BRIEF REPORT
Evaluation of the RHINO gene for breast cancer predispositionin Finnish breast cancer families
Tuomas Heikkinen • Sofia Khan • Elina Huovari • Sara Vilske •
Johanna Schleutker • Anne Kallioniemi • Carl Blomqvist •
Kristiina Aittomaki • Heli Nevanlinna
Received: 11 February 2014 / Accepted: 12 February 2014 / Published online: 22 February 2014
� Springer Science+Business Media New York 2014
Abstract Hereditary predisposition to breast cancer is
largely affected by the mutations in the genes of the DNA
repair pathways. Novel genes involved in DNA repair are
therefore prospective candidates also for breast cancer
susceptibility genes. The RHINO (Rad9, Rad1, Hus1-
interacting nuclear orphan) gene plays a central role in
DNA damage response and in cell cycle regulation.
RHINO interacts with Rad9-Rad1-Hus1 (9-1-1) complex
and with ATR activator TopBP1, which recruit it to the site
of DNA damage. We analyzed the effects of the germline
variation in RHINO on breast cancer risk. We sequenced
the coding region of the RHINO gene 466 index cases of
Finnish breast cancer families and in 507 population con-
trols. The genotypes of the most likely functional variant
were further determined in a large dataset of 2,944 cases
and 1,976 controls. We analyzed the common variation of
the RHINO locus and determined the haplotypes using five
SNPs in 1,531 cases and 1,233 controls. We identified
seven variants including four missense variations, a 50 UTR
variant, a silent variant, and a nonsense variant c.250C[T,
R84X (rs140887418). All variants were also present in
control individuals with frequencies close to those of the
cases (P [ 0.05). The c.250C[T variant was present in 12
breast cancer patients (0.4 %) and of 16 controls (0.8 %)
with the difference not statistically significant (OR = 0.50,
95 %CI: 0.24–1.06, P = 0.066). The haplotype frequen-
cies did not differ in cases and controls (P = 0.59).
Germline variation in the RHINO gene is unlikely to
influence inherited susceptibility to breast cancer.
Keywords RHINO � Rad9, Rad1, Hus1-interacting
nuclear orphan � Breast cancer susceptibility gene �Candidate gene � Germline variation � Genetic risk �Familial breast cancer
Introduction
Inherited predisposition to breast cancer is for a large
proportion caused by mutations in genes involved in
homologous recombination DNA double strand break
repair machinery, most notably BRCA1, BRCA2, and
PALB2 [1, 2]. Mutations in these genes affect the breast
cancer susceptibility typically with high or moderate pen-
etrance and are found mostly in families with multiple
affected individuals making them rare in general popula-
tion [3]. Some of the notable moderate penetrance genes
include ATM, CHEK2, and BACH1, all with functions
related to DNA damage response or cell cycle control, with
approximately two-fold increase in the risk of breast cancer
T. Heikkinen (&) � S. Khan � E. Huovari � S. Vilske �H. Nevanlinna
Department of Obstetrics and Gynecology, University of
Helsinki and Helsinki University Central Hospital, Biomedicum
Helsinki, P. O. Box 700, 00029 Helsinki, Finland
e-mail: [email protected]
J. Schleutker � A. Kallioniemi
Institute of Biomedical Technology/BioMediTech, University of
Tampere and Fimlab Laboratories, Tampere, Finland
J. Schleutker
Medical Biochemistry and Genetics, Institute of Biomedicine
University of Turku, Turku, Finland
C. Blomqvist
Department of Oncology, Helsinki University Central Hospital,
Helsinki, Finland
K. Aittomaki
Department of Clinical Genetics, Helsinki University Central
Hospital, Helsinki, Finland
123
Breast Cancer Res Treat (2014) 144:437–441
DOI 10.1007/s10549-014-2884-z
[1]. Other genes involved in the DNA repair mechanisms
are also prospective candidates for breast cancer suscepti-
bility genes. A recently identified gene RHINO (Rad9,
Rad1, Hus1-interacting nuclear orphan), participates in
DNA damage response signaling [4]. RHINO interacts with
Rad9-Rad1-Hus1 (9-1-1) complex and with ATR activator
TopBP1, which recruit RHINO to the site of DNA damage.
RHINO is also involved in G1 to S phase transition and in
CHEK1 phosphorylation. The central role RHINO plays in
DNA damage repair makes it an interesting candidate gene
for cancer susceptibility.
The RHINO gene, located on chromosome 12p13.33,
consists of only two exons coding for a protein of 238
amino acids. The protein contains a conserved hypothetical
APSES DNA binding domain (SWVPDF) between resi-
dues 55 and 61, and it has overall high level of conserva-
tion on the N- and C-terminal regions. The SWVPDF motif
is required for interaction with 9-1-1 complex, but not with
TopBP1, and it is needed for localization to the sites of
DNA damage [4].The RHINO transcript (C12orf32) has
been reported to be overexpressed in breast cancer with
very low expression levels in normal tissue with the
silencing of the gene also repressing the growth of breast
cancer cell lines [5].
To evaluate the impact of the variation in the RHINO
gene on breast cancer risk, we sequenced the protein
coding regions of the gene, with exon–intron boundaries, in
a large set of 466 breast cancer families and in 507 pop-
ulation controls. We further determined the genotypes of
the most potentially functional variant in larger set of cases
and controls and also in an independent breast cancer case–
control dataset. We also analyzed the effects of common
variation of the gene region with haplotype analysis in
cases and controls.
Materials and methods
Patients
Germline DNA isolated from whole blood samples of
Finnish breast cancer patients and controls from Helsinki
and Tampere regions were analyzed for variation in the
RHINO gene. The Helsinki series consisted of two unse-
lected breast cancer cohorts collected at the Helsinki
University Central Hospital department of oncology in
1997–1998 with 884 patients [6, 7] and in the department
of surgery in 2000 with 986 patients [8] covering 79 and
87 %, respectively, of all consecutive newly diagnosed
breast cancer cases during the time of collection. Addi-
tional familial cases were collected at the department of
Clinical Genetics [9].The unaffected female population
controls were collected from the matching geographical
region. The second series of breast cancer patients and
controls was collected in the Tampere region Finland
consisting of 787 cases and 816 controls. The cancer
diagnoses were confirmed through Finnish Cancer Registry
and hospital records.The study was carried out with the
informed consent from the participants and with permis-
sion from the respective ethics committees.
DNA analyses
The coding region and the exon intron boundaries of the
RHINO gene consisting of two exons were bi-directionally
sequenced from DNA samples of index patients of 466 of
breast and ovarian cancer families found negative for
BRCA1 and BRCA2 mutations, and of 507 population
controls. The primer sequences for exon 1 were AAA
TGTTCGTTAGATGAATGTTGA and GAATGGTGTGA
ACCCAGGAG and for exon 2 CCCCGATTTAAGA
GTCTGGTC and TTGAATTCCTTTATGACTCCAGAA.
The PCR products were purified with ExoSAP-IT treat-
ment (Affymetrix) and sequenced using ABI BigDye
Terminator 3.1 Cycle sequencing kit (Life Technologies).
The sequencing reactions were analyzed with the service
provided by FIMM Sequencing services with ABI3730xl
DNA Analyzer (Life Technologies). The sequence traces
were examined using Variant Reporter 1.0 software (Life
Technologies). The c.250G[T variant (rs140887418) was
further genotyped in larger data sets of Helsinki and
Tampere regions using custom TaqMan allelic discrimi-
nation assay and TaqMan Genotyping Master Mix (Life
Technologies). PCR was performed in 7500 Fast Real-
Time PCR System or in 9800 Fast Thermal Cycler, and
genotype calling was performed with 7500 Fast Real-Time
PCR System and ABI Prism 7500 SDS v1.4 software (Life
Technologies).
Statistical methods and bioinformatics
The differences in the genotype frequencies were evaluated
using V2 test, and when the count in any cell was less than
five, with Fishers exact test. All P values are two-sided.
The functional consequences of the identified missense
variants on the protein were evaluated with SIFT, Poly-
phen-2, and SNPs3D tools.We analyzed common variation
surrounding the region for the RHINO gene with the
genotypes determined in iCOGS chip genotyping [10] for
1,531 breast cancer patients and 1,233 populations controls
of the Helsinki study. Five SNPs (rs11062370, rs17834697,
rs11062381, rs1860434, and rs2041311), located at posi-
tions 12:2937298-3021000 spanning 83,702 bp, were taken
into the haplotype analyses with Phase 2.1 software, and
the frequencies of the haplotypes were compared between
cases and controls.
438 Breast Cancer Res Treat (2014) 144:437–441
123
Results
The sequencing of the coding region of the RHINO gene
revealed seven sequence changes: one 50 UTR variant,
four amino acid changing missense variants, one silent
variant on protein coding region, and one nonsense variant
introducing a premature stop codon (Table 1). Although
bioinformatics prediction tools suggested some of the
missense variants to have deleterious effects on protein
product (Table 2), no difference was seen with the fre-
quency of any of the variants between the cases and
controls (Table 1). The nonsense variant c.250C[T was
further genotyped in larger material as it was considered
to be the most likely functional variant by terminating the
translation and removing 66 % of the protein product. Of
the 5,343 samples analyzed, the genotyping was suc-
cessful for 5,165 (97 %). There was no significant dif-
ference in the frequencies of the c.250C[T variant
between cases and controls, although it was slightly more
common in controls (Table 3). Altogether 15 haplotypes
were present among the 2,765 study subjects of the Hel-
sinki breast cancer study analyzed with iCOGS chip, but
they were not differentially distributed in cases and con-
trols (P = 0.59) (Table 4).
Discussion
To our knowledge, this is the first report on the analysis of
genetic variation in the RHINO gene in cancer families.
The large number of cases and controls sequenced here in
parallel allowed us to analyze the associations of all
identified variants directly. None of the variants regardless
of their predicted impact on protein product was present
with a significantly different frequency in cases and con-
trols. The most likely candidate for a functional variant was
the truncating c.250C[T change. It, however, was not
more frequent among breast cancer cases compared to
normal population, which strongly indicates that inherited
variation in the RHINO gene does not affect breast cancer
susceptibility. As the c.250C[T variant and the missense
changes were present with low frequency in the Finnish
population possible low penetrance risk effects cannot be
completely excluded, but due to the rarity of the variants,
the detection of such effects would require extremely large
sample sets.
ATR and TopBP1, interaction partners of RHINO, play
a central role of in DNA repair, cell cycle regulation, and
have further interactions and functional similarities with
known breast cancer genes, particularly BRCA1 and ATM,
Table 1 Detected variants in the sequencing of the RHINO gene with frequencies in cases and controls
Variant Rs number Protein effect AA Aa aa P value
c.-28T[G (rs73040528) na Cases 459 98.5 % 7 1.5 % 0 0.0 % 0.3301
Controls 495 97.6 % 12 2.4 % 0 0.0 %
c.22C[T (rs34096285) R8C Cases 465 99.8 % 1 0.2 % 0 0.0 % 1
Controls 505 99.6 % 2 0.4 % 0 0.0 %
c.45–46GC[AG (rs138375075, rs150099344) L16V Cases 460 98.7 % 6 1.3 % 0 0.0 % 0.3244
Controls 504 99.4 % 3 0.6 % 0 0.0 %
c.80A[G (rs142328102) K27R Cases 460 98.7 % 6 1.3 % 0 0.0 % 0.2941
Controls 496 97.8 % 11 2.2 % 0 0.0 %
c.250C[T (rs140887418) R84X Cases 464 99.6 % 2 0.4 % 0 0.0 % 0.1812
Controls 500 98.6 % 7 1.4 % 0 0.0 %
c.328C[G (rs373986339) P110A Cases 466 100.0 % 0 0.0 % 0 0.0 % 1
Controls 506 99.8 % 1 0.2 % 0 0.0 %
c.489G[A (rs2907608) S163S Cases 214 45.9 % 182 39.1 % 70 15.0 % 0.4800
Controls 240 47.4 % 198 39.1 % 68 13.4 %
Table 2 The predicted effects
on the protein product of the
identified RHINO missense
variants
Protein
effect
SIFT PolyPhen-2 SNPs3D
R8C 0.08 (tolerated) Benign -0.68 (deleterious)
L16V 0.00 (intolerated) Probably damaging -1.16 (deleterious)
K27R 0.42 (tolerated) Probably damaging 1.03 (non-deleterious)
P130A 0.08 (tolerated) Probably damaging -1.08 (deleterious)
Breast Cancer Res Treat (2014) 144:437–441 439
123
which have made them prospective candidate genes for
breast cancer susceptibility. Despite these features, no
association with breast cancer risk and variation in the ATR
gene has been identified [11, 12]. A missense variant
R309C in the TopBP1 gene has been suggested to be
associated with breast cancer risk [13], but in further
investigations this association has not been validated [14].
The hereditary background of breast cancer remains
largely unexplained although recent advances not only in
the discovery of low penetrance alleles but also in mod-
erate penetrance variants have increased the knowledge of
the subject [15]. Recently, the number of identified low
penetrance variants for breast cancer association has
increased considerably through the successful consortia
collaborations and is reaching for the level for the multi-
plicative model to make clinical significance [10]. The
genes coding for proteins involved in DNA repair
machinery, however, remains putative candidates for can-
cer susceptibility. As high throughput sequencing of exo-
mes and genomes is becoming more common in the
management of breast cancer families the inevitable find-
ings of potentially pathogenic variants in candidate genes
will require careful evaluation. The results here emphasize
the importance of large sample sets of cases and controls in
evaluation of variants based on the in silico functional
predictions also when interpreting the findings emerging
from deep sequencing projects.
Acknowledgments We thank research nurse Irja Erkkila for assis-
tance with data management. The Finnish Cancer Registry is
acknowledged for diagnostic data. The study has been funded by the
Helsinki University Central Hospital Research Fund, the Sigrid
Juselius Foundation, the Finnish Cancer Society, and the Academy of
Finland (132473), and for T.H. by the Finnish Cultural Foundation,
Orion Farmos Research Fund, and Biomedicum Helsinki Foundation.
Conflict of interest The authors declare that they have no conflict
of interest.
References
1. Mavaddat N, Antoniou AC, Easton DF et al (2010) Genetic
susceptibility to breast cancer. Mol Oncol 4:174–191
2. Shuen AY, Foulkes WD (2011) Inherited mutations in breast
cancer genes–risk and response. J Mammary Gland Biol Neo-
plasia 16:3–15
3. Foulkes WD (2008) Inherited susceptibility to common cancers.
N Engl J Med 359:2143–2153
4. Cotta-Ramusino C, McDonald ER 3rd, Hurov K et al (2011) A
DNA damage response screen identifies RHINO, a 9-1-1 and
TopBP1 interacting protein required for ATR signaling. Science
332:1313–1317
Table 4 The haplotypes detected using the five SNP markers with
frequency estimates in cases and controls (P = 0.59)
Haplotype Haplotype
count
Frequency
cases (%)
Frequency
controls (%)
GGAAG 2,624 45.2 45.4
GGAGA 1,051 20.5 20.4
AGGGA 445 6.9 6.0
GGAAA 429 7.5 9.0
AGGAG 336 7.0 7.0
GAAGA 240 3.8 4.0
GGAGG 238 4.5 4.7
GAAAG 75 2.2 1.8
GAAGG 71 1.1 0.9
AGGGG 9 0.7 0.6
AGAAA 5 0.1 0.1
GGGGA 2 0.0 0.0
AGAAG 2 0.0 0.1
AGGAA 2 0.1 0.1
GGGAG 1 0.0 0.0
Table 3 The frequencies of
RHINO c.250C[T variant in
breast cancer patients and
population controls
CC % CT % OR 95 % CI P value
Helsinki controls 1,159 99.1 10 0.9
Helsinki familial 922 99.7 3 0.3 0.38 0.10–1.37 0.164
Helsinki sporadic 1,284 99.6 5 0.4 0.45 0.15–1.32 0.137
Helsinki all 2,206 99.6 8 0.4 0.42 0.17–1.07 0.060
Tampere controls 802 99.3 6 0.7
Tampere familial 253 99.2 2 0.8 1.06 0.21–5.27 1
Tampere sporadic 473 99.6 2 0.4 0.57 0.11–2.81 0.718
Tampere all 726 99.5 4 0.5 0.74 0.21–2.62 0.756
Combined controls 1,961 99.2 16 0.8
Combined familial 1,175 99.6 5 0.4 0.52 0.19–1.43 0.197
Combined sporadic 1,757 99.6 7 0.4 0.49 0.20–1.19 0.107
Combined all 2,932 99.6 12 0.4 0.50 0.24–1.06 0.066
440 Breast Cancer Res Treat (2014) 144:437–441
123
5. Kim JW, Fukukawa C, Ueda K et al (2010) Involvement of
C12orf32 overexpression in breast carcinogenesis. Int J Oncol
37:861–867
6. Syrjakoski K, Vahteristo P, Eerola H et al (2000) Population-
based study of BRCA1 and BRCA2 mutations in 1035 unselected
Finnish breast cancer patients. J Natl Cancer Inst 92:1529–1531
7. Kilpivaara O, Bartkova J, Eerola H et al (2005) Correlation of
CHEK2 protein expression and c.1100delC mutation status with
tumor characteristics among unselected breast cancer patients. Int
J Cancer 113:575–580
8. Fagerholm R, Hofstetter B, Tommiska J et al (2008)
NAD(P)H:quinoneoxidoreductase 1 NQO1*2 genotype (P187S)
is a strong prognostic and predictive factor in breast cancer. Nat
Genet 40:844–853. doi:10.1038/ng.155
9. Vehmanen P, Friedman LS, Eerola H et al (1997) A low pro-
portion of BRCA2 mutations in Finnish breast cancer families.
Am J Hum Genet 60:1050–1058
10. Michailidou K, Hall P, Gonzalez-Neira A et al (2013) Large-scale
genotyping identifies 41 new loci associated with breast cancer
risk. Nat Genet 45:353–361
11. Heikkinen K, Mansikka V, Karppinen SM et al (2005) Mutation
analysis of the ATR gene in breast and ovarian cancer families.
Breast Cancer Res 7:R495–R501
12. Durocher F, Labrie Y, Soucy P et al (2006) Mutation analysis and
characterization of ATR sequence variants in breast cancer cases
from high-risk French Canadian breast/ovarian cancer families.
BMC Cancer 6:230
13. Karppinen SM, Erkko H, Reini K et al (2006) Identification of a
common polymorphism in the TopBP1 gene associated with
hereditary susceptibility to breast and ovarian cancer. Eur J
Cancer 42:2647–2652
14. Blaut MA, Bogdanova NV, Bremer M et al (2010) TOPBP1
missense variant Arg309Cys and breast cancer in a German
hospital-based case-control study. J Negat Results Biomed 9:9
15. Fletcher O, Houlston RS (2010) Architecture of inherited sus-
ceptibility to common cancer. Nat Rev Cancer 10:353–361
Breast Cancer Res Treat (2014) 144:437–441 441
123