ORIGINAL PAPER

ZmHSP16.9, a cytosolic class I small heat shock protein in maize(Zea mays), confers heat tolerance in transgenic tobacco

Liping Sun • Yang Liu • Xiangpei Kong • Dan Zhang •

Jiaowen Pan • Yan Zhou • Li Wang • Dequan Li •

Xinghong Yang

Received: 6 January 2012 / Revised: 15 February 2012 / Accepted: 2 April 2012 / Published online: 26 April 2012

� Springer-Verlag 2012

Abstract Various organisms produce HSPs in response

to high temperature and other stresses. The function of heat

shock proteins, including small heat shock protein (sHSP),

in stress tolerance is not fully explored. To improve our

understanding of sHSPs, we isolated ZmHSP16.9 from

maize. Sequence alignments and phylogenetic analysis

reveal this to be a cytosolic class I sHSP. ZmHSP16.9

expressed in root, leaf and stem tissues under 40 �C

treatment, and was up-regulated by heat stress and exog-

enous H2O2. Overexpression of ZmHSP16.9 in transgenic

tobacco conferred tolerance to heat and oxidative stresses

by increased seed germination rate, root length, and anti-

oxidant enzyme activities compared with WT plants. These

results support the positive role of ZmHSP16.9 in response

to heat stress in plant.

Key message The overexpression of ZmHSP16.9 enhanced

tolerance to heat and oxidative stress in transgenic tobacco.

Keywords Heat stress � Small heat-shock protein �Maize � Heat tolerance

Introduction

Plants as sessile organisms are exposed to persistently

changing stress factors that limit the growth and yield of

diverse crop plants. The environmental factors include

drought, salinity, high and low temperatures and chemicals

(Zhu 2002). It is generally accepted that the worldwide

greenhouse effect produces a warmer world. The heat

stress is even more damaged and can disturb cellular

homeostasis and lead to severe retardation in growth and

development, and even death (Kotak et al. 2007). However,

plants deploy a variety of sophisticated mechanisms to

rapidly sense a changing environment and protect them-

selves from these environmental stresses (Xiong et al.

2002; Zhu 2001, 2002).

The heat shock protein (HSP) superfamily is one of the

proteins universally accumulated under heat stress condi-

tion (Schlesinger 1990). In plants, HSP genes are also

induced in response to a large number of abiotic stresses,

such as cold, salinity, drought, and some signaling mole-

cules, such as abscisic acid (ABA), salicylic acid (SA), and

H2O2, suggesting that HSPs play important roles in pro-

tecting plants against stress and in the reestablishment of

cellular homeostasis (Charng et al. 2006; Guan et al. 2004;

Ma et al. 2006; Malik et al. 1999; Rampino et al. 2009; Sun

et al. 2001; Volkov et al. 2006). Molecular weight placed

the plant HSPs into six groups: HSP100s; HSP90s;

HSP70s; HSP60s; and small HSPs (sHSPs) (12–40 kDa)

(Sanmiya et al. 2004), and co-chaperones HSP40 or DNAJ

family (Qiu et al. 2006).

Plant sHSPs are divided into six classes: three classes of

(classes CI, CII and CIII) sHSPs are localized in the

cytosole or in the nucleus and the other three in the plas-

tids, endoplasmic reticulum and mitochondria (CIV, CV

and CVI) (Sun et al. 2002; Wang et al. 2004). Completion

Communicated by K. Chong.

L. Sun � Y. Liu � X. Kong � D. Zhang � J. Pan � Y. Zhou �L. Wang � D. Li � X. Yang (&)

State Key Laboratory of Crop Biology, Shandong Key

Laboratory of Crop Biology, College of Life Sciences,

Shandong Agricultural University, 61 Daizong Street,

Tai’an 271018, Shandong, China

e-mail: xhyang@sdau.edu.cn

L. Sun

Taishan Medical University, Tai’an 271000, Shandong, China

123

Plant Cell Rep (2012) 31:1473–1484

DOI 10.1007/s00299-012-1262-8

of the Arabidopsis genome-sequencing project has revealed

the existence of 19 sHSPs (Siddique et al. 2008). A similar

repertoire of genes was observed in the sequenced genomes

of other plants, such as rice (Oryza sativa) and poplar

(Populus sp.) (Sarkar et al. 2009). sHSPs play important

roles in plant stress tolerance because of their abundance

and heterogeneity. The AtHSP17.6A expression was

induced by heat and osmotic stress, as well as during seed

development and over-expression of AtHSP17.6A

increased salt and drought tolerance in Arabidopsis (Sun

et al. 2001). Over-expression of chloroplast sHSP, HSP21,

in transgenic Arabidopsis confers heat and high-light

stresses (Harndahl et al. 1999). Over-expression of rice

Hsp16.9-CI was shown to provide thermotolerance to

E. coli cells (Yeh et al. 1997). In addition, over-expression

of rice Hsp17.7-CI showed heat tolerance, drought toler-

ance and UV-B resistance (Murakami et al. 2004; Sato and

Yokoya 2008). Furthermore, transgenic E. coli expressing

DcHsp17.7 exhibited a higher salt stress tolerance than

control E. coli (Song and Ahn 2011). Recently, Jiang et al.

(2009) showed that RcHSP17.8 confers resistance to a

variety of stresses to E. coli, yeast and Arabidopsis.

Maize (Zea mays L.) is one of the oldest and most

important worldwide crops (Kong et al. 2011b). Up to date,

only seven sHSPs (sHSP16.9, sHSP17.4, sHSP17.5,

sHSP18, sHSP18.3, sHSP22, and sHSP26) have been

characterized in maize (Liu et al. 2009; Pegoraro et al.

2011). However, the functions of these maize sHSPs have

not yet been experimentally defined completely. Thus, in

the present study we isolated and characterized sHSP16.9

from maize (Zhengdan 958). The expression of

ZmHSP16.9 was induced by heat stress and H2O2. Over-

expression of ZmHSP16.9 in transgenic tobacco confers

tolerance to heat and oxidative stresses.

Materials and methods

Plant materials and growth conditions

Maize (Zea mays L. cv Zhengdan 958, from Shandong

Academy of Agricultural Sciences, China) seeds were

washed several times with tap water and soaked in distilled

water for germination. Seedlings of maize were grown in

Hoagland’s solution (pH 6.0) in growth chamber at

25/22 �C (day/night), a photosynthetic photo flux density

of 200 lmol m-2 s-1 and a photoperiod of 14/10 h (day/

night) for 2 weeks.

Tobacco (Nicotiana tabacum L. cv NC89) was also used

in this study. The wild type (WT) tobacco was germinated

in 1/2 MS medium in a growth chamber under a 14/10 h

(day/night) photoperiod at a temperature of 25/22 �C (day/

night) for 2 weeks. The transgenic tobacco was germinated

in 1/2 MS medium containing 100 mg L-1 kanamycin in

the same growth chamber at the same time as the WT

plants. Surviving plants were transferred into vermiculite

and watered with Hoagland’s solution every day for

6–8 weeks.

Plant materials treatment

The 2-week-old maize seedlings were dipped in Hoa-

gland’s solution containing 15 mM H2O2 at 25 �C with a

continuous light intensity of 200 lmol m-2 s-1. A high

temperature treatment was carried out at 40 �C under the

same light periods, and plants were watered with Hoa-

gland’s solution. Then the seedlings were transferred to

25/22 �C (day/night) for recovery. Seedlings treated with

Hoagland’s solution for the entire study period served as

controls. Samples were collected at different intervals after

treatment and were immediately frozen in liquid nitrogen

and stored at -80 �C for further use.

6-week-old transgenic lines and WT plants were treated

at 45 �C for 12 h under the same photoperiod conditions

described above, after which a second leaf sample was

taken. Seedlings treated at 25 �C for the entire study period

served as controls. Each experiment was repeated three

times at least.

Identification of ZmHSP16.9 gene

Total RNA was extracted according to the instructions of

Trizol reagent (Invitrogen, Carlsbad, CA, USA) from

leaves of maize seedlings with heat treatment at 40 �C for

3 h. The first-strand cDNAs were synthesized using a First-

Strand cDNA Synthesis kit (Fermentas, Glen Burnie, MD,

USA). The primers (forward: GTGTTGAGACTTGA-

GACGCAT and reverse: GCAGGAAACATCACACAA-

GAC) were designed according to the known maize

ZmHSP16.9 sequence (GenBank accession number:

NM_001157311) (Alexandrov et al. 2009) to amplify the

full-length ZmHSP16.9 by reverse transcription PCR (RT-

PCR). The expected PCR fragment was cloned into the

PMD18-T vector and sequenced.

Total RNA extraction and northern blotting analysis

Total RNA was isolated from leaves with Trizol reagent

(Invitrogen) according to the manufacturer’s instructions.

Northern blotting was carried out as described earlier

(Kong et al. 2011a). Briefly, 20 lg of total RNA was

separated by denaturing 1.0 % (w/v) agarose gel, stained

with ethidium bromide to ensure equal loading and then

transferred to nylon membranes (Hybond-N?, Amersham,

USA). The whole coding sequence of ZmHSP16.9 was

used as probe.

1474 Plant Cell Rep (2012) 31:1473–1484

123

Antibody production and western blotting

Antibody production was carried out as described earlier

(Liu et al. 2009). Briefly, the ZmHSP16.9 gene was

expressed in E. coli BL21 (DE3). Protein was purified by a

Ni–NTA spin column (Novagen) following the manufac-

turer’s instructions and the rat was injected (guinea pig for

experiment) with Freund’s adjuvant four times for making

primary antibody. The blood from rats was agglomerated

and centrifuged (3,000 rpm, 5 min), and the supernatant

liquor obtained was anti-blood serum. The antibody titer

was determined by indirect ELISA.

Protein extraction and western blotting analysis were

done as described previously (Rorat et al. 2004). Briefly,

20 lg total proteins were separated by SDS-PAGE, and

then electroblotted onto a polyvinylidene difluoride mem-

brane (Millipore, Boston, MA, USA). Membranes were

incubated with an antiserum that had been raised in rat

against ZmHSP16.9. Immuno-reactive proteins were

detected with peroxidase-conjugated goat antibodies

against rat IgG. The membranes were detected by ECL

(Enhanced Chemiluminescence; GE Healthcare), following

the manufacturer’s instructions.

Construction of a plant expression vector

with ZmHSP16.9 and transformation of tobacco

The open reading frame (ORF) of ZmHSP16.9 was

amplified by a polymerase chain reaction with primers

covering both termini of the ORF. The 50 primer was

50-GGGATCCTGTTGAGACTTGAGACGCAT-30, and

the 30 primer was 50-GGAGCTCCAGGAAACATCACA

CAAGAC-30 with the underlined BamHI and SacI

restriction site introduced. This fragment was inserted into

the expression vector pBI121 under the control of a cau-

liflower mosaic virus (CaMV) 35S promoter. The recom-

binant plasmid, pBI121-ZmHSP16.9, was introduced into

the Agrobacterium tumefaciens strain LBA4404. Trans-

formation of tobacco was performed using an Agrobacte-

rium-mediated leaf disc transformation, as described by

Horsch et al. (1985). Transgenic plants were also confirmed

by northern blotting and western blotting as described

above. Plants that produced 100 % kanamycin-resistant

progenies in the T2 generation were considered homozy-

gous for the selection marker and used for further studies.

Subcellular localization of ZmHSP16.9 protein

The full-length ZmHSP16.9 coding region was amplified

with primers ZmHSP16.9-GFP-F (50GTCTAGACGCATA

GAGCTAGCGTCGA, Xba1 site underlined) and ZmHSP

16.9-GFP-R (50GGGTACCTATCTCAATAGCCTTCAC

CT, Kpn1 site underlined). The PCR product was cloned

into pMD18-T simple vector (TaKaRa) and sequenced.

The coding sequence of the gene was inserted into the

reconstructed binary vector pBI121-GFP, which generated

a C-terminal fusion with the green fluorescence protein

(GFP) gene controlled by the cauliflower mosaic virus

(CaMV) 35S promoter. The identity of the construct was

confirmed by sequencing and the plasmid construct was

used to coat gold particles, and the plasmid containing GFP

alone was used as control. The onion epidermis was

bombarded with the plasmid-coated gold particles using a

gene gun (Bio-Rad, Hercules, CA, USA), and then incu-

bated at 25 �C over night on a fresh plate. Plasmolysis of

the cells resulted by placing each sample in 30 % sucrose

for 5–10 min. Cells were observed under a confocal

microscope (Olympus, Tokyo, Japan). This experiment

was repeated three times at least with identical results.

High temperature treatment during germination

of seeds and growth of seedlings

About 50 surface sterilized seeds each from transgenic

tobacco lines and WT plants were sown on MS plates, and

placed in a controlled-environment growth chamber at 25

or 40 �C separately with a photoperiod of 14/10 h (day/

night) for 10 days. Plates were then incubated at 25 �C and

germination rates were scored every 2 days up to 10 days.

Each experiment was repeated three times at least.

WT and transgenic lines were germinated and allowed

to grow at 25 �C for 7 days. Then seedlings were trans-

ferred to fresh MS medium and incubated at 25 �C or

40 �C for 9 h in growth chamber. The seedlings were

allowed to grow for 20 days at 25/22 �C (day/night) before

the photographs were taken. The response of seedlings to

high temperature was quantified in terms of the lengths of

the main roots. Twenty seedlings were measured in each

experiment and the experiment was repeated three times at

least.

Oxidative stress treatment during germination of seeds

and growth of seedlings

About 50 surface sterilized seeds each from transgenic

tobacco lines and WT line were sowed on MS plates

supplemented with 0 mM or 5 mM H2O2, and placed at a

photoperiod of 14/10 h (day/night) at a temperature of

25/22 �C (day/night). Germination rate was scored every

2 days for 18 days. Each experiment was repeated three

times at least.

Seedlings of transgenic lines and WT grown on MS

medium for 7 days, and then were transferred to MS

medium supplemented with 0 mM or 10 mM H2O2 for

20 days before the photographs were taken. The response

of seedlings to oxidative stress was quantified in terms of

Plant Cell Rep (2012) 31:1473–1484 1475

123

the lengths of the main roots. 20 seedlings were measured

in each experiment and the experiment was repeated three

times at least.

Malondialdehyde (MDA) content and electrolyte

conductivity

Malondialdehyde (MDA) content was determined using the

thiobarbituric acid (TBA) reaction, as described by Heath

and Packer (1968). Relative electrolytic leakage (REL) was

determined by following the methods of Wahid (2007).

The content of H2O2

The content of H2O2 was measured by monitoring the

absorbance at 415 nm of the titanium peroxide complex

following the method described by Jiang and Zhang (2001).

Enzyme assays

Frozen leaf segments (0.5 g) were homogenized in 5 ml of

50 mM potassium phosphate buffer, pH 7.0, containing

1 mM EDTA and 1 % polyvinylpyrrolidone. The homog-

enate was centrifuged at 15,0009g for 20 min at 4 �C, and

the supernatant was immediately used for detection of

antioxidant enzyme activities. Superoxide dismutase

(SOD) activities were measured by the nitro-blue tetrazo-

lium (NBT) method according to Beyer and Fridovich

(1987). Peroxidase (POD) activity was measured by the

change in absorbance of 470 nm due to guaiacol oxidation

according to the method described by Polle (1994). Cata-

lase (CAT) activity was assayed according to Corbisier

(1987). Each experiment was repeated three times at least.

Bioinformatic and statistic analyses

Bioinformatic work described here was performed using

the websites http://blast.ncbi.nlm.nih.gov/Blast.cgi. Statis-

tical analyses and plotting were conducted using SigmaPlot

and SPSS.

Results

Isolation and characterization of a maize cytosolic class

I sHSP gene, ZmHSP16.9

We isolated ZmHSP16.9 (GenBank accession number:

NM_001157311) from maize using specific primers. The

length of ZmHSP16.9 cDNA is 576 bp and contains a

459 bp ORF, which encodes a protein of 152 amino acids.

Alignment of the amino acid sequences of ZmHSP16.9 and

other representative cytosolic class I sHSPs from other

plants showed that the ZmHSP16.9 protein contains 2

sHSPs conserved domains (Fig. 1). Phylogenetic analysis

showed that ZmHSP16.9 is closer to cytosolic class I

sHSPs, and 86.2 % with OsHSP16.9A, 85.5 % with OsH-

SP16.9B and 82.2 % with OsHSP16.9C (Fig. 2).

In order to further confirm that ZmHSP16.9 belongs to

cytosolic sHSP family, the amino acid sequence of

ZmHSP16.9 was analyzed in the ProtComp v.9.0 database

(http://linux1.softberry.com/berry.phtml?topic=protcomppl

&group=programs&subgroup=proloc). ZmHSP16.9 was

predicted to be localized to the cytosolic, with an expected

accuracy of nearly 98 %. In order to confirm this prediction,

we performed transient expression assays using onion epi-

dermal cells with constructs expressing GFP alone and the

CaM35S::ZmHSP16.9:GFP fusion protein. As shown in

Fig. 3, ZmHSP16.9: GFP fusion protein accumulated mainly

in the cytoplasm, whereas GFP alone distributed in the

nucleus and the cytoplasm. Exposure of the bombarded onion

epidermal cells to 30 % sucrose resulted in plasmolysis,

ZmHSP16.9: GFP fluorescence accumulated mainly in the

cytoplasm and not in the cell wall (Fig. 3). These results

clearly indicate that ZmHSP16.9 is a cytosolic-localized

protein. Taken together, these results support that ZmHSP16.9

is a member of plant cytosolic class I sHSP gene family.

Expression patterns of ZmHSP16.9 in response to heat

stress and H2O2 treatment

The expression pattern of ZmHSP16.9 was investigated by

northern blot and western blot analyses. First, we studied the

tissue-specific expression pattern of ZmHSP16.9 in maize.

As shown in Fig. 4a and b, ZmHSP16.9 mRNA and protein

were expressed in the leaves, stems and roots, and the level in

the leaves was higher than that in the roots and stems under

heat stress, whereas there were nearly no expression under

normal condition (data not shown). 40 �C treatment led to a

significant increase of ZmHSP16.9 transcript level within

30 min, reaching a maximum at 6 h and then decreased

(Fig. 4g), whereas the protein level increased within 3 h,

reaching a maximum at 9 h, and showed high levels

at recovery stage (Fig. 4h), There was no change in

ZmHSP16.9 transcription and protein level at 25 �C condi-

tion during observation series (Fig. 4i, j). Because heat stress

induces the accumulation of H2O2, the effect of H2O2 on

ZmHSP16.9 transcription was examined. Exogenous appli-

cation of 15 mM H2O2 increased the transcription level of

ZmHSP16.9 within 6 h, the maximum level was observed

at 12 h (Fig. 4c). H2O2 also increased the protein level

of ZmHSP16.9, and the protein accumulated even after

recovery 36 h later (Fig. 4d); there was no change in

ZmHSP16.9 transcription and protein level without H2O2

(Fig. 4e, f). These results suggest that the ZmHSP16.9 gene

is involved in response to heat and oxidative stresses.

1476 Plant Cell Rep (2012) 31:1473–1484

123

Identification of transgenic plants

In order to further analyze the possible function of

ZmHSP16.9 in plants under stress conditions, the full-

length ZmHSP16.9 sequence was placed under the control

of CaMV-35S promoter and the WT plants were trans-

formed. A total of 20 independent transgenic lines (T0)

were generated and screened for ZmHSP16.9. Six inde-

pendent T2 lines were selected and their expression of

ZmHSP16.9 was detected at both mRNA and protein levels

by northern blot (Fig. 5a) and western blot (Fig. 5b), three

lines (T2-1, T2-3 and T2-10) for ZmHSP16.9 transgenic

lines were chosen for further analysis.

The ZmHSP16.9 transgene alleviated the negative

effect of high temperature during the germination

of seeds and growth of seedlings

As shown in Fig. 4g and h, ZmHSP16.9 was induced by

heat stress, we then examined the biological function of

ZmHSP16.9 in response to heat stress in tobacco. Under

normal condition, the ZmHSP16.9-overexpressing lines did

not show any significant difference from WT plants during

growth of seedlings and root length (Fig. 6c, d). However,

when seeds were incubated for 10 days at 40 �C, and

subsequent recovery at 25/22 �C (day/night) for 10 days,

the frequencies of germination were 68, 89, and 93 % for

seeds of transgenic line 1, line 3 and line 10, respectively,

but it was only approximately 59 % for wild type seeds

(Fig. 6a, b). Furthermore, the ZmHSP16.9-overexpressing

seedlings were also more tolerant to high temperature than

those of WT seedlings. Seedlings grown on MS medium

for 7 days were heat shocked at 40 �C for 9 h, and then

recovered at 25/22 �C (day/night) for 20 days. As shown in

Fig. 6c and d, in transgenic lines L1, L3 and L10, the root

length was 2.23, 3.27, 3.56 cm, respectively, while only

1.66 cm for WT seedlings. These results demonstrate that

over-expression of ZmHSP16.9 appears to confer tolerance

to heat stress in seed germination and early seedling growth

of transgenic tobacco.

Previous studies have indicated that heat stress causes

damage in plants via oxidative stress involving the gener-

ation of reactive oxygen species (ROS), such as hydrogen

peroxide, superoxide, and singlet oxygen (Mittler et al.

Fig. 1 Comparison of amino

acid alignment of ZmHSP16.9with other plant sHSP. The two

conserved regions in sHSP are

underlined. Accession numbers

of sHSPs are: Zm16.9

(NM_001157311); Zm17.9

(ACF78669); Os16.9A

(Os01g04370); Os16.9B

(Os01g04380); Os16.9C

(Os01g04360); Os17.4

(Os03g16020); Os17.9A

(Os03g15960); At17.4

(NM_114492); At17.6A

(BT024694); At17.6B

(NM_128504); At17.6C

(NM_104232); At17.8

(NM_100614); At18.1

(AY122948)

Plant Cell Rep (2012) 31:1473–1484 1477

123

2004). We determined the accumulation of H2O2 in

transgenic seedlings under heat stress, the results showed

that H2O2 content increased after 45 �C treatment in both

WT and ZmHSP16.9-overexpressing plants; however,

compared to WT plants, ZmHSP16.9-overexpressing plants

accumulated less H2O2 under heat stress condition

(Fig. 7a). The amount of MDA in cells is commonly used

as an indicator of the extent of lipid peroxidation. After

45 �C treatment, compared with WT plants, the MDA

content was significantly lower in ZmHSP16.9-over-

expressing plants (Fig. 7b). We then measured electrolyte

leakage, which is thought to reflect stress caused by

impairment-induced lipase activity, leading to lipid phase

changes and membrane leakiness. As shown in Fig. 7c,

transgenic plants had a lower electrolyte leakage than WT

under 45 �C treatment. To test whether ZmHSP16.9 regu-

lates the activities of antioxidant enzymes, three antioxi-

dant enzymes were measured in response to heat stress.

As shown in Fig. 8, compared with WT plants, POD, CAT

and SOD activities were significantly higher in the

ZmHSP16.9-overexpression plants in response to heat

stress. Taken together, these results suggested that

ZmHSP16.9-overexpressing plants exhibited more heat

tolerance than that of WT plants.

Constitutive expression of ZmHSP16.9 improves

tolerance to oxidative stress

In order to further confirm the ability of ZmHSP16.9-

overexpressing plants to scavenge ROS, the oxidative

stress tolerance was used. WT and ZmHSP16.9 transgenic

seeds were surface sterilized, and then sown on MS med-

ium supplemented with different concentrations of H2O2 at

25/22 �C (day/night) for 18 days. Transgenic line 1, line 3

and line 10 showed 87, 94 and 94 % germination rates,

respectively, while the WT had a germination rate of 79 %

(Fig. 9a, b). Furthermore, the phenotype of WT and over-

expression seedlings were grown on normal medium for

7 days and then treated with 10 mM H2O2 for 20 days. As

shown in Fig. 9c and d, in transgenic line 1, line 3 and line

10, the root length was 1.23, 2.34, and 2.46 cm, respec-

tively, while only 1.09 cm for WT seedlings, however, on

MS plates without H2O2, the ZmHSP16.9-overexpressing

lines did not show any significant difference from WT

plants (Fig. 9c, d).These results demonstrated that

ZmHSP16.9-overexpressing plants were more tolerant to

oxidative stress.

Fig. 3 Subcellular localization

of the ZmHSP16.9: GFP fusion

protein in onion epidermal cells.

Cells were bombarded with

DNA-coated gold particles

carrying GFP or GFP:

ZmHSP16.9, and GFP

expression was visualized

16 h later

Fig. 2 The phylogenetic relationship of the ZmHSP16.9 with other

sHSP from maize and other plant species

1478 Plant Cell Rep (2012) 31:1473–1484

123

Discussion

Heat shock proteins (HSPs) are a class of proteins whose

expression increases when cells are exposed to elevated

temperatures or other stress. Although results on the posi-

tive role of sHSPs against environmental stresses have

already been reported in different plant species (Mahmood

et al. 2010), an interesting question to consider is poly-

ploidy in cereals, whereby molecular diversity of sHSP

species within each plant is increased due to the contri-

bution of the subgenomes. Furthermore, sHSP gene fami-

lies have more members in diploid cereals than in dicots

contributing to the molecular diversity (Maestri et al.

2002). However, the mechanisms for these multiple func-

tions are not entirely understood.

In this study, we isolated and characterized a full-length

cDNA clone that encodes ZmHSP16.9 from maize. Phy-

logenetic analysis and subcellular localization showed that

ZmHSP16.9 belongs to cytosolic class I sHSP family

(Figs. 1, 2, 3). We established that ZmHSP16.9 is involved

in response to heat stress and H2O2 treatment.

Fig. 5 Northern blot and western blot analyses for ZmHSP16.9-

overexpressing plants. a The transcript levels of ZmHSP16.9 in

different over-expression lines analyzed by northern blots. b The

levels of ZmHSP16.9 protein in different over-expression lines

analyzed by western blots. Total RNA and protein were extracted

from WT plants and ZmHSP16.9-overexpressing plants

Fig. 4 Northern blot and western blot analyses of the expression of

ZmHSP16.9. a Tissue-specific expression of ZmHSP16.9. Total RNA

was isolated from roots (R), stems (S) and leaves (L) under 40 �C

treatment for 1 h, respectively. b Tissue-specific expression of

ZmHSP16.9. Total protein was extracted from roots (R), stems (S)

and leaves (L) under 40 �C treatment for 3 h, respectively. c, e, g iMaize seedlings were treated with 15 mM H2O2, Hoagland’s solution

(CK), high temperature (40 �C) and normal condition (25 �C)

respectively. Total RNA was isolated from leaves at indicated times.

d, f, h and j maize seedlings were treated with 15 mM H2O2,

Hoagland’s solution (CK), high temperature (40 �C) and normal

condition (25 �C), respectively. Total protein was extracted from

leaves at indicated times. As additional loading control, the ethidium

bromide-stained rRNA is shown after northern blots and the large

subunit of ribulose 1, 5-bisphosphate carboxylase/oxygenase (Rubi-

sco) is shown after western blots. The experiments were repeated

at least two times with similar results. R represents recovery;

PC represents positive control (purified ZmHSP16.9 in vitro)

Plant Cell Rep (2012) 31:1473–1484 1479

123

Fig. 6 Enhanced heat tolerance of ZmHSP16.9-overexpressing

plants. a WT and transgenic tobacco seed germination rate under

high temperature stress (40 �C). The seeds were incubated for

10 days at 40 �C, and subsequent recovery at 25/22 �C (day/night) for

10 days before the photographs were taken. b Germination rate under

high temperature stress (40 �C). The germination rate was evaluated

at indicated time after recovery at 25/22 �C (day/night). c The

phenotype of WT and over-expression seedlings grown on normal

temperature (25 �C) for 7 days and then shifted to normal

temperature (25 �C) or high temperature (40 �C) for 9 h, and photos

were taken after 20 days of recovery (25 �C). d Root length of WT

and over-expression seedlings after normal temperature (25 �C) or

high temperature (40 �C) treatment. The root length was evaluated

from 20 seedlings in each of three independent experiments. Each

column represents an average of three replicates, and bars indicate

SDs. ** and * indicate significant differences in comparison with the

control at P \ 0.01 and P \ 0.05, respectively. The bar in c represents

1 cm

Fig. 7 ROS accumulation,

MDA content, and relative

electrolytic leakage

conductivity in WT and

ZmHSP16.9-overexpressing

plants under heat stress. a H2O2

content in 6-week-old

ZmHSP16.9-overexpressing

plants and WT plants treated

with 45 �C for 3, 6, and 12 h.

b MDA content in 6-week-old

ZmHSP16.9-overexpressing

plants and WT plants treated

with 45 �C for 3, 6, and 12 h.

c Comparison of leaf electrolyte

leakage between 6-week-old

ZmHSP16.9-overexpressing

plants and WT plants treated

with 45 �C for 3, 6, and 12 h.

Each column represents an

average of three replicates, and

bars indicate SDs. ** and

* indicate significant differences

in comparison with the control

at P \ 0.01 and P \ 0.05,

respectively

1480 Plant Cell Rep (2012) 31:1473–1484

123

Fig. 9 Enhanced oxidative tolerance of ZmHSP16.9-overexpressing

plants. a WT and transgenic tobacco seed germination rate on the

medium containing 5 mM H2O2. The seeds were allowed to grow for

18 days before the photographs were taken. b Germination rate on the

medium containing 5 mM H2O2. The germination rate was evaluated

at indicated time after sowing. c The phenotype of WT and over-

expression seedlings grown on normal medium for 7 days and then

treated with 0 or 10 mM H2O2 for 20 days. d Root length of WT and

over-expression seedlings treated with 0 or 5 mM H2O2 for 20 days.

The root length was evaluated from 20 seedlings in each of three

independent experiments. Each column represents an average of three

replicates, and bars indicate SDs. ** and * indicate significant

differences in comparison with the control at P \ 0.01 and P \ 0.05,

respectively. The bar in c represents 1 cm

Fig. 8 Peroxidase (POD),

catalase (CAT), and superoxide

dismutase (SOD) activities in

WT and ZmHSP16.9-

overexpressing plants under

heat stress. a POD activity in

plants treated with 45 �C for 3,

6, and 12 h. b CAT activity in

plants treated with 45 �C for 3,

6, and 12 h. c SOD activity in

plants treated with 45 �C for 3,

6, and 12 h. Each columnrepresents an average of three

replicates, and bars indicate

SDs. ** and * indicate

significant differences in

comparison with the control at

P \ 0.01 and P \ 0.05,

respectively

Plant Cell Rep (2012) 31:1473–1484 1481

123

Overexpression of ZmHSP16.9 in transgenic tobacco

enhanced both thermotolerance and oxidative stress resis-

tance, and transgenic tobacco plants exhibited ROS scav-

enging ability through the protection of antioxidative

enzymes under heat stress condition.

sHSP production has now been observed upon many

abiotic stresses, the tomato chloroplast small sHSP,

HSP21, is induced by heat treatment in leaves (Neta-Sharir

et al. 2005). As shown in Fig. 4, the results showed that

ZmHSP16.9 is more strongly expressed in the leaves of Zea

mays under heat stress (Fig. 4a). ZmHSP16.9 was clearly

induced by heat stress and H2O2 treatment (Fig. 4c–h).

However, ZmHSP16.9 did not show significant difference

under NaCl, PEG and low temperature stress conditions

compared to normal condition (data not shown). In rice,

OsHSP16.9A, OsHSP16.9B and OsHSP16.9C, which share

high identity with ZmHSP16.9, were also not significant in

the expression level in response to salt, drought and cold

stresses (Guan et al. 2004; Sarkar et al. 2009). These results

suggest that ZmHSP16.9 may play an important role in

response to heat stress and oxidative stress.

The role of sHSPs in response to environmental stresses

has been clearly established by several studies. Over-

expression of HSP26 in transgenic Arabidopsis enhanced

thermotolerance due to increased amount of free proline

caused by the elevated proline biosynthetic pathway genes

(Xue et al. 2010). Transgenic rice plants with increased

levels of sHSP17.7 protein exhibited significantly increased

thermotolerance and UV-B tolerance compared to untrans-

formed control plants (Murakami et al. 2004). For further

understanding of the function of ZmHSP16.9 under abiotic

stress, we generated overexpressing ZmHSP16.9 plants

under the control of constitutive CaMV 35S promoter. At

normal growth conditions, ZmHSP16.9-overexpressing

tobacco lines and wild type plants showed no difference in

seed germination or seedling growth (Figs. 6, 9), however,

compared with WT plants, ZmHSP16.9-overexpressing lines

showed higher tolerance in response to heat stress, as shown

by the germination rate, early seedling growth and root

length (Fig. 6). In addition, under heat stress, ZmHSP16.9-

overexpressing lines showed less accumulation of MDA

(Fig. 7b) and lower electrolyte leakage (Fig. 7c) than that of

wild type plants, suggesting that ZmHSP16.9 protein could

protect the cell membrane integrity of tobacco plant under

heat stress. These results indicate that transgenic plants

enhanced the tolerance to high temperature.

Heat stress affects almost all plant growth and devel-

opment, which leads to overproduce ROS, and ROS can

cause damage to cell growth by oxidizing proteins, lipids,

and DNA (Mittler et al. 2004). Plants have developed

sophisticated systems, such as SOD, POD, APX, CAT and

glutathione peroxidase, to protect them from oxidative

stress by adjusting ROS homeostasis. Heat shock protein is

also involved in oxidative stress (Harndahl et al. 1999;

Neta-Sharir et al. 2005; Scarpeci et al. 2008; Volkov et al.

2006). Overexpression RcHSP17.8 enhanced SOD activity

in transgenic Arabidopsis under various stresses (Jiang

et al. 2009). In the present study, we found that the POD,

CAT and SOD activities were all enhanced in ZmHSP16.9-

overexpressing plants compared to the wild type plants

under heat treatment (Fig. 8). Consistently, ZmHSP16.9-

overexpressing tobacco plants showed less H2O2 accumu-

lation compared with WT plants under 45 �C treatment

(Fig. 7a). Furthermore, ZmHSP16.9-overexpressing

tobacco plants also improved tolerance to oxidative stress

in seed germination and early seedling growth (Fig. 9).

These findings imply that ZmHSP16.9 regulates oxidative

stress responses and reduces H2O2 accumulation by

affecting antioxidant defense systems. The plant CI, CII

sHSPs and their contribution to thermotolerance have been

characterized for chaperone activity in several in vivo

(Basha et al. 2010; Low et al. 2000) and in vitro studies

(Basha et al. 2004; Lee et al. 1997; Lee and Vierling 1998;

Lee and Vierling 2000) using different heat-sensitive pro-

teins as model substrates. For example, recombinant

OsHSP17.7 had heat-stable chaperone properties that were

capable of protecting stressed CAT from precipitation

(Sato and Yokoya 2008). Based on these analyses, we

propose that ZmHSP16.9 as molecular chaperone may

enhance plant stress tolerance through the protection of

antioxidative enzymes and the reduction of ROS. However,

many further assays are necessary to confirm the chaperone

activity of ZmHSP16.9 protein.

Take together, constitutive expression of ZmHSP16.9

confers higher thermotolerance and resistance to oxidative

stress. These data can be used to better understand the

molecular mechanisms driving stress responses which are

crucial in the designing of targeting strategies to engineer

stress-tolerant plants. There is a diverse range of responses

to environmental conditions for each member in a partic-

ular HSP family. Thus, further studies are needed to clarify

the specificities/commonalities of HSPs induced as a

defense mechanism against each environmental stress.

Acknowledgments This work was supported by the State Key

Basic Research and Development Plan of China (2009CB118500),

the National Natural Sciences Foundation of China (30970229), the

Research Fund for the Doctoral Program of Higher Education of

China (20103702110007) and the foundation of State Key Laboratory

of Crop Biology (2010KF11).

References

Alexandrov NN, Brover VV, Freidin S, Troukhan ME, Tatarinova

TV, Zhang H, Swaller TJ, Lu YP, Bouck J, Flavell RB,

Feldmann KA (2009) Insights into corn genes derived from

large-scale cDNA sequencing. Plant Mol Biol 69:179–194

1482 Plant Cell Rep (2012) 31:1473–1484

123

Basha E, Lee GJ, Breci LA, Hausrath AC, Buan NR, Giese KC,

Vierling E (2004) The identity of proteins associated with a

small heat shock protein during heat stress in vivo indicates that

these chaperones protect a wide range of cellular functions.

J Biol Chem 279:7566–7575

Basha E, Jones C, Wysocki V, Vierling E (2010) Mechanistic

differences between two conserved classes of small heat shock

proteins found in the plant cytosol. J Biol Chem 285:11489–

11497

Beyer WF, Fridovich I (1987) Assaying for superoxide dismutase

activity: some large consequences of minor changes in condi-

tions. Anal Biochem 161:559–566

Charng YY, Liu HC, Liu NY, Hsu FC, Ko SS (2006) ArabidopsisHsa32, a novel heat shock protein, is essential for acquired

thermotolerance during long recovery after acclimation. Plant

Physiol 140:1297–1305

Guan JC, Jinn TL, Yeh CH, Feng SP, Chen YM, Lin CY (2004)

Characterization of the genomic structures and selective expres-

sion profiles of nine class I small heat shock protein genes

clustered on two chromosomes in rice (Oryza sativa L.). Plant

Mol Biol 56:795–809

Harndahl U, Hall RB, Osteryoung KW, Vierling E, Bornman JF,

Sundby C (1999) The chloroplast small heat shock protein

undergoes oxidation-dependent conformational changes and may

protect plants from oxidative stress. Cell Stress Chaperon

4:129–138

Horsch RBFJ, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT

(1985) A simple and general method for transferring genes into

plants. Science 227:1229–1231

Jiang C, Xu J, Zhang H, Zhang X, Shi J, Li M, Ming F (2009) A

cytosolic class I small heat shock protein, RcHSP17.8, of Rosachinensis confers resistance to a variety of stresses to Esche-richia coli, yeast and Arabidopsis thaliana. Plant Cell Environ

32:1046–1059

Kong X, Pan J, Zhang M, Xing X, Zhou Y, Liu Y, Li D, Li D (2011a)

ZmMKK4, a novel group C mitogen-activated protein kinase

kinase in maize (Zea mays), confers salt and cold tolerance in

transgenic Arabidopsis. Plant Cell Environ 34:1291–1303

Kong X, Sun L, Zhou Y, Zhang M, Liu Y, Pan J, Li D (2011b)

ZmMKK4 regulates osmotic stress through reactive oxygen

species scavenging in transgenic tobacco. Plant Cell Rep

30:2097–2104

Kotak S, Larkindale J, Lee U, von Koskull-Doring P, Vierling E,

Scharf KD (2007) Complexity of the heat stress response in

plants. Curr Opin Plant Biol 10:310–316

Lee GJ, Vierling E (1998) Expression, purification, and molecular

chaperone activity of plant recombinant small heat shock

proteins. Method Enzymol 290:350–365

Lee GJ, Vierling E (2000) A small heat shock protein cooperates with

heat shock protein 70 systems to reactivate a heat-denatured

protein. Plant Physiol 122:189–198

Lee GJ, Roseman AM, Saibil HR, Vierling E (1997) A small heat

shock protein stably binds heat-denatured model substrates and

can maintain a substrate in a folding-competent state. EMBO J

16:659–671

Liu L, Hu X, Song J, Zong X, Li D, Li D (2009) Over-expression of a

Zea mays L. protein phosphatase 2C gene (ZmPP2C) in

Arabidopsis thaliana decreases tolerance to salt and drought.

J Plant Physiol 166:531–542

Low D, Brandle K, Nover L, Forreiter C (2000) Cytosolic heat-stress

proteins Hsp17.7 class I and Hsp17.3 class II of tomato act as

molecular chaperones in vivo. Planta 211:575–582

Ma C, Haslbeck M, Babujee L, Jahn O, Reumann S (2006)

Identification and characterization of a stress-inducible and a

constitutive small heat-shock protein targeted to the matrix of

plant peroxisomes. Plant Physiol 141:47–60

Maestri E, Klueva N, Perrotta C, Gullı̀ M, Nguyen HT, Marmiroli N

(2002) Molecular genetics of heat tolerance and heat shock

proteins in cereals. Plant Mol Biol 48:667–681

Mahmood T, Safdar, Abbasi BH, Naqvi SMS (2010) An overview on

the small heat shock proteins. Afr J Biotechnol 9:927–949

Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999) Modified

expression of a carrot small heat shock protein gene, hsp17.7,

results in increased or decreased thermotolerance double dagger.

Plant J 20:89–99

Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004)

Reactive oxygen gene network of plants. Trends Plant Sci

9:490–498

Murakami T, Matsuba S, Funatsuki H, Kawaguchi K, Saruyama H,

Tanida M, Sato Y (2004) Over-expression of a small heat shock

protein, sHSP17.7, confers both heat tolerance and UV-B

resistance to rice plants. Mol Breed 13:165–175

Neta-Sharir I, Isaacson T, Lurie S, Weiss D (2005) Dual role for

tomato heat shock protein 21: protecting photosystem II from

oxidative stress and promoting color changes during fruit

maturation. Plant Cell 17:1829–1838

Pegoraro C, Mertz L, Maia L, Rombaldi C, Oliveira A (2011)

Importance of heat shock proteins in Maize. J Crop Sci Biotech

14:85–95

Qiu XB, Shao YM, Miao S, Wang L (2006) The diversity of the DnaJ/

Hsp40 family, the crucial partners for Hsp70 chaperones. Cell

Mol Life Sci 63:2560–2570

Rampino P, Mita G, Assab E, De Pascali M, Giangrande E, Treglia

AS, Perrotta C (2009) Two sunflower 17.6HSP genes, arranged

in tandem and highly homologous, are induced differently by

various elicitors. Plant Biol 12:13–22

Rorat T, Grygorowicz WJ, Irzykowski W, Rey P (2004) Expression of

KS-type dehydrins is primarily regulated by factors related to

organ type and leaf developmental stage during vegetative

growth. Planta 218:878–885

Sanmiya K, Suzuki K, Egawa Y, Shono M (2004) Mitochondrial

small heat-shock protein enhances thermotolerance in tobacco

plants. FEBS Lett 557:265–268

Sarkar NK, Kim YK, Grover A (2009) Rice sHsp genes: genomic

organization and expression profiling under stress and develop-

ment. BMC Genomics 10:393

Sato Y, Yokoya S (2008) Enhanced tolerance to drought stress in

transgenic rice plants overexpressing a small heat-shock protein,

sHSP17.7. Plant Cell Rep 27:329–334

Scarpeci TE, Zanor MI, Valle EM (2008) Investigating the role of

plant heat shock proteins during oxidative stress. Plant Signal

Behav 3:856–857

Schlesinger MJ (1990) Heat shock proteins. J Biol Chem 265:

12111–12114

Siddique M, Gernhard S, von Koskull-Doring P, Vierling E, Scharf

KD (2008) The plant sHSP superfamily: five new members in

Arabidopsis thaliana with unexpected properties. Cell Stress

Chaperon 13:183–197

Song NH, Ahn YJ (2011) DcHsp17.7, a small heat shock protein in

carrot, is tissue-specifically expressed under salt stress and

confers tolerance to salinity. New Biotech doi:10.1016/

j.nbt.2011.04.002

Sun W, Bernard C, van de Cotte B, Van Montagu M, Verbruggen N

(2001) At-HSP17.6A, encoding a small heat-shock protein in

Arabidopsis, can enhance osmotolerance upon overexpression.

Plant J 27:407–415

Sun W, Van Montagu M, Verbruggen N (2002) Small heat shock

proteins and stress tolerance in plants. Biochim Biophy Acta

1577:1–9

Volkov RA, Panchuk II, Mullineaux PM, Schoffl F (2006) Heat

stress-induced H2O2 is required for effective expression of heat

shock genes in Arabidopsis. Plant Mol Biol 61:733–746

Plant Cell Rep (2012) 31:1473–1484 1483

123

Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant

heat-shock proteins and molecular chaperones in the abiotic

stress response. Trends Plant Sci 9:244–252

Xiong L, Schumaker KS, Zhu JK (2002) Cell signaling during cold,

drought, and salt stress. Plant Cell 14(Suppl):S165–S183

Xue Y, Xiong A, Li X, Zha D, Yao Q (2010) Over-expression of heat

shock protein gene hsp26 in Arabidopsis thaliana enhances heat

tolerance. Biol Plantarum 54:105–111

Yeh CH, Chang PF, Yeh KW, Lin WC, Chen YM, Lin CY (1997)

Expression of a gene encoding a 16.9-kDa heat-shock protein,

Oshsp16.9, in Escherichia coli enhances thermotolerance. Proc

Natl Acad Sci USA 94:10967–10972

Zhu JK (2001) Plant salt tolerance. Trends Plant Sci 6:66–71

Zhu JK (2002) Salt and drought stress signal transduction in plants.

Annu Rev Plant Biol 53:247–273

1484 Plant Cell Rep (2012) 31:1473–1484

123