Upload
rivka
View
117
Download
0
Tags:
Embed Size (px)
DESCRIPTION
What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?. A Genetically Modified Organism is a living thing whose DNA has been altered by humans. Transgenic Organisms (Genetically Modified Organisms). Transgenic Zebra Fish Reading - PowerPoint PPT Presentation
Citation preview
What is a Genetically
Modified Organism (GMO)? Would you ever eat a GMO?
A Genetically Modified Organism
is a living thing whose DNA has been altered by
humans.
Transgenic Organisms (Genetically Modified Organisms)
Transgenic Zebra Fish Reading
1. Actively read through quick article: Glowing Fish – First Genetically Modified Organism Available as a Pet
2. Class Discussion
How will the world be different when
you are your parent’s age?
JQ: If you could create a transgenic
glowing human, what would you
choose to trigger the human to glow?
Transgenic Zebra Fish Reading
1. Zebra Fish vs. GloFish?2. Transgenic?3. Promotor?4. Creating Transgenic?5. Estrogen vs. Stress
Induced Promotors?6. Ethical Issues?7. Avatar?
Using Glofish to study water pollution
Promoter: TATAGCTAGCC
DNA code before geneturns gene on or off
Normal Zebrafish DNA:AGTTATGACCTCATTCAGCGTATCT
Glofish Glows!ATCCTAGTATA
ATCCTAGTATA
AGTTATGACCTCATTCAGCGTATCTGlofish doesn’t glowATCCTAGTATAX X
How Did Scientists Engineer the Transgenic Glowfish? It is called DNA Microinjection
Glo Gene: ATCCTAGTATA
DNA code for glowing protein
ATCCTAGTATA Normal Zebrafish DNA:
AGTTATGACCTCATTCAGCGTATCTTransgenic Glofish!
Think back to the video
Journal Question : Should humans be altering the DNA of
organisms?
Nova: Harvest of Fear
Part 1 Part 2 Part 3 Part 4
If you could choose which traits your baby will have,
would you do it? Explain.
JQ: What are enzymes, and why are they so important for living
organisms? You need your textbook today.
H2O + CO2 H2CO3
ReactantsProduct
What is an enzyme?Specialized proteins that speed up the rate of a chemical reaction by
lower its activation energy.
Structure of an Enzyme• Active Site – for
attaching onto reactants aka substrates
• The chemical(s) that enzyme attaches to is called the substrate.
• Highly specific with what they bind onto.
• Lock and Key analogy
Analogies for Enzymes
• Mentos and Diet coke
Active site? _______ Substrate? _______
• Stapler analogy Active site? _______ Substrate? _______
link
Essential Concept: Enzymes are involved in almost every
cellular process, including DNA replication
Read pages 300 - 303 in your text book, and answer
questions 1, 2, 5 on pages 303
What is DNA replication?
Replication is the process where DNA makes an exact copy of
itself. Why does DNA
replicate?
Original DNA
Building Blocks for new DNA
(Nucleotides)
DNA Helicase (Protein)
DNA Polymerase
(Protein)
2 identical pieces of DNA
DNA Replication Steps1. DNA Helicase (enzyme) splits open
double strand right through hydrogen bonds in the middle.
3. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way.4. End product is two identical strands of DNA.
2. Binding Proteins holds two strands apart, so they don’t reattach to one another.
Where do the free-floating nucleotides come from?
Link
DNA Replication Play - Brainstorm1. What roles, or characters, will we need
to perform a play about DNA replication?
2. How will we form, or represent our DNA using people?
How do the enzymes make all this happen?
In order to break a bond within a molecule, a certain amount of energy must be used.
Reactants
ActivationEnergy
ProductsGlucose & Galactose
C12H22O11 C6H12O6 + C6H12O6
If you wanted that bond to break more easily, you would have to lower the amount
of energy it would require to break the bond. An enzyme can lower the “Activation
Energy” of a reaction
Reactants
ActivationEnergy
Products
Lactose
Glucose & Galactose
C12H22O11 C6H12O6 + C6H12O6
Reactants
Products
AE w/o Enzyme
AE w/ Enzyme
Reaction pathway with enzyme
Reaction pathway w/o enzyme
JQ: Why does your body sweat
& shiver? Okay I know what you will say, “to regulate body temperature.”
That is true, but why must you
do that?
Enzymes Only Work in Specific Conditions
Enzymes need the right
conditions to work In extreme
conditions they Denature –
change shape and don’t work
Toothpick Enzyme Activity
1. Read the Pre-Lab, and answer the pre-lab questions.
2. Read through the lab
3. Find a partner, and perform the lab
4. Clean up
5. Collect Class Data on Board
6. Answer Post-Lab Questions
Class Data:Name Normal Cold
Average
Name Normal Denatured (taped)
Average
Journal Question: What are three things that you are thankful for?
H2 + O2 H2OReactants Products
Energy-Absorbing Reaction
Bonds are formed
Activation energy
Reactants
Products
Energy-Absorbing Reaction
Potential Energy
•Energy at rest. Stored Energy.
H2 + O2H2O
Reactants Products
Energy-Releasing Reaction
Bonds are broken
Decomposition
Energy-Releasing Reaction
Products
Activation energy
Reactants
Kinetic Energy
•Energy in motion. Releasing energy.
Lactase Post Lab Discussion
1. What happens when you alter the environment of an enzyme?
2. What happens when you alter the active site of an enzyme?
HomeostasisNegative feedback systems &
positive feedback systems
Welcome to the day you’ve been
preparing for all semester long.
You have 10 minutes to prepare for your
presentation.Please hand in the
presentation rubrics you were given.
Good Luck!-Romanoffski
Why can’t scientists just
inject your arm today with glo-fish genes and
have you glow?
Review DNA Model
1. Monomer & Polymer
2. Sides vs. Center3. Base pairing4. Hydrogen
Bonding5. # of DNA strands6. Antiparallel7. Helix8. Function9. Genes
What does a typical day look like for a
cell?
When does a cell divide? Is it the same for every
cell?
Cell Type Life Span Cell Division
Red Blood Cell Less than 120 days
NO
Skeletal Muscle Long-lived NOLining of
Esophagus2-3 days Yes
Stomach Cell 2 days YesNerve Cell Very Long
Lived??Most Do Not
Sperm Cell 2-4 days outside the
body
Yes
How long do certain cells live within your body?
Let’s take a look at the
life cycle of a somatic cell!
1.All body cells except sperm or egg cells
2. Somatic cells are Diploid Cell
What is a somatic cell?
# of sets
# of DNA pieces in each set
What is a diploid cell?
N = 23; 23 pieces from MOM & 23 from DAD
What would a human somatic cell look like?
Dad’s & Mom’s Chromosomes are homologous – meaning they match up.
Dad’s Chromo.
Mom’s Chromo
Eye Color Gene
Blue EyesBrown
Eyes
What is unique about mom and dads chromosomes?
JQ: Do you think humans will ever become immortal? Would you want to
live forever?
Karyotype – shows an organism’s homologous chromosomes in order
How is this karyotype different from the first?
JQ: No Journal Question today.
Hand in your Group’s Avatar Scientific Paper
JQ: Why would our cells need to make more
of themselves? Give specific examples.
What does the cell cycle look like?
Two Parts: 1. Interphase 2. m-phase
Cell Cycle Visual Non-Audio Version
M-phase
Part 1: Interphase – Cell growth, DNA
replication and Preparation for
Division
Part 2: M-phase – Division of Nucleus
& Cytoplasm
Mitosis is the division of the nucleus (DNA).
Cytokinesis is the division of the cytoplasm (cell).
After Interphase? After
Mitosis?After
Cytokinesis?
M-phase
9246
46
4646
•Animal cell – cell membrane pinches in forming a cleavage furrow = 2 new cells
How does cytokinesis work?
•Plant cell – cell plate (membrane & wall) forms between two cells = 2 new cells
How long does it take to make a new cell?
If Dr. Evil and mini me’s
cells are the same size, what make
them different?
Large cells require too
many proteins to be made at
the same time. DNA
cannot keep up.
1. DNA Overload
Big cells demand more nutrients
and produce more waste, but do not
have enough roadways to get the nutrients in and waste out
efficiently.
2. Supply and Demand Issues
What could she grow up
to be? Explain.
Stem Cells:Cells that haven’t turned into a specific cell type yet (they’re undifferentiated)
Once a stem cell becomes particular cell type (heart cell, liver cell, lung cell) it is called Differentiated
All of the somatic cells in your body have the same DNA in them, and the same genes in them
Not all 20,000 genes are turned on at the same time maybe 5,000 at a time
Example: heart cell has different genes turned on than liver, muscle, or brain cell.
How does a stem cell turn into a specialized cell?
Stem Cell Video
Stem Cells
Please read the article and answer the questions to
follow
Cancer and Cell Phones
JQ: What is Interphase? Recap what
occurs during interphase.(Take out
your homework)
How does a cell know when to
divide? Every cell
contains proteins called cyclins
which monitors external and
internal activity, and communicate to cells when it is
time to make a new one.
Cell Cycle! Making new
cells.
P53
Cyclin & CDK the protein
supervisors of the cell cycle!
JQ: Propose a way that we
can stop cancer. (Think outside the box. There are no silly
ideas)
Retinal Cancer
Cancer is the uncontrolled cell
growth of abnormal cells in
the body.
What is cancer?
How do cells become
abnormal?•Cyclin is a protein that turns the cell cycle on and off.
• If the gene for cyclin is mutated, or cell’s ability to respond to cyclin fails, cancer can occur
How do cells become
abnormal?• DNA miscopying• Exposure to mutagens – agents that can mutate DNA
Examples: Food, UV Rays, Tobacco products, viruses, non-stick pans, chemical carcinogens, cell phones?
mutation causes cell to lose its ability to start and
stop cell replication.Cyclin is Sleeping
continual cell growth will lead to a
mass of cells called a tumor.
What types of tumors exist?
Fast growing and are likely to
spread to other parts of the body
and cause problems
(metastasize – when a tumor spreads)
Malignant Tumors
Slow growing and do not
metastasize. ISOLATED
Benign Tumors
Cancer Treatment Activity:Cancer treatment has come a long way, but we still have
much more work to do as a species. Cancer is the leading cause of death worldwide
I will assign you and a partner one of the following treatments: Radiation, Chemotherapy, Targeted therapy, transplants, gene therapy
Using your smartphone/electronic device, access this website: http://www.cancer.gov/cancertopics/treatment/types-of-treatment
Write answers the following questions, and be prepared to explain them to the class next time. A few sentences for each.
1. What is your treatment?2. What does it do?3. How does it work?4. What are the side effects?5. Other important / interesting information?
Please read the article and answer the questions to
follow
Cancer and Cell Phones
If all of your diploid cells
have the same DNA in it, then what makes a
skin, heart, lung, and brain
cell so different?
Journal Question:
JQ: If humans make 2.5x10^7 cells per minute, how many will they make in 1
hour? Place answer in scientific notation.