Effects on Neuroblastoma Tumor Initiating
Cells and Established Neuroblastoma Cell
Lines Using Putative Inhibitors of HIF-2α
Authors: David Schmidt, Tobias Lindeberg
Supervisors:
Bachelor Thesis
August 2010
Department of Laboratory Medicine, Center for Molecular Pathology,
CREATE Health and University Hospital MAS, Lund University, SE-205 02
Malmö, Sweden
2
Effects on Neuroblastoma Tumor
Initiating Cells and Established
Neuroblastoma Cell Lines Using Putative
Inhibitors of HIF-2α
Authors: David Schmidt, Tobias Lindeberg
Bachelor Thesis
August 2010
Abstract
A growing number of solid tumors have been shown to have a constitutively high
protein expression of HIF-2α f f y -inducible
transcription factors. In these tumors, which include neuroblastoma, glioma and
breast cancer, a high HIF-2α c w gg
metastasis and death. In this study, we have tried to inhibit the activity of HIF-2α
by preventing its dimerization with HIF-1β g c y c
neuroblastoma cell lines using honokiol and acriflavine, the aim being to induce
sympathetic neuronal differentiation of the neuroblastoma stem cells and
possibly thereby impairing cell proliferation. Since acriflavine should inhibit the
HIF-2α g g c w c c
levels of VEGF, DEC1, GLUT1 and SERPINB9 expression. This study shows that
acriflavine does not lower the expression of either VEGF, DEC1, GLUT1 or
SERPINB9 in tumor initiating cells and hypoxic neuroblastoma cell lines.
Keywords
Neuroblastoma, HIF-2α y c f k
Department of Laboratory Medicine, Center for Molecular Pathology, CREATE
Health and University Hospital MAS, Lund University, SE-205 02 Malmö, Sweden
3
TABLE OF CONTENTS
TABLE OF CONTENTS ................................................................................................. 3
ABSTRACT ..................................................................................................................... 4
ABBREVATIONS ........................................................................................................... 5
INTRODUCTION ............................................................................................................ 5
Tumor initiation and metastasis .................................................................................... 5
Clonal evolution ........................................................................................................... 6
Cancer stem cells .......................................................................................................... 6
Neuroblastoma .............................................................................................................. 6
Tumors and hypoxia ..................................................................................................... 6
Hypoxia-inducible factors ............................................................................................ 7
AIMS OF THE PRESENT STUDY ................................................................................. 9
MATERIALS AND METHODS ..................................................................................... 9
Cell culture ................................................................................................................... 9
Quantitative real-time PCR .......................................................................................... 9
RESULTS ....................................................................................................................... 10
Cell culture ................................................................................................................. 10
Acriflavine and HIF- 2α target genes ......................................................................... 10
Neuroblastoma and hypoxia ....................................................................................... 11
DISCUSSION ................................................................................................................. 11
ACKNOWLEDGEMENTS ........................................................................................... 12
REFERENCES ............................................................................................................... 13
FIGURES ....................................................................................................................... 15
4
Effects on Neuroblastoma Tumor Initiating Cells and Established
Neuroblastoma Cell Lines Using Putative Inhibitors of HIF-2α
Tobias Lindeberg, David Schmidt
Author Affiliations
Department of Laboratory Medicine, Center for Molecular Pathology, CREATE Health
and University Hospital MAS, Lund University, SE-205 02 Malmö, Sweden
ABSTRACT
A growing number of solid tumors have been shown to have a constitutively high
protein expression of HIF-2α, one of three identified hypoxia-inducible transcription
factors. In these tumors, which include neuroblastoma, glioma and breast cancer, a high
HIF-2α expression correlates with aggressive disease, metastasis and death. In this
study, we have tried to inhibit the activity of HIF-2α by preventing its dimerization with
HIF-1β in tumor initiating cells and hypoxic neuroblastoma cell lines using honokiol
and acriflavine, the aim being to induce sympathetic neuronal differentiation of the
neuroblastoma stem cells and possibly thereby impairing cell proliferation. Since
acriflavine should inhibit the HIF-2α expressing tumor initiating cells, we expected to
see a decrease in the levels of VEGF, DEC1, GLUT1 and SERPINB9 expression. This
study shows that acriflavine does not lower the expression of either VEGF, DEC1,
GLUT1 or SERPINB9 in tumor initiating cells and hypoxic neuroblastoma cell lines.
5
ABBREVATIONS
ARNT Aryl hydrocarbon receptor nuclear
bHLH Basic helix-loop-helix
BNIP3 BCL2/adenovirus E1B 19 kDa protein-interacting protein 3
CSC Cancer stem cell
DEC1 Deleted in esophageal cancer
DMSO Dimethyl sulfoxide
GLUT1 Glucose transporter 1
HIF Hypoxia inducible factor
MEM Minimal Essential Medium
PBS phosphate buffered saline
PHD Prolyl hydroxylase
PEST Penicillin streptomycin
SERPINB9 Serpin peptidase inhibitor, clade B, 9
SNS Sympathetic nervous system
TIC Tumor initiating cells
VEGF Vascular endothelial growth factor
VHL Von Hippel-Lindau protein
qPCR Real-time quantitative polymerase chain reaction
INTRODUCTION
Cancer is a genetic disease where mutations or alterations of the genome change the
control mechanism and/or function of the replicating cell. If the cell survives, this leads
to a change in behavior where the cell can begin to replicate uncontrollably and initiate
a tumor. In 2000, Hanahan and Weinberg suggested that in most tumors, if not all, the
cell has to acquire six capabilities to become a cancer. These are self-sufficiency in
growth signals, insensitivity to anti-growth signals, tissue invasion and metastasis,
limitless replicative potential, sustained angiogenesis and avoiding apoptosis (Hanahan
& Weinberg, 2000). The focus of this study is on the effects of putative inhibitors on
sustained angiogenesis, tissue invasion and metastasis.
Tumor initiation and metastasis
At present, there are two prevalent theories in the field of tumor progression and
metastasis: the clonal evolution theory and the cancer stem cell (CSCs) theory.
6
Clonal evolution
Some researchers claim that tumors progress from one single cell that has acquired a
beneficial growth advantage compared to adjacent normal cells (Nowell, 1976).
According to this theory, the growth advantage causes that cell to proliferate, resulting
in several new neoplastic alterations, of which the advantageous ones proceed while the
not so fortunate are eliminated. This way, only the most favorable cell becomes a
precursor to the primary tumor.
Cancer stem cells
On the other hand, there are an increasing number of researchers who assume that there
is a small subpopulation of cells within the tumor with stem cell-like properties that can
replicate itself an unlimited amount of times as well as create new differentiated cell
types that only have limited replicative capacity. This implies that it is the CSCs that
metastasize and colonize a new locus. These cancer cells can originate from stem cells
or have dedifferentiated into stem cell-like cells and are, to avoid confusion, therefore
often referred to as tumor initiating cells (TICs) (Gupta et al., 2009).
Neuroblastoma
Neuroblastoma is a childhood tumor, which rarely is diagnosed after the age of 10
years. There are several types of neuroblastoma in which the grade of differentiation is
correlated to the severity and aggressiveness of the disease (Fredlund et al., 2008).
Neuroblastoma tumors derive from immature or precursor cells of the sympathetic
nervous system (SNS). The finding of corresponding marker gene expression further
supports this hypothesis (Edsjö et al., 2007). The tumors can occur in any structure of
the SNS.
Tumors and hypoxia
Gene expression in cells is regulated by many interdependent intra- and extracellular
factors. One of these factors is the availability of oxygen: during hypoxia, a reduction in
tissue oxygen tension, gene expression is heavily altered, leading to a cell phenotype
more capable of withstanding the new extracellular conditions.
7
In spite of avidly adapting themselves to hypoxia, tumors generally have a tendency
to develop intratumoral hypoxia due to the fact that they produce poorly functioning
blood vessels with severe structural abnormalities compared to the ones in normal tissue
(Knowles et al., 2001). This is of particular importance, since published data have
shown that tumor hypoxia is associated with increased metastasis and poor survival
(Vaupel et al., 2001) and induces dedifferentiation of tumor cells (Axelsson et al., 2005,
Pietras et al., 2009, Jögi et al., 2002).
Hypoxic tumors are more aggressive and are also more resistant to radiation therapy,
because the destructive effect of ionizing radiation is dependent on free radicals from
oxygen (Knowles et al., 2001). Although the hypoxic response of cells is a complex and
multi-faceted process, the hypoxia-inducible factors (HIFs) have emerged as some of
the most contributing pieces of the puzzle.
Hypoxia-inducible factors
Hypoxia-inducible factors are heterodimeric transcription factors, capable of mediating
adaptive responses to hypoxia. They have been shown to play crucial roles in tumor
growth and vascularization as well as maintaining an undifferentiated state in tumor-
initiating cells (Axelson et al., 2005). They consist of one α-subunit and one β-subunit,
which together form the active complex. To date, three different subunits of HIF-α are
known; HIF-1α (Wang and Semenza, 1995), HIF-2α (Tian et al., 1997) and HIF-3α
(Makino et al., 2001). Both HIF-1α and HIF-2α form heterodimers with HIF-1β, while
HIF-3α is thought to act as a negative regulator of hypoxia-induced gene expression.
Although their names suggest otherwise, in most cells both HIF-1α and HIF-2α are
constitutively expressed during normoxia as well as hypoxia. During normoxia,
however, they are rapidly hydroxylated by prolyl hydroxylase 1-3 (PHD 1-3) which
makes them recognizable by the von Hippel-Lindau protein (VHL). This, in turn, results
in ubiquination, which targets the HIFs for proteosomal degradation. Since the
hydroxylation occurs through a reaction that is oxygen dependent, O2 becomes a
limiting substrate (Semenza, 2003). During hypoxia, the proteosomal degradation of
HIFs slow down, and consequently, an increase of cytosolic HIFs can be seen.
The HIFs immediately enter the nucleus, where they form a complex with HIF-1β
and form the active transcription factor. HIF-1 and HIF-2 then bind to, and activate the
expression of, several hypoxia-response genes, including, but not limited to, vascular
endothelial growth factor (VEGF), glucose transporter 1 (GLUT1), deleted in
8
esophageal cancer-1 (DEC1) and serpin peptidase inhibitor, clade B, member 9
(SERPINB9).
Although HIF-1α and HIF-2α seem to share most of their target genes, they appear to
have a few somewhat exclusive targets, best exemplified by BCL2/adenovirus E1B 19
kDa protein-interacting protein 3 (BNIP3) for HIF-1α and SERPINB9 for HIF-2α.
Between HIF-1α and HIF-2α, HIF-1α is more often linked to tumor aggressiveness
and the regulation of most hypoxia-induced genes. This might, in part, be due to the fact
that HIF-1α has been more extensively studied than HIF-2α (Semenza et al., 2009).
While the role of HIF-2α is less clear, it has been suggested that HIF-2α mediates a
more chronic response to hypoxia than HIF-1α (Holmquist-Mengelbier et al., 2006). As
summarized in Pietras (2010), in some tumor forms, HIF-2α is linked to low overall
survival and aggressive behavior, whilst HIF-1α in contrast is correlated with an overall
better survival (Helczynska et al., 2008; Noguera et al., 2009). Also, HIF-2α preserves
an undifferentiated state in neuroblastoma cells (Pietras et al., 2009), and a growing
number of solid tumors have been shown to express constitutively high levels of HIF-
2α, which in these tumors correlates with an aggressive disease progression, metastasis
and death (Holmquist-Mengelbier et al., 2006; Helczynska et al., 2008; Noguera et al.,
2009).
Acriflavine
Acriflavine has long been used against sleeping sickness, and is known to have
antibacterial and antiviral effects. The effects of acriflavine on cancer were described
over 50 years ago, but was then somewhat forgotten in the cancer field (Goldie et al.,
1959). Recently, studies have redirected their focus back on its anticancerous effects,
and it was found to have an inhibiting effect on HIF-2α and HIF-1α (Semenza et al.,
2009). It has also been administered to patients for several months without any major
adverse effects.
In light of the potential impact of a pharmaceutical substance targeting HIF-2α, we
set out to evaluate the effectiveness of putative inhibitors in order to achieve
sympathetic neuronal differentiation, and thereby impair cell proliferation.
Unfortunately, our results did not confirm the inhibiting effects of neither acriflavine
nor honokiol on our studied cell types.
9
AIMS OF THE PRESENT STUDY
The aim of this study is to evaluate honokiol and acriflavine as potential inhibitors for
the activity of HIF-2α by preventing its dimerization with HIF-1β in tumor initiating
cells and hypoxic neuroblastoma cell lines.
MATERIALS AND METHODS
Cell culture
Neuroblastoma TICs (NB122R) were cultured in growth medium; DMEM/F12 (3:1;
Invitrogen), growth factors; bFGF (40 ng/mL; Peprotech), EGF (20 ng/mL; Invitrogen),
antibiotics; 1x B27, penicillin (100 u/mL) and streptomycin (100 µg/mL) (PEST).
TICs were cultured in a humidified incubator at approximately normoxic conditions
(21% O2) and 37 °C. Acriflavine and honokiol, solved in phosphate buffered saline
(PBS), was added to the cells in concentrations ranging between 0 and 1 µM with
solvent vehicle as control. SK-N-BE(2)C-cells were cultured in conventional minimal
essential medium (MEM/EBSS) containing 1% PEST and 10% FBS. 1µM acriflavine
was added to cells cultured under both normoxic and hypoxic conditions. Under
normoxic conditions the SK-N-BE2C-cells were cultured in a humified incubator at
approximately normoxic conditions (21% O2) and 37 °C. For hypoxic condition the
cells were cultured in a hypoxystation H35 cell culture incubator (Don Whitley) at 37
°C with 1% O2. Cells were counted in Bürker chambers.
Quantitative real-time PCR
A QIA-shredder kit was used (Qiagen) to homogenize and lyse the cells. The cells were
loaded onto an Rneasy spin column and then washed according to the qPCR protocol.
The RNA was then treated with DNAse and washed through spin columns. The RNA
was used to synthesize cDNA by using Multiscribe Reverse Transcriptase (Applied
Biosystems) and random primers. The cDNA was used as a template and a PCR
mastermix was formed by using SYBR green (Applied Biosystems), forward- and
reverse primers. The expression levels of VEGF, GLUT1, DEC1 and SERPINB9 were
normalized and quantified using three housekeeping genes (SDHA, UBC and YWHAZ)
(Vandesompele et al., 2002). Primer sequences are listed in Table 1.
10
RESULTS
Cell culture
Previous studies and unpublished data had suggested that acriflavine and honokiol
would target HIF-2α (Semenza et al., 2009, Dr Jack Arbiser, personal communication).
Two studies were performed where TICs were cultured for 72 h in 0, 5 and 10 µM of
honokiol and acriflavine, respectively, and two vehicle controls with the highest
volumes of DMSO used in the honokiol/acriflavine cultures. This initial study showed
that honokiol did not affect the number of TICs (Fig. 1A), but acriflavine drastically
reduced the number of cells in the culture, suggesting toxic effects (data not shown).
The concentration levels of acriflavine were lowered to a range between 0 to 1 µM in a
second study to give a more nuanced result. Figure 1B shows a concentration dependent
correlation between the number of TICs and the concentration of acriflavine. As
honokiol did not affect VEGF expression either (data not shown), we concentrated our
further efforts on acriflavine.
Acriflavine and HIF- 2α target genes
Since TICs are known to constituently express HIF-2α (Pietras et al., 2009) and
acriflavine is suggested to target HIF-1α and HIF-2α (Semenza et al., 2009), we
expected to see a decrease in the levels of VEGF, DEC1, GLUT1 and SERPINB9
expression. However, the mRNA results unexpectedly showed that VEGF expression,
which is indirectly used to monitor the activity of HIF-2α, did not decrease but showed
a tendency to increase at 1 µM of acriflavine, as determined by quantitative PCR (Fig.
2).
To further assess if HIF expression in TICs was altered by acriflavine, mRNA from
three additional genes (DEC1, GLUT1 and SERPINB9), commonly known to be driven
by either HIF-1, HIF-2 or both, were analyzed. DEC1 and SERPINB9 expression
increased at high levels of acriflavine (Fig. 2), following the same pattern as VEGF
albeit in the case of DEC1 more pronounced. The DEC1 data should be considered with
caution, since the individual data points varied considerably. GLUT1 on the other hand
displayed a seemingly concentration-dependent linear decrease (Fig. 2).
11
Neuroblastoma and hypoxia
Since TICs grown at normoxia has no or little HIF-1α activity, we instead cultured
neuroblastoma cells established as classical cell lines grown in serum, to assess the
effect of acriflavine on HIF-1α and HIF-2α under hypoxic conditions. As expected,
VEGF, DEC1, SERPINB9, and, to a lesser extent, GLUT1, increased as a result of
hypoxia in the neuroblastoma cells (SK-N-BE(2)C) (Fig. 3). Nevertheless, our data,
again, seems to indicate an unexpected rise in mRNA for VEGF, DEC1 and SERPINB9
after exposure to 1 µM acriflavine (Fig. 3). The GLUT1 results are more in line with
what was expected, suggesting decreasing mRNA levels after exposure to acriflavine
during both normoxia and hypoxia (Fig. 3D).
DISCUSSION
In recent years, an increasing number of studies have emphasized the crucial role of
TICs in the development and metastasis of tumors. If, somehow, there was a way to
differentiate the TICs into a classic bulk phenotype, the tumors could more readily be
eliminated by conventional treatment regimens.
Since HIF-2α has been shown to keep TICs in an undifferentiated state, HIF-2α
presented itself as a viable target for potential drugs. In 2009, acriflavine emerged as a
likely candidate after one report that it impairs the dimerization of both HIF-1α and
HIF-2α with HIF-1β (Semenza et al., 2009).
To measure the effect of acriflavine on HIF-2α, we monitored downstream changes
in the level of HIF-2α target gene expression. More specifically, the genes were VEGF,
DEC1, SERPINB9, and GLUT1. Given that acriflavine is an inhibitor of HIF-2α, we
expected to see a lowered expression across the board.
However, no such decrease was found. In our tested TICs, acriflavine appears not to
down-regulate HIF-2α.
Although acriflavine did not seem to have an effect on HIF-2α in TICs, it could still
have an effect on HIF-2α/HIF-1α in normal neuroblastoma cells. To study this, we
cultured neuroblastoma cells at hypoxia. The state of hypoxia triggers the
neuroblastoma cells to ramp up the levels of HIF-2α and HIF-1α, which, during
normoxic conditions, are present only in low levels. Importantly, during the acute state
of hypoxia, HIF-1α levels also rise markedly. This should result in further increased
levels of VEGF, since it is a target of both HIF-2α and HIF-1α.
12
Our results in the hypoxia trial did not show a decrease in neither HIF-2α nor HIF-
1α-driven genes, except for GLUT1, which however is also driven by other factors than
the HIFs. Our results stand in contrast to previous results (Semenza et al., 2009).
There could be several reasons for our results differing from previous ones; either a
methodological error is at fault, either the cause could lie in differences with
metabolism or intracellular interactions between different cell types, or there are some
forms of reversing concentration-dependent effects taking place.
If a systematical methodological error during the preparation and handling of the
cells is the explanation, one would expect to see the same pattern across all studied
genes. As mentioned above, the decrease of GLUT in hypoxia shows this to not be the
case.
The cellular mechanisms behind our results remain unclear. It is not unheard of that
the effects of a substance become reversed after reaching a threshold concentration, so
one could hypothesize that there are dosage-dependent pharmacological interactions
occurring which contribute to the tendency of higher DEC1, VEGF and SERPINB9
expression with high levels of acriflavine.
Although acriflavine might not be the final answer, the prospect of a working and
effective inhibitor of HIF-2α remains profoundly attractive, and further research should
be aimed at finding a suitable substance. In addition, there could also be benefits to
further examining the concentration-dependent duality of acriflavine on TICs and
neuroblastoma cells.
ACKNOWLEDGEMENTS
This work was carried out at the Center for Molecular Pathology, Department of
Laboratory Medicine, Lund University, Malmö University Hospital, Malmö, Sweden.
The work was supported by grants from Barncancerfonden. We wish to express our
deep gratitude to Sven Påhlman for invaluable ideas, support, and enthusiasm as well as
insightful input along the way. Alexander Pietras, without your skillfull technical
assistance, unfaltering patience and knack for making the complex easier to understand,
we would have been lost indeed. We would also like to extend our appreciation to Sofie,
Elisabet and Annika for your assistance.
13
REFERENCES
Guan Y, Ramasamy R. et al. G-rich Oligonucleotides Inhibit HIF-1α ad HIF-2α and
Block Tumor Growth. Molecular Therapy 2010;18:188-197.
Gupta P, Chaffer C, Weinberg R. Cancer Stem Cells: mirage or reality? Nature
Medicine 2009;15:1010-1012.
Hanahan D, Weinberg R. The Hallmarks of Cancer. Cell 2000;100:57-70.
Helen J. Knowles, Adrian L., Harris. Hypoxia and oxidative stress in breast cancer.
Hypoxia and tumourigenesis. Breast Cancer Research 2001:3 (5), 318-322
Helczynska et al. Hypoxia-Inducible Factor-2α Correlates to Distant Recurrence and
Poor Outcome in Invasive Breast Cancer. Cancer Res 2008;68:9212-9220.
Jögi et al. Hypoxia Alters Gene Expression In Human Neuroblastoma Cells toward an
Immature and Neural Crest-like Phenotype. PNAS 2002;99:7021-7026.
Lee K., Semenza, G.L. et al. Acriflavine inhibits HIF-1 dimerization, tumor growth, and
vascularization. PNAS 2009;106:17910-17915.
Makino et al. Inhibitory PAS domain protein is a negative regulator of hypoxia-
inducible gene expression. Nature 2001;414:550-554.
Nowell, P.C. The clonal evolution of tumor cell populations. Science 1976:194:23-28.
Pietras A. et al. HIF-2α maintains an undifferentiated state in neural crest-like human
neuroblastoma tumor-initiating cells. PNAS 2009;106:16805-16810.
Semenza G.L. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 2003;3:721-732.
14
Tian et al. The hypoxia-responsive transcription factor EPAS1 is essential for
catecholamine homeostasis and protection against heart failure during embryonic
development. Genes Dev 1997;12:3320-3324.
Vandesompele J et al. Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biol
2002;RESEARCH00034.1-0034.11.
Wainwright M. Acridine - a neglected antibacterial chromophore. J Antimicrob
Chemother 2001;47:1–13.
Wang, G.L., and Semenza, G.L. Purification and characterization of hypoxia-inducible
factor 1. J Biol Chem 1995;270:1230-1237.
Goldie H. et al. Topical effect of acriflavine compounds on growth and spread of
malignant cells. J Natl Cancer Inst.1959;23:841-855.
15
FIGURES
Fig. 1. Effect of honokiol (A) and acriflavine (B) on number of neuroblastoma TICs.
NB 122R TICs were treated with the indicated concentrations of honokiol and
acriflavine for 72 h. Cells were harvested and the number of cells were counted in a
Bürker chamber. The control culture number was set to one.
16
Fig. 2. Effects of acriflavine on relative DEC1, VEGF, SERPINB9 and GLUT1 in
neuroblastoma TICs. NB 122R TICs were treated with the indicated concentrations of
acriflavine for 72 h. mRNA was extracted according to Qiagen and Applied Biosystems
protocol.
17
Fig. 3. Effect of acriflavine on relative DEC1 (A), VEGF (B), SERPINB9 (C) and
GLUT1 (D) expression during normoxia and hypoxia with or without 1 M acriflavine.
SK-N-BE(2)C-cells were treated with acriflavine for 24 h at hypoxia (1% oxygen).
mRNA was extracted according to Qiagen and Applied Biosystems protocol. Results
for A were calculated using six data points, while three data points each were used for
B-D.
18
Table 1
Gene Forward primer (5’-3’) Reverse primer (5’-3’)
UBC ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGG
T
SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCA
T
YWHAZ ACTTTTGGTACATTGTGGCTTCA
A
CCGCCAGGACAAAACAGTAT
VEGF AGGAGGAGGGCAGAATCATCA CTCGATTGGATGGCAGTAGC
T
DEC1 CAGTGGCTATGGAGGAGAATCG GCGTCCGTGGTCACTTTTG
GLUT1 CTTCTATCCCAGGAGGTGGCTA
T
AATGGAGCCTGACCCCTAGA
G
SERPINB
9
CTTCGGCATTTGGGAATTGT GGTCTCTCTCCGCTGACATT
G