BRIEF REPORT

Evaluation of the RHINO gene for breast cancer predispositionin Finnish breast cancer families

Tuomas Heikkinen • Sofia Khan • Elina Huovari • Sara Vilske •

Johanna Schleutker • Anne Kallioniemi • Carl Blomqvist •

Kristiina Aittomaki • Heli Nevanlinna

Received: 11 February 2014 / Accepted: 12 February 2014 / Published online: 22 February 2014

� Springer Science+Business Media New York 2014

Abstract Hereditary predisposition to breast cancer is

largely affected by the mutations in the genes of the DNA

repair pathways. Novel genes involved in DNA repair are

therefore prospective candidates also for breast cancer

susceptibility genes. The RHINO (Rad9, Rad1, Hus1-

interacting nuclear orphan) gene plays a central role in

DNA damage response and in cell cycle regulation.

RHINO interacts with Rad9-Rad1-Hus1 (9-1-1) complex

and with ATR activator TopBP1, which recruit it to the site

of DNA damage. We analyzed the effects of the germline

variation in RHINO on breast cancer risk. We sequenced

the coding region of the RHINO gene 466 index cases of

Finnish breast cancer families and in 507 population con-

trols. The genotypes of the most likely functional variant

were further determined in a large dataset of 2,944 cases

and 1,976 controls. We analyzed the common variation of

the RHINO locus and determined the haplotypes using five

SNPs in 1,531 cases and 1,233 controls. We identified

seven variants including four missense variations, a 50 UTR

variant, a silent variant, and a nonsense variant c.250C[T,

R84X (rs140887418). All variants were also present in

control individuals with frequencies close to those of the

cases (P [ 0.05). The c.250C[T variant was present in 12

breast cancer patients (0.4 %) and of 16 controls (0.8 %)

with the difference not statistically significant (OR = 0.50,

95 %CI: 0.24–1.06, P = 0.066). The haplotype frequen-

cies did not differ in cases and controls (P = 0.59).

Germline variation in the RHINO gene is unlikely to

influence inherited susceptibility to breast cancer.

Keywords RHINO � Rad9, Rad1, Hus1-interacting

nuclear orphan � Breast cancer susceptibility gene �Candidate gene � Germline variation � Genetic risk �Familial breast cancer

Introduction

Inherited predisposition to breast cancer is for a large

proportion caused by mutations in genes involved in

homologous recombination DNA double strand break

repair machinery, most notably BRCA1, BRCA2, and

PALB2 [1, 2]. Mutations in these genes affect the breast

cancer susceptibility typically with high or moderate pen-

etrance and are found mostly in families with multiple

affected individuals making them rare in general popula-

tion [3]. Some of the notable moderate penetrance genes

include ATM, CHEK2, and BACH1, all with functions

related to DNA damage response or cell cycle control, with

approximately two-fold increase in the risk of breast cancer

T. Heikkinen (&) � S. Khan � E. Huovari � S. Vilske �H. Nevanlinna

Department of Obstetrics and Gynecology, University of

Helsinki and Helsinki University Central Hospital, Biomedicum

Helsinki, P. O. Box 700, 00029 Helsinki, Finland

e-mail: tuomas.heikkinen@helsinki.fi

J. Schleutker � A. Kallioniemi

Institute of Biomedical Technology/BioMediTech, University of

Tampere and Fimlab Laboratories, Tampere, Finland

J. Schleutker

Medical Biochemistry and Genetics, Institute of Biomedicine

University of Turku, Turku, Finland

C. Blomqvist

Department of Oncology, Helsinki University Central Hospital,

Helsinki, Finland

K. Aittomaki

Department of Clinical Genetics, Helsinki University Central

Hospital, Helsinki, Finland

123

Breast Cancer Res Treat (2014) 144:437–441

DOI 10.1007/s10549-014-2884-z

[1]. Other genes involved in the DNA repair mechanisms

are also prospective candidates for breast cancer suscepti-

bility genes. A recently identified gene RHINO (Rad9,

Rad1, Hus1-interacting nuclear orphan), participates in

DNA damage response signaling [4]. RHINO interacts with

Rad9-Rad1-Hus1 (9-1-1) complex and with ATR activator

TopBP1, which recruit RHINO to the site of DNA damage.

RHINO is also involved in G1 to S phase transition and in

CHEK1 phosphorylation. The central role RHINO plays in

DNA damage repair makes it an interesting candidate gene

for cancer susceptibility.

The RHINO gene, located on chromosome 12p13.33,

consists of only two exons coding for a protein of 238

amino acids. The protein contains a conserved hypothetical

APSES DNA binding domain (SWVPDF) between resi-

dues 55 and 61, and it has overall high level of conserva-

tion on the N- and C-terminal regions. The SWVPDF motif

is required for interaction with 9-1-1 complex, but not with

TopBP1, and it is needed for localization to the sites of

DNA damage [4].The RHINO transcript (C12orf32) has

been reported to be overexpressed in breast cancer with

very low expression levels in normal tissue with the

silencing of the gene also repressing the growth of breast

cancer cell lines [5].

To evaluate the impact of the variation in the RHINO

gene on breast cancer risk, we sequenced the protein

coding regions of the gene, with exon–intron boundaries, in

a large set of 466 breast cancer families and in 507 pop-

ulation controls. We further determined the genotypes of

the most potentially functional variant in larger set of cases

and controls and also in an independent breast cancer case–

control dataset. We also analyzed the effects of common

variation of the gene region with haplotype analysis in

cases and controls.

Materials and methods

Patients

Germline DNA isolated from whole blood samples of

Finnish breast cancer patients and controls from Helsinki

and Tampere regions were analyzed for variation in the

RHINO gene. The Helsinki series consisted of two unse-

lected breast cancer cohorts collected at the Helsinki

University Central Hospital department of oncology in

1997–1998 with 884 patients [6, 7] and in the department

of surgery in 2000 with 986 patients [8] covering 79 and

87 %, respectively, of all consecutive newly diagnosed

breast cancer cases during the time of collection. Addi-

tional familial cases were collected at the department of

Clinical Genetics [9].The unaffected female population

controls were collected from the matching geographical

region. The second series of breast cancer patients and

controls was collected in the Tampere region Finland

consisting of 787 cases and 816 controls. The cancer

diagnoses were confirmed through Finnish Cancer Registry

and hospital records.The study was carried out with the

informed consent from the participants and with permis-

sion from the respective ethics committees.

DNA analyses

The coding region and the exon intron boundaries of the

RHINO gene consisting of two exons were bi-directionally

sequenced from DNA samples of index patients of 466 of

breast and ovarian cancer families found negative for

BRCA1 and BRCA2 mutations, and of 507 population

controls. The primer sequences for exon 1 were AAA

TGTTCGTTAGATGAATGTTGA and GAATGGTGTGA

ACCCAGGAG and for exon 2 CCCCGATTTAAGA

GTCTGGTC and TTGAATTCCTTTATGACTCCAGAA.

The PCR products were purified with ExoSAP-IT treat-

ment (Affymetrix) and sequenced using ABI BigDye

Terminator 3.1 Cycle sequencing kit (Life Technologies).

The sequencing reactions were analyzed with the service

provided by FIMM Sequencing services with ABI3730xl

DNA Analyzer (Life Technologies). The sequence traces

were examined using Variant Reporter 1.0 software (Life

Technologies). The c.250G[T variant (rs140887418) was

further genotyped in larger data sets of Helsinki and

Tampere regions using custom TaqMan allelic discrimi-

nation assay and TaqMan Genotyping Master Mix (Life

Technologies). PCR was performed in 7500 Fast Real-

Time PCR System or in 9800 Fast Thermal Cycler, and

genotype calling was performed with 7500 Fast Real-Time

PCR System and ABI Prism 7500 SDS v1.4 software (Life

Technologies).

Statistical methods and bioinformatics

The differences in the genotype frequencies were evaluated

using V2 test, and when the count in any cell was less than

five, with Fishers exact test. All P values are two-sided.

The functional consequences of the identified missense

variants on the protein were evaluated with SIFT, Poly-

phen-2, and SNPs3D tools.We analyzed common variation

surrounding the region for the RHINO gene with the

genotypes determined in iCOGS chip genotyping [10] for

1,531 breast cancer patients and 1,233 populations controls

of the Helsinki study. Five SNPs (rs11062370, rs17834697,

rs11062381, rs1860434, and rs2041311), located at posi-

tions 12:2937298-3021000 spanning 83,702 bp, were taken

into the haplotype analyses with Phase 2.1 software, and

the frequencies of the haplotypes were compared between

cases and controls.

438 Breast Cancer Res Treat (2014) 144:437–441

123

Results

The sequencing of the coding region of the RHINO gene

revealed seven sequence changes: one 50 UTR variant,

four amino acid changing missense variants, one silent

variant on protein coding region, and one nonsense variant

introducing a premature stop codon (Table 1). Although

bioinformatics prediction tools suggested some of the

missense variants to have deleterious effects on protein

product (Table 2), no difference was seen with the fre-

quency of any of the variants between the cases and

controls (Table 1). The nonsense variant c.250C[T was

further genotyped in larger material as it was considered

to be the most likely functional variant by terminating the

translation and removing 66 % of the protein product. Of

the 5,343 samples analyzed, the genotyping was suc-

cessful for 5,165 (97 %). There was no significant dif-

ference in the frequencies of the c.250C[T variant

between cases and controls, although it was slightly more

common in controls (Table 3). Altogether 15 haplotypes

were present among the 2,765 study subjects of the Hel-

sinki breast cancer study analyzed with iCOGS chip, but

they were not differentially distributed in cases and con-

trols (P = 0.59) (Table 4).

Discussion

To our knowledge, this is the first report on the analysis of

genetic variation in the RHINO gene in cancer families.

The large number of cases and controls sequenced here in

parallel allowed us to analyze the associations of all

identified variants directly. None of the variants regardless

of their predicted impact on protein product was present

with a significantly different frequency in cases and con-

trols. The most likely candidate for a functional variant was

the truncating c.250C[T change. It, however, was not

more frequent among breast cancer cases compared to

normal population, which strongly indicates that inherited

variation in the RHINO gene does not affect breast cancer

susceptibility. As the c.250C[T variant and the missense

changes were present with low frequency in the Finnish

population possible low penetrance risk effects cannot be

completely excluded, but due to the rarity of the variants,

the detection of such effects would require extremely large

sample sets.

ATR and TopBP1, interaction partners of RHINO, play

a central role of in DNA repair, cell cycle regulation, and

have further interactions and functional similarities with

known breast cancer genes, particularly BRCA1 and ATM,

Table 1 Detected variants in the sequencing of the RHINO gene with frequencies in cases and controls

Variant Rs number Protein effect AA Aa aa P value

c.-28T[G (rs73040528) na Cases 459 98.5 % 7 1.5 % 0 0.0 % 0.3301

Controls 495 97.6 % 12 2.4 % 0 0.0 %

c.22C[T (rs34096285) R8C Cases 465 99.8 % 1 0.2 % 0 0.0 % 1

Controls 505 99.6 % 2 0.4 % 0 0.0 %

c.45–46GC[AG (rs138375075, rs150099344) L16V Cases 460 98.7 % 6 1.3 % 0 0.0 % 0.3244

Controls 504 99.4 % 3 0.6 % 0 0.0 %

c.80A[G (rs142328102) K27R Cases 460 98.7 % 6 1.3 % 0 0.0 % 0.2941

Controls 496 97.8 % 11 2.2 % 0 0.0 %

c.250C[T (rs140887418) R84X Cases 464 99.6 % 2 0.4 % 0 0.0 % 0.1812

Controls 500 98.6 % 7 1.4 % 0 0.0 %

c.328C[G (rs373986339) P110A Cases 466 100.0 % 0 0.0 % 0 0.0 % 1

Controls 506 99.8 % 1 0.2 % 0 0.0 %

c.489G[A (rs2907608) S163S Cases 214 45.9 % 182 39.1 % 70 15.0 % 0.4800

Controls 240 47.4 % 198 39.1 % 68 13.4 %

Table 2 The predicted effects

on the protein product of the

identified RHINO missense

variants

Protein

effect

SIFT PolyPhen-2 SNPs3D

R8C 0.08 (tolerated) Benign -0.68 (deleterious)

L16V 0.00 (intolerated) Probably damaging -1.16 (deleterious)

K27R 0.42 (tolerated) Probably damaging 1.03 (non-deleterious)

P130A 0.08 (tolerated) Probably damaging -1.08 (deleterious)

Breast Cancer Res Treat (2014) 144:437–441 439

123

which have made them prospective candidate genes for

breast cancer susceptibility. Despite these features, no

association with breast cancer risk and variation in the ATR

gene has been identified [11, 12]. A missense variant

R309C in the TopBP1 gene has been suggested to be

associated with breast cancer risk [13], but in further

investigations this association has not been validated [14].

The hereditary background of breast cancer remains

largely unexplained although recent advances not only in

the discovery of low penetrance alleles but also in mod-

erate penetrance variants have increased the knowledge of

the subject [15]. Recently, the number of identified low

penetrance variants for breast cancer association has

increased considerably through the successful consortia

collaborations and is reaching for the level for the multi-

plicative model to make clinical significance [10]. The

genes coding for proteins involved in DNA repair

machinery, however, remains putative candidates for can-

cer susceptibility. As high throughput sequencing of exo-

mes and genomes is becoming more common in the

management of breast cancer families the inevitable find-

ings of potentially pathogenic variants in candidate genes

will require careful evaluation. The results here emphasize

the importance of large sample sets of cases and controls in

evaluation of variants based on the in silico functional

predictions also when interpreting the findings emerging

from deep sequencing projects.

Acknowledgments We thank research nurse Irja Erkkila for assis-

tance with data management. The Finnish Cancer Registry is

acknowledged for diagnostic data. The study has been funded by the

Helsinki University Central Hospital Research Fund, the Sigrid

Juselius Foundation, the Finnish Cancer Society, and the Academy of

Finland (132473), and for T.H. by the Finnish Cultural Foundation,

Orion Farmos Research Fund, and Biomedicum Helsinki Foundation.

Conflict of interest The authors declare that they have no conflict

of interest.

References

1. Mavaddat N, Antoniou AC, Easton DF et al (2010) Genetic

susceptibility to breast cancer. Mol Oncol 4:174–191

2. Shuen AY, Foulkes WD (2011) Inherited mutations in breast

cancer genes–risk and response. J Mammary Gland Biol Neo-

plasia 16:3–15

3. Foulkes WD (2008) Inherited susceptibility to common cancers.

N Engl J Med 359:2143–2153

4. Cotta-Ramusino C, McDonald ER 3rd, Hurov K et al (2011) A

DNA damage response screen identifies RHINO, a 9-1-1 and

TopBP1 interacting protein required for ATR signaling. Science

332:1313–1317

Table 4 The haplotypes detected using the five SNP markers with

frequency estimates in cases and controls (P = 0.59)

Haplotype Haplotype

count

Frequency

cases (%)

Frequency

controls (%)

GGAAG 2,624 45.2 45.4

GGAGA 1,051 20.5 20.4

AGGGA 445 6.9 6.0

GGAAA 429 7.5 9.0

AGGAG 336 7.0 7.0

GAAGA 240 3.8 4.0

GGAGG 238 4.5 4.7

GAAAG 75 2.2 1.8

GAAGG 71 1.1 0.9

AGGGG 9 0.7 0.6

AGAAA 5 0.1 0.1

GGGGA 2 0.0 0.0

AGAAG 2 0.0 0.1

AGGAA 2 0.1 0.1

GGGAG 1 0.0 0.0

Table 3 The frequencies of

RHINO c.250C[T variant in

breast cancer patients and

population controls

CC % CT % OR 95 % CI P value

Helsinki controls 1,159 99.1 10 0.9

Helsinki familial 922 99.7 3 0.3 0.38 0.10–1.37 0.164

Helsinki sporadic 1,284 99.6 5 0.4 0.45 0.15–1.32 0.137

Helsinki all 2,206 99.6 8 0.4 0.42 0.17–1.07 0.060

Tampere controls 802 99.3 6 0.7

Tampere familial 253 99.2 2 0.8 1.06 0.21–5.27 1

Tampere sporadic 473 99.6 2 0.4 0.57 0.11–2.81 0.718

Tampere all 726 99.5 4 0.5 0.74 0.21–2.62 0.756

Combined controls 1,961 99.2 16 0.8

Combined familial 1,175 99.6 5 0.4 0.52 0.19–1.43 0.197

Combined sporadic 1,757 99.6 7 0.4 0.49 0.20–1.19 0.107

Combined all 2,932 99.6 12 0.4 0.50 0.24–1.06 0.066

440 Breast Cancer Res Treat (2014) 144:437–441

123

5. Kim JW, Fukukawa C, Ueda K et al (2010) Involvement of

C12orf32 overexpression in breast carcinogenesis. Int J Oncol

37:861–867

6. Syrjakoski K, Vahteristo P, Eerola H et al (2000) Population-

based study of BRCA1 and BRCA2 mutations in 1035 unselected

Finnish breast cancer patients. J Natl Cancer Inst 92:1529–1531

7. Kilpivaara O, Bartkova J, Eerola H et al (2005) Correlation of

CHEK2 protein expression and c.1100delC mutation status with

tumor characteristics among unselected breast cancer patients. Int

J Cancer 113:575–580

8. Fagerholm R, Hofstetter B, Tommiska J et al (2008)

NAD(P)H:quinoneoxidoreductase 1 NQO1*2 genotype (P187S)

is a strong prognostic and predictive factor in breast cancer. Nat

Genet 40:844–853. doi:10.1038/ng.155

9. Vehmanen P, Friedman LS, Eerola H et al (1997) A low pro-

portion of BRCA2 mutations in Finnish breast cancer families.

Am J Hum Genet 60:1050–1058

10. Michailidou K, Hall P, Gonzalez-Neira A et al (2013) Large-scale

genotyping identifies 41 new loci associated with breast cancer

risk. Nat Genet 45:353–361

11. Heikkinen K, Mansikka V, Karppinen SM et al (2005) Mutation

analysis of the ATR gene in breast and ovarian cancer families.

Breast Cancer Res 7:R495–R501

12. Durocher F, Labrie Y, Soucy P et al (2006) Mutation analysis and

characterization of ATR sequence variants in breast cancer cases

from high-risk French Canadian breast/ovarian cancer families.

BMC Cancer 6:230

13. Karppinen SM, Erkko H, Reini K et al (2006) Identification of a

common polymorphism in the TopBP1 gene associated with

hereditary susceptibility to breast and ovarian cancer. Eur J

Cancer 42:2647–2652

14. Blaut MA, Bogdanova NV, Bremer M et al (2010) TOPBP1

missense variant Arg309Cys and breast cancer in a German

hospital-based case-control study. J Negat Results Biomed 9:9

15. Fletcher O, Houlston RS (2010) Architecture of inherited sus-

ceptibility to common cancer. Nat Rev Cancer 10:353–361

Breast Cancer Res Treat (2014) 144:437–441 441

123