Effects on Neuroblastoma Tumor Initiating

Cells and Established Neuroblastoma Cell

Lines Using Putative Inhibitors of HIF-2α

Authors: David Schmidt, Tobias Lindeberg

Supervisors:

Bachelor Thesis

August 2010

Department of Laboratory Medicine, Center for Molecular Pathology,

CREATE Health and University Hospital MAS, Lund University, SE-205 02

Malmö, Sweden

2

Effects on Neuroblastoma Tumor

Initiating Cells and Established

Neuroblastoma Cell Lines Using Putative

Inhibitors of HIF-2α

Authors: David Schmidt, Tobias Lindeberg

Bachelor Thesis

August 2010

Abstract

A growing number of solid tumors have been shown to have a constitutively high

protein expression of HIF-2α f f y -inducible

transcription factors. In these tumors, which include neuroblastoma, glioma and

breast cancer, a high HIF-2α c w gg

metastasis and death. In this study, we have tried to inhibit the activity of HIF-2α

by preventing its dimerization with HIF-1β g c y c

neuroblastoma cell lines using honokiol and acriflavine, the aim being to induce

sympathetic neuronal differentiation of the neuroblastoma stem cells and

possibly thereby impairing cell proliferation. Since acriflavine should inhibit the

HIF-2α g g c w c c

levels of VEGF, DEC1, GLUT1 and SERPINB9 expression. This study shows that

acriflavine does not lower the expression of either VEGF, DEC1, GLUT1 or

SERPINB9 in tumor initiating cells and hypoxic neuroblastoma cell lines.

Keywords

Neuroblastoma, HIF-2α y c f k

Department of Laboratory Medicine, Center for Molecular Pathology, CREATE

Health and University Hospital MAS, Lund University, SE-205 02 Malmö, Sweden

3

TABLE OF CONTENTS

TABLE OF CONTENTS ................................................................................................. 3

ABSTRACT ..................................................................................................................... 4

ABBREVATIONS ........................................................................................................... 5

INTRODUCTION ............................................................................................................ 5

Tumor initiation and metastasis .................................................................................... 5

Clonal evolution ........................................................................................................... 6

Cancer stem cells .......................................................................................................... 6

Neuroblastoma .............................................................................................................. 6

Tumors and hypoxia ..................................................................................................... 6

Hypoxia-inducible factors ............................................................................................ 7

AIMS OF THE PRESENT STUDY ................................................................................. 9

MATERIALS AND METHODS ..................................................................................... 9

Cell culture ................................................................................................................... 9

Quantitative real-time PCR .......................................................................................... 9

RESULTS ....................................................................................................................... 10

Cell culture ................................................................................................................. 10

Acriflavine and HIF- 2α target genes ......................................................................... 10

Neuroblastoma and hypoxia ....................................................................................... 11

DISCUSSION ................................................................................................................. 11

ACKNOWLEDGEMENTS ........................................................................................... 12

REFERENCES ............................................................................................................... 13

FIGURES ....................................................................................................................... 15

4

Effects on Neuroblastoma Tumor Initiating Cells and Established

Neuroblastoma Cell Lines Using Putative Inhibitors of HIF-2α

Tobias Lindeberg, David Schmidt

Author Affiliations

Department of Laboratory Medicine, Center for Molecular Pathology, CREATE Health

and University Hospital MAS, Lund University, SE-205 02 Malmö, Sweden

ABSTRACT

A growing number of solid tumors have been shown to have a constitutively high

protein expression of HIF-2α, one of three identified hypoxia-inducible transcription

factors. In these tumors, which include neuroblastoma, glioma and breast cancer, a high

HIF-2α expression correlates with aggressive disease, metastasis and death. In this

study, we have tried to inhibit the activity of HIF-2α by preventing its dimerization with

HIF-1β in tumor initiating cells and hypoxic neuroblastoma cell lines using honokiol

and acriflavine, the aim being to induce sympathetic neuronal differentiation of the

neuroblastoma stem cells and possibly thereby impairing cell proliferation. Since

acriflavine should inhibit the HIF-2α expressing tumor initiating cells, we expected to

see a decrease in the levels of VEGF, DEC1, GLUT1 and SERPINB9 expression. This

study shows that acriflavine does not lower the expression of either VEGF, DEC1,

GLUT1 or SERPINB9 in tumor initiating cells and hypoxic neuroblastoma cell lines.

5

ABBREVATIONS

ARNT Aryl hydrocarbon receptor nuclear

bHLH Basic helix-loop-helix

BNIP3 BCL2/adenovirus E1B 19 kDa protein-interacting protein 3

CSC Cancer stem cell

DEC1 Deleted in esophageal cancer

DMSO Dimethyl sulfoxide

GLUT1 Glucose transporter 1

HIF Hypoxia inducible factor

MEM Minimal Essential Medium

PBS phosphate buffered saline

PHD Prolyl hydroxylase

PEST Penicillin streptomycin

SERPINB9 Serpin peptidase inhibitor, clade B, 9

SNS Sympathetic nervous system

TIC Tumor initiating cells

VEGF Vascular endothelial growth factor

VHL Von Hippel-Lindau protein

qPCR Real-time quantitative polymerase chain reaction

INTRODUCTION

Cancer is a genetic disease where mutations or alterations of the genome change the

control mechanism and/or function of the replicating cell. If the cell survives, this leads

to a change in behavior where the cell can begin to replicate uncontrollably and initiate

a tumor. In 2000, Hanahan and Weinberg suggested that in most tumors, if not all, the

cell has to acquire six capabilities to become a cancer. These are self-sufficiency in

growth signals, insensitivity to anti-growth signals, tissue invasion and metastasis,

limitless replicative potential, sustained angiogenesis and avoiding apoptosis (Hanahan

& Weinberg, 2000). The focus of this study is on the effects of putative inhibitors on

sustained angiogenesis, tissue invasion and metastasis.

Tumor initiation and metastasis

At present, there are two prevalent theories in the field of tumor progression and

metastasis: the clonal evolution theory and the cancer stem cell (CSCs) theory.

6

Clonal evolution

Some researchers claim that tumors progress from one single cell that has acquired a

beneficial growth advantage compared to adjacent normal cells (Nowell, 1976).

According to this theory, the growth advantage causes that cell to proliferate, resulting

in several new neoplastic alterations, of which the advantageous ones proceed while the

not so fortunate are eliminated. This way, only the most favorable cell becomes a

precursor to the primary tumor.

Cancer stem cells

On the other hand, there are an increasing number of researchers who assume that there

is a small subpopulation of cells within the tumor with stem cell-like properties that can

replicate itself an unlimited amount of times as well as create new differentiated cell

types that only have limited replicative capacity. This implies that it is the CSCs that

metastasize and colonize a new locus. These cancer cells can originate from stem cells

or have dedifferentiated into stem cell-like cells and are, to avoid confusion, therefore

often referred to as tumor initiating cells (TICs) (Gupta et al., 2009).

Neuroblastoma

Neuroblastoma is a childhood tumor, which rarely is diagnosed after the age of 10

years. There are several types of neuroblastoma in which the grade of differentiation is

correlated to the severity and aggressiveness of the disease (Fredlund et al., 2008).

Neuroblastoma tumors derive from immature or precursor cells of the sympathetic

nervous system (SNS). The finding of corresponding marker gene expression further

supports this hypothesis (Edsjö et al., 2007). The tumors can occur in any structure of

the SNS.

Tumors and hypoxia

Gene expression in cells is regulated by many interdependent intra- and extracellular

factors. One of these factors is the availability of oxygen: during hypoxia, a reduction in

tissue oxygen tension, gene expression is heavily altered, leading to a cell phenotype

more capable of withstanding the new extracellular conditions.

7

In spite of avidly adapting themselves to hypoxia, tumors generally have a tendency

to develop intratumoral hypoxia due to the fact that they produce poorly functioning

blood vessels with severe structural abnormalities compared to the ones in normal tissue

(Knowles et al., 2001). This is of particular importance, since published data have

shown that tumor hypoxia is associated with increased metastasis and poor survival

(Vaupel et al., 2001) and induces dedifferentiation of tumor cells (Axelsson et al., 2005,

Pietras et al., 2009, Jögi et al., 2002).

Hypoxic tumors are more aggressive and are also more resistant to radiation therapy,

because the destructive effect of ionizing radiation is dependent on free radicals from

oxygen (Knowles et al., 2001). Although the hypoxic response of cells is a complex and

multi-faceted process, the hypoxia-inducible factors (HIFs) have emerged as some of

the most contributing pieces of the puzzle.

Hypoxia-inducible factors

Hypoxia-inducible factors are heterodimeric transcription factors, capable of mediating

adaptive responses to hypoxia. They have been shown to play crucial roles in tumor

growth and vascularization as well as maintaining an undifferentiated state in tumor-

initiating cells (Axelson et al., 2005). They consist of one α-subunit and one β-subunit,

which together form the active complex. To date, three different subunits of HIF-α are

known; HIF-1α (Wang and Semenza, 1995), HIF-2α (Tian et al., 1997) and HIF-3α

(Makino et al., 2001). Both HIF-1α and HIF-2α form heterodimers with HIF-1β, while

HIF-3α is thought to act as a negative regulator of hypoxia-induced gene expression.

Although their names suggest otherwise, in most cells both HIF-1α and HIF-2α are

constitutively expressed during normoxia as well as hypoxia. During normoxia,

however, they are rapidly hydroxylated by prolyl hydroxylase 1-3 (PHD 1-3) which

makes them recognizable by the von Hippel-Lindau protein (VHL). This, in turn, results

in ubiquination, which targets the HIFs for proteosomal degradation. Since the

hydroxylation occurs through a reaction that is oxygen dependent, O2 becomes a

limiting substrate (Semenza, 2003). During hypoxia, the proteosomal degradation of

HIFs slow down, and consequently, an increase of cytosolic HIFs can be seen.

The HIFs immediately enter the nucleus, where they form a complex with HIF-1β

and form the active transcription factor. HIF-1 and HIF-2 then bind to, and activate the

expression of, several hypoxia-response genes, including, but not limited to, vascular

endothelial growth factor (VEGF), glucose transporter 1 (GLUT1), deleted in

8

esophageal cancer-1 (DEC1) and serpin peptidase inhibitor, clade B, member 9

(SERPINB9).

Although HIF-1α and HIF-2α seem to share most of their target genes, they appear to

have a few somewhat exclusive targets, best exemplified by BCL2/adenovirus E1B 19

kDa protein-interacting protein 3 (BNIP3) for HIF-1α and SERPINB9 for HIF-2α.

Between HIF-1α and HIF-2α, HIF-1α is more often linked to tumor aggressiveness

and the regulation of most hypoxia-induced genes. This might, in part, be due to the fact

that HIF-1α has been more extensively studied than HIF-2α (Semenza et al., 2009).

While the role of HIF-2α is less clear, it has been suggested that HIF-2α mediates a

more chronic response to hypoxia than HIF-1α (Holmquist-Mengelbier et al., 2006). As

summarized in Pietras (2010), in some tumor forms, HIF-2α is linked to low overall

survival and aggressive behavior, whilst HIF-1α in contrast is correlated with an overall

better survival (Helczynska et al., 2008; Noguera et al., 2009). Also, HIF-2α preserves

an undifferentiated state in neuroblastoma cells (Pietras et al., 2009), and a growing

number of solid tumors have been shown to express constitutively high levels of HIF-

2α, which in these tumors correlates with an aggressive disease progression, metastasis

and death (Holmquist-Mengelbier et al., 2006; Helczynska et al., 2008; Noguera et al.,

2009).

Acriflavine

Acriflavine has long been used against sleeping sickness, and is known to have

antibacterial and antiviral effects. The effects of acriflavine on cancer were described

over 50 years ago, but was then somewhat forgotten in the cancer field (Goldie et al.,

1959). Recently, studies have redirected their focus back on its anticancerous effects,

and it was found to have an inhibiting effect on HIF-2α and HIF-1α (Semenza et al.,

2009). It has also been administered to patients for several months without any major

adverse effects.

In light of the potential impact of a pharmaceutical substance targeting HIF-2α, we

set out to evaluate the effectiveness of putative inhibitors in order to achieve

sympathetic neuronal differentiation, and thereby impair cell proliferation.

Unfortunately, our results did not confirm the inhibiting effects of neither acriflavine

nor honokiol on our studied cell types.

9

AIMS OF THE PRESENT STUDY

The aim of this study is to evaluate honokiol and acriflavine as potential inhibitors for

the activity of HIF-2α by preventing its dimerization with HIF-1β in tumor initiating

cells and hypoxic neuroblastoma cell lines.

MATERIALS AND METHODS

Cell culture

Neuroblastoma TICs (NB122R) were cultured in growth medium; DMEM/F12 (3:1;

Invitrogen), growth factors; bFGF (40 ng/mL; Peprotech), EGF (20 ng/mL; Invitrogen),

antibiotics; 1x B27, penicillin (100 u/mL) and streptomycin (100 µg/mL) (PEST).

TICs were cultured in a humidified incubator at approximately normoxic conditions

(21% O2) and 37 °C. Acriflavine and honokiol, solved in phosphate buffered saline

(PBS), was added to the cells in concentrations ranging between 0 and 1 µM with

solvent vehicle as control. SK-N-BE(2)C-cells were cultured in conventional minimal

essential medium (MEM/EBSS) containing 1% PEST and 10% FBS. 1µM acriflavine

was added to cells cultured under both normoxic and hypoxic conditions. Under

normoxic conditions the SK-N-BE2C-cells were cultured in a humified incubator at

approximately normoxic conditions (21% O2) and 37 °C. For hypoxic condition the

cells were cultured in a hypoxystation H35 cell culture incubator (Don Whitley) at 37

°C with 1% O2. Cells were counted in Bürker chambers.

Quantitative real-time PCR

A QIA-shredder kit was used (Qiagen) to homogenize and lyse the cells. The cells were

loaded onto an Rneasy spin column and then washed according to the qPCR protocol.

The RNA was then treated with DNAse and washed through spin columns. The RNA

was used to synthesize cDNA by using Multiscribe Reverse Transcriptase (Applied

Biosystems) and random primers. The cDNA was used as a template and a PCR

mastermix was formed by using SYBR green (Applied Biosystems), forward- and

reverse primers. The expression levels of VEGF, GLUT1, DEC1 and SERPINB9 were

normalized and quantified using three housekeeping genes (SDHA, UBC and YWHAZ)

(Vandesompele et al., 2002). Primer sequences are listed in Table 1.

10

RESULTS

Cell culture

Previous studies and unpublished data had suggested that acriflavine and honokiol

would target HIF-2α (Semenza et al., 2009, Dr Jack Arbiser, personal communication).

Two studies were performed where TICs were cultured for 72 h in 0, 5 and 10 µM of

honokiol and acriflavine, respectively, and two vehicle controls with the highest

volumes of DMSO used in the honokiol/acriflavine cultures. This initial study showed

that honokiol did not affect the number of TICs (Fig. 1A), but acriflavine drastically

reduced the number of cells in the culture, suggesting toxic effects (data not shown).

The concentration levels of acriflavine were lowered to a range between 0 to 1 µM in a

second study to give a more nuanced result. Figure 1B shows a concentration dependent

correlation between the number of TICs and the concentration of acriflavine. As

honokiol did not affect VEGF expression either (data not shown), we concentrated our

further efforts on acriflavine.

Acriflavine and HIF- 2α target genes

Since TICs are known to constituently express HIF-2α (Pietras et al., 2009) and

acriflavine is suggested to target HIF-1α and HIF-2α (Semenza et al., 2009), we

expected to see a decrease in the levels of VEGF, DEC1, GLUT1 and SERPINB9

expression. However, the mRNA results unexpectedly showed that VEGF expression,

which is indirectly used to monitor the activity of HIF-2α, did not decrease but showed

a tendency to increase at 1 µM of acriflavine, as determined by quantitative PCR (Fig.

2).

To further assess if HIF expression in TICs was altered by acriflavine, mRNA from

three additional genes (DEC1, GLUT1 and SERPINB9), commonly known to be driven

by either HIF-1, HIF-2 or both, were analyzed. DEC1 and SERPINB9 expression

increased at high levels of acriflavine (Fig. 2), following the same pattern as VEGF

albeit in the case of DEC1 more pronounced. The DEC1 data should be considered with

caution, since the individual data points varied considerably. GLUT1 on the other hand

displayed a seemingly concentration-dependent linear decrease (Fig. 2).

11

Neuroblastoma and hypoxia

Since TICs grown at normoxia has no or little HIF-1α activity, we instead cultured

neuroblastoma cells established as classical cell lines grown in serum, to assess the

effect of acriflavine on HIF-1α and HIF-2α under hypoxic conditions. As expected,

VEGF, DEC1, SERPINB9, and, to a lesser extent, GLUT1, increased as a result of

hypoxia in the neuroblastoma cells (SK-N-BE(2)C) (Fig. 3). Nevertheless, our data,

again, seems to indicate an unexpected rise in mRNA for VEGF, DEC1 and SERPINB9

after exposure to 1 µM acriflavine (Fig. 3). The GLUT1 results are more in line with

what was expected, suggesting decreasing mRNA levels after exposure to acriflavine

during both normoxia and hypoxia (Fig. 3D).

DISCUSSION

In recent years, an increasing number of studies have emphasized the crucial role of

TICs in the development and metastasis of tumors. If, somehow, there was a way to

differentiate the TICs into a classic bulk phenotype, the tumors could more readily be

eliminated by conventional treatment regimens.

Since HIF-2α has been shown to keep TICs in an undifferentiated state, HIF-2α

presented itself as a viable target for potential drugs. In 2009, acriflavine emerged as a

likely candidate after one report that it impairs the dimerization of both HIF-1α and

HIF-2α with HIF-1β (Semenza et al., 2009).

To measure the effect of acriflavine on HIF-2α, we monitored downstream changes

in the level of HIF-2α target gene expression. More specifically, the genes were VEGF,

DEC1, SERPINB9, and GLUT1. Given that acriflavine is an inhibitor of HIF-2α, we

expected to see a lowered expression across the board.

However, no such decrease was found. In our tested TICs, acriflavine appears not to

down-regulate HIF-2α.

Although acriflavine did not seem to have an effect on HIF-2α in TICs, it could still

have an effect on HIF-2α/HIF-1α in normal neuroblastoma cells. To study this, we

cultured neuroblastoma cells at hypoxia. The state of hypoxia triggers the

neuroblastoma cells to ramp up the levels of HIF-2α and HIF-1α, which, during

normoxic conditions, are present only in low levels. Importantly, during the acute state

of hypoxia, HIF-1α levels also rise markedly. This should result in further increased

levels of VEGF, since it is a target of both HIF-2α and HIF-1α.

12

Our results in the hypoxia trial did not show a decrease in neither HIF-2α nor HIF-

1α-driven genes, except for GLUT1, which however is also driven by other factors than

the HIFs. Our results stand in contrast to previous results (Semenza et al., 2009).

There could be several reasons for our results differing from previous ones; either a

methodological error is at fault, either the cause could lie in differences with

metabolism or intracellular interactions between different cell types, or there are some

forms of reversing concentration-dependent effects taking place.

If a systematical methodological error during the preparation and handling of the

cells is the explanation, one would expect to see the same pattern across all studied

genes. As mentioned above, the decrease of GLUT in hypoxia shows this to not be the

case.

The cellular mechanisms behind our results remain unclear. It is not unheard of that

the effects of a substance become reversed after reaching a threshold concentration, so

one could hypothesize that there are dosage-dependent pharmacological interactions

occurring which contribute to the tendency of higher DEC1, VEGF and SERPINB9

expression with high levels of acriflavine.

Although acriflavine might not be the final answer, the prospect of a working and

effective inhibitor of HIF-2α remains profoundly attractive, and further research should

be aimed at finding a suitable substance. In addition, there could also be benefits to

further examining the concentration-dependent duality of acriflavine on TICs and

neuroblastoma cells.

ACKNOWLEDGEMENTS

This work was carried out at the Center for Molecular Pathology, Department of

Laboratory Medicine, Lund University, Malmö University Hospital, Malmö, Sweden.

The work was supported by grants from Barncancerfonden. We wish to express our

deep gratitude to Sven Påhlman for invaluable ideas, support, and enthusiasm as well as

insightful input along the way. Alexander Pietras, without your skillfull technical

assistance, unfaltering patience and knack for making the complex easier to understand,

we would have been lost indeed. We would also like to extend our appreciation to Sofie,

Elisabet and Annika for your assistance.

13

REFERENCES

Guan Y, Ramasamy R. et al. G-rich Oligonucleotides Inhibit HIF-1α ad HIF-2α and

Block Tumor Growth. Molecular Therapy 2010;18:188-197.

Gupta P, Chaffer C, Weinberg R. Cancer Stem Cells: mirage or reality? Nature

Medicine 2009;15:1010-1012.

Hanahan D, Weinberg R. The Hallmarks of Cancer. Cell 2000;100:57-70.

Helen J. Knowles, Adrian L., Harris. Hypoxia and oxidative stress in breast cancer.

Hypoxia and tumourigenesis. Breast Cancer Research 2001:3 (5), 318-322

Helczynska et al. Hypoxia-Inducible Factor-2α Correlates to Distant Recurrence and

Poor Outcome in Invasive Breast Cancer. Cancer Res 2008;68:9212-9220.

Jögi et al. Hypoxia Alters Gene Expression In Human Neuroblastoma Cells toward an

Immature and Neural Crest-like Phenotype. PNAS 2002;99:7021-7026.

Lee K., Semenza, G.L. et al. Acriflavine inhibits HIF-1 dimerization, tumor growth, and

vascularization. PNAS 2009;106:17910-17915.

Makino et al. Inhibitory PAS domain protein is a negative regulator of hypoxia-

inducible gene expression. Nature 2001;414:550-554.

Nowell, P.C. The clonal evolution of tumor cell populations. Science 1976:194:23-28.

Pietras A. et al. HIF-2α maintains an undifferentiated state in neural crest-like human

neuroblastoma tumor-initiating cells. PNAS 2009;106:16805-16810.

Semenza G.L. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 2003;3:721-732.

14

Tian et al. The hypoxia-responsive transcription factor EPAS1 is essential for

catecholamine homeostasis and protection against heart failure during embryonic

development. Genes Dev 1997;12:3320-3324.

Vandesompele J et al. Accurate normalization of real-time quantitative RT-PCR data by

geometric averaging of multiple internal control genes. Genome Biol

2002;RESEARCH00034.1-0034.11.

Wainwright M. Acridine - a neglected antibacterial chromophore. J Antimicrob

Chemother 2001;47:1–13.

Wang, G.L., and Semenza, G.L. Purification and characterization of hypoxia-inducible

factor 1. J Biol Chem 1995;270:1230-1237.

Goldie H. et al. Topical effect of acriflavine compounds on growth and spread of

malignant cells. J Natl Cancer Inst.1959;23:841-855.

15

FIGURES

Fig. 1. Effect of honokiol (A) and acriflavine (B) on number of neuroblastoma TICs.

NB 122R TICs were treated with the indicated concentrations of honokiol and

acriflavine for 72 h. Cells were harvested and the number of cells were counted in a

Bürker chamber. The control culture number was set to one.

16

Fig. 2. Effects of acriflavine on relative DEC1, VEGF, SERPINB9 and GLUT1 in

neuroblastoma TICs. NB 122R TICs were treated with the indicated concentrations of

acriflavine for 72 h. mRNA was extracted according to Qiagen and Applied Biosystems

protocol.

17

Fig. 3. Effect of acriflavine on relative DEC1 (A), VEGF (B), SERPINB9 (C) and

GLUT1 (D) expression during normoxia and hypoxia with or without 1 M acriflavine.

SK-N-BE(2)C-cells were treated with acriflavine for 24 h at hypoxia (1% oxygen).

mRNA was extracted according to Qiagen and Applied Biosystems protocol. Results

for A were calculated using six data points, while three data points each were used for

B-D.

18

Table 1

Gene Forward primer (5’-3’) Reverse primer (5’-3’)

UBC ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGG

T

SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCA

T

YWHAZ ACTTTTGGTACATTGTGGCTTCA

A

CCGCCAGGACAAAACAGTAT

VEGF AGGAGGAGGGCAGAATCATCA CTCGATTGGATGGCAGTAGC

T

DEC1 CAGTGGCTATGGAGGAGAATCG GCGTCCGTGGTCACTTTTG

GLUT1 CTTCTATCCCAGGAGGTGGCTA

T

AATGGAGCCTGACCCCTAGA

G

SERPINB

9

CTTCGGCATTTGGGAATTGT GGTCTCTCTCCGCTGACATT

G