane region anchoring PknH to the

membrane (Fig. 1). PknH antisera were used for the lo-

calization of PknH amongst different cellular fractions ofM. tuberculosis H37Rv. PknH was also observed as a 68

kDa protein predominantly in the cell membrane fraction

but a faint signal was also observed in the cytoplasmic

fraction (Fig. 5, lanes 1 and 2). These results suggested

that PknH is a transmembrane protein predominantly

localized in the cell envelope of M. tuberculosis H37Rv.

PknH was also detected in the whole cell lysates of M.

tuberculosisH37Rv andM. tuberculosisH37Ra, but not inthose of M. smegmatis. (Fig. 5, lanes 3–5)

3.6. Analysis of prevalence of pknH in other mycobacte-rial strains

Blast search against the unfinished genome sequence

of M. smegmatis (http://tigrblast.tigr.org/ufmg/index.

cgi?database¼msmegmatisŒseq) revealed the presence

Fig. 6. Presence of pknH in other mycobacterial strains. Genomic

DNA samples from mycobacterial species were digested with NotI,

separated on agarose gels and transferred to nitrocellulose membrane

as described in Section 2. Hybridization was performed with 32P-ra-

diolabeled pknH probe and autoradiography. Lane 1, M. tuberculosis

H37Rv; lane 2, M. tuberculosis H37Ra; lane 3, M. bovis BCG; lane 4,

M. avium; lane 5, M. smegmatis LR222; and lane 6, M. fortuitium.

112 K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113

of a sequence with significant homology in the N-

terminus kinase domain but not in the C-terminus re-

gion. However, Southern analysis demonstrated that

gene homologous to pknH was absent in the saprophytic

fast growing M. smegmatis and M. fortuitum and pres-

ent in all the members of the M. tuberculosis complex

analyzed in this study (Fig. 6).

4. Discussion

Phosphorylation and dephosphorylation, catalyzed

by protein kinases and protein phosphatases, can alter

the function of a protein in almost every conceivable

way; for example, by stabilizing it or marking it for

destruction, by increasing or decreasing its biologicalactivity, or by initiating or terminating protein–protein

interactions. Based on the demonstrated importance

of protein phosphorylation, the prokaryotic STPKs

have been implicated in regulation of develop-

ment, response to stress conditions and pathogenicity

[8,19].

The occurrence of phosphorylated proteins [20] and

functional STPKs [11] was illustrated before release ofthe complete genome of M. tuberculosis. From the ge-

nome sequence the presence of 11 STPKs was predicted

[8] and a recent study based on bioinformatic analysis

predicts that most of these STPKs are essential for

survival of M. tuberculosis inside the host cell [21]. Six of

these kinases have been characterized biochemically [10–

15]. Here, we report the cloning, expression and char-

acterization of pknH gene, a mycobacterial STPK. Invitro kinase assays demonstrated that pknH encodes a

functional STPK. The purified PknH phosphorylates

itself by an autocatalytic mechanism and is capable of

phosphorylating exogenous substrates (Figs. 3a and b).

PknH was sensitive to kinase inhibitors like stauro-

sporine and H-7, both of which impeded the kinase

activity in a dose-dependent manner (Fig. 3d). All my-

cobacterial STPKs other than PknI, possess a lysine inthe ATP-binding site, which is characteristic of this

family of kinases [8]. The mutation of this highly con-

served lysine residue to methionine abrogated the kinase

activity of PknH (Figs. 3a and b).

In silico analysis of the polypeptide sequence of PknH

illustrated that immediately adjacent to the catalytic

domain is a proline-rich sequence (Fig. 1) which may

simply function as a ‘‘linker’’ sequence between the N-

terminal catalytic domain and the C-terminal domain.Alternatively, this region may play a role in the binding

of PknH to other proteins, such as substrates, regula-

tors, or cofactors [22].

In addition, the bioinformatic analysis also suggested

that PknH is a transmembrane protein with a predicted

topology of �N-in, C-out�. It was reported earlier that the

environment sensing kinases are generally transmem-

brane and their extracellular C-terminus senses the sig-nal and the intracellular N-terminus carrying the kinase

domain transduces this signal into the cellular response

thereby facilitating adaptation to the prevailing condi-

tions [5,8,23,24]. The localization of PknH was analyzed

by immunoblot analysis of different subcellular fractions

and it was confirmed that PknH is a transmembrane

protein (Fig. 5). The topology prediction for PknH was

supported by the appearance of 97 and 75 kDa fusionproteins (Fig. 2). The cleaved off 22 kDa region of 97

kDa fusion protein is equivalent to the predicted size of

the C-terminal region of PknH which is extracellular

and cleaved by the extracellular proteases. This is in

consensus with similar observations made for PknD and

PknE, other mycobacterial STPKs [11,15]. However,

further experimental validation is required to confirm

these topology predictions. In addition, the Southernblot analysis revealed the presence of pknH homologues

in members of the M. tuberculosis complex analyzed in

this study, but they were absent in the saprophytic fast-

growing M. smegmatis and M. fortuitum (Fig. 6). This

observation was further confirmed by Western blot

analysis in which PknH was detected in the whole cell

lysates of pathogenic mycobacterial species but not in

those of M. smegmatis (Fig. 5).A number of kinases have been shown to play a role

in stress-mediated signaling in eukaryotes as well as

prokaryotes [25,26]. For pathogens, such environmental

sensing apparatus is fundamental for their intracellular

survival. To examine whether pknH is involved in stress-

mediated signaling in M. tuberculosis, its expression was

studied in response to a variety of stress conditions. In

particular, acidic and heat stress decreased the level ofpknH transcription to a significant extent whereas other

stress conditions like hypoxia, oxidative stress and nu-

trient deprivation had no effect on the transcription

levels of pknH (Fig. 4). These observations in the

pathogenic M. tuberculosis H37Rv are in consensus with

previous studies done with the pknH promoter using

Gfp transcriptional fusion assays in M. smegmatis [27].

Differential expression during stress conditions,transmembrane localization and its absence in non-

pathogenic strains suggest possible roles of PknH in

processes that are unique to the pathogenic strains and

K. Sharma et al. / FEMS Microbiology Letters 233 (2004) 107–113 113

their environmental sensing mechanisms. More experi-

mental evidences will be necessary to confirm that PknH,

like other STPKs, acts as a protein receptor sensing en-

vironmental signals, especially the acidic or heat stress,

enabling bacterial adaptation to the changed environ-ment. �Knock out� studies, further functional character-ization and identification of the downstream substrates of

PknH are in progress, all of which might provide in-

triguing insights into the fundamental question as to the

significance of PknH in M. tuberculosis and add to our

understanding of mycobacterial pathogenicity.

Acknowledgements

Financial support for the project was provided by

NMITLI, Council of Scientific and Industrial Research

(CSIR). Rochelle was recipient of Rajiv Gandhi Science

Talent Research Fellowship.

References

[1] Krebs, E.G. and Fischer, E.H. (1989) The phosphorylase b to a

converting enzyme of rabbit skeletal muscle, 1956. Biochim.

Biophys. Acta 1000, 302–309.

[2] Matsumoto, A., Hong, S.K., Ishizuka, H., Horinouchi, S. and

Beppu, T. (1994) Phosphorylation of the AfsR protein involved in

secondary metabolism in Streptomyces species by a eukaryotic-

type protein kinase. Gene 146, 47–56.

[3] Han, G. and Zhang, C.C. (2001) On the origin of Ser/Thr kinases

in a prokaryote. FEMS Microbiol Lett. 200, 79–84.

[4] Madec, E., Laszkiewicz, A., Iwanicki, A., Obuchowski, M. and

Seror, S. (2002) Characterization of a membrane-linked Ser/Thr

protein kinase in Bacillus subtilis, implicated in developmental

processes. Mol. Microbiol. 46, 571–586.

[5] Inouye, S., Jain, R., Ueki, T., Nariya, H., Xu, C.Y., Hsu, M.Y.,

Fernandez-Luque, B.A., Munoz-Dorado, J., Farez-Vidal, E. and

Inouye, M. (2000) A large family of eukaryotic-like protein Ser/

Thr kinases of Myxococcus xanthus, a developmental bacterium.

Microb. Comp. Genomics 5, 103–120.

[6] Hanks, S. and Quinn, A.M. (1991) Protein kinase catalytic

domain sequence database: identification of conserved features of

primary structure and classification of family members. Methods

Enzymol. 200, 38–62.

[7] Bakal, C.J. and Davies, J.E. (2000) No longer an exclusive club:

eukaryotic signalling domains in bacteria. Trends Cell Biol. 10,

32–38.

[8] Av-Gay, Y. and Everett, M. (2000) The eukaryotic-like Ser/Thr

protein kinases of Mycobacterium tuberculosis. Trends Microbiol.

8, 238–244.

[9] Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C.,

Harris, D., Gordon, S.V., Eiglmeier, K., Gas, S., Barry III, C.E.,

Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth,

T., Connor, R., Davies, R., Devlin, K., Feltwell, T.S., Gentles, N.,

Hamlin, S., Holroyd, T., Hornsby, K., Jagels, Krogh, A., Mclean,

J., Moule, J., Murphy, L., Oliver, K., Osborne, J., Quail, M.A.,

Rajandream, M.A., Rogers, J., Rutter, S., Seeger, K., Skelton, J.,

Squares, R., Squares, S., Sulston, J.E., Taylor, K., Whitehead, S.

and Barrell, B.G. (1998) Deciphering the biology of Mycobacte-

rium tuberculosis from the complete genome sequence. Nature 393,

537–544.

[10] Young, T.A., Delagoutte, B., Endrizzi, J.A., Falick, A.M. and

Alber, T. (2003) Structure of Mycobacterium tuberculosis PknB

supports a universal activation mechanism for Ser/Thr protein

kinases. Nat. Struct. Biol. 10, 168–174.

[11] Peirs, P., De Wit, L., Braibant, M., Huygen, K. and Content, J.

(1997) A serine/threonine protein kinase from Mycobacterium

tuberculosis. Eur. J. Biochem. 244, 604–612.

[12] Av-Gay, Y., Jamil, S. and Drews, S.J. (1999) Expression and

characterization of the Mycobacterium tuberculosis

serine/threonine protein kinase PknB. Infect. Immun. 67, 5676–

5682.

[13] Koul, A., Choidas, A., Tyagi, A.K., Drlica, K., Singh, Y. and

Ullrich, A. (2001) Serine/threonine protein kinases PknF and

PknG of Mycobacterium tuberculosis: characterization and local-

ization. Microbiology 147, 2307–2314.

[14] Chaba, R., Raje, M. and Chakraborti, P.K. (2002) Evidence that a

eukaryotic-type serine/threonine protein kinase from Mycobacte-

rium tuberculosis regulates morphological changes associated with

cell division. Eur. J. Biochem. 269, 1078–1085.

[15] Molle, V., Girard-Blanc, C., Kremer, L., Doublet, P., Cozzone,

A.J. and Prost, J.F. (2003) Protein PknE, a novel transmembrane

eukaryotic-like serine/threonine kinase from Mycobacterium tu-

berculosis. Biochem. Biophys. Res. Commun. 308, 820–825.

[16] Agarwal, N. and Tyagi, A.K. (2003) Role of 50-TGN-30 motif in

the interaction of mycobacterial RNA polymerase with a pro-

moter of �extended -10� class. FEMS Microbiol. Lett. 225,

75–83.

[17] Dahl, J.L., Wei, J., Moulder, J.W., Laal, S. and Friedman, R.L.

(2001) Subcellular localization of the intracellular survival-en-

hancing Eis protein ofMycobacterium tuberculosis. Infect. Immun.

69, 4295–4302.

[18] Drews, S.J., Hung, F. and Av-Gay, Y. (2001) A protein kinase

inhibitor as an antimycobacterial agent. FEMS Microbiol Lett.

205, 369–374.

[19] Hakansson, S., Galyov, E.E., Rosqvist, R. and Wolf-Watz, H.

(1996) The Yersinia YpkA Ser/Thr kinase is translocated and

subsequently targeted to the inner surface of the HeLa cell plasma

membrane. Mol. Microbiol. 20, 593–603.

[20] Chow, K., Ng, D., Strokes, R. and Johnson, P. (1994) Protein

tyrosine phosphorylation in Mycobacterium smegmatis. FEMS

Microbiol. Lett. 124, 203–208.

[21] Lamichhane, G., Zignol, M., Blades, N.J., Geiman, D.E.,

Dougherty, A., Grosset, J., Broman, K.W. and Bishai, W.R.

(2003) A postgenomic method for predicting essential genes at

subsaturation levels of mutagenesis: application toMycobacterium

tuberculosis. Proc. Natl. Acad. Sci. U S A 100, 7213–7218.

[22] Williamson, M.P. (1994) The structure and function of proline-

rich regions in proteins. Biochem. J. 297, 249–260.

[23] Nadvornik, R., Vomastek, T., Janecek, J., Technikova, Z. and

Branny, P. (1999) Pkg2, a novel transmembrane protein Ser/Thr

kinase of Streptomyces granaticolor. J. Bacteriol. 181,

15–23.

[24] Umeyama, T., Lee, P.C. and Horinouchi, S. (2002) Protein serine/

threonine kinases in signal transduction for secondary metabolism

and morphogenesis in Streptomyces. Appl. Microbiol. Biotechnol.

59, 419–425.

[25] Kang, C.M., Brody, M.S., Akbar, S., Yang, X. and Price, C.W.

(1996) Homologous pairs of regulatory proteins control activity of

Bacillus subtilis transcription factor rB in response to environ-

mental stress. J. Bacteriol. 178, 3846–3853.

[26] Iordanov, M.S. and Magun, B.E. (1999) Different mechanisms of

c-Jun NH(2)-terminal kinase-1 (JNK1) activation by ultraviolet-B

radiation and by oxidative stressors. J. Biol. Chem. 274, 25801–

25806.

[27] Cowley, S.C. and Av-Gay, Y. (2001) Promoter activity and

protein localization in Mycobacterium spp. using green fluorescent

protein. Gene 264, 225–231.